Hong Kong Baptist University
DOCTORAL THESIS
Redox control of the transcriptional response to oxidative stress byArabidopsis redox-sensitive basic leucine zipper protein 68Li, Yimin
Date of Award:2016
Link to publication
General rightsCopyright and intellectual property rights for the publications made accessible in HKBU Scholars are retained by the authors and/or othercopyright owners. In addition to the restrictions prescribed by the Copyright Ordinance of Hong Kong, all users and readers must alsoobserve the following terms of use:
• Users may download and print one copy of any publication from HKBU Scholars for the purpose of private study or research • Users cannot further distribute the material or use it for any profit-making activity or commercial gain • To share publications in HKBU Scholars with others, users are welcome to freely distribute the permanent URL assigned to thepublication
Download date: 19 Feb, 2022
i
Redox Control of the Transcriptional Response to Oxidative
Stress by Arabidopsis Redox-sensitive BASIC LEUCINE ZIPPER
PROTEIN 68
LI Yimin
A thesis submitted in partial fulfillment of the requirements
for the degree of
Doctor of Philosophy
Principal Supervisor: Prof. XIA Yiji
Hong Kong Baptist University
June 2016
ii
Declaration
I hereby declare that this thesis represents my own work which has been done
after registration for the degree of PhD at Hong Kong Baptist University, and has
not been previously included in a thesis or dissertation submitted to this or any
other institution for a degree, diploma or other qualifications.
Signature: _ _
Date: June 2016
iii
Abstract
Cellular redox states mediate various physiological and developmental processes.
Mechanisms involved in sensing cellular redox state and linking it to an
appropriate physiological response remains poorly understood in plants.
Arabidopsis bZIP68 was previously found to undergo reversible oxidation in its
Cys320 in cells under oxidative stress. In this study, it was found that bZIP68 was
localized in the nucleus in Arabidopsis seedlings under normal conditions. Upon
treatment of oxidative stress, bZIP68 underwent nucleocytoplasmic shuttling and
accumulated in the cytoplasm. This stress-dependent nucleocytoplasmic shuttling
depends on the redox-sensitive Cys320 and its nuclear export signal. bZIP68
suppresses expression of stress response genes under normal conditions and its
loss-of-function mutation of bZIP68 leads to elevated expression of genes
involved in oxidative stress defense including genes encoding for antioxidant
proteins and for enzymes involved in biosynthesis of small molecule antioxidants.
The bzip68 mutant also showed enhanced responses to stress treatment such as the
oxidative stress and cold stress. Our study suggests that bZIP68 directly or
indirectly senses perturbation of cellular redox states and links the redox change
to activation of oxidative stress defense genes through redox regulation of
transcription.
iv
Acknowledgements
In the first place I wish to give my deepest gratitude to my principal supervisor,
Prof. XIA Yiji. I am deeply grateful to him for detailed discussions on my project
and experimental plans. I would never have been able to finish my thesis without
his support. I remember that he used to say something like “there is no easy
experiment that can lead to significant findings without solid training, full
dedication, persistence and patience.” which encouraged me when I was in
difficulty. I hope that one day I would become as good as an advisor to my
students as Prof. Xia has been to me.
I am grateful to Prof. Jiang Liwen and his student Dr. Wang Juan and Dr.
Ding Yu for the help during the time when I did the experiments in CUHK. I
would like to thank Dr. Ng Danny Wang Kit for serving as my co-supervisor.
I am grateful to Dr. Liu Changjun and Prof. Jiang Liwen for serving as
external examiners of the thesis and their suggestion to improve the thesis. I
would also like to thank Prof. Zhao Zhongying, Prof. Ricky M S Wong, Prof.
Chris K C Wong, and Prof. Nai Ki Mak on oral examination board.
I would like to express my sincere gratitude to my colleagues Dr. Liu Pei,
Miss. Zhong Huan and Mr. Zhang Hailei, for their contributions to the production
of my thesis. Their fruitful discussions and friendship help me to finish my thesis.
I am also thankful to the staff in scientific office: Ms. Ng Louise Lai Ha, Mr.
Chung Wai Shing, Mr. Ma Kwok Keung, and Ms. Chau Olivia Ching Wah. Thank
them for their grateful helps and supports.
