![Page 1: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/1.jpg)
1
Identification of tyrosine residues in vascular endothelial growth factor receptor-2/FLK-1 involved in activation of phosphatidylinositol-3 kinase and cell proliferation✽
Volkan Dayanir§, Rosana D. Meyer, Kameran Lashkari‡, and Nader Rahimi¶ Boston University, School of Medicine, Departments of Ophthalmology and Biochemistry, 715 Albany St. Boston, MA 02118 and ‡Schepens Eye Research Institute, Department of Ophthalmology, Harvard Medical School, Boston, MA 02114 ¶Corresponding author: Nader Rahimi Boston University, School of Medicine Departments of Ophthalmology and Biochemistry 715 Albany St. Room L921, Boston, MA 02118 Tel: 617-638-5011 Fax: 617-638-5337 E.mail: [email protected] Running title: VEGFR-2 activates PI-3 kinase ✽ This work was supported in part by departmental grants from Research To Prevent Blindness, Inc, the Massachusetts Lions Eye Research Fund Inc and American Cancer Society, Massachusetts Division, Inc (NR). §Funded by TUBITAK (the Scientific and Technical Research Council of Turkey) NATO Science Scholarship and Turkish Education Foundation Scholarship Programs.
Copyright 2001 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on March 8, 2001 as Manuscript M009128200 by guest on M
arch 30, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/2.jpg)
2
Abstract: Activation of vascular endothelial growth factor receptor-2 (VEGFR-2)
plays a critical role in vasculogenesis and angiogenesis. However, the
mechanism by which VEGFR-2 activation elicits these cellular events is not
fully understood. We recently constructed a chimeric receptor containing the
extracellular domain of human CSF-1R/c-fms, fused with the entire
transmembrane and cytoplasmic domains of murine VEGFR-2 (Rahimi et al.,
JBC 275: 16986-16992, 2000). In this study we used VEGFR-2 chimera
(herein named CKR) to elucidate the signal transduction relay of VEGFR-2 in
porcine aortic endothelial (PAE) cells. Mutation of tyrosines 799 and 1173
individually on CKR resulted in partial loss of CKR’s ability to stimulate cell
growth. Double mutation of these sites caused total loss of CKR’s ability to
stimulate cell growth. Interestingly, mutation of these sites had no effect on the
ability of CKR to stimulate cell migration. Further analysis revealed that
tyrosines 799 and 1173 are docking sites for p85 of PI-3 kinase. Pre-treatment
of cells with wortmannin, an inhibitor of PI-3 kinase, and rapamycin, a potent
inhibitor of S6 kinase, abrogated CKR-mediated cell growth. However,
expression of a dominant negative form of ras (N17ras) and inhibition of the
MAP kinase pathway by PD98059 did not attenuate CKR stimulated cell
growth. Altogether, these results demonstrate that activation of VEGFR-2
results in activation of PI-3 kinase and that activation of PI-3 kinase/S6kinase
pathway, but not Ras/MAPK is responsible for VEGFR-2 mediated cell growth.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/3.jpg)
3
Introduction Vascular endothelial growth factor receptor-1 (VEGFR-1/FLT-1) and
VEGFR-2 (FLK-1/KDR) belong to a subfamily of receptor tyrosine kinases
implicated in vasculogenesis and angiogenesis. The important contribution of
VEGFR-2 in vasculogenesis and angiogenesis was initially underscored by the
observation that homozygous knockout mice lacking VEGFR-2 exhibited
severe deficiency in vessel formation (1). Furthermore, introduction of either a
neutralizing antibody against VEGF or the dominant negative form of VEGFR-2
was able to block angiogenesis (2,3). On the other hand, VEGFR-1 activation
alone appears to play a less significant role in these cellular processes (4,5,6).
The mechanism by which VEGFR-2 activation evokes angiogenesis is
not well understood. It is presumed that these events are initiated by binding of
VEGF to VEGFR-2 leading to tyrosine phosphorylation of the dimerized
VEGFR-2 and subsequent phosphorylation of SH2-containing intracellular
signaling proteins including phospholipase C-γ1 (PLC-γ1), Src family tyrosine
kinases, and phosphatidylinositol-3 kinase (PI-3 kinase), adaptor molecules,
SHC, NCK and Ras GTPase-activating protein (7-10). The contributions of
individual signaling molecules to various aspects of angiogenesis and the
tyrosine sites on VEGFR-2 that potentially mediate their recruitment and
activation have not been fully investigated. Moreover, the data presented in the
literature is often inconsistent. Waltenberger et al., (1994), Abedi and Zachary
(1997) and Takahashi et al., (1997) have suggested that stimulation of
endothelial cells with VEGF results in no PI-3 kinase activation (7,8,11), while
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/4.jpg)
4
others have shown that VEGFR-2 activation does indeed result in PI-3 kinase
stimulation, which may stimulate endothelial cell growth and survival (12,13).
