1
Insulin resistance, microbiota and fat distribution changes by a new model of vertical sleeve
gastrectomy in obese rats
Running title: glandular gastrectomy in obese rats
Nicola Basso1, Emanuele Soricelli
1, Lidia Castagneto-Gissey
1, Giovanni Casella
1, Davide
Albanese3, Francesca Fava
2, Claudio Donati
3, Kieran Tuohy
2, Giulia Angelini
4, Federica La
Neve4, Anna Severino
4, Virginia Kamvissi-Lorenz
5,6, Andrea L. Birkenfeld
5,6, Stefan Bornstein
5,6,
Melania Manco7, Geltrude Mingrone
6, 8
1Surgical-Medical Department for Digestive Diseases, Policlinico Umberto I, University of Rome Sapienza, Rome,
Italy
2 Department of Food Quality and Nutrition, and 3 Computational Biology, Research and Innovation Centre-Fondazione
Edmund Mach, San Michele all’Adige, Trento, Italy.
4Institute of Cardiology, Catholic University, Rome, Italy
5Department of Medicine III, Universitätsklinikum Carl Gustav Carus an der Technischen Universität Dresden,
Dresden, Germany.
6Diabetes and Nutritional Sciences, Hodgkin Building, Guy's Campus, King's College London, London, UK.
7Research Unit for Multifactorial Diseases, Scientific Directorate, Bambino Gesù Children Hospital, Rome, Italy.
8 Department of Internal Medicine, Catholic University, Rome, Italy
Text: 4369 words, 2 tables and 6 figures
Corresponding author
Geltrude Mingrone, MD, PhD
Department of Internal Medicine
Catholic University
Largo A. Gemelli 8 – 00168 Rome, Italy
Email: [email protected]; [email protected]
Page 1 of 44 Diabetes
Diabetes Publish Ahead of Print, published online July 18, 2016
2
ABSTRACT
Metabolic-surgery improves insulin-resistance and type-2 diabetes, possibly related to weight-loss.
We have performed a novel sleeve-gastrectomy in rats that resects ≈80% of the glandular portion
leaving the forestomach almost intact (Glandular Gastrectomy,GG) and compared subsequent
metabolic re-modeling with a sham-operation (SO).
GG did not affect body weight, at least after 10 weeks, improved hepatic and peripheral insulin
sensitivity likely through the increased Akt, GSK-3 and AMPK phosphorylation, and reduced
ectopic fat deposition and hepatic glycogen over-accumulation. The body adipose tissue was
redistributed with reduction of intra-abdominal fat. We found reduction of circulating ghrelin levels,
increased GLP1 plasma concentration and remodeling of the gut microbiome diversity,
characterized by lower relative abundance of Ruminococcus and by higher relative abundance of
Lactobacillus and Collinsella. These data suggest that, at least in rat, the glandular stomach plays a
central role in the improvement of insulin resistance even if obesity persists. GG provides a new
model of the metabolically healthy obese phenotype.
Page 2 of 44Diabetes
3
INTRODUCTION
While lifestyle changes should be the first choice for treating the global pandemic of obesity and
diabetes, long-term compliance is poor (1). Metabolic surgery (MS) is, at present, the most effective
therapy for morbid obesity. In the last few years, randomized controlled trials have shown that MS
is effective in determining diabetes remission also in the long term (2-5). Insulin resistance is the
primary defect of type-2 diabetes (T2D) and plays a central role in its pathogenesis, while β-cell
failure develops only afterwards (6). Interestingly, some types of MS, including Bilio-Pancreatic
Diversion (BPD), Sleeve Gastrectomy (SG) and Roux-en-Y Gastric Bypass (RYGB), determine a
net amelioration of insulin resistance with subsequent reduction of insulin secretion even if the
patients remain obese (7,8). Based on clinical observations in SG patients, we formulated a “gastric
hypothesis” for diabetes resolution with early involvement of ghrelin and GLP-1 independent of
weight change or modified food intake (9).
To understand the resolution of diabetes upon MS a relevant problem arises from the difficulty in
separating the effect of weight loss per se, from that of gastrointestinal manipulations and
subsequent metabolic recovery. The rat stomach possesses two distinct portions, the proximal
(forestomach), non-glandular part, lined by keratinized squamous epithelium which functions as a
reservoir for food, and the distal (corpus), glandular part, which is lined by simple columnar
epithelium responsible for exocrine and endocrine secretions (10). The modified sleeve gastrectomy
or glandular gastrectomy (GG), devised by us, resects approximately 80% of the glandular portion
in order to induce the hormonal effects but leave the non-glandular portion almost intact, thereby
limiting loss of gastric volume and its sequel on body weight. In high-fat diet (HFD) - obese rats
the effect of GG on body fat distribution, insulin sensitivity, insulin signaling and gut microbiota
was compared with that of a gastric sham operation (SO).
Page 3 of 44 Diabetes
4
MATERIALS AND METHODS
Animals
Sixty male Wistar rats aged 10 weeks were housed individually in hanging wire cages in a
controlled room at 22°C with a 12-h day/night cycle (lights on from 07:00 to 19:00).
The animals received a purified tripalmitin-based HFD ad libitum (Rieper AG SpA, Bolzano, Italy)
with an energy density of 21.10 kJ/g that supplied 59% of energy as fat and 20% as carbohydrate
comprised of cornstarch and sucrose (2:1 wt/wt) and containing corn oil (1.9/100g diet) to prevent
essential fatty acid deficiency. The HFD was continued for 10 weeks before and 10 weeks after the
operation.
The animals randomly underwent GG or SO. Survival rates were 90% after sham operations and
75% after GG. All experimental procedures were approved by the Catholic University of Rome
Institutional Animal Care Committee.
Interventions
The rats were anesthetized using ketamine (75 mg/kg intramuscularly) and xylazine (10 mg/kg
intramuscularly). Ten milliliters of sterile 0.9% NaCl were administered s.c. prior to surgery.
Access to the peritoneal cavity was obtained by 3 cm laparotomy. About 80% of the glandular
stomach was removed by resecting the organ along a line as in Figure S1, and the non-glandular
forestomach was left almost intact. The gastric remnant was closed by single-layer continuous
suture using 6–0 Prolene thread (Ethicon Inc. USA). The sham-operated rats had the same
anesthesia as described above. A midline laparotomy was performed, and the stomach was exposed
and gently manipulated. The abdominal cavity was kept open for the same amount of time required
to perform GG. A 1 cm gastrotomy was performed and then closed as in the previous group.
Page 4 of 44Diabetes
5
Post-operative care
At the end of the surgical procedures, all rats received sterile 0.9% NaCl (10 ml i.p. and 10 ml s.c.)
to maintain hydration during healing. The animals received ketoprophen (5 mg/kg) as analgesic.
They were placed on a heated mat until they recovered and then returned to their home cages. The
rats were allowed to drink purified water for 12 hours after surgery and then a liquid diet containing
5% glucose and 0.2% KCl was provided for the next 48 hours. Successively they received the HFD
until 10 weeks after surgery.
Oral glucose tolerance test (OGTT)
The OGTT was performed at sacrifice. Animals were fasted overnight and then received a 50% D-
glucose solution (1g/kgbw) by oral gavage. Blood was collected from the tail for measurement of
glucose and insulin concentrations at 0, 15, 30, 60, 90, and 120 min at the end of the study. At the
end of the OGTT blood was obtained by cardiac puncture and placed in tubes containing EDTA,
aprotinin and a dipeptidyl peptidase-IV inhibitor, and analysed for GLP1 and ghrelin.
After centrifugation, plasma was divided into appropriate subsamples and stored at −20°C until
analyses.
Histology
SO and GG rats were euthanized, fresh portions of liver, muscle and adipose tissue from each rat
were cut, fixed in neutral buffered formalin (10%), then dehydrated using grades of ethanol (70%,
80%, 90%, 95%, and 100%). Dehydration was followed by clearing the samples in two changes of
xylene. The samples were then embedded in paraffin and cut with a microtome (3-4 µm).
Hematoxylin-eosin staining was used. Periodic-acid-Schiff (PAS) staining has been employed to
evaluate glycogen storage. Photographs of stained sections from sham and distal gastrectomy rats
were taken using an optical microscope (Microscope ZEISS Primo Star HAL).
Page 5 of 44 Diabetes
6
Western blot analysis
Muscle biopsies were rinsed in phosphate buffer saline (PBS) and homogenized in RIPA buffer
containing a cocktail of protease inhibitors. Homogenates were cleared by centrifugation (13.000
rpm; 30 min, 4°C). Protein content was determined using Bradford Protein Assay (Biorad).