In the course of my doctoral study, I have had the opportunity to collaborate
with brilliant fellow students, colleagues and friends: Ms Jiang Tiantian, Dr. Wu
Yingying, Dr. Wang Yiping, Dr. Zhang Shoudong, Dr. Yu Boying, Miss Yin Zhao,
Miss Pan Shuying and Dr. Wang Hai. I would like to thank them for their
contributions, valuable discussions and continued collaboration.
Besides, I would like to give my gratitude to my roommate, Dr. Li Yuanxi,
for always supporting and encouraging me during the difficult time. If love makes
v
me grow up, then friendship let me go back to the times when I was a little girl
and days when I had been pursuing the initial dream.
I owe my gratitude to all those people who have made this thesis possible
and because of them my graduate experience has been one that I will cherish
forever.
Most importantly, none of this would have been possible without the love
and patience of my family. Without the supporting of my husband Dr. Zhang Gang,
I could not overcome setbacks and stay focused on my graduate study. He has
always been there cheering me up and stood by me through the good times and
bad. I would also like to thank my parents in-law and I deeply appreciate their
support and encouragement on me. Finally, my deepest heartfelt thanks to my
beloved parents, they make my family be a constant source of love, concern,
support and strength all these years. I will always love them until the end of the
world.
vi
Table of Contents
Chapter 1 General Introduction and the Objective ............................................ 1
1.1 The Concepts of Redox Homostasis and Redox Signaling in Plants ... 1
1.2 Production of ROS and RNS in Plants .................................................. 2
1.3 Antioxidants in scavenging ROS and repairing oxidized biomolecules
3
1.3.1 Characteristics of antioxidants ........................................................... 3
1.3.2 Superoxide dismutases ........................................................................ 4
1.3.3 Catalases ............................................................................................. 5
1.3.4 Ascorbate and Glutathione ................................................................. 5
1.3.5 Others .................................................................................................. 7
1.4 Redox Regulation and Redox signaling in Plants ................................. 8
1.4.1 The term of redox regulation............................................................... 8
1.4.2 Redox regulation during different biological processes ..................... 9
1.5 Redox signaling in environmental stress ................................................ 9
1.5.1 Redox signaling responding to abiotic stress.................................... 10
1.5.2 Oxidative burst in response to biotic stress in plants ....................... 10
1.5.3 Redox–phytohormone interactions ................................................... 11
1.5.4 MAPK cascades in oxidative stress response ................................... 12
1.6 Examples of redox signaling components ............................................ 13
1.6.1 Redox sensor in bacteria and yeast .................................................. 13
1.6.2 Redox sensitive proteins in human .................................................... 14
1.6.3 Redox sensors in plants ..................................................................... 14
1.7 bZIP transcription factors in Arabidopsis ........................................... 15
vii
1.7.1 Overview of the bZIP factor family ................................................... 15
1.7.2 Functions of the Arabidopsis G-group bZIPs ................................... 16
1.7.3 Well known bZIPs in other groups .................................................... 17
1.8 Objective ................................................................................................. 18
Chapter 2 Materials and Methods...................................................................... 19
2.1 Plant Materials and Growth Conditions.............................................. 19
2.2 Transformation of Arabidopsis ............................................................. 19
2.3 Constructs for Subcellular Localization Study of bZIP68-eYFP and
its point mutations and seedling treatment .................................................... 20
2.4 Confocal Microscopy for subcellular localization of eYFP ................ 20
2.5 Phenotypic analysis under stress treatments ....................................... 21
2.6 Genetic complementation of the bzip68 mutant .................................. 21
2.7 GUS reporter assay ................................................................................ 22
2.8 RNA isolation, RNA-seq and quantitative real-time RT-PCR .......... 22
2.9 Accession Numbers ................................................................................ 23
Chapter 3 Results ................................................................................................. 27
3.1 bZIP68 is localized in nuclei under normal conditions ...................... 27
3.2 Nucleocytoplasmic shuttling of bZIP68 is dictated by its
redox-sensitive Cys320 and requires its nuclear export signal..................... 34
3.4 The bzip68 mutant showed an enhanced response to the oxidative
stress treatment ................................................................................................. 66
3.5 The bzip68-1 mutant showed an enhanced stress response under cold
70
Chapter 4 Discussion ........................................................................................... 75
4.1 bZIP68 directly or indirectly senses perturbation of cellular redox
viii
states ................................................................................................................. 75
4.2 bZIP68 links the redox change to activation of oxidative stress
defense genes through redox regulation of transcription ............................. 77
4.3 bZIP68 mediates plant abiotic stress responses .................................. 77
4.4 Conclusion and Working model ........................................................... 78
List of References ................................................................................................. 88
Curriculum Vitae ............................................................................................... 109
ix
List of Tables
Table 2.1 Information of the primers used for genotyping and construction of
various constructs used in this study. ..................................................................... 24
Table 2.2 Information of the primers used for qRT-PCR analysis. ....................... 26
Table 3.1 Gene ontology (GO) categories enriched among the genes expressed at
higher levels in bzip68-1 and bzip68-2 than in wildtype. ...................................... 50
Table 3.2 Differentially expressed genes between wt and the bzip68 mutants that
were shown in the heat map (Fig 3.12). ................................................................. 54
Table 3.3 Examples of antioxidant genes and stress response genes that were
expressed at the higher levels in the bzip68 mutants compared with the WT plants.
