![Page 1: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/1.jpg)
Mapping in Arabidopsis
Jeff Long Salk Institute
![Page 2: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/2.jpg)
Cotyledons (seed leaves)Shoot Apical Meristem
Hypocotyl (seedling stem)
Root
Root Apical Meristem
![Page 3: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/3.jpg)
WT
tpl-1 mutant phenotypes
monocot
tpl-1
tube
tpl-1
pin
tpl-1
One way to learn about development is by examining mutants
![Page 4: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/4.jpg)
One way to learn about development is by examining mutants
How does one generate mutants?
T-DNA mutagenesis
Mutagens that create base pair changes
EMS, Gamma Rays, Others
Problem-How do you identify the mutated gene from the other 25,000 found in the genome?
![Page 5: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/5.jpg)
The answer is by mapping!
In Arabidopsis we can take advantage of DNA differences between different strainsor ecotypes.
What is an ecotype?
![Page 6: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/6.jpg)
An ecotype is just another strain of Arabidopsisthat has been geographically isolated
![Page 7: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/7.jpg)
![Page 8: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/8.jpg)
Different ecotypes often contain differences in their DNA
These differences can destroy or create newrestriction sites
Known as restriction fragment length polymorphismsor RFLP’s
These RFLP’s can be tracked either by Southern blotting or PCR followed by digestion
![Page 9: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/9.jpg)
promoter coding
Sequence differences can be found between ecotypes
CCAAGCTGAATTCTTCGAAT Col
CCAAGCTGTATTCTTCGAAT Ler
EcoR1
![Page 10: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/10.jpg)
Ler Col
Ler Col
Ler Col
![Page 11: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/11.jpg)
Ler
Col
DNA changes can also cause insertions/deletions-Indels
Can use PCR primers to track these changes=markers
The example below is a simple sequence length polymorphism-SSLP’s
![Page 12: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/12.jpg)
Indels can be tracked by PCR with no digestion
![Page 13: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/13.jpg)
Mapping strategy
Cross your mutant to a different ecotype (our case mutant is in Landsberg erecta and different ecotype is Columbia)
Allow the F1 population to self after meiosis (where recombination will take place)
Isolate DNA from resulting F2 mutant plants- use DNA differences between ecotypes to map
![Page 14: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/14.jpg)
F1 plant
F2 gametes
![Page 15: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/15.jpg)
Mutant X different ecotype
Self F1 plants
Select mutant F2 plantsfor mapping
mutant
marker 1
marker 2
F2 chromosomes
![Page 16: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/16.jpg)
mutant
marker 1
marker 2
Markers close to your gene will showa bias toward the original ecotypeReferred to as linkage
LerCol9/10 Ler
F2 chromosomesBy picking homozygous mutants, you know the ecotype at the mutant locus
5/12 LerLerCol
![Page 17: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/17.jpg)
![Page 18: Mapping in Arabidopsis Jeff Long Salk Institute. Cotyledons (seed leaves) Shoot Apical Meristem Hypocotyl (seedling stem) Root Root Apical Meristem](https://reader036.vdocuments.us/reader036/viewer/2022062314/56649ee85503460f94bfa1fa/html5/thumbnails/18.jpg)
monocot
tpl-1
Isolate DNA from tpl-1 mapping population