Protein lysates (30 µg) were separated on 8% SDS-PAGE and transferred on PVDF membrane.
Membrane were probed overnight with the following antibodies pAktSer473 (D9E), pAMPKα and
GSK3α-β Ser21/9 (9331). Membrane were stripped for 30 min at 56°C and re-probed overnight
respectively with Aktpan (C67E7), AMPKα (D5A2) and GSK3α-β (D75D3). All the antibodies are
from Cell Signaling. Detection and analysis were performed respectively with Chemidoc XRS
Image system and Image Lab 5.0 software (Biorad). All the results are expressed as
phosphoprotein/total protein ratio.
16S rRNA Gene Sequencing by Roche GS FLX+ Platform
Bacterial genomic DNA was extracted from rat fecal samples using the FastDNA Spin Kit for Feces
(MP Biomedicals LLC). The V3–V5 16S rRNA gene variable regions were amplified by PCR using
454 adapter-linked and bar-coded primers 338F (5’-TCCTACGGGAGGCAGCAG-3’) and 934R
(5’-TGTGCGGGCCCCCGTCAATT-3’). Each PCR reaction was carried out in triplicate with 0,2
µM dNTPs, 0,4 µM primers, 0.05U Taq Polymerase (FastStart™ High Fidelity PCR System,
Roche), and 40ng template DNA. The following thermal cycles were employed: 95°C for 5
minutes; 30 cycles at 95°C for 30 seconds, 58°C for 30 seconds and 72°C for 1 minute; a final
elongation step at 72°C for 8 minutes. PCR products were analysed by Lab-on-Chip electrophoresis
(2100 Bioanalyzer, Agilent Technologies, Santa Clara, CA, USA) and cleaned using the Agencourt
AMPure XP system (Beckman Coulter, Brea, CA, USA) following the manufacturer’s instructions.
Purified products were quantitated by qPCR (LightCycler 480, Roche) using the KAPA Library
quantification kit (KAPA Biosystems, Boston, MA, USA) and pooled in an equimolar way in a
Page 6 of 44Diabetes
7
final amplicon library. The pyrosequencing was carried out on the GS FLX+ system using XL+
chemistry (454 Life Sciences, Roche, Basel, Switzerland) following the manufacturer’s
recommendations.
16S rDNA pyrosequencing resulted in a total of 1,088,841 16S rDNA reads with a mean of 35,123
sequences per sample. Average sequence lengths were 671 nt with an average phred quality score of
31. Raw 454 files were demultiplexed using the Roche's sff file software, and available at the
European Nucleotide Archive (www.ebi.ac.uk) under the accession study PRJEB11901. Sample
accessions and metadata are available in Supplementary Table S1. Reads were preprocessed using
the MICCA pipeline (version 0.1, http://micca.org ). Forward and reverse
primer trimming and quality filtering were performed using micca-preproc (parameters
-fTCCTACGGGAGGCAGCAG -rTGTGCGGGCCCCCGTCAATT-O 16 -q 20 -l 300) truncating
reads shorter than 300 nt. De-novo sequence clustering, chimera filtering and taxonomy assignment
were performed by micca-otu-denovo (parameters -s 0.97 -d -l 200 -c): operational taxonomic units
(OTUs) were assigned by clustering the sequences with a threshold of 97% pair-wise identity, and
their representative sequences were classified using the RDP software version 2.8. Template-guided
multiple sequence alignment (MSA) was performed using PyNAST (version 0.1) against the
multiple alignment of the Greengenes database (release 13_05) filtered at 97% similarity. Finally, a
phylogenetic tree was inferred using FastTree and micca-phylogeny (parameters: -a template-
template-min-perc 75). Sampling heterogeneity was reduced by rarefaction (12,562 sequences per
sample). Alpha (within sample richness) and beta-diversity (between-sample dissimilarity)
estimates were computed using the phyloseq R package. Permutational ANOVA (PERMANOVA)
tests were performed using the adonis function of the vegan R package with 999 permutations.
The Random Forest model was computed using the supervised_learning.py script of QIIME
(doi:10.1038/nmeth.f.303) version 1.8.0, with 1000 trees and 10-fold cross validation.
Page 7 of 44 Diabetes
8
Analytical methods
Plasma glucose levels were analyzed by the glucose-oxidase method (Glucose Analyzer II;
Beckman, Fullerton, CA, USA). The plasma concentrations of cholesterol and triacylglycerol
(TAG) were measured using spectrophotometric methods. Serum insulin was measured by a rat
insulin ultrasensitive ELISA (Biovendor GmbH, Kassel, Germany), with a sensitivity of 0.025
ng/ml and an intra- and inter-assay precision of 10%. Plasma GLP17-36 and active ghrelin were
measured by rodent/rat-specific ELISAs (Millipore, St Charles, MO, USA). Sensitivity was
5.2 pg/ml, intra-assay <11%, inter-assay <19%, accuracy 83% for GLP17–36. The intra-assay was 1–
6%, the inter-assay was 1-5% and the accuracy 94-105% for ghrelin. Total plasma bile acids were
determined with a bile acid assay kit (Trinity Biotech, Jamestown, NY, USA). Plasma
lipopolysaccharide (LPS) levels were determined using a Limulus amebocyte lysate kit (QCL-1000,
Lonza, Walkersville, MD).
Statistical analysis
Values are expressed as mean±SEM. The homeostatic model assessment of insulin resistance
(HOMA-IR) index(11) was calculated as HOMA-IR = (FBG x FPI)/405, where FBG denotes
fasting blood glucose (mg/dl) and FPI is fasting plasma insulin (µU/ml). The factor 405 accounts
for measurement units.
The incremental AUCs were computed using the trapezoidal rule. Insulin sensitivity after the OGTT
was measured as the glucose/insulin AUCs ratio. Glucose and insulin AUC data intra-group
variations were assessed by Wilcoxon while inter-group differences by Mann Whitney U test due to
lack of normal distribution by Shapiro-Wilk test.
Differences were considered significant at P < 0.05. Spearman’s correlation analysis was performed
to detect the correlations among variables.
Page 8 of 44Diabetes
9
RESULTS
All animals lost weight in the week following surgery with about 10% weight loss in the SO and
15% in the GG group, respectively. Rats in the GG group recovered more slowly but from the 3rd
week after surgery, their weight was not statistically different from that of SO animals (Figure
S2A). Food intake also did not differ between the groups from week 3 post-surgery (Figure S2B).
At 10 weeks after the operation, mesenteric and retroperitoneal fat content was higher in the SO
than in the GG group (9.67±1.26 vs. 8.11±1.22 g, P<0.01 and 8.75±1.16 vs. 7.30±0.95 g, P<0.01
respectively). In contrast, subcutaneous fat was more represented in GG than in SO rats (2.64±0.65
vs. 4.10±0.78 g, P<0.0001).
Insulin sensitivity
The data in Table 1 and in the Figures refer to the end of the study. Insulin sensitivity was
significantly improved in GG compared to SO rats as demonstrated both by HOMA-IR values,
which were reduced by about 50%, and by the ratio AUCglucose/AUCinsulin which was about 55%
lower in GG than in SO rats (Table 1). The time courses of blood glucose and plasma insulin
concentrations after the OGTT are reported in Figure 1A and 1B, respectively. In spite the glycemic
curve was significantly lower after GG than after SO, blood glucose levels did not return to the
baseline. Both Cholesterol and TAG levels dropped in GG rats (Table1).
Active plasma ghrelin levels (Table1) in GG rats (2.24±4.04 vs.48.32±5.38 fmol/ml), were
significantly reduced (P<0.0001) with respect to the SO group.
Plasma levels of GLP1 were significantly higher (P<0.0001) in GG rats (5.15±1.52 pmol/ml)
compared to SO ones (3.01±0.84 pmol/ml)(Table1). We cannot exclude a more rapid gastric
emptying after GG which could have stimulated GLP1 secretion.
Page 9 of 44 Diabetes
10
LPS levels were almost halved while BAs were nearly doubled in GG as compared with SO animals
(Table 1).
Table 2 shows the coefficients of Spearman’s correlation between relevant metabolic and microbial
measures. In a multiple regression analysis (R2=0.84, P<0.0001) with HOMA-IR as dependent
variable and ghrelin, GLP1, BAs, TAG and mesenteric and retroperitoneal fat as independent
variables, the significant predictors were ghrelin levels (β=0.26,P=0.034), GLP1 (β=-0.32,P=0.019),
BAs (β=−0.26,P=0.040) and TAG (β=0.49,P=0.002).