............................................................................................................................... 62
Supplementary Table 1 Differentially expressed genes between wt and the bzip68
mutants under H2O2 treatment and the differences in their expression levels
between mock and treated and ROS-treated seedlings. ......................................... 81
x
List of Figures
Figure 3.1 Expression patterns of AtbZIP68 revealed by the GUS reporter assay.
............................................................................................................................... 28
Figure 3.2 bZIP68-eYFP is primarily localized in nuclei of Arabidopsis root cells
under the normal growth condition. ....................................................................... 29
Figure 3.3 bZIP68-eYFP became localized in the cytoplasm under the ROS
treatment. ............................................................................................................... 32
Figure 3.4 eYFP signal in the At5g09240-eYFP transgenic line. ......................... 33
Figure 3.5 bZIP68C320S-eYFP is retained in the nuclei under oxidative stress. . 35
Figure 3.6 bZIP68 is predicted to have a NES signal around AAs 148-162 (A, B).
............................................................................................................................... 37
Figure 3.7 Both bZIP68L157A-eYFP and bZIP68L160A-eYFP were localized in
nuclei under the normal condition, and under the oxidative stress. ....................... 39
Figure 3.8 The L157A&L160A mutation partially hinders bZIP68’s shuttling to
the cytosol under oxidative stress. ......................................................................... 41
Figure 3.9 The LMB treatment partially inhibited the nuclearcytoplasmic
shuttling of bZIP68-eYFP under oxidative stress. ................................................. 43
Figure 3.10 Structural organization of bZIP68 and the bzip68-1 and bzip68-2
mutants and the bZIP68 transcript levels in the wt and mutant plants. ................. 45
Figure 3.11 A heat map of transcriptome profiles of wt and the mutant seedlings
of bzip68-1 and bzip68-2. ...................................................................................... 47
Figure 3.12 The heat maps of expression profiles of the differentially expressed
genes between wt and bzip68-1 and bzip68-2 in the categories of oxidative stress
response (A) and defense response (B). ................................................................. 53
Figure 3.13 qRT-PCR analysis of selective stress-related genes. ......................... 64
Figure 3.14 Venn diagram comparisons of differentially expressed genes. .......... 65
Figure 3.15 The morphology of the bzip68 mutants under the normal conditions.