The reason for the apparent inconsistency in the activation and
association of signaling molecules with VEGFR-2 is not known. It may be due
to the complexity of VEGFR-2 mediated signal transduction relay in endothelial
cells such as expression of VEGFR-1 and neuropilin-1 and 2 which may modify
or antagonize VEGFR-2 mediated signal transduction and its final biological
responses (5,14,15). To circumvent these issues, we have recently constructed
a chimeric receptor containing the extracellular domain of human CSF-1R/c-
fms, fused with the transmembrane and the cytoplasmic domains of murine
VEGFR-2. (5). This model permitted us to dissect the functions of VEGFR-2 in
endothelial cells by selectively stimulating the receptor with CSF-1. In this study
we used this chimeric receptor to elucidate the signal transduction relay
induced by VEGFR-2 in PAE cells. We show that mutation of tyrosine sites 799
and 1173 individually on CKR result in partial loss of CKR’s ability to stimulate
cell growth, while double mutation of these tyrosine sites result in complete
loss of CKR ability to stimulate endothelial cell growth. Mutation of these sites
however had no effect on CKR’s ability to stimulate cell migration. Further
analysis showed that tyrosines 799 and 1173 are binding sites for p85 of PI-3
kinase and that activation of PI-3 kinase is responsible for CKR-mediated
endothelial cell growth.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/5.jpg)
5
Materials and Methods
Reagents and Antibodies: Mouse anti-phosphotyrosine (PY-20), anti-PLC-γ,
anti-mouse and anti-rabbit secondary antibodies were purchased from
Transduction Laboratories (Lexington, KY). Rabbit anti-MAPK, anti-phospho-
MAPK, anti-phospho-S6 kinase and anti-phospho-AKT antibodies were
purchased from New England BioLabs (Boston, MA). Pan anti-Ras antibody was
purchased from Oncogene Science (Boston, MA). Rabbit anti-phospho-PLC-γ
antibody was purchased from Biosource (Camarillo, CA). Rabbit anti-VEGFR-2
antibody was made to amino acids corresponding to kinase insert of VEGFR-2.
Wortmannin and rapamycin were purchased from Sigma (St. Louis, MO).
PD98059 was purchased from Calbiochem (San Diego, CA). GST-SH2 fusion
proteins of p85 were purchased from UBI (Lake Placid, NY).
Cell lines: Porcine aortic endothelial (PAE) cells expressing chimeric CKR and
three mutants; CKR/F799, CKR/F1173 and CKR/F2 were established by a
retroviral system as described previously (5). Briefly, cDNA encoding for CKR,
CKR/F799, CKR/F1173 and CKR/F2 were cloned into retroviral vector, pLNCX2
and transfected into 293GPG cells. Viral supernatants were collected for 7 days,
concentrated by centrifugation and used as previously described (16).
Site-directed mutagenesis: The VEGFR-2 chimera (CKR) was used as a
template to construct the mutations. CKR was subcloned into pGEMT cloning
vector, and site-directed mutagenesis was carried out by using the Stratagene
site-directed mutagenesis kit. Site-directed mutagenesis primers for replacement
of tyrosines 799 and 1173 to phenylalanine were
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/6.jpg)
6
CTGAAGACAGGCTTCTTGTCTATTGTC and CCGGATTTCGTTCGAAAAGG,
respectively. The resultant mutations were verified by sequencing and were
subsequently cloned into pLNCX2 vector by NotI and SalI sites.
Immunoprecipitation and Western Blotting: PAE cells expressing CKR and
CKR mutants were grown in semi-confluent culture condition in DMEM
containing 10% fetal bovine serum (FBS) supplemented with glutamate, penicillin
and streptomycin, and serum-starved overnight in DMEM. Cells were left either
resting or stimulated with 20 ng/ml CSF-1 for 10 min., at 37OC. Cells were
washed twice with H/S buffer (25mM HEPES, pH 7.4, 150mM NaCl, 2mM
Na3VO4) and lysed in lysis (EB) buffer (10mM Tris-HCl, 10% glycerol, pH 7.4,
5mM EDTA, 50mM NaCl, 50mM NaF, 1% Triton X-100, 1mM
phenylmethylsulfonyl fluoride, 2mM Na3VO4, and 20(µg/ml aprotinin). Proteins
were immunoprecipitated by using appropriate antibodies. Immunocomplexes
were bound to protein A Sepharose, and washed three times with 1.0 ml of EB.
Immunoprecipitates were resolved on a SDS-PAGE gel, and the proteins were
transferred to Immobilon membrane. For Western blot analysis, the membranes
were incubated for 60 minute in Block solution containing 10mM Tris-HCl, pH
7.5, 150mM NaCl, 10mg/ml BSA, 0.05% Tween 20. Membranes then were
incubated in Primary antibodies diluted in Block for another 60 minute.
Membrane was washed three times in Western rinse, incubated with HRP-
secondary antibody, washed and developed with ECL (NEN). Finally,
membranes were stripped by incubating them in a stripping buffer containing
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/7.jpg)
7
6.25 mM Tris-HCl, pH 6.8, 2% SDS, and 100 mM β-mercaptoethanol, at 50 oC
for 30 min., washed in Western rinse and reprobed with antibody of interest.
PI3-kinase assay: PI-3 kinase activity was measured in immunoprecipitates
using anti-phosphotyrosine antibody (PY20), as previously described (17).
Briefly, immunoprecipitates were washed twice with 25 mM Hepes buffer pH 7.4
containing 1% NP-40, two times with 100 mM Tris-HCl, pH 7.4, 500 mM LiCl and
100 mM Na3VO4 and twice with 10 mM Tris-HCl, pH 7.4, 100 mM NaCl, 1 mM
EDTA and 100 mM Na3VO4. Finally, immunoprecipitates were resuspended in a
final volume of 10 µl of assay buffer containing a mixture of phosphatidylinositol
at a final concentration of 0.2 mg/ml, 0.88 mM ATP and 10 µCi [γ-32P]ATP. After
15 minutes of incubation at 30°C, the reaction was stopped by adding 20 µl of 6
N HCl and lipids were extracted by adding 160 µl of CH3OH: CHCl3 (1:1). The
phospholipids in the organic phase were recovered and spotted onto Silica Gel
TLC plate (Merk) pre-coated with 1% Na-tartarate. Migration was performed in
CH3OH:CHCl3:H2O:25% NH4OH, (45:35:7:3). The TLC plate was dried and
autoradiographed.
Cell Proliferation: Proliferation assay was performed as described before (18).