Ectopic fat deposition and hepatic glycogen
Since fat deposition in muscle and liver is associated with insulin resistance, the histological effects
of both surgical procedures in these sites were evaluated.
Skeletal muscle fat infiltration was present in SO but not in GG rats (Figure 2, panels 2A and 2B,
respectively).
All SO animals showed moderate-to-marked hepatic steatosis and some ballooning degeneration
(Figure 2, panel 2C). Rats in the GG group showed normal liver architecture (Figure 2, panel 2D).
Furthermore, SO rats exhibited higher glycogen liver storage than the GG group (Figure 2 panels
2E and 2F, respectively). Finally, an increase in both interstitial cellular infiltration and fibrosis was
observed in the visceral adipose tissue of SO rats as compared with GG rats (Figure 2, panels 2G
and 2H respectively).
Western blots
When compared to SO rats, GG rats exhibited increased phosphorylation of Akt on Ser473 in
muscle (Figure3, panel A, left side) (21.5 ±8.2 vs. 74.03 ±11.8%; P=0.006) and in liver (Figure3,
panel B, left side) (8.7±0.8 vs. 13.9±1.7%; P=0.03). No significant difference of Akt
Page 10 of 44Diabetes
11
phosphorylation in the subcutaneous adipose tissue (Figure3 panel C, left side) (16.1±3.4 vs.
9.4±3.4%) and of phosphorylation of GSK3β in both muscle (7.4%±0.5 vs. 9.4±0.2%, not reported
in the figure) and adipose tissue (Figure3, panel C, right side) (38.7±11.2 vs. 12.8±3.3%) between
SO and GG rats was observed. The liver (Figure3, panel B, right side) showed an increased
phosphorylation of GSK3β in GG when compared to SO rats (4.6±1.3 vs. 10.5±2.0%; P=0.049).
GSK3α isoform phosphorylation (Ser21) in the muscle showed no significant differences between
SO and GG rats (5.3±1.0 vs. 6.5±2.2%) while it was not even detectable in the liver and adipose
tissue.
The muscle phosphorylated AMPKα (Tyr172) form was 53% higher in GG than in SO rats (Figure
3, panel A, right side) (1.9% ±0.18 vs. 2.9% ±0.2; P=0.007).
Gut microbiota
GG wrought significant changes in microbiome structure, with GG animals showing significantly
higher taxa richness (α-diversity) calculated using the Shannon index (P=0.0064, Wilcoxon rank-
sum test, FDR corrected) (Figure 4). GG and SO animals were significantly different in terms of β-
diversity using unweighted UniFrac (Figure 4b), weighted UniFrac and Bray-Curtis between-
samples dissimilarity measures (P=0.002, 0.034 and 0.002 respectively, PERMANOVA test).
Differences in the relative abundance of bacteria within the gut microbiota of GG and SO animals
are shown in Figure 5 at different taxonomic levels (phylum to genus). No statistically significant
differences were observed between the groups at phylum level. At the Class level, γ-Proteobacteria
(P=0.020), Actinobacteria (P=0.034), Bacilli (P=8.0x10-5) and Erysipelotrichia (P=0.016) were all
significantly enriched in the GG group compared to the SO rats, while the Clostridia were enriched
in the SO group (P=0.031). At the order level, Aeromonadales (P=0.04), Actinomycetales (P=0.03),
Coriobacteriales (P=0.04), Lactobacilli (P<0.0001), Clostridia (P=0.03) and Erysipelotrichales
(P=0.02) differed between groups. According to the Wilcoxon ranked-sum test significant
Page 11 of 44 Diabetes
12
differences occurred between GG and SO animals at genus level, with GG animals harbouring
higher relative abundance of Lactobacillus (P=0.0003) and Collinsella (P=0.0095), while SO
animals had higher Ruminococcus (P=0.0095).
To define bacteria characteristic of GG or SO groups at order and genus taxonomic levels, we
performed a Random Forests model in a 10-fold cross-validation (CV) scheme obtaining an
estimated test error of 13.3±18.5% (order level abundances) and 12.5±22.65% (genus level
abundances). The top ranked orders and genera (mean decrease in classification accuracy>0.1%)
identified by Random Forests are shown in Figure 6 in decreasing order of their discriminatory
importance. Lactobacilli were the main drivers of difference between groups at both taxonomic
levels.
Page 12 of 44Diabetes
13
DISCUSSION
In this study we describe the results of a novel experimental model of metabolic surgery, the
glandular gastrectomy, which is associated with
1) Reduction of ectopic fat deposition and redistribution of body fat;
2) Improvement of insulin resistance;
3) Changes in the gut microbiota profile with increase primarily of lactobacilli but also
increase of microbial diversity and alteration of BA pool size;
4) Decrease of the low-grade inflammation state, as shown by the reduction of the
concentrations of circulating LPS and by the reduction of cellular infiltrates and fibrosis in
the adipose tissue.
As compared with SO, GG did not induce any significant body weight loss or food intake
reduction after the first 3 weeks following the operations. However, we did not measure the impact
of GG on intestinal transit or whether it altered meal frequency or size.
The weight loss observed in GG and SO rats during the first 2 weeks after surgery is in
agreement with that reported in the literature for rodents under a high fat diet after conventional
sleeve gastrectomy or sham operation (12,13), with about 18% weight reduction from baseline.
However, while the weight gain curve post conventional sleeve gastrectomy remains significantly
lower than SO rats (12,13), in our series there was no difference in weight gain between GG and SO
animals over time. This suggests that the rapid fall of circulating ghrelin levels following GG
acutely reduced appetite, but since the aglandular stomach remained intact (the gastric section
responsible for food storage and digestion in the rat), this may have permitted a normal food intake,
comparable with that of SO rats. Our model was not designed to measure the early dynamic effects
of glandular gastrectomy, but rather to shed some light on the steady effects of this operation. In
fact, the GG rats ate about 50% less calories for a full 2 weeks following the operation and this
Page 13 of 44 Diabetes
14
might be resulted in loss of fat and lean mass and improvements in glycemic control. We do not
know if this weight loss period might have influenced the findings observed at the end of the study,
although 8 further weeks during which GO animals rapidly gained weight should be a period of
time long enough to minimize the effect of these 2 weeks of hypo-caloric intake. Given that days in
rats translates into months for humans, we cannot extrapolate our results to the human situation,
where some types of bariatric/metabolic operations improve insulin action just few days after
surgery, independently of weight loss.
Further monitoring of insulin sensitivity during the weight loss period as well as in the
regaining phase would be useful and would provide additional mechanistic evidence.
The HFD determined insulin resistance and fat deposition in both liver and skeletal muscle
tissue in SO animals, while GG prevented these features and determined redistribution of the
adiposity pattern characterized by decreased visceral fat and by proportionally increased
subcutaneous fat. Fat redistribution may have played an important role in modulating insulin
resistance. Visceral fat weight was directly associated with HOMA-IR. It is worth noting that partial
surgical removal of intra-abdominal fat prevents the onset of age-dependent insulin resistance and
delays significantly the onset of glucose intolerance and diabetes in rodent models of obesity and
diabetes (14). GG used in our series provides a model of metabolically healthy obesity. In humans,
metabolically healthy but obese individuals (MHO) have significantly lower levels of visceral fat
and are resistant to the metabolic and cardiovascular risks deriving from obesity (15). Furthermore,
MHO appear to have higher microbial diversity, both in species and gene richness compared to
other obese subjects (16).
It has been shown that BAs (ursodeoxycholic acid) ingestion decreases age-related adiposity
and inflammation in mice (17). BAs circulating levels and composition are regulated by gut
microbiota (18, 19) and, indeed, we found that the plasma levels of total BAs were significantly and
inversely correlated with HOMA-IR in a multiple regression analysis.
Page 14 of 44Diabetes
15
In addition, accumulation of glycogen was observed only in the liver of SO rats. A net liver
glycogen accumulation is described in about 80% of diabetic patients (20)
as well as in obese
patients (21) and has been suggested to be linked to an enhanced gluconeogenesis.
Therefore, GG modifies adipose tissue distribution preventing ectopic fat deposition,
reduces liver glycogen accumulation possibly as a consequence of the evidenced drastic reduction
of ghrelin secretion and of the less pronounced GLP-1 increased levels, which have been linked to
changes in the gut microbiome and circulating BAs (22-24).