............................................................................................................................... 67
Figure 3.16 The morphological phenotypes of wt and bzip68-1 seedlings under
xi
oxidative stress. ...................................................................................................... 69
Figure 3.17 The phenotypes of wt and bzip68-1 mutant under cold stress. .......... 73
Figure 4.1 A working model on the molecular mode of action of bZIP68. .......... 79
xii
List of Abbreviations
ABA, abscisic acid;
ADF, adult T cell leukemia–derived factor;
AOX, alternative oxidase;
APX, ascorbate peroxidases;
as-1, activation sequence-1;
AsA, ascorbate;
At, Arabidopsis thaliana;
AtXPO1,Arabidopsis exportin 1;
bZIP, basic region/leucine zipper;
bZIP68, basic region/leucine zipper transcription factor 68;
CaMV, cauliflower Mosaic Virus;
CAT, catalase;
ChIP, chromatin immunoprecipitation;
CoQ, coenzyme Q;
DHA, dehydroascorbate;
DTT, dithiothreitol;
ECL, enhanced chemiluminescence;
ETI, effector-triggered immunity;
eYFP, enhanced yellow fluorescent protein;
GA, gibberellic acid;
GBF1, G-box binding factor 1;
GO, gene ontology;
GPx, glutathione peroxidase;
GPXs, glutathione peroxidases;
GR, glutathione reductase;
Grx1, glutaredoxin 1;
GSH, glutathione;
GSSG, glutathione disulfide;
xiii
GST, glutathione S-transferases;
GUS, beta-glucuronidase;
HL, high light;
HR, hypersensitive response;
JA, jasmonic acid;
LD, long day;
LHC, light-harvesting complex;
LHCB2.4, light-harvesting chlorophylla/b-binding protein2.4;
LMB, leptomycin B;
LTR, long term response;
MAPK, mitogen-activated-protein kinase;
MDHA, monodehydroascorbate;
MIOX1, myo-inositol oxygenase 1;
MIOX2, myo-inositol oxygenase 2;
mtETC, mitochondrial electron transport chains;
MTI, molecular pattern-triggered immunity;
NES, nuclear export signal;
NF-κB, nuclear factor kappa B;
NLS, nuclear localization signal;
NPC, nuclear pore complexes;
NPR1, non-expressor of pathogenesis-related gene 1;
OST1, open stomata 1;
OXI1, oxidative signal inducible 1
PCD, programmed cell death;
POX, peroxidases;
PQ, plastquinone;
Prx, peroxiredoxins
PSI, photosystem I;
PSII, photosystem II;
P-SO2H, sulfinic acid;
xiv
P-SO3H, sulfonic acid;
PVDF, polyvinylidene difluoride;
Rboh, respiratory burst oxidase homologs;
RNS, nitrogen species;
ROIs, reactive oxygen intermediates;
ROS, reactive oxygen species;
SA, salicylic acid;
SAA, systemic acquired acclimation;
SAR, systemic acquired resistance;
SD, short day;
SODs, superoxide dismutase enzymes;
TBHP, tert-Butyl hydroperoxide;
X-Gluc, 5-bromo-4-chloro-3-indolyl glucuronide;
Δp, protonmotive force;
1
Chapter 1 General Introduction and the Objective
Aerobic metabolism could lead to continuous production of reactive oxygen
species (ROS) or reactive oxygen intermediates (ROIs) including singlet oxygen
(1O2), superoxide anion radical (O2•–), hydrogen peroxide (H2O2), and hydroxyl
radicals (OH•) in mitochondria, chloroplasts, peroxisomes, and other enzymatic
systems (1-3). However, generation or accumulation of ROS, is also a common
process during plant responses to different abiotic and biotic stresses such as
excessive light, cold, heat, drought, wounding, UV-B irradiation, osmotic shock
and pathogens (4-11). Under normal conditions, ROS are scavenged by various
antioxidants defense mechanisms. Under stress conditions, the balance between
ROS producing and scavenging is often disturbed, which leads to oxidative
damage to various biomolecules. On the other hand, ROS also play a role as
signals and oxidative stress activates signaling pathways leading to transcriptional
regulation of genes encoding transcription factors, antioxidant defense enzymes,
metabolic enzymes, and structural proteins, resulting in physiological and
developmental adjustment (12).
1.1 The Concepts of Redox Homostasis and Redox Signaling in Plants
Cellular redox states are maintained by the delicate balance between production
and scavenging of ROS/RNS (13). Both in animals and plants, oxidative stress
occurs when redox homeostasis is broken. Over-production of ROS and/or
depletion of antioxidant, lead to damage to DNA, lipids and proteins (14). Redox
signaling occurs when a biological system alters in response to a change in
cellular redox states (15, 16). In plants, redox signaling mediates many biological
processes such as programmed cell death, plant-pathogen interaction and abiotic
stress responses (17). ROS have been known to act as second messengers in
2
response to various biotic and abiotic stresses; however, how redox signals
regulate biological pathways in plants are largely unknown (18, 19).
1.2 Production of ROS and RNS in Plants
For the aerobic metabolism process, many organelles could attribute to the
production of ROS both in unstressed and stressed conditions (20). ROS produced
by the photosynthetic and respiratory electron transport chains from chloroplasts
and mitochondria are known as organellar ROS. Besides, apoplastic ROS are
generated by NADPH oxidases or other cytoplasmic enzyme systems (21).
