Transcript
Page 1: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Joint work with many colleagues at FDA

precision.fda.gov | [email protected] | @precisionFDA

Taha A. Kass-Hout, MD, MSFDA Chief Health Informatics OfficerDirector, FDA’s Office of Health Informatics

David Litwack, PhDPolicy AdvisorFDA’s Center for Devices and Radiological Health

Elaine R. JohansonDeputy, FDA Chief Health Informatics OfficerDeputy Director, FDA’s Office of Health Informatics

Page 2: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 3: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Genetic test

(upstream)

Clinician orders test/services for patient,

collects sample

Sample preparation

and sequencing

Core processing(Mapping,

Variation Calling)

Special processing(Annotation, Filtering, Interpretation)

+

(downstream)

Clinician discusses outcomewith patient

NGS-based Genetic Test (end-to-end product)

Page 4: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Initial Focus

Genotype

Location 9: C → G mutation...

File with variants (VCF)

" You are at risk for X outcome. "

Report

Predicted Outcome

Analytical Benchmark Clinical Benchmark

Page 5: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Initial Focus – Analytic Benchmarking

•Assess reproducibility of a test

•Assess accuracy using reference samples

•Assess agreement with other methods

•Assess test performance on synthetic data

Page 6: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Features

Private or community areas

Data

Apps

Comparisons

Notes

Page 7: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 8: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 9: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 10: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 11: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 12: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 13: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 14: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 15: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 16: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 17: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 18: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 19: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 20: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 21: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 22: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

https://github.com/FDA

Page 23: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 24: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

>930 members from >450 organizations

Page 25: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

precision.fda.gov

Page 26: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Thank You!

precision.fda.gov | [email protected] | @precisionFDA

Page 27: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Backup Slides

precision.fda.gov | [email protected] | @precisionFDA

Page 28: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

… AGCATCGATGCAGAAGATTACAAGACGATCCGCTC …

DNA

Gene

Page 29: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

We are all unique

… AGCATCGATGCAGAAGATTACAACATAAAAAGATTACACGCGATCCGCTC …

… AGCATCGATGCATAAGATTACAAGATAAAAAGATTACACGCGATCCGCTC …

… AGCATCGATGCATAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …

… AGCATCGCTGCAGAAGATTACAACATAAAAAGATTACATGCGATCCGCTC …

reference

David

Taha

Elaine

Page 30: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics
Page 31: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

The Internet Cloud

Page 32: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Community Assurance

Page 33: Joint work with many colleagues at FDA   | Taha A. Kass-Hout, MD, MS FDA Chief Health Informatics

Add new Feature (Discussion)

New Feature


Top Related