Briefly, cells were plated at 2X104 cells/ml in 24-well plates containing DMEM
supplemented with 10% FBS, and incubated at 37 OC for 12h. Cells were then
washed once with PBS and serum-starved with DMEM containing 0.1% BSA for
30h. Cells were then given various concentrations of CSF-1 either immediately or
after pretreatment with various concentrations of PD98059 or Wortmannin as
indicated in the text. At the last 4h of incubation, cells were pulsed with [3H]
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/8.jpg)
8
thymidine (0.2 µCi/ml) and harvested. Results for each group were collected
from four samples. Each experiment was repeated three times and essentially
the same results were obtained. The data are presented as fold increase over
control.
Migration Assay: Migration of PAE cells expressing CKR and CKR mutants was
assessed using the Boyden chamber (Neuro Probe, Gaithersburg, MD). CSF-1
was diluted in DMEM to a concentration of 5 ng/ml and placed in the bottom
wells of the chamber. Polycarbonate filters with 8µm pore size (Osmonics Inc,
Westboro, MA) were pre-incubated in 4ml of 0.02N acetic acid containing 400 µl
of 3.1 ng/ml, type I collagen (Collagen Biomaterials, Palo Alto, CA) for 30min.
Membranes were flipped several times during incubation, washed twice with
PBS, air dried, and placed between the upper and lower chambers of the
Boyden chamber. Semi-confluent cells were trypsinized and re-suspended in
DMEM to make a concentration of 1.5X106 cells/ml and 50 µl of this suspension
was loaded into each upper well. Chambers were incubated at 37 oC for 8 hours.
After incubation the membranes were removed, and fixed and stained with Quick
Diff (Dade International, Miami, FL), washed with water, and mounted on 75X50
mm glass slides (Fisher Scientific, Pittsburgh, PA) bottom side down. The top
cell layer was wiped off with a cotton-tipped applicator leaving only cells that had
crossed through the membrane. Representative areas were counted at 20X
magnification. Twelve wells were used for a given concentration of test
substance in each independent experiment. The experiment was repeated three
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/9.jpg)
9
times and essentially the same results were obtained. The data are presented as
mean of cells ± standard deviation.
Results: Construction and expression of the tyrosine mutant VEGFR-2 chimeras: To elucidate the signal transduction relay induced by VEGFR-2 in
endothelial cells, we mutated tyrosines (Y) 799 and 1173 on the chimeric
VEGFR-2 (CKR), either individually or together by replacing them with
phenylalanine (F). These mutants were termed CKR/F799, CKR/F1173 and
CKR/F2. Tyrosines 799 and 1173 are located in the juxtamembrane and C-
terminus of CKR, respectively (Figure 1A). CKR and tyrosine mutant CKRs
were expressed in PAE cells using a retroviral system. To avoid clonal
variations, all experiments were performed on pooled G418-resistant clones
rather than on isolated clones.
PAE cells expressing either empty vector (pLNCX2), CKR, CKR/799,
CKR/F1173 and CKR/F2 were lysed and equal amounts of protein of total cell
lysates were subjected to Western blot analysis by using anti-VEGFR-2
antibody. Figure 1B shows that all the mutant receptors are expressed at
relatively comparable levels. Expression of CKR in PAE cells is relatively
similar to the expression of VEGFR-2 in primary adrenal microvascular
endothelial (ACE) cells (39). To ensure that all the G418-resistant cells are
indeed are positive for CKRs, we also subjected PAE cells expressing CKR
and tyrosine mutant CKRs to immunohistochemical analysis by using anti-
VEGFR-2 antibody. The result showed that all the G418-resistant cells are
expressing CKR (data not shown). Next, we investigated the tyrosine
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/10.jpg)
10
phosphorylation of mutant receptors in response to CSF-1 stimulation. Serum-
starved PAE cells expressing CKR and various mutant receptors were
stimulated with CSF-1 (20 ng/ml) for 10 min, lysed and immunoprecipitated
with anti-VEGFR-2 antibody. The immunoprecipitated proteins were subjected
to anti-phosphotyrosine (pY) Western blot analysis. Figure 1C shows that CKR
and as well as all mutant receptors were tyrosine phosphorylated in a CSF-1
dependent manner, suggesting that mutant CKRs were active and that
replacement of tyrosines 799 and 1173 to phenylalanine in CKR did not
prevent it from responding to CSF-1 stimulation.
Tyrosines 799 and 1173 of CKR are required for CKR-mediated cell growth
but not cell migration.
To determine whether tyrosines 799 and 1173 are required for CKR
mediated biological responses in the endothelial cells, we subjected PAE cells
expressing CKR and mutant CKRs to DNA synthesis and migration assays. As
Figure 2A shows, stimulation of PAE cells expressing CKR with CSF-1 induced
their growth in a dose-dependent manner. The CSF-1 response in cells
expressing CKR/F799 and CKR/F1173 was partially reduced, specifically in PAE
cells expressing CKR/F799. Notably, CSF-1 response in cells expressing
CKR/F2 was significantly reduced and treatment of cells with higher
concentrations of CSF-1 also did not augment their growth stimulation. Also,
ability of tyrosine mutant CKRs to stimulate cell growth, were measured by
proliferation assays other than [3H] thymidine incorporation by using BrdU-ELISA
or counting of cells under microscope by using trypan blue exclusion approach.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/11.jpg)
11
Basically, similar results were obtained by using these assays (Data not shown).
These results suggest that tyrosines 799 and 1173 both are required for CKR-
mediated cell growth. Surprisingly, CSF-1 stimulation of cells expressing mutant
CKRs caused profound morphological changes consistent with their
differentiation. This effect of CSF-1 was much more robust at higher
concentrations of CSF-1, suggesting that tyrosines 799 and 1173 may suppress
differentiation by either promoting cell proliferation or by other undetermined
mechanisms (Dayanir et al., unpublished data).