Furthermore, GG improved insulin signaling. We found, in fact, a significantly higher
phosphorylation of Akt in both liver and skeletal muscle of GG as compared with SO rats. Once
phosphorylated on both Thr308 and Ser473 Akt is fully activated and phosphorylates its
downstream effector, GSk3β (25). This latter was in fact significantly more phosphorylated in GG
than in SO rats. GSk3β phosphorylation on Ser9 or Ser21, depending on tissue specific isoform
expression, decreases its active site availability. Since GSK-3 is a protein kinase that
phosphorylates and inactivates glycogen synthesis, the rate-limiting enzyme in glycogen formation
(26), its inactivation stimulates glycogen production. Therefore, although we did not measure it
directly, the accumulation of glycogen in SO rat tissues is a likely consequence of impaired
glycogen breakdown. Cellular glycogen, in fact, results from the balance between synthesis and
glycogenolysis. Indeed, both hyperglycemia and hyperinsulinemia are potent inhibitors of
glycogenolysis (27,28) and thus HFD by inducing insulin resistance may reduce glycogenolysis
with subsequent glycogen accumulation. In addition, in hyperglycemic conditions glucose passively
enters the hepatocytes by insulin-independent GLUT2, and is rapidly phosphorylated, with
inhibition of its release from hepatocytes (29).
Fully phosphorylated Akt, as observed in GG rats, suppresses hepatic glucose production by
decreasing the expression of gluconeogenic enzymes by phosphorylation and nuclear exclusion of
the forkhead box protein, FOXO1, and its pro-gluconeogenic targets (30). These functional cellular
findings may explain why HOMA-IR, an index of hepatic insulin resistance, and the AUCs glucose-
Page 15 of 44 Diabetes
16
to-insulin ratio, indicative of peripheral insulin resistance, were markedly reduced only in GG rats.
In fact, HFD impairs insulin signaling determining hepatic and peripheral insulin resistance by
reducing Akt and GSK phosphorylation and function. We note, however, that glycemia did not
return to baseline values in both GG and SO rats after the OGTT (see Figure 1) suggesting that the
glucose clearance from the circulation to the metabolic compartment is not fully normalized by
glandular gastrectomy.
Looking for the mechanism of action of GG on the normalization of insulin resistance, three
possible factors, namely the abolition of ghrelin secretion, the increased circulating GLP1 and the
elevation of BAs, might have played a significant role.
In accordance to our findings, i.e. that our GG rats did not appreciably lose weight, ghrelin -/- mice
do not show appetite reduction or weight loss under a HFD (31). Ghrelin−/−
mice show improved
glucose tolerance and increased insulin sensitivity (32). Interestingly, also in ghrelin receptor
knockout mice, i.e. in mice producing ghrelin which however cannot bind to its receptor, peripheral
insulin sensitivity is greatly increased while hepatic glucose production is reduced (33).
Thus, it appears that the most important role of ghrelin is that of regulating insulin sensitivity and
glucose homeostasis.
We cannot exclude, however, that the marked improvement of insulin sensitivity observed in our
series can be partially explained by the increase of GLP1 secretion or by changes in gut microbiota
profile and resultant changes in BA pool size. It has, in fact, been demonstrated that the lack of
dipeptidyl peptidase IV (DPPIV), the enzyme that degrades GLP1, improves both HOMA-IR and
the AUC in the OGTT in genetically DPPIV deficient rats (F344/DuCrj), under a HFD compared
with F344/Crj control rats (34). Interestingly, microbially produced short-chain fatty-acids (SCFA),
BAs and certain probiotic strains, e.g. Lactobacillus reuteri SD5865, stimulate glucose-induced
GLP1 release (35-37).
Page 16 of 44Diabetes
17
The literature data on the gut microbiota profiles in obesity and after metabolic surgery are
consistent in showing dramatic effects on microbial make-up but less so in terms of which
organisms or microbial related metabolic activities are affected.
The first studies in ob/ob mice demonstrated that the Firmicutes were more represented whereas
the Bacteroidetes were correspondingly reduced (38), and this was considered as an imprinting of
obesity. However, successively using an ob/ob mouse model fed either low-fat or high-fat diets and
compared with wild-type mice, Murphy et al. (39) demonstrated that this increased Firmicutes to
Bacteroidetes ratio was the resultant of the high-fat diet rather than genetic obesity. Accordingly,
Turnbaugh et al. (40) found that in the diet-induced obese mice, the difference in
Firmicutes/Bacteroidetes ratio was mainly related to the increase in a single class of bacteria, the
Mollicutes belonging to the Firmicutes phylum.
After the gastric bypass in a rat model, Li et al. (41) showed a simultaneous reduction of both
Firmicutes (4.5-fold) and Bacteroidetes (2-fold) in comparison to sham-operated rats, but a
significant increase of Proteobacteria (52-fold), which are a phylum of gram-negative bacteria.
In our study, we found no significant changes in the Firmicutes/Bacteroidetes ratio between GG and
SO rats under a HFD but rather dramatic shifts in relative abundance within the Firmicutes, with
increased relative abundance of Lactobacillus and reduced abundance of Ruminococcus
characterizing improved metabolic health in the GG animals. Indeed, our Random Forest analysis
showed lactobacilli to be the main bacteria taxa distinguishing GG from SO animals.
GG was associated with a reduced endotoxemia as shown by the lower circulating levels of LPS in
comparison with SO rats. Luche et al. (42) demonstrated that metabolic endotoxemia increases the
macrophage number in the mice adipose tissue in a CD14 mediated manner. Accordingly, the
visceral adipose tissue of SO rats showed an increased cellular infiltration and fibrosis, not observed
after GG.
We acknowledge some limitations of our study. Our model is markedly different from the
human model, where improvements in glycemic control are generally observed during the period of
Page 17 of 44 Diabetes
18
weight loss. However, we note that after bilio-pancreatic diversion the patients become extremely
insulin sensitive even though they have lost negligible amounts of weight (8) or they pass from
super obesity to morbid obesity (43). In addition, the gastric anatomy of the rats is completely
different from that of humans, where the glands containing endocrine cells are distributed
throughout the entire gastric surface, thus preventing replication of this operation in patients.
Finally, we did not test the mechanistical aspects of the observed metabolic changes.
In conclusion, the GG devised by us shows a role for the stomach in glycemia even though the rats
remained essentially obese. It lowered insulin resistance – through the improvement of both insulin-
mediated hepatic and peripheral insulin sensitivity, with the increase of Akt and GSK-3
phosphorylation, and insulin-independent glucose disposal, as demonstrated by the increased
muscular phosphorylation of AMPK – and reduced ectopic fat deposition and hepatic glycogen
over-accumulation. These findings are associated with body adipose tissue redistribution, with net
reduction of intra-abdominal fat, dramatic reduction of circulating ghrelin levels, increased GLP1
plasma concentration and with remodeling of gut microbiome with increased taxonomic richness,
increased relative abundance of lactobacilli and increased circulating BA pool. Collectively, these
data suggest that, in the rat, the secreting portion of the stomach plays a central role in the
improvement of the metabolic syndrome.
Page 18 of 44Diabetes
19
Acknowledgments
Professor Geltrude Mingrone is the guarantor of this study.
NB, GM and SF designed the study. NB, ES, LCG and GC researched data and operated the
animals. NB, GM, VK, FF and KT wrote the manuscript. DA, FF, CD and KT performed the
experiments on gut microbiota and made statistical analysis. GA, FLN and AS performed the
western blots. AB, MM, LCG and GC contributed discussion.
We would like to thank Mrs. Anna Caprodossi for her excellent technical support.
This study was partially supported by the grant 70201398 - LINEA D.1 2015 from the Catholic
University.
ALB was supported by a grant from the German Diabetes Association (DDG)
Page 19 of 44 Diabetes
20
REFERENCES
1. Wadden, TA, Butryn ML, Byrne KJ. Efficacy of lifestyle modification for long-term weight
control. Obes Res. 2004; 12:151S-62S.
2. Mingrone, G, Panunzi S, De Gaetano A, Guidone C, Iaconelli A, Leccesi L, Nanni G, Pomp A,
Castagneto M, Ghirlanda G, Rubino F.. Bariatric surgery versus conventional medical therapy
for type 2 diabetes. N Engl J Med. 2012; 366:1577-1585.
3. Schauer, PR, Kashyap SR, Wolski K, Brethauer SA, Kirwan JP, Pothier CE, Thomas S, Abood
B, Nissen SE, Bhatt DL.Bariatric surgery versus intensive medical therapy in obese patients with
diabetes. N Engl J Med. 2012; 366:1567-1576.
4. Schauer, PR, Schauer PR, Bhatt DL, Kirwan JP, Wolski K, Brethauer SA, Navaneethan SD,
Aminian A, Pothier CE, Kim ES, Nissen SE, Kashyap SR; STAMPEDE Investigators. Bariatric
surgery versus intensive medical therapy for diabetes--3-year outcomes. N Engl J Med. 2014;
370:2002-2013.