The major site of ROS production is in the mitochondrial electron transport
chains (mtETC), specifically in the complex I (NADH dehydrogenase) and III
(cytochrome b/c1 complex). In vitro isolated mitochondria assay in mammalian
cells indicates that, from complex I, when the mitochondria stop making ATP,
which leads to a high protonmotive force (Δp) and reduced coenzyme Q (CoQ),
then the high NADH/NAD+ ratio in matrix can result in significant superoxide O2
•− production (22). In complex III, molecular oxygen (O2) are catalyzed to O2•− by
accepting a single electron transfer, and then converted to H2O2, which locate both
in the matrix and intermembrane space (23). In mitochondria respiratory chain,
when electrons pass down the respiratory chain exit prior to the reduction of
oxygen to water at cytochrome c oxidase, O2•–can be formed, and this process is
called electron leak. Moreover, the producing sites are thought to be a
semiquinone radical or a reduced favin (24).
Photosystem I (PSI) and photosystem II (PSII), as well as free electron
carriers plastoquinone and plastocyanin are composed of the photosynthetic
electron transport chain in chloroplast. Together with the light-harvesting complex
(LHC), PSI acceptor center and PSII reaction center form three major sites for the
generation of ROS or oxidizing molecules in chloroplast thylakoids (4, 25). In PSI,
oxygen subjects to photoreduction leading to the production of O2•−, and its
disproportionation is responsible for the generation of H2O2 and O2 (26).
3
Both in plants and animal cells, NOX family of NADPH oxidases are able to
transport electrons across the plasm membrane, leading to the generation of
superoxide and other downstream ROS (27). In plants, NOX homologs were
named as respiratory burst oxidase homologs (Rboh). Those Rboh proteins are
involved in the generation of O2•– which depend on the electrons transfer process
from membrane to extracellular (EC) acceptor (28). For example, AtrbohD and
AtrbohF contribute to ROS production in response to pathogen infection (29). In
the apoplastic space, cell wall bound peroxidases (POX) is one of plants specific
oxidoreductase, and ROS are produced as by products in some POX-dependent
organic radical generation process (30). During normal metabolism process,
peroxisomes are a major site for H2O2, O2•−, GSNO and nitric oxide (NO
•)
production in eukaryotic organisms (31).
Molecules derived by NO are designated as reactive nitrogen species (RNS),
such as radicals like nitric oxide (NO•), nitric dioxide (NO2
•), dinitrogen tridoxide
(N2O3), peroxynitrite (ONOO−), S-nitrosothiols (RSNOs), S-nitrosoglutathione
(GSNO), which could trigger specific physiology process in plants (32). In
animals, NO is primarily generated by nitric oxide synthase(s) (NOS).
Peroxynitrite (ONOO−) is very reactive, formed by the condensation of O2•− and
NO (33).
In general, ROS and RNS are well acceptable for playing a dual role as both
beneficial and deleterious species. The accumulation of ROS/RNS acts as
signaling molecules or leading to damage is determined by the antioxidative
system (34, 35).
1.3 Antioxidants in scavenging ROS and repairing oxidized biomolecules
1.3.1 Characteristics of antioxidants
An efficient ROS-scavenging system is crucial to maintain the low levels of ROS
pools (36). The term antioxidant should be any compound capable of quenching
ROS without undergoing conversion to a detrimental radical (37). The antioxidant
4
enzymes include those that could catalyze such reactions (38). Therefore, the
antioxidant systems consist of low molecular weight antioxidants, such as
glutathione, ascorbate, α-tocopherol, carotenoids and flovonoids, and antioxidant
protective enzymes, such as catalases, superoxide dismutase enzymes (SODs),
glutathione peroxidases (GPXs), and thioredoxins (39, 40). A large number of
genes coding for proteins involved in antioxidant biosynthesis, ROS
detoxification, and oxidative damage repair (41-43). Here some key components
of the antioxidant system are introduced.