Because VEGFR-2 activity is associated with endothelial cell migration
(7), we also examined whether tyrosines 799 and 1173 on CKR was required for
CKR-mediated cell migration. To this end, PAE cells expressing CKR and mutant
CKRs were subjected to migration assay. The result showed that CSF-1
stimulation of PAE cells expressing CKR and mutant CKRs resulted in a
significant motility response. As Figure 2B shows stimulation of PAE cells
expressing CKR/F799, CKR/F1173 and CKR/F2 with CSF-1 resulted in similar
migration responses. Thus, tyrosines 799 and 1173 on VEGFR-2 seem to be
more involved in recruitment and activation signaling molecules concerned with
cell proliferation than cell migration in PAE cells.
Tyrosines 799 and 1173 of CKR are required for activation of PI-3 kinase
but not PLCγ1.
To test whether PI-3 kinase is activated by CKR and whether tyrosines
799 and 1173 are contributing to its recruitment by VEGFR-2, we first subjected
PAE cells expressing CKR and mutant CKRs to an in vitro PI-3 kinase assay.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/12.jpg)
12
Stimulation of PAE cells expressing CKR with CSF-1 resulted in strong activation
of PI-3 kinase, as judged by PI3P Production. However, PI3P production by
CKR/799 and CKR/F1173 was significantly lower than by CKR. CKR/F2 was
unable to stimulate PI3P production above baseline (Figure 3A).
It is conceivable that the CKR-mediated PI-3 kinase activation is
established by direct interaction between p85 of PI-3 kinase and CKR. To test
this possibility, serum-starved PAE cells expressing CKR, CKR/F799,
CKR/F1173 and CKR/F2 were stimulated with CSF-1, and cell lysates were
immunoprecipitated with anti-VEGFR-2 antibody. Protein precipitates were
electrophoresed and subjected to Western blotting using anti-p85 antibody. As
shown in Figure 3B, p85 was recovered from anti-VEGFR-2 immunoprecipitates
of cell lysates derived from cells expressing CKR but not from those of
CKR/F799, CKR/F1173 and CKR/F2. A long exposure of the blot showed trace
evidence of p85 in CKR/F799 and CKR/F1173 but not in CKR/F2 (data not
shown), suggesting that binding of p85 to CKR is not strong and both tyrosines
799 and 1173 may be acting as low affinity binding sites for p85. The inability to
detect p85 in cells expressing CKR/F799, CKR/F1173 and CKR/F2 was not
simply due to the absence of CKR itself, since CKR protein was detected equally
in each group (Figure 3C).
Previously it has been demonstrated that the SH2 domains of p85 are
required for complex formation between p85 and other tyrosine phosphorylated
proteins (19). To test the ability of the p85 SH2 domains to bind CKR, cell lysates
derived from PAE cells expressing CKR were examined for their capacity to bind
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/13.jpg)
13
a GST-(N terminus) SH2 and GST-(C terminus) SH2. The complexed proteins
were eluted, and CKR was detected by immunobloting with an anti-VEGFR-2
antibody. In a lysate of CSF-1 stimulated CKR/PAE cells, both GST-SH2-NH2
and GST-SH2-COOH of p85 formed stable complexes with CKR but not in non-
stimulated cells. In contrast, incubation of the protein extracts with GST alone did
result in any binding to CKR (Figure 3D). These data show that p85 binds to
CKR in vivo and in vitro and that tyrosines 799 and 1173 play a role in this
association. p85 binding occurred via both SH2 domains of p85, although C-
terminus SH2 domain exhibited stronger binding to CKR than N-terminus in a
pull down experiment (Figure 3D). To analysis role of PI 3-kinase pathway in this
system we evaluated phosphorylation of Akt, a known downstream target of PI 3-
kinase. For this intention, serum-starved cells were stimulated with CSF-1 and
total cell lysates were subjected to an anti-phospho-Akt Western blot analysis.
The result showed that stimulation of cells expressing CKR results in activation
of Akt in a time dependent manner (Figure 3E). Collectively, these results
suggest that stimulation of VEGFR-2 results in PI-3 kinase activation and that
tyrosines 799 and 1173 of VEGFR-2 are responsible for its association with p85
and activation of p110 of PI-3 kinase.
To further characterize activation of signaling molecules by VEGFR-2, we
measured PLCγ1 activation. For this purpose, serum-starved cells were
stimulated with CSF-1 and cell lysates were either immunoprecipitated with an
anti-PLC-γ antibody and then subjected to anti-phosphotyrosine Western blot
analysis, or total cell lysates were subjected to an anti-phospho-PLC-γ Western
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/14.jpg)
14
blot analysis. The results showed that CKR and the mutant CKRs were able to
stimulate tyrosine phosphorylation of PLC-γ and no appreciable decrease in
tyrosine phosphorylation of PLC-γ was observed among CKR/F799, CKR/F1173
or CKR/F2 in two different assays (Figure 4A and 4C). These results suggest
that tyrosines 799 and 1173 are not required for activation of PLC-γ and most
likely other tyrosine sites on VEGFR-2 may act as a docking sites for this
molecule. Therefore, it appears that mutations of tyrosines 799 and 1173 on
VEGFR-2 do not impair the ability of this receptor to activate PLC-γ, suggesting
that these sites preferentially serve as binding sites for p85 of PI-3 kinase.
PI-3 kinase/S6 kinase activation is required for CKR-mediated Cell growth.