5. Mingrone, G, Panunzi S, De Gaetano A, Guidone C, Iaconelli A, Nanni G, Castagneto M,
Bornstein S, Rubino F. Bariatric–metabolic surgery versus conventional medical treatment in
obese patients with type 2 diabetes: 5 year follow-up of an open-label, single-centre, randomised
controlled trial. The Lancet. 2015; 386: 964 - 973
6. DeFronzo, RA, Tripathy, D. Skeletal muscle insulin resistance is the primarydefect in type 2
diabetes. Diabetes Care. 2009; 32:S157-S163.
7. Pories, WJ, Swanson MS, MacDonald KG, Long SB, Morris PG, Brown BM, Barakat HA,
deRamon RA, Israel G, Dolezal JM,Who would have thought it? An operation proves to be the
most effective therapy for adult-onset diabetes mellitus. Ann Surg 1995; 222:339–350.
Page 20 of 44Diabetes
21
8. Guidone C, Manco M, Valera-Mora E, Iaconelli A, Gniuli D, Mari A, Nanni G, Castagneto M,
Calvani M, Mingrone G. Mechanisms of recovery from type 2 diabetes after malabsorptive
bariatric surgery. Diabetes. 2006;55:2025-2031.
9. Basso N, Capoccia D, Rizzello M, Abbatini F, Mariani P, Maglio C, Coccia F, Borgonuovo G,
De Luca ML, Asprino R, Alessandri G, Casella G, Leonetti F. First-phase insulin secretion,
insulin sensitivity, ghrelin, GLP-1, and PYY changes 72 h after sleeve gastrectomy in obese
diabetic patients: the gastric hypothesis. Surg Endosc. 2011;25:3540-3550.
10. Proposed terminology for the anatomy of the rat stomach. Robert A. Gastroenterology. 1971;
60:344-345.
11. Matthews DR, Hosker JP, Rudenski AS, Naylor BA, Treacher DF, Turner RC. Homeostasis
model assessment: insulin resistance and beta-cell function from fasting plasma glucose and
insulin concentrations in man. Diabetologia 1985; 28:412–419.
12. Rodríguez A, Becerril S, Valentí V, Moncada R, Méndez-Giménez L, Ramírez B, Lancha A,
Martín M, Burrell MA, Catalán V, Gómez-Ambrosi J, Frühbeck G. Short-term effects of sleeve
gastrectomy and caloric restriction on blood pressure in diet-induced obese rats. Obes Surg.
2012;22:1481-1490.
13. Valentí V, Martín M, Ramírez B, Gómez-Ambrosi J, Rodríguez A, Catalán V, Becerril S,
Lancha A, Fernández S, Cienfuegos JA, Burrell MA, Frühbeck G. Sleeve gastrectomy induces
weight loss in diet-induced obese rats even if high-fat feeding is continued. Obes Surg.
2011;21:1438-1443.
14. Gabriely, I, Ma XH, Yang XM, Atzmon G, Rajala MW, Berg AH, Scherer P, Rossetti L.
Removal of visceral fat prevents insulin resistance and glucose intolerance of aging: an
adipokine-mediated process? Diabetes. 2002; 51:2951-2958.
15. Hwang, YC, Hayashi T, Fujimoto WY, Kahn SE, Leonetti DL, McNeely MJ, Boyko EJ.
Visceral abdominal fat accumulation predicts the conversion of metabolically healthy obese
subjects to an unhealthy phenotype. Int J Obes (Lond). 2015; 39:1365-1370.
Page 21 of 44 Diabetes
22
16. Cotillard A, Kennedy SP, Kong LC, Prifti E, Pons N, Le Chatelier E, Almeida M, Quinquis B,
Levenez F, Galleron N, Gougis S, Rizkalla S, Batto JM, Renault P; ANR MicroObes
consortium, Dore J, Zucker JD, Clement K, Ehrlich SD. Dietary intervention impact on gut
microbial gene richness. Nature. 2013 ;500:585-588.
17. Oh AR, Bae JS, Lee J, Shin E, Oh BC, Park SC, Cha JY. Ursodeoxycholic acid decreases age-
related adiposity and inflammation in mice. BMB Rep. 2016;49:105-110.
18. Midtvedt T. Microbial bile acid transformation. Am J Clin Nutr. 1974;27:1341-1347.
19. Ridlon JM, Kang DJ, Hylemon PB. Bile salt biotransformations by human intestinal bacteria. J
Lipid Res. 2006;47:241-259.
20. Ferrannini, E, Lanfranchi, A, Rohner-Jeanrenaud, F, Manfredini, G, VandeWerve, G. Influence
of long-term diabetes on liver glycogen metabolism in the rat. Metabolism 1990; 39:1082-1088.
21. Creutzfeldt, W, Frerichs, H, Sickinger, K. Liver diseases and diabetes mellitus. Prog Liver Dis.
1970; 13:371-407.
22. Simon, MC, Strassburger K, Nowotny B, Kolb H, Nowotny P, Burkart V, Zivehe F, Hwang JH,
Stehle P, Pacini G, Hartmann B, Holst JJ, MacKenzie C, Bindels LB, Martinez I, Walter J, Henrich
B, Schloot NC, Roden M.Intake of Lactobacillus reuteri Improves Incretin and Insulin Secretion
in Glucose-Tolerant Humans: A Proof of Concept. Diabetes Care. 2015; 38:1827-1834.
23. Okubo, H, Nakatsu Y, Sakoda H, Kushiyama A, Fujishiro M, Fukushima T, Matsunaga Y, Ohno
H, Yoneda M, Kamata H, Shinjo T, Iwashita M, Nishimura F, Asano T.Mosapride citrate
improves nonalcoholic steatohepatitis with increased fecal lactic acid bacteria and plasma
glucagon-like peptide-1 level in a rodent model. Am J Physiol Gastrointest Liver Physiol. 2015;
308:G151-G158.
24. Murakami M, Une N, Nishizawa M, Suzuki S, Ito H, Horiuchi T. Incretin secretion stimulated
by ursodeoxycholic acid in healthy subjects. Springerplus. 2013;2:20.
25. Ishiki, M, Klip, A. Minireview: recent developments in the regulation of glucose transporter-4
traffic: new signals, locations, and partners. Endocrinology. 2005; 146:5071-5078.
Page 22 of 44Diabetes
23
26. Hemmings, BA, Aitken, A, Cohen, P, Rymond, M, Hofmann, F. Phosphorylation of the type-II
regulatory subunit of cyclic-AMP-dependent protein kinase by glycogen synthase kinase 3 and
glycogen synthase kinase 5. Eur J Biochem. 1982;127:473-481.
27. Adkins, A, Basu R, Persson M, Dicke B, Shah P, Vella A, Schwenk WF, Rizza R. Higher insulin
concentrations are required to suppress gluconeogenesis than glycogenolysis in non-diabetic
humans. Diabetes 2003; 52 :2213 –2220.
28. Petersen, KF, Laurent, D, Rothman, DL, Cline, GW, Shulman, GI. Mechanism by which glucose
and insulin inhibit net hepatic glycogenolysis in humans. J Clin Invest 1998; 101:1203 –1209.
29. Chatila, R, West, AB. Hepatomegaly and abnormal liver tests due to glycogenosis in adults with
diabetes. Medicine (Baltimore) 1996; 75:327–333.
30. Matsumoto, M, Pocai, A, Rossetti, L, Depinho, RA, Accili, D. Impaired regulation of hepatic
glucose production in mice lacking the forkhead transcription factor Foxo1 in liver. Cell Metab.
2007; 6:208-216.
31. Sun, Y, Butte, NF, Garcia, JM, Smith, RG. Characterization of adult ghrelin and ghrelin receptor
knockout mice under positive and negative energy balance. Endocrinology. 2008; 149:843-850.
32. Sun, Y, Asnicar, M, Saha, PK, Chan, L, Smith, RG. Ablation of ghrelin improves the diabetic
but not obese phenotype of ob/ob mice. Cell Metab. 2006; 3:379-386.
33. Qi, Y, Longo KA, Giuliana DJ, Gagne S, McDonagh T, Govek E, Nolan A, Zou C, Morgan K,
Hixon J, Saunders JO, Distefano PS, Geddes BJ.Characterization of the insulin sensitivity of
ghrelin receptor KO mice using glycemic clamps. BMC Physiol. 2011;11:1.
34. Yasuda, N, Nagakura, T, Yamazaki, K, Inoue, T, Tanaka, I. Improvement of high fat-diet-
induced insulin resistance in dipeptidyl peptidase IV-deficient Fischer rats. Life Sci. 2002;
71:227-238.