1.3.2 Superoxide dismutases
All SODs are multimeric metalloproteins and very efficient in scavenging the
superoxide radical (44). Previous study identified seven genes for SODs in
Arabidopsis including three CuZnSODs (CSD1, CSD2, and CSD3), three FeSODs
(FSD1, FSD2 and FSD3) and one MnSOD (MSD1) (45). At transcription levels,
CSD1 and CSD2 can be induced in response to oxidative stress, while the
overexpressing of CSD2 thereby resulted in more tolerance to high light, heavy
metals and other oxidative stresses (46). SODs catalyze the conversion of O2•− to
H2O2 by dismutation reaction (2O2•− + 2H+ → H2O2 + O2) (47). For subcellular
localization of SOD isoenzymes. Typically, MnSOD is mitochondrial. CuZnSOD
is plastidic or cytosolic, and FeSOD is plastic (48). Knocking down of CSD2
suppress the development of photosynthetic apparatus, and induce the transcripts
of a number of defense genes under oxidative stress. In addition, those
mechanisms could not be complemented if the water-water cycle is suppressed,
thereby supporting the view that water-water cycle play a role in the protection of
photooxidative damage (49). In mammalian cells, there are three known genes
(CuZn-SOD, EC-SOD and Mn-SOD) encoding SOD1, SOD2 and SOD3
respectively. SODs play important roles against ROS in mammals. For example,
the knockout of SOD2 gene in mice results in a lethal cardiomyopathy (50).
5
1.3.3 Catalases
In Arabidopsis, the catalase multigene family includes three genes (CAT1, CAT2
and CAT3) (51). Catalase is mainly associated with the removal of H2O2 in
peroxisomes by catalyzing the dismutation reaction (2H2O2 → 2H2O + O2) (52).
As H2O2 scavengers, CAT2 is primary activated under cold and drought, while
CAT1 and CAT3 are mainly induced in light or darkness (53). The concentration
of light-dependent H2O2 during photorespiration are regulated by CAT2, and the
knock-out of CAT2 caused perturbation of redox signaling and severely cell death
phenotype (54). In general, catalase is essential for development and growth
regulation, and it also modifies the plants innate defense responses by redox
mechanisms (55, 56).
1.3.4 Ascorbate and Glutathione
Low molecular weight antioxidants ascorbate (AsA) and glutathione (GSH) are
the best studied water-soluble antioxidants in plants (57). Ascorbic acid (AA;
ascorbate; vitamin C) is a powerful free radical scavenger both in plants and
humans (58). In addition, ascorbate is the most abundant low molecular
antioxidant by far (59). The first described ascorbate deficient mutant in
Arabidopsis is soz1, and the mutant displays hypersensitive to both sulfur dioxide
and UVB stresses (60). soz1 is also known as vitamin c-1 (vtc1-1) which encodes
for the GDP-mannose pyrophosphorylase. Five VTC genes (VTC1, VTC2, VTC3,
VTC4 and VTC5) have been identified in the ascorbate biosynthesis pathway in
Arabidopsis (61). VTC2 and VTC5 genes encode for GDP-L-galactose
phosphorylase enzymes catalyzing the first step in ascorbate biosynthesis pathway
(62, 63). The deficient of those genes changes the ascorbate steady-state levels in
plants (64).
Glutathione (GSH; γ-glutamylcysteinyl glycine) is a ubiquitous thiol with
roles in stabilizing enzymes of the Calvin cycle, and keeping ascorbic acid in the
reduced form in chloroplast (65, 66). The cellular redox state is dependent upon
6
the GSH/GSSG (reduction/oxidation) ratio, as well as its biosynthesis, utilization,
degradation and transport (67). The oxidized GSSG can be converted back to
GSH by glutathione reductase (GR) with NADPH (68). GSH protects proteins
against the oxidization of thiol groups during stress, with consequence to form
glutathione disulphide (GSSG) (69). γ-GLUTAMYLCYSTEINE SYNTHETASE
1(GSH1) encodes a chloroplastic γ-glutamylcysteine synthetase controlling the
critical step of glutathione biosynthesis, and the mutation of GSH1 leads to the
transcriptinal changes of several defense-related gene (70). Glutathione
S-transferases (GST) catalyze the S-conjugation of reactive compounds with GSH
(71). The Arabidopsis genome contains 48 GST genes that have diverse functions,
and the major studied function of those encoded GSTs are their roles in
detoxification of xenobiotics and protection of tissues against oxidative damage
(72). Zeta-class glutathione transferase (AtGSTZ1) contains three active-site
cysteines which can undergo spontaneous thiolation with GSSG-biotin (73).
Furthermore, Arabidopsis contains eight glutathione peroxidases GPX genes that
encodes ubiquitous enzymes associated with GST to detoxify lipid
hydroperoxides under several stress conditions (74). Among those GPXs,
ATGPX3 is described as an oxidative signal transducer that act as a general
scavenger, which specifically relay on the H2O2 signal in ABA and drought
stresses signaling pathway (75).