To evaluate the importance of PI-3 kinase further in CKR-mediated cell
growth, we used an additional approach by using wortmannin, a specific inhibitor
of PI-3 kinase (20). To this end, PAE cells expressing CKR, were pre-treated
with different concentrations of wortmannin, stimulated with CSF-1 and cells
subjected to a proliferation assay. Figure 5A shows that pretreatment of cells
with wortmannin effectively inhibits CSF-1 stimulated cell growth in a dose
dependent manner. This result combined with the site-directed mutagenesis data
(Figure 2A) strongly suggests that PI-3 kinase activation play a key role in
VEGFR-2 stimulated endothelial cell proliferation.
To further identify and define the involvement of PI-3 kinase-regulated
pathways in this system in particular, endothelial cell proliferation, we
investigated the role of p70 S6 kinase, a downstream target of PI-3 kinase. For
this reason, serum-starved PAE cells expressing CKR and tyrosine mutant CKRs
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/15.jpg)
15
were stimulated with CSF-1 and total cell lysates were subjected to an anti-
phospho-S6 kinase Western blot analysis. The results showed that CKR is able
to stimulate phosphorylation of S6 kinase in a CSF-1 dependent manner.
CKR/F799 and CKR/F1173 were partially able to stimulate S6 kinase activation,
whereas CKR/F2 complelty failed to stimulate S6 kinase phosphorylation in the
same assay condition (Figure 5B). To establish whether S6 kinase activity is
required for CKR-mediated PAE cell proliferation, serum-starved CKR/PAE cells
were pretreated with rapamycin, an inhibitor of RAFT1 and as a consequence
downstream target of p70 S6 kinase (21). The result showed that rapamycin
effectively blocks CKR stimulated PAE cell growth (Figure 5C), suggesting that
PI-3 kinase/S6 kinase pathway is responsible for VEGFR-2 mediated endothelial
cell growth. Notably, treatment of PAE cells with rapamycin without CSF-1
stimulation also partly reduced basal growth of PAE cells, suggesting that S6
kinase activity is required for normal growth of PAE cells. This effect of
rapamycin does not appear due to high concentration of rapamycin, since at 10-
50 ng/ml it inhibited phosphorylation of S6 kinase approximately by 60 to 90%,
respectively (data not shown). As it is true for most of pharmacological agents,
rapamycin may also effect activation of signaling molecules other than S6 kinase
that might be involved in growth of PAE cells.
Activation Ras/MAPK pathway is not required for CKR-mediated cell
growth
Next we tested the capability of these mutant receptors to stimulate MAPK
activation. For this purpose, PAE cells expressing CKR and mutant CKRs were
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/16.jpg)
16
serum-starved, stimulated with CSF-1, lysed and equal amount of proteins of
total cell lysates were subjected to Western blot analysis using anti-phospho-
MAPK antibody. The result shows that mutant CKRs are able to stimulate MAPK
with equal ability as compared to wild type CKR (Figure 6A). In addition,
phosphorylation of MAPK by mutant CKRs was not effected at least up to 30
minutes of stimulation with CSF-1 (data not shown).
To test whether MAPK activation plays a role in CKR-mediated cell growth, we
subjected PAE cells expressing CKR to proliferation assay in which cells were
pre-treated with PD98059, a potent and selective inhibitor of MAP kinase
inhibitor (22). As Figure 6C shows, PD98059 treatment of PAE cells expressing
CKR did not inhibit CKR mediated cell proliferation. Collectively, these data
suggest that although CKR activation results in robust MAPK activation, its
activity may not be required for CKR-mediated cell growth in PAE cells. To
assure that PD98059 at the concentration used in proliferation assay indeed is
inhibiting MAP kinase activation, we measured MAP kinase phosphorylation. As
Figure 6D shows pre-treatment of cells with PD98059 (50 µM) effectively
inhibited MAP kinase phosphorylation. Since, MAPK activation is mainly
mediated by Ras finally we assessed its role in this process. For this purpose, we
transiently over-expressed N17ras in CKR/PAE cells by a retrovirus system and
subjected them to proliferation assay. The result showed that expression of
dominant negative form of ras (N17 ras) only had a minor effect on the CSF-1
stimulated cell growth (Figure 7A). Figure 7B shows expression of N17 ras in
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/17.jpg)
17
CKR/PAE cells. All together, these results suggest that activation of Ras/MAPK
pathway is not required for VEGFR-2 mediated PAE cell proliferation.
Discussion
Our study demonstrates that mutation of tyrosines 799 and 1173 on
VEGFR-2 abolishes binding of P85 of PI-3 kinase to CKR without impairing
CKR’s ability to activate PLC-γ and Ras/MAPK pathways. A single mutation of
799 and 1173 on CKR partially inhibited PI-3 kinase activation and cell
proliferation. Additionally, double mutation of tyrosines 799 and 1173 totally
abolished CKR’s ability to stimulate PI-3 kinase activation and endothelial cell
growth but not cell migration. These results suggest that distinct signaling
pathways are activated by VEGFR-2 and are responsible for the induction of
endothelial cell growth and likely for VEGF-induced angiogenesis. Consistent
with mutant CKRs, pre-treatment of cells with wortmannin, a potent inhibitor of
PI-3 kinase blocked CKR’s ability to stimulate cell growth. Activation of PI-3
kinase results in PIP3 production, which can activate Protein kinase C-ς (23),
AKT (24) and stimulation of p70 S6 kinase (25). Our results show that
rapamycin, a potent inhibitor of S6 kinase pathway (21), abrogates CKR
mediated cell growth, suggesting that PI-3 kinase/S6kinase pathway is
responsible for CKR mediated cell growth. Interestingly, it appears that activation
of PLCγ and Ras/MAPK pathways are not involved in VEGFR-2 stimulated
growth of PAE cells. Nonetheless activation of these enzymes by CKR strongly
suggest that these molecules are likely to participate in the other VEGF-induced
cellular processes such as cell migration and cell differentiation.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/18.jpg)
18
A number of groups have investigated the role PLCγ1 in VEGF-dependent
signal relay. The initial observations suggested that PLCγ activation is increased
in a VEGF stimulated cells (8,9,26). Subsequent study showed that tyrosine 951
on the human VEGFR-2 is a major binding site for PLCγ1 (27). In agreement with
this study our results demonstrate that tyrosines 799 and 1173 of mouse
VEGFR-2 are not required for PLCγ1 activation and likely tyrosine 951 is the
primary binding site for PLCγ1. In addition, our results demonstrate that although
PLCγ1 is activated by VEGFR-2, its activation is not required for VEGF-mediated
endothelial cell growth. Activation of PLCγ1 has been shown to stimulate cell
growth and migration in variety of cellular systems, however its role in VEGFR-2
mediated signal transduction and endothelial cell function is largely unknown.