35. Psichas A, Sleeth ML, Murphy KG, Brooks L, Bewick GA, Hanyaloglu AC, Ghatei MA, Bloom
SR, Frost G. TheThe short chain fatty acid propionate stimulates GLP-1 and PYY secretion via
free fatty acid receptor 2 in rodents. Int J Obes (Lond) 2015; 39:424-429.
Page 23 of 44 Diabetes
24
36. Simon MC, Strassburger K, Nowotny B, Kolb H, Nowotny P, Burkart V, Zivehe F, Hwang JH,
Stehle P, Pacini G, Hartmann B, Holst JJ, MacKenzie C, Bindels LB, Martinez I, Walter J,
Henrich B, Schloot NC, Roden M.. Intake of Lactobacillus reuteri Improves Incretin and Insulin
Secretion in Glucose-Tolerant Humans: A Proof of Concept. Diabetes Care 2015; 38:1827-
1834.
37. Vettorazzi JF, Ribeiro RA, Borck PC, Branco RC, Soriano S, Merino B, Boschero AC, Nadal A,
Quesada I, Carneiro EM. The bile acid TUDCA increases glucose-induced insulin secretion via
the cAMP/PKA pathway in pancreatic beta-cells. Metabolism. 2016;65:54-63.
38. Ley RE, Bäckhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Obesity alters gut
microbial ecology. Proc Natl Acad Sci USA 2005;102:11070–11075.
39. Murphy EF, Cotter PD, Healy S, Marques TM, O'Sullivan O, Fouhy F, Clarke SF, O'Toole PW,
Quigley EM, Stanton C, Ross PR, O'Doherty RM, Shanahan F.Composition and energy
harvesting capacity of the gut microbiota: relationship to diet, obesity and time in mouse models.
Gut 2010;59:1635–1642.
40. Turnbaugh PJ, Bäckhed F, Fulton L, Gordon JI. Diet-induced obesity is linked to marked but
reversible alterations in the mouse distal gut microbiome. Cell Host Microbe 2008;3:213–223.
41. Li, JV, Ashrafian H, Bueter M, Kinross J, Sands C, le Roux CW, Bloom SR, Darzi A,
Athanasiou T, Marchesi JR, Nicholson JK, Holmes E.Metabolic surgery profoundly influences
gut microbial—host metabolic cross-talk. Gut. 2011; 60: 1214–1223.
42. Luche E, Cousin B, Garidou L, Serino M, Waget A, Barreau C, André M, Valet P, Courtney M,
Casteilla L, Burcelin R. Metabolic endotoxemia directly increases the proliferation of adipocyte
precursors at the onset of metabolic diseases through a CD14-dependent mechanism. Mol Metab.
2013;2:281-291.
43. Mari A, Manco M, Guidone C, Nanni G, Castagneto M, Mingrone G, Ferrannini E. Restoration
of normal glucose tolerance in severely obese patients after bilio-pancreatic diversion: role of
insulin sensitivity and beta cell function. Diabetologia. 2006;49:2136-2143.
Page 24 of 44Diabetes
25
Glandular gastrectomy Sham operation P value
Weight (g) 299.83±47.21 296.15±55.56 0.953
Fasting plasma glucose
(mg/dl)
138.76±21.39 166.47±28.18 0.001
Fasting plasma insulin
(ng/ml)
1.27±0.25 2.42±0.67 <0.0001
HOMA-IR 14.93±3.20 23.72±7.10 <0.0001
Glucose AUC 11753.57±8024.38 17210.16±5554.65 0.029
Insulin AUC 138.24±55.66 254.53±114.01 0.001
AUCglucose/AUCinsulin 64.53±62.90 143.32±70.70 0.001
Cholesterol (mg/dl) 122.33±9.55 167.81±25.21 <0.0001
Triacylglycerol (mg/dl) 133.28±10.23 189.85±21.40 <0.0001
Ghrelin (fmol/ml) 4.20±11.75 48.69±5.79 <0.0001
GLP1 (pmol/ml) 5.15±1.57 2.93±0.93 <0.0001
LPS (EU/ml) 4.65±0.87 7.84±0.98 <0.0001
BAs (µmol/l) 22.96±3.79 14.17±2.76 <0.0001
Table 1: weight and metabolic parameters in SO rats and in rats after GG. The blood
samples were taken at sacrifice. Data are mean±SD. Significance (P) was computed by
Wilcoxon signed-rank test.
Page 25 of 44 Diabetes
26
Variables
Spearman’s coefficients of correlation
GRL GLP1 Cholesterol TAG HOMA-
IR Weight
Mesenteric
adipose tissue
Retroperitoneal
adipose tissue
Subcutaneous
adipose tissue LPS BA
Lacto
bacillus
Collin
sella
Ruminoc
occus
GRL 1.00 -0.52* 0.01 0.32 0.70* 0.09 0.42 0.31 -0.02 0.18 -0.39 0.22 -0.49* 0.20
GLP1 -0.52* 1.00 -0.07 -0.36 -0.64* -0.31 -0.36 -0.33 -0.10 -0.08 0.21 -0.14 0.09 0.08
Cholesterol 0.01 -0.07 1.00 0.53* 0.45 0.61* 0.65* 0.69* 0.79* 0.64* -0.55* 0.20 0.02 -0.55*
TAG 0.32 -0.36 0.53* 1.00 0.64* 0.80* 0.52* 0.54* 0.56* 0.50* -0.25 0.29 -0.16 -0.33
HOMA-IR 0.70* -0.64* 0.45 0.64* 1.00 0.45 0.57* 0.50* 0.40 0.42 -0.62* 0.17 -0.30 -0.19
Weight 0.09 -0.31 0.61* 0.80* 0.45 1.00 0.55* 0.59* 0.53* 0.46 -0.08 0.14 0.05 -0.45
Mesenteric
adipose tissue 0.42 -0.36 0.65* 0.52* 0.57* 0.55* 1.00 0.97* 0.61* 0.47* -0.54* 0.36 0.05 -0.52*
Retroperitoneal
adipose tissue 0.31 -0.33 0.69* 0.54* 0.50* 0.59* 0.97* 1.00 0.67* 0.52* -0.54* 0.42 0.08 -0.57*
Subcutaneous
adipose tissue -0.02 -0.10 0.79* 0.56* 0.40 0.53* 0.61* 0.67* 1.00 0.43 -0.38 0.26 0.19 -0.69*
LPS 0.18 -0.08 0.64* 0.50* 0.42 0.46 0.47* 0.52* 0.43 1.00 -0.65* 0.16 -0.34 -0.08
BAs -0.39 0.21 -0.55* -0.25 -0.62* -0.08 -0.54* -0.54* -0.38 -0.65* 1.00 -0.17 0.20 0.13
Lactobacillus 0.22 -0.14 0.20 0.29 0.17 0.14 0.36 0.42 0.26 0.16 -0.17 1.00 0.03 -0.21
Collinsella -0.49* 0.09 0.02 -0.16 -0.30 0.05 0.05 0.08 0.19 -0.34 0.20 0.03 1.00 -0.69*
Ruminococcus 0.20 0.08 -0.55* -0.33 -0.19 -0.45 -0.52* -0.57* -0.69* -0.08 0.13 -0.21 -0.69* 1.00
Table 2. Coefficients of Spearman’s correlation between relevant metabolic and microbial measures within the GG animals (n=18). * indicates
statistically significant correlation (P<0,05).
Page 26 of 44Diabetes
27
FIGURE LEGENDS
Figure 1
Time courses of plasma glucose (Figure 1, panel A) and of plasma insulin (Figure 1, panel B) in
SO, continuous lines, and GG, dotted lines. Both plasma glucose and insulin concentrations were
reduced in GG as compared with SO rats.
The OGTT was performed the day of animal sacrifice.
Figure 2
Representative hematoxylin and eosin stained muscle sections from SO and GG rats fed with HFD.
Sham rats exhibited predominantly steatosis in muscle (A) and liver (C) sections. After glandular
gastrectomy rats showed no steatosis in muscle (B) and liver (D) sections. SO rats (G) show
abundant interstitial cellular infiltration (possibly macrophages) of the retroperitoneal adipose tissue
with pronounced fibrosis; these features are absent in GG rats (H).
Representative PAS stained sections of liver from SO and GG rats fed with HFD. Sham rats
exhibited a higher glycogen storage in liver (E) sections. After GG, rats showed a decrease in
glycogen deposition in liver (F) sections.
Magnification x20.
