Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions
• Phenotype = genotype (+ environment)
• 1 chromosome gene ---> 1 protein
• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material
• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides
• DNA replication by unzipping
• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy
• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
• Steps of Translation (Protein Synthesis)
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions
• Phenotype = genotype (+ environment)
• 1 chromosome gene ---> 1 protein
• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material
• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides
• DNA replication by unzipping
• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy
• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
Central Dogma of Biology: How Shape and Form Are Dictated By DNA Genes
A segment of DNA (gene)
carries specific coded
instructions for the making
of a single proteins.
Genotype:The genes carried in a cell for a particular trait
Phenotype: The physical expression of genes for a particular trait
QuickTime™ and a decompressor
are needed to see this picture.
DNA Genes are Instructions for Making Specific Polypeptides
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions
• Phenotype = genotype (+ environment)
• 1 chromosome gene ---> 1 protein
• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material
• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides
• DNA replication by unzipping
• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy
• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
Microbial Genetics: DNA and RNAWhat chemical carries the genetic instructions in cells, and how is this chemical reproduced? How is this chemical used inside
the cell to direct the production of new molecules?
• The Need for Protein Making Instructions
• Phenotype = genotype (+ environment)
• 1 chromosome gene ---> 1 protein
• DNA-->RNA (copy)-->protein production
• Structure of DNA, The Genetic Material
• Two polynucleotide strands with H bonds
• DNA + protein make up a chromosome
• RNA is single stranded, difft sugar, uracil
• How DNA copies itself when a cell divides
• DNA replication by unzipping
• DNA polymerase enzyme synthesizes new complementary strands --> 2 new helices
• Transcription: Making a short DNA copy
• RNA polymerase makes RNA from DNA
• Only one set of instructions (gene) is copied
• Copy is complementary to the DNA gene
• In eukaryotes, the RNA copy is edited
• The Three Kinds of RNA
• mRNA: carries instructions for 1 protein
• rRNA: structural support in ribosomes
• tRNA: amino acid trucks with anticodons
DNA, the genetic material, replicates by semiconservative replication. It is further copied in transcription for use in building proteins for the cell.
=
3 Types of RNA – Each With a Different Job
Messenger RNA (mRNA)
Carries copy of gene informationto the ribosome to make protein
anticodon
Ribosomal RNA (rRNA)
Part of the structure ofthe ribosome; key component in aminoacid linking machinery
CUG
C U G
Transfer RNA (tRNA)
Carries amino acids to the ribosome for linking; identified by anticodon “sign”
DNA template strand:
CGTTTACGACCGGCCTTAGATCCTGACG
Central Dogma: DNARNAProtein
mRNA: GCAAAUGCUGGCCGGAAUCUAGGACUGC
Transcription by RNA polymerase
Translation by ribosome
Protein: Met -
Leu -Ala -
Gly -Ile