AsA and GSH could perform function separately as well as form AsA−GSH
cycle together with water−water cycle to scavenge ROS in chloroplasts (76). The
purpose of water-water cycle in chloroplast is photoreduction of dioxygen to
water. As a consequence, water-water cycle dissipate excess photons and adjust
the ratio of ATP/NADPH (77). For AsA-GSH cycle, reduced GSH is oxidized to
disulphide form glutathione disulfide (GSSG) which could be recycled to GSH by
NADPH-dependent glutathione reductase (GR). Moreover, GSH can react with
dehydroascorbate (DHA) to generate AsA by dismutation of
monodehydroascorbate (MDHA) (78). While, MDHA could be produced in
ascorbate peroxidases (APX) catalyzed reaction, with a short lifetime, then
7
disproportionates to AsA and DHA (79). As a key enzyme, the class I superfamily
peroxidase APX plays a central role in the AsA-GSH cycle which functions to
control the H2O2 level in photosynthetic organisms (80). Six APX genes are
identified in Arabidopsis, including three cytosolic types (APX1, APX2, APX6),
two chloroplastic (stromal sAPX, thylakoid tAPX), and three microsomal isoforms
(APX3, APX4, APX5) (81). Among those genes, evidence shows that cytosolic
type APX1 plays a central role for the chloroplast protection during light stress
(82). Deficient APX1 in Arabidopsis results in the accumulation of H2O2, thereby
leading to the suppression of development under optimal conditions, and
induction of heat shock proteins during light stress (82, 83). Study described that,
together with glutathione, APX1 and APX2 regulates the reversible
photoinhibition of photosynthesis in response to low light or excess light stress
(84).
1.3.5 Others
In addition to ascorbate and glutathione, tocopherols also exhibit a high affinity to
peroxy radicals. It could also protect membranes by controlling the oxidation rate
of lipid peroxidation (85). Besides above mentioned pathway, different from
mammalian cells, plant mitochondria have a single homodimeric protein that form
an alternative respiratory pathway: alternative oxidase (AOX) (86). AOX involves
in regulating the balance of energy and carbon during environmental changing
(87). AOX plays a role in lowering ROS formation in plant mitochondria (88). It
could also acts as reductant especially for the products of photosynthesis, allowing
the TCA cycle to proceed when the cytochrome pathway subjects to detriment
(89). Evidence suggests that during abiotic stress, when the generation of NADPH
in chloroplast exceeds the Calvin cycle consuming, AOX in plant mitochondria
may oxidize the “excess” reducing power (90).
Peroxiredoxins (Prx) are also important antioxidants in higher plants,
including one each of cytosolic, mitochondrial, plastidic type II Prx, PrxQ in
8
chloroplast, one 2-CysPrx for plastid and one nucleo-cytoplasmic 1-CysPrx,
which could reduce H2O2 by employing a thiol-based catalytic mechanism (91).
About 286 peroxisomal genes encode for potential peroxisomal proteins have
been identified in Arabidopsis (92). H2O2-detoxificaton and photorespiration are
believed as major mechanisms that peroxisomes take part in. For example, 2 CP
take part in the anti-oxidant network of chloroplast, and the suppressed mutation
increase the expression of other anti-oxidative genes (93). Due to decreasing the
accumulation of ROS, AtrbohC is essential for plant root cell expansion which
dependent on Ca2+ uptake (94).
Since the interaction between ROS and antioxidant determine the specificity
of the ROS signal, absorb and buffer oxidants that controlled by these antioxidants
are the determinants of redox homeostasis (95). In other words, ROS and
antioxidants govern plant to sense environment, regulate gene expression, and
affect metabolism and physiology by regulating the cellular redox state (96).
1.4 Redox Regulation and Redox signaling in Plants
1.4.1 The term of redox regulation
Typically, the post-translational modification of reversible change of thiol groups
(S−S↔2SH) of a protein, leading to change in its oxidative state and activity was
called the redox regulation (97). Several systems contribute to redox regulation of
many biological processes, including the NADP/thioredoxin system, the
glutathione/glutaredoxin system and the ferredoxin/thioredoxin system. These
systems each linking a hydrogen donor to an intermediary disulfide protein to
alter the activity of target proteins (98-100). The regulation of redox status of a
protein could alter signaling pathway, leading to changes in biological processes
such as translation, transcription, programmed cell death, environmental and
biological stresses response. And those regulations are considered as redox
signaling. Therefore, redox signaling is a special form of redox regulation (97).