Figure 3
The graphs depict densitometric analyses of phosphorylated form/total protein in 20 muscle samples
of SO and GG rats obtained at sacrifice. Results are expressed as the mean±SEM. Representative
blot of a single rat (Sham and GG) is shown.
Page 27 of 44 Diabetes
28
(A, left side) Level of Akt phosphorylation (Ser473) in muscle biopsies of SO and GG rats.
There is a low level of phosphorylation of Ser473 in sham operated rats and a significant increase of
phosphorylation after GG (21.5% ±8.2 vs. 74.03% ±11.8; P=0.006).
(A, right side) Rats undergoing glandular gastrectomy exhibit increased phosphorylation of
AMPKα (Tyr172) than sham operated rats (1.9% ±0.18 vs. 2.9% ±0.2; P=0.007).
(B, left side) Level of Akt phosphorylation (Ser473) in liver biopsies of SO and GG rats.
There is a low level of phosphorylation of Ser473 in sham operated rats and a significant increase of
phosphorylation after GG (8.7% ±0.8 vs. 13.9% ±1.7; P=0.03).
(B, right side) Level of GSK3β phosphorylation (Ser9) in liver biopsies of SO and GG rats. There is
a low level of phosphorylation of Ser9 in sham operated rats and a significant increase of
phosphorylation after GG (4.6% ±1.3 vs. 10.5% ±2; P=0.05). GSK3α was not detected.
(C, left side) Level of Akt phosphorylation (Ser473) in adipose tissue biopsies of SO and GG rats.
There is no significant difference of phosphorylation after GG (16.1% ±3.4 vs. 9.4% ±3.4).
(C, right side) Level of GSK3β phosphorylation (Ser9) in adipose tissue biopsies of SO and GG
rats. There is no significant difference of phosphorylation after GG (38.7% ±11.2 vs. 12.8% ±3.3).
GSK3α was not detected.
Figure 4
4a: Alpha diversity from Genus to Phylum level for GG (A) and sham operated rats (B) measured
using the number of observed taxa, the Chao1 index and the Shannon entropy. The central line in
the box indicates the median, and the box extends to the 25th and 75th percentiles.
4b: PCoA of the between samples distances (beta diversity) computed using the Unweighted
UniFrac distance. Red dots represent the GG rats (A) and green dots the sham operated rats (B).
The right panel shows the same PCoA plot with the ten most abundant Genera (showing the highest
Page 28 of 44Diabetes
29
average relative abundance across all the samples) overlaid as colored squares with a size
proportional to their mean relative abundance. Genus coordinates were calculated as the weighted
average across sample coordinates.
Figure 5
Differences in relative abundance of taxa from phylum to genus level for GG (A) and sham-
operated (B) animals.
Taxa with relative abundance <1% are merged into the other label.
Figure 6
Top ranked orders (A) and genera (B) identified by Random Forests according to their ability to
discriminate the microbiota of GG and sham operated rats in decreasing order of their
discriminatory importance (mean decrease in classification accuracy >0.1%). Importance was
determined based on the expected mean decrease in classification accuracy when the feature was
ignored. Error bars indicate the standard deviations.
Page 29 of 44 Diabetes
0
50
100
150
200
250
300
350
400
450
0 20 40 60 80 100 120
Pla
sma
glu
cose
(m
g/m
l)
Time (minutes)
0
1
2
3
4
5
6
0 20 40 60 80 100 120
Pla
sma
insu
lin (
ng/
ml)
Time (minutes)
1A
1B
GG
GG
SO
SO
Page 30 of 44Diabetes
���������
������� ���
��������������
��������������
�����
���������
������� ���
��������������
�������������������
������ ��
������� ��
������
�����
���������������
�������������������
��������������
������������
������ ��
������� ��
��������������������������
�������������������
��������������������������
������ ����
������� ���
��������������
�����
����������������
����������������
���������� ���
���������������
������ ����
������� ���
�������������������
����������������
����������������
���������� ������������������
��������������
��������������
��������������������
��������������
�����
����������������������� �����
������������ �����
������������������
������������������
!�"��#�
�����������������
����������������������������
��������������������
�������������������
����������������
������� �����
������������ �����
������������������
������������������
!�"��#�
�����������������
!�"��#�
�����
������ ��� $%
������������������� �
����������
�����������
������
�������
����������
������������
��������������
������ ��� $�&���������������
!�"��#�
�����
������ ��� $%
������������������� �
��������������������������� �������
����������
������������
�������������������� ��� $�&�
��������������
������
���
�� ��
������
'���
� Page 34 of 44Diabetes
Fibrobacterales
Bacteroidales
Bifidobacteriales
Enterobacteriales
Spirochaetales
Aeromonadales
Bacillales
TM7_genera_incertae_sedis
Coriobacteriales
Pasteurellales
Erysipelotrichales
Actinomycetales
Clostridiales
Lactobacillales
0.0 2.5 5.0 7.5 10.0Mean decrease in classification accuracy %
Ord
erA
Clostridium sensu strictoRikenella
CorynebacteriumCoprobacillusFlavonifractor
Escherichia/ShigellaTreponema
PeptococcusActinomyces
GemellaBlautia
EnterorhabdusButyricicoccus
AnaerovoraxClostridium XIClostridium IV
PeptostreptococcusVeillonella
AnaerobiospirillumTuricibacter
AnaerovibrioTM7_genera_incertae_sedis
AlistipesAllobaculum
ParabacteroidesRothia
PrevotellaErysipelotrichaceae_incertae_sedis
RuminococcusCollinsella
StreptococcusLactobacillus
0 2 4Mean decrease in classification accuracy %
Gen
us
BPage 35 of 44 Diabetes
�
��
�
���������
���������
������������������� �������������������
�
�� �����
������������������������ ������������������������������������������ ��������������
���� ���������� ����� ��� �������� �������� ��� �� �� ��� ����� ��������� ������� ���� ����� ��������
�������� !�� ����������������� ����������������������������������������� ������������
���������� ������������������������������������������������������������������������������ �����
������������ �������������
�"�������� ������ ���������!#�$"��������������#�%&'"��������������#�(&�"������ ����������
�
��� )������������������� �������������� ��������������������������*�����������������+,��
-��.�/��0!"122&3��
�
�� ������
$���%��������!���
Page 36 of 44Diabetes
Sample accession Secondary accession Sample unique name Study accession Experiment accession Run accession ID Name BarcodeSequence
LinkerPrimerSequence ReversePrimer Rat Cage Status GRL..fmol.ml. GLP1..pmol.ml. Chol..mg.dl. TAG..mg.dl. HOMA.IR AUC.glu
AUC.ins AUGglu.AUCins WEIGHT LPS..EU.ml. BA..micromol.l. MESENTERIC RETROPERITONEAL subcutaneous
ERS986129 SAMEA3678980 rat_gastrectomy1 PRJEB11901 ERX1225758 ERR1146956 454Reads.10265 10-265 CTCTACGCTC
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 30 10 B 45 2.5 158.2 205 34.9 14205 273.9 51.9
350 9.03 14.3 9.69 9.55 3.16
ERS986130 SAMEA3678981 rat_gastrectomy2 PRJEB11901 ERX1225759 ERR1146957 454Reads.10320 10-320 TGTACTACTC
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 20 10 B 49 2.1 152 181 21 17355 59.7 290.9
320 7.77 16.2 10.6 9.29 1.65
ERS986131 SAMEA3678982 rat_gastrectomy3 PRJEB11901 ERX1225760 ERR1146958 454Reads.11290 11-290 TGTGAGTAGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 17 11 A 1.2 4.4 111 130 10.2 17010 30.6 555.9