Recently, it has been suggested that inhibition of PLCγ1 by pharmacological
mean blocks VEGF-stimulated sinusoidal endothelial cell growth (28). Since
sinusoidal cells express both VEGFR-1 and VEGFR-2, it is difficult to judge the
contributions of each receptor to the observed PLCγ1 activation.
Thus, it seems that tyrosines 799 and 1173 are novel p85 docking sites
for p85 of PI 3-kinase, although they may represent a low affinity binding sites for
P85. Amino acids residues surrounding tyrosine 799 (YLSIVM) and 1173
(YIVLPM) of VEGFR-2 do not correspond to conventional (Y-M/V/I/E-X-M) p85
binding sites (29,30). While, it is generally believed that SH2 domains of p85
preferentially bind to receptor tyrosine kinases through this motif, other binding
sites for p85 of PI -3 kinase have been described. For instance, p85 binding to
hepatocyte growth factor receptor family including c-Met, c-Ron and c-Sea is
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/19.jpg)
19
mediated by the YVHV (31,32). Similarly, it has been demonstrated that amino
acids YVNA on VEGFR-1 is binding site for p85 (33).
Until now, little evidence existed for the involvement of PI-3 kinase in
VEGFR-2 mediated signal transduction and angiogenesis. The possibility that PI-
3 kinase may be involved could be inferred only from very indirect evidence.
Initial studies about the activation of PI-3 kinase by VEGFR-2 suggested that PI-
3 kinase is not activated by VEGFR-2 stimulation (7,8,11). However, subsequent
studies suggested that VEGF stimulation of endothelial cells results in activation
of PI-3 kinase and its activation may promote endothelial cell survival (12,13).
Furthermore, recently it has been shown that viral oncogenic PI-3 kinase
stimulates angiogenesis in the CAM assay by stimulating VEGF expression (34).
During angiogenesis VEGF induces endothelial cell migration, growth and
differentiation in a coordinated manner. Our current study suggests that specific
activation of VEGFR-2 in endothelial cells activates a number signaling
molecules including, PI-3 kinase, Akt, PLCγ1 and MAPK. Altogether, this
suggests that during angiogenesis stimulation of PI-3 kinase/S6 kinase pathway
by VEGFR-2 may influence endothelial cell growth and likely endothelial cell
survival leading to formation of new blood vessels. Previous studies have
suggested that activation of PI-3 kinase/S6 kinase pathway is essential for serum
and FGF-stimulated endothelial cell growth (35,36), implying that activation of PI-
3 kinase by a variety of factors in the endothelial cells serves as a molecular
switch to control cell proliferation.
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/20.jpg)
20
Regulation of angiogenesis is the most critical step in the development of
tumors, ocular neovascularization and in inflammation (37,38). The results
presented in this work identify tyrosine residues of VEGFR-2 responsible for
recruiting and activation of PI-3 kinase and its role as a regulator of endothelial
cell growth. These findings are important to the understanding of the role
different signaling molecules to different aspects of angiogenesis. Further
studies will delineate the contributions of other signaling molecules to different
cellular processes involved during angiogenesis.
Acknowledgment: We thank Cyrus Vaziri (Cancer Research Center,
Boston University) for providing N17 ras construct. Rosana D Meyer is Medical
Fellow from Schepens Eye research Institute.
References:
1. Shalaby, F., Rossant, J., Yamaguchi, T. P., Gertsentein, M., Fu Wu, X.,
Breitman, M.L., and Schuh, A.C. (1995) Nature, 376, 62-66.
2. Millauer B, Shawver LK, Plate KH, Risau W, Ullrich A. (1994) Nature
367,576-579.
3. Kim KJ, Li B, Winer J, Armanini M, Gillett N, Phillips HS, Ferrara N. (1993)
Nature 362, 841-844
4. Fong GH, Zhang L, Bryce DM, Peng J. (1999) Development 126, 3015-
3025
5. Rahimi N, Dayanir V, Lashkari K. (2000) J Biol Chem. 275,16986-16992.
6. Hiratsuka S, Minowa O, Kuno J, Noda T, Shibuya M. (1998) Proc Natl Acad
Sci U S A. 95, 9349-9354
7. . Waltenberger, J., Calaesson-Welsh, L., Siegbahn, A., Shibuya, M., and
Heldin, C-H. (1994) J. Biol. chem, 269: 26988-26995
8. Takahashi T, Shibuya M. (1997) Oncogene 4, 2079-2089
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/21.jpg)
21
9. Igarashi K, Isohara T, Kato T, Shigeta K, Yamano T, Uno I. (1998)
Biochem Biophys Res Commun. 246, 95-99
10. Guo D, Jia Q, Song HY, Warren RS, Donner DB. (1995) J Biol Chem. 270,
6729-6733
11. Abedi H, Zachary I. (1997) J Biol Chem. 272, 15442-15451
12. Thakker GD, Hajjar DP, Muller WA, Rosengart TK. (1999) J Biol Chem.
274, 10002-10007.
