Download - M sc2
Molecular Approaches to Nutrition
Molecular Biology 2
Principles and Methods
Dr. Janice Drew
Principles and Methods Purification and handling of DNA/RNA
Gel Electrophoresis
Nucleic Acid Hybridisation
Cutting and rejoining DNA
Methods of introducing DNA into cells
PCR
DNA sequencing
Sequence interpretation
Handling of DNA/RNA
DNases and RNases
Glass and plasticware
Solutions
Extraction of DNA/RNA
DNA extraction Alkaline lysis Neutralisation Precipitation of proteins and cell debris Precipitation or elution using spin column
RNA extraction Lysis incorporating instantaneous inactivation of RNases Separation of contaminating DNA Precipitation or elution using spin column
Quantitation and analysis of DNA/RNA
Spectrometric determination at 260nm
Gel Electrophoresis
Agilent technology
Gel Electrophoresis Nucleic acids are negatively charged
PO4- groups
Electrophoresis resolves by size
Agarose is the usual gel matrix
Ethidium bromide/SYBR green ‘stains’ DNA & RNA Fluorescent colour under UV illumination
Agarose Gel Preparation
Agarose : fine white powder; polysaccharide (galactose polymer) isolated from seaweed.
1% (w/v) dissolves in Tris-acetate buffer at ~60 °C and the solution sets at ~30 °C
Agarose Gel Image
Largest (1,500bp)
Smallest (100bp)
Markers (DNA Ladder)Known Sizes
_
+
Agilent Technology
Electropherogram showing Agilent analysis of total RNA
18S
28S
Times (seconds)
Fluo
resc
ence
Hybridisation - Identification of DNA/RNA
Agarose gel electrophoresis separates nucleic acids on the basis of size - does not identify DNA/RNA fragments
Nucleic acid probes are used to identify specific DNA/RNA sequences in a gel
Probe is a known nucleic acid sequence Relies on the principle of base pairing -
complementary DNA/RNA sequences stick (hybridise) together
Hybridisation - Identification of DNA/RNA
Many molecular biology procedures to identify specific DNA/RNA sequences use this principle -
Southern (DNA) or Northern (RNA) blotting
In situ hybridisation
Microarrays
Antisense technologies
Probe Production Synthesise a known fragment
OR Purify a known fragment of DNA
Restriction enzyme digestion
Heat denature to give single strands
Add primers, DNA polymerase and radioactive/colour labelled nucleotides Make a radioactive/ colour labelled complementary
strand
Denature to give single strands
HYBRIDISATION OVEN
Incubate filter and probe in hybridisation buffer
TREAT and BLOT GEL
Transfer to nylon membrane
nylon membrane and transferred DNA
Southern/Northern Blotting
and
Hybridisation
Restriction Endonucleases
Restriction endonucleases cut DNA Present in bacteria Cut at sequence specific sites
Usually 4 or 6 base pairs long
Bacteria use them to destroy ‘foreign’ DNA Bacteria protect their own DNA against self-cutting by
special methylation of their DNA
Restriction enzymes can be purified and are used in genetic engineering studies
Restriction Endonucleases Example Restriction enzymes
EcoR I (E. coli Restriction Endonuclease I) Stu I (Streptomyces tubercidicus I)
GAATTCCTTAAG
5’
5’
3’
3’
Sticky Ended Blunt Ended
AGGCCTTCCGGA
5’
5’
3’
3’
EcoR I Stu IPalindromicAxis of rotational symmetry
Molecular Scissors and Glue
There are 100’s of restriction enzymes, each one with a different recognition site These enzymes are ‘molecular scissors’ and can be used
to specifically cut long DNA strands into smaller pieces
The T4 virus, which infects E. coli, has an enzyme, T4 DNA ligase, which can form a phosphodiester bonds between DNA molecules Purified T4 DNA ligase can be used as ‘molecular glue’ to
join pieces of DNA. This enzyme is widely used for DNA cloning
Ligation of DNA
EcoR IOH 3’ 5’ PO4
Circular DNA
T4 DNA ligase catalyses the formation of phosphodiester bonds
PO4 5’ 3’OH
T4 DNA Ligase
T4 DNA Ligase
Stu I
EcoR I
GCTTAA
AATTC G
Methods of introducing DNA into cells
Plasmids
Viruses
DNA and RNA viruses
Phage vectors
Cloning DNA into Plasmids
Bacteria have a circular DNA genome5 to 10 million base pairs (bp) in size
Many bacteria also contain plasmids Small circular DNA molecules, ~3,000 to 50,000 bp Note: The bacterial genome is not a plasmid
Plasmids contain ‘extra’ genes which are often vital for the survival of the bacteriumNutrient metabolism, antibiotic resistance
Plasmids can be used as vectors in which foreign DNA can be ligated (cloned)
A General Laboratory Plasmid
Multiple Cloning Site
A foreign gene can be ligated into a plasmid, and the genetically engineered plasmid introduced into E. coli.