298 4.14 24.3 6.9 6.54 3.15
ERS986132 SAMEA3678983 rat_gastrectomy4 PRJEB11901 ERX1225761 ERR1146959 454Reads.11310 11-310 TCTAGCGACT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 7 11 A 2.6 4.5 109 123 7.7 9405 55.4 169.7
195 3.56 26.2 6.64 5.91 2.75
ERS986133 SAMEA3678984 rat_gastrectomy5 PRJEB11901 ERX1225762 ERR1146960 454Reads.12275 12-275 AGTACGCTAT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 11 12 A 0.6 4.2 136 136 11.9 10830 43 252
335 5.55 23.5 8.51 7.22 4.11
ERS986134 SAMEA3678985 rat_gastrectomy6 PRJEB11901 ERX1225763 ERR1146961 454Reads.12295 12-295 TGACGTATGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 25 13 B 39 4.6 139 169 10.1 15135 55.7 272
335 6.49 12.7 9.86 9.54 2.26
ERS986135 SAMEA3678986 rat_gastrectomy7 PRJEB11901 ERX1225764 ERR1146962 454Reads.13330 13-330 ACGACTACAG
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 21 13 B 56 3.7 136 178 19.4 6795 133.9 50.8
189 7.53 15.2 8.75 8.91 2.55
ERS986136 SAMEA3678987 rat_gastrectomy8 PRJEB11901 ERX1225765 ERR1146963 454Reads.14310 14-310 CGTACTCAGA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 29 14 B 57 2 190.6 215 41.4 23407.5 306.3
76.4 322 9.15 13.6 9.64 9.15 4.02
ERS986137 SAMEA3678988 rat_gastrectomy9 PRJEB11901 ERX1225766 ERR1146964 454Reads.14320 14-320 TACGCTGTCT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 31 14 B 55 2.1 220 232 47.3 9630 298.8 32.2
355 9.26 9.2 10.95 8.81 2.11
ERS986138 SAMEA3678989 rat_gastrectomy10 PRJEB11901 ERX1225767 ERR1146965 454Reads.15320 15-320 TCGCACTAGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 18 15 A 1.3 4 119 141 12.3 1777.5 102.1 17.4
Page 37 of 44 Diabetes
311 5.15 19.4 8.77 7.41 4.16
ERS986139 SAMEA3678990 rat_gastrectomy11 PRJEB11901 ERX1225768 ERR1146966 454Reads.15330 15-330 CTACGCTCTA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 12 15 A 0.6 5.4 119 141 9.6 6930 18 385
329 3.77 28 7.44 7.09 3.77
ERS986140 SAMEA3678991 rat_gastrectomy12 PRJEB11901 ERX1225769 ERR1146967 454Reads.16305 16-305 ATAGAGTACT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 22 16 B 44 4.2 174 170 25.4 13740 548.9 25
270 8.36 12.3 8.64 8.11 2.78
ERS986141 SAMEA3678992 rat_gastrectomy13 PRJEB11901 ERX1225770 ERR1146968 454Reads.16405 16-405 ACTGTACAGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 26 16 B 42 3.1 131 162 21.4 7395 108.9 67.9
191 7.21 16.5 8.16 6.96 3.29
ERS986142 SAMEA3678993 rat_gastrectomy14 PRJEB11901 ERX1225771 ERR1146969 454Reads.17255 17-255 CTATAGCGTA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 13 17 A 1.2 3.9 120 132 10.8 11557.5 95.7
120.8 355 4.33 25.4 8.12 7.19 4.09
ERS986143 SAMEA3678994 rat_gastrectomy15 PRJEB11901 ERX1225772 ERR1146970 454Reads.17325 17-325 CACGCTACGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 4 17 A 0 6.6 128 134 9.8 14872.5 9
1647.6 300 4.29 25.2 6.5 5.8 5.56
ERS986144 SAMEA3678995 rat_gastrectomy16 PRJEB11901 ERX1225773 ERR1146971 454Reads.18340 18-340 CGTACAGTCA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 8 18 A 1.3 3.8 121 127 12.4 7500 86.1 87.1
215 4.51 19.6 9.31 8 4.36
ERS986145 SAMEA3678996 rat_gastrectomy17 PRJEB11901 ERX1225774 ERR1146972 454Reads.2290 2-290 CGTCTAGTAC
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 19 8 B 53 2 185 209 33.8 16485 162 101.7
265 6.58 18 11.78 10.06 3.11
ERS986146 SAMEA3678997 rat_gastrectomy18 PRJEB11901 ERX1225775 ERR1146973 454Reads.3A315 3A-315 TCTATACTAT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 9 3A A 0 7.1 127 118 7.3 13680 64.1 213.6
285 5.25 18.2 7.25 7 3.49
ERS986147 SAMEA3678998 rat_gastrectomy19 PRJEB11901 ERX1225776 ERR1146974 454Reads.3A335 3A-335 CGACGTGACT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 5 3A A 2.1 4.6 129 139 13.1 2872.5 11.9 240.8
320 6.1 16.9 8.64 7.36 4.12
ERS986148 SAMEA3678999 rat_gastrectomy20 PRJEB11901 ERX1225777 ERR1146975 454Reads.4A310 4A-310 CGTGTCTCTA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 2 4A A 5.2 6.1 135 155 18.5 6795 67 101.4
320 6.27 16.5 9.56 8.02 5
ERS986149 SAMEA3679000 rat_gastrectomy21 PRJEB11901 ERX1225778 ERR1146976 454Reads.4A340 4A-340 TACGTCATCA
Page 38 of 44Diabetes
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 14 4A A 2.1 3.1 126 143 14.7 3007.5 135.6 22.2
315 4.51 20.1 7.55 7.14 4.01
ERS986150 SAMEA3679001 rat_gastrectomy22 PRJEB11901 ERX1225779 ERR1146977 454Reads.535512 5-355 1/2
AGTGCTACGA TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 23 5 B 47 2.6 188.5 202 25.1 6727.5
1.6 4219 355 7.55 15.4 11.9 11.06 2.19
ERS986151 SAMEA3679002 rat_gastrectomy23 PRJEB11901 ERX1225780 ERR1146978 454Reads.535522 5-355 2/2
ACTACTATGT TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 27 5 B 45 3.1 163.4 177 23.1 11850
68.4 173.2 310 6.52 18.3 8.51 8.36 1.96
ERS986152 SAMEA3679003 rat_gastrectomy24 PRJEB11901 ERX1225781 ERR1146979 454Reads.5A320 5A-320 ACTAGCAGTA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 15 5A A 1 4.6 128 144 8.8 4027.5 110.6 36.4
356 5.26 25.5 9.5 8.01 4.48
ERS986153 SAMEA3679004 rat_gastrectomy25 PRJEB11901 ERX1225782 ERR1146980 454Reads.5A360 5A-360 CATAGTAGTG
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 3 5A A 1.2 8.2 115 121 6.3 19095 89.4 213.6
251 5.12 25 6.91 6.91 3.36
ERS986154 SAMEA3679005 rat_gastrectomy26 PRJEB11901 ERX1225783 ERR1146981 454Reads.7250 7-250 CGCGTATACA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 28 7 B 47 4.1 168 196 28.2 12592.5 145.4
86.6 288 8.29 11.5 8.74 7.55 2.04
ERS986155 SAMEA3679006 rat_gastrectomy27 PRJEB11901 ERX1225784 ERR1146982 454Reads.7A320 7A-320 CGTCGATCTC
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 16 7A A 0 8.6 103 116 5.2 7350 45.5 161.6
250 3.19 30 6.69 6.49 3.12
ERS986156 SAMEA3679007 rat_gastrectomy28 PRJEB11901 ERX1225785 ERR1146983 454Reads.8355 8-355 CGATCGTATA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 24 8 B 54 2.2 175.8 172 28.6 12420 52.5 236.3
300 8.19 11 10.71 8.14 3.11
ERS986157 SAMEA3679008 rat_gastrectomy29 PRJEB11901 ERX1225786 ERR1146984 454Reads.9330 9-330 TAGTGTAGAT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 6 9 A 3.2 3.9 131 141 16.9 11557.5 43.3
267.2 371 5.02 23.1 10.11 9.89 5.12
ERS986158 SAMEA3679009 rat_gastrectomy30 PRJEB11901 ERX1225787 ERR1146985 454Reads.9335 9-335 ATACGACGTA
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 10 9 A 1 5.6 133 129 9.4 15870 15.8 1002.8
301 3.59 22.3 9.64 8.05 5
ERS986159 SAMEA3679010 rat_gastrectomy31 PRJEB11901 ERX1225788 ERR1146986 454Reads.A260 A-260 ACGAGTGCGT
TCCTACGGGAGGCAGCAG TGTGCGGGCCCCCGTCAATT 1 A A 51 4.2 112 129 12.9 8295 49.4 168
290 4.11 24 8.5 6.89 2.68
Page 39 of 44 Diabetes
Observed Chao1 Shannon
6
8
10
12
5.0
7.5
10.0
12.5
15.0
0.4
0.6
0.8
1.0
20
30
40
20
30
40
50
0.50
0.75
1.00
1.25
1.50
1.75
Alp
ha D
ivers
ity M
easu
re
16
20
24
15
20
25
30
0.50
0.75
1.00
1.25
1.50
1.75
30
40
50
60
70
30
40
50
60
70
80
1.50
1.75
2.00
2.25
2.50
50
60
70
80
90
100
60
70
80
90
100
110
2.0
2.4
2.8
3.2
A B A B A B
Status
Phylum
Class
Order
Family
Genus
Page 43 of 44 Diabetes