13. Gerber HP, McMurtrey A, Kowalski J, Yan M, Keyt BA, Dixit V, Ferrara N.
(1998) J Biol Chem. 273, 30336-30343.
14. Soker S, Takashima S, Miao HQ, Neufeld G, Klagsbrun M. Cell (1998) 92,
735-745.
15. Kendall RL, Wang G, Thomas KA. (1996) Biochem Biophys Res Commun.
226, 324-328
16. Ory DS, Neugeboren BA, Mulligan RC. (1996) Proc Natl Acad Sci U S A.
93:11400-11406
17. Rahimi N, Tremblay E, Elliott B. (1996) Biol Chem 271, 24850-24855
18. Rahimi N, Hung W, Tremblay E, Saulnier R, Elliott B. (1998) Biol Chem
273, 33714-33721
19. Sonyang, Z., Shoelson, S.E., Chaudhuri, M., Gish, G., Pasown, T., Roberts,
T., et al., (1993) Cell 72: 767-778
20. Yano H, Nakanishi S, Kimura K, Hanai N, Saitoh Y, Fukui Y, Nonomura Y,
Matsuda Y. (1993) J Biol Chem. 268, 25846-25856.
21. Lane HA, Fernandez A, Lamb NJ, Thomas G. (1993) Nature 363,170-1702
22. Alessi DR, Cuenda A, Cohen P, Dudley DT, Saltiel AR. (1995) J Biol Chem.
270, 27489-27494
23. Chou MM, Hou W, Johnson J, Graham LK, Lee MH, Chen CS, Newton AC,
Schaffhausen BS, Toker A. (1998) Curr Biol. 8,1069-1077
24. Stokoe D, Stephens LR, Copeland T, Gaffney PR, Reese CB, Painter GF,
Holmes AB, McCormick F, Hawkins PT. (1997) Science. 277, 567-570
25. Romanelli A, Martin KA, Toker A, Blenis J. (1999) Mol Cell Biol. 19, 2921-
2928
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/22.jpg)
22
26. Cunningham SA, Arrate MP, Brock TA, Waxham MN. (1997) Biochem
Biophys Res Commun. 240,635-639
27. Wu LW, Mayo LD, Dunbar JD, Kessler KM, Baerwald MR, Jaffe EA, Wang
D, Warren RS, Donner DB. (2000) J Biol Chem. 275, 5096-50103
28. Takahashi T, Ueno H, Shibuya M. (1999) Oncogene 18, 2221-2230
29. Rameh LE, Chen CS, Cantley LC. (1995) Cell 83, 821-830
30. Carpenter CL, Cantley LC. (1996) Biochim Biophys Acta. 1288, M11-16
Derman MP, Chen JY, Spokes KC, Songyang Z, Cantley LG. (1996) J Biol
Chem. 271, 4251-4255
31. Ponzetto C, Bardelli A, Zhen Z, Maina F, dalla Zonca P, Giordano S,
Graziani A, Panayotou G, Comoglio PM. (1994) Cell 77, 261-271
32. Cunningham SA, Waxham MN, Arrate PM, Brock TA. (1995) J Biol Chem.
270, 20254-20257.
33. Jiang BH, Zheng JZ, Aoki M, Vogt PK. (2000) Proc Natl Acad Sci U S A. 97,
1749-1753
34. Vinals F, Chambard JC, Pouyssegur J. (1999) J Biol Chem. 274, 26776-
26782
35. Kanda S, Hodgkin MN, Woodfield RJ, Wakelam MJ, Thomas G, Claesson-
Welsh L. (1997) J Biol Chem. 272, 23347-23353
36. Risau, W., (1997) Nature, 386: 671-674
37. Folkman, J., and D’Amore, P. (1996) Cell 87,1153-1155
38. Rahimi, N and Kazlauskas A. (1999) Molecular Biology of the Cell 10, 3401-
3407
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 23: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/23.jpg)
23
Figure 1. Schematic representation of the construction of the tyrosine
mutant chimera VEGFR-2, their expression and activation in PAE cells.
The tyrosine (Y) residues and amino acids surrounding 799 and 1173 and
replacement of these sites individually or together to phenylalanine (F) are
shown. CKR/F2 is corresponds to double mutations of 799 and 1173 (A). Semi
confluent PAE cells expressing pLNCX2, CKR, CKR/F799, CKR/F1173, and
CKR/F2 were lysed and blotted with anti-VEGFR-2 antibody (B). Serum-
starved semi confluent PAE cells expressing CKR and tyrosine mutant CKRs
were either non-stimulated or stimulated with 20ng/ml CSF-1, lysed and
immunoprecipitated with anti-VEGFR-2 antibody. The immunoprecipitated
proteins were collected, resolved on SDS-PAGE, transferred to Immobilon
membrane, and immunoblotted with anti-pY antibody. The same membrane
was reprobed with anti-VEGFR-2 antibody for protein level (D).
Figure 2.Tyrosines 799 and 1173 are required for VEGFR-2 mediated cell
growth but not cell migration. Serum-starved PAE cells expressing wild type
CKR and tyrosine mutant CKRs were treated with different concentrations of
CSF-1 and DNA synthesis was measured by [3H] thymidine uptake. The results
are expressed as the mean of (cpm/well) ±SD of quadruplicates (A). The data
are expressed as a ratio of stimulated over non-stimulated samples. Same group
of cells were subjected to migration assay by plating the cells in top wells of
Boyden chamber. CSF-1 (5 ng/ml) or DMEM medium was placed in the bottom
chambers and incubated at 37oC for 8 hours. Cells that crossed the membrane
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 24: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/24.jpg)
24
were fixed, stained and one representing field was counted. The results are
expressed as the mean of ±SD of twelve wells per each cell line (B).