Cloning DNA into a Plasmid
Both plasmid and foreign DNA have sticky EcoR I ends
Insertion into E. coli
(transformation)
Agar plates contain antibiotic.
Grow at 37 °C
Place 1 colony in liquid media + antibiotic. Grow at 37 °C
Purify Plasmid DNA (Billions of copies)
DNA and Retroviruses can serve as vehicles for the introduction of new
DNA into a cell
DNA / RNA viruses as ‘vehicles’DNA / RNA viruses as ‘vehicles’
Chromosomal DNAViral DNA
Integration into genome
gene x
Gene Therapy and Transgenics
Polymerase Chain Reaction (PCR)
PCR generates multiple copies of DNA Heat resistant DNA polymerase used to copy a
section of DNA e.g Taq
Very efficient copying Billions of copies from a single ‘template’ DNA
Small volume / quick analysis
Polymerase Chain Reaction (PCR)Entire reaction performed in single tube
10 to 50 μl volume
Reaction contains Template DNA, heat resistant DNA polymerase, a pair
of specific DNA primers (in excess over the template), nucleotide bases, appropriate reaction buffer
Reaction is repeatedly cycled through 3 temperatures (x30) 95 °C (makes DNA single stranded) ~55 - 60 °C (primers anneal to template DNA) 72 °C DNA polymerase copies DNA, starting from the
primers
A Thermocycler
This thermocycler can accept 1500 reactions at a time, and complete them in 2 to 4 hours.
AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | || | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA
5’
3’ 5’
3’
AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |
5’ 3’
| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA
3’ 5’
3’ 5’
AGCTAGCATGTTGCGCGTATCATGTACAGTGCATACGTCCCCTTAGCT| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | GTATG
5’ 3’
GTTGC | | | | || | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |TCGATCGTACAACGCGCATAGTACATGTCACGTATGCAGGGGAATCGA
3’
5’ 3’
5’
Heat 95° C(Denatures)
Add Specific PrimersCool to 55° C Cool. This allows specific
‘primers’ to anneal as shown
Principal of PCR
DNA (Double Stranded)
Heat Denature (Becomes Single Stranded)
Heat to 72 °C. Heat resistant DNA polymerase extends new
DNA from the primers
Heat to 72 °C
DNA Sequencing A specific primer binds to denatured DNA
Heat resistant DNA polymerase extends a new strand from this primer
Complementary nucleotides are added as appropriate
In the reaction are small quantities of coloured dideoxynucleotides Colours: ddTTP ddGTP ddATP ddCTP These prevent further additions (terminators)
Dideoxynucleotides
ddNTPs have no 3’ OH, so when added they cannot form thephosphodiester bond required to add the next nucleotide
DNA Sequencing ReactionThe reaction is boiled to make all the DNA single stranded and then the reaction is resolved on a long polyacrylamide or capillary gel in a DNA sequencer
Electropherogram of sequencing gel
Decoding DNA sequence data
Genotyping
Genotyping includes a variety of techniques that are used to identify the
primary localization and mapping of genes implicated in human diseases.
• Polymorphisms (different forms of a gene) may be present in coding and non-coding regions of a gene.
• Polymorphisms may influence gene regulation in response to nutrients
Primer Extension TheorySNP Analysis - primer extension theory
SNP Analysis