Figure 3. Tyrosines 799 and 1173 of VEGFR-2 are required for PI-3 kinase
activation and for its association with p85 of PI-3 kinase. Serum-starved
PAE cells expressing wild type CKR and tyrosine mutant CKRs were treated with
CSF-1, washed, lysed, cell extracts were normalized for protein and
immunoprecipitated with anti-pY antibody. The immunoprecipitates were washed
and subjected to in vitro PI-3kinase assay. The products of the reaction were
analyzed by thin layer chromatography, visualized by autoradiography. The origin
and position of phosphatidylinositol 3-phosphate (PI3P) are indicated (A).
Serum-starved PAE cells expressing wild type CKR and tyrosine mutant CKRs
were treated with CSF-1 for 10 min, washed, lysed, cell extracts were normalized
for protein and immunoprecipitated with anti-VEGFR-2 antibody. The
immunoprecipitates were washed and subjected to western blot using anti-p85
antibody (B). The same membrane was stripped and reprobed with anti-VEGFR-
2 antibody (C). Serum-starved PAE cells expressing wild type CKR and tyrosine
mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, and
incubated with Sepharose bound GST alone, GST-N-SH2-p85, or GST-C-SH2-
p85 fusion proteins. After extensive washing, the precipitated proteins were
subjected to western blot analysis using anti-VEGFR-2 antibody (D). Serum-
starved PAE cells expressing wild type CKR were stimulated with CSF-1 for 5-30
min, washed, lysed, cell extracts were normalized for protein level and subjected
to western blot using anti-phospho-Akt antibody (E).
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 25: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/25.jpg)
25
Figure 4. Tyrosines 799 and 1173 of VEGFR-2 are not required for PLCγ1
activation. Serum-starved PAE cells expressing wild type CKR and tyrosine
mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, cell extracts
were normalized for protein level. Immunoprecipitated with anti-PLCγ1 antibody
and subjected to western blot using anti-pY antibody (A). Total cell lysates were
subjected to western blot using anti-phosphoPLCγ1 antibody (C). The same
membranes were stripped and reprobed with anti-PLCγ1 antibody (B and D).
Figure 5. Wortmannin and rapamycin inhibit CKR-mediated cell
proliferation. Serum-starved PAE cells expressing wild type CKR pre-treated
with different concentrations of wortmannin (A) or rapamycin (C) and stimulated
with 1 ng/ml of CSF-1. DNA synthesis was measured by [3H] thymidine uptake
as described in Figure 2. The results are expressed as the mean of (cpm/well)
±SD of quadruplicates. The data are expressed as a ratio of stimulated over non-
stimulated samples. Serum-starved PAE cells expressing wild type CKR and
tyrosine mutant CKRs were stimulated with CSF-1, washed, lysed, cell extracts
were normalized for protein level and subjected to western blot using anti-
phospho-S6 kinase (p70) antibody (B).
Figure 6. Activation of MAP Kinase is not essential for CKR-mediated
cell proliferation. Serum-starved PAE cells expressing wild type CKR and
tyrosine mutant CKRs were stimulated with CSF-1 for 10 min, washed, lysed, cell
extracts were normalized for protein level and total cell lysates were subjected to
western blot using anti-phospho-MAPK antibody (A). The same membrane was
stripped and re-probed with anti-MAPK antibody (B). Serum-starved PAE cells
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 26: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/26.jpg)
26
expressing wild type CKR were pre-treated with different concentrations of
PD98059, stimulated with 1 ng/ml CSF-1 and DNA synthesis was measured by
[3H] thymidine uptake. The results are expressed as the mean of (cpm/well) ±SD
of quadruplicates (C). The data are expressed as a ratio of stimulated over non-
stimulated samples. Serum-starved PAE cells expressing wild type CKR were
pre-treated with different concentrations of PD98059 or left non-treated for 30
min, stimulated with CSF-1 for 10 min, washed, lysed, cell extracts were
normalized for protein level and total cell lysates were subjected to western blot
using anti-phospho-MAPK antibody (D). The same membrane was stripped and
reprobed with anti-MAPK antibody (E).
Figure 7. Activation of Ras pathway is not necessary for CKR-mediated
cell proliferation: PAE cells expressing wild type CKR were infected with
retrovirus containing N17ras, cells were serum-starved for 24 hours and
stimulated with different concentrations of CSF-1, and DNA synthesis was
measured by [3H] thymidine uptake. The results are expressed as the mean of
(cpm/well) ±SD of quadruplicates (A). The data are expressed as a ratio of
stimulated over non-stimulated samples. PAE cells expressing wild type CKR
were infected with retrovirus containing N17ras, as described in part A, however
cells were lysed and subjected to western blot analysis by using anti-Ras
antibody (B).
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 34: Identification of tyrosine residues in vascular endothelial growth](https://reader034.vdocuments.us/reader034/viewer/2022052607/588dbb2d1a28ab77318b557a/html5/thumbnails/34.jpg)
Volkan Dayanir, Rosana D. Meyer, Kameran Lashkari and Nader Rahimiproliferation
receptor-2/FLK-1 involved in activation of phosphatidylinositol-3 kinase and cell Identification of tyrosine residues in vascular endothelial growth factor
published online March 8, 2001J. Biol. Chem.
10.1074/jbc.M009128200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on March 30, 2018
http://ww
w.jbc.org/
Dow
nloaded from