9
1.4.2 Redox regulation during different biological processes
Redox regulation is common in both animals and plants (101, 102). The pathway
and mechanism of redox regulation remain poorly characterized (103). In yeast,
mitosis happened at the reductive condition and cell division occur in the
oxidative condition during respiratory process (104). In plants, growing evident
suggests that by regulating the specific gene expression through redox sensitive
transcription factors, cellular redox state has an important effect on cell division
and multicellular organism development (105). For example, a transcription factor
UPBEAT1 (UPB1) directly regulates certain peroxidases to manage the balance of
ROS between the zones of cell proliferation and the zone of cell elongation to
control the initiation of cell differentiation in root (106). The cellular redox state
also has a major impact on cell fate (107).
For triggering the programmed cell death (PCD), ROS acts as signals to
regulate gene expression which involvs in cell suicide events, rather than direct
create physicochemical damage (108). In addition, the interaction between NO
and H2O2 are identified the only factor to trigger the hypersensitive cell death in
response to pathogen attack in plant (109). In mammalian cells, intracellular ROS
play a specific signaling role in induction of the cellular senescence which is
related to aging process (110). Under environment stress, the excessive ROS
primary damage the Rubisco in chloroplast during leaf senescence process (111).
At low levels, as signaling molecules, ROS regulate the autophagy process to
decide the survival or death of cell by mitochondrial origin both in mammalian
and plant cells (112). In general, by redox regulation, plants act as masters that
employ flexible oxidants and antioxidants to integrate signals from metabolism
and environment (113).
1.5 Redox signaling in environmental stress
Besides local responses, acclimation mechanism under abiotic stimuli, such as
high light (HL), heat, cold, drought or salinity, is termed as systemic acquired
10
acclimation (SAA) (114). Various pathogenic and insect invaders may induce
long-lasting systemic protection against a broad spectrum of microorganisms in
plant, and the mechanism is termed systemic acquired resistance (SAR) (115, 116).
Any subtle disturb of the cellular redox balance may induce acclimation responses
in plant; however, how the redox signal trigger the cellular reprogramming in
response to environmental stress are still obscure in plants (21).
1.5.1 Redox signaling responding to abiotic stress
Most of abiotic stresses such as ozone, heat, cold, drought, high light (HL) and
UV may lead to a burst of ROS, epically H2O2 (117). ROS and redox cues which
generated in the chloroplast and mitochondria could activate acclimation response
under abiotic stress to control the SAA and cellular coordination in plants (118).
Here are some studies that link the ROS with abiotic stress. Drought inducing
reductions in photosynthesis in conjunction with photorespiration may contribute
to the production of ROS in mitochondria, leading to the ratio of mitochondrial
respiration (R) to photosynthesis (R/P) being greater, and then the water loss may
affect the function of mitochondria (119). Acclimation to HL need to maintain the
redox states in chloroplast. During short term response, besides phosphorylation
of thylakoid-bound protein, the reduction and oxidation of plastquinone (PQ) pool
are essential for balancing the photosynthetic energy distribution between PSII
and PSI. Moreover, the balance in long term response (LTR) is maintained by
regulating photosystem stoichiometry and antenna structure, and adjusting the
abundance of reaction central and light harvesting proteins (120-122). Chilling
can impair electron transport, ATP activity and respiratory activity, leading to the
production of H2O2, which may induce the antioxidants enzymes for the
mitochondria against oxidative damage (123). Under salinity stress, ionic stress
leads to the production of ROS in mitochondria, and salt tolerance can be
enhanced by overexpressing antioxidant genes AOX and MnSOD (124).
1.5.2 Oxidative burst in response to biotic stress in plants
11
Two forms of immunity can be activated by microbial elicitors in plants. The first
one related to basal resistance is known as microbe-associated molecular
pattern-triggered immunity (MTI). While the other one effector-triggered
immunity (ETI) is activated by R genes. Oxidative burst acts as a key role both in
MTI and ETI signaling (125). Rapid production and accumulation of ROS during
microbe infection are known as oxidative burst, which usually follow by
cross-linking of cell wall proteins, induction of defense-related genes,
biosynthesis of phytoalexin and activation of hypersensitive response (HR) (126).
For orchestration of localized hypersensitive response, H2O2 could also induce
some antioxidants (127). Besides, the rapid production of H2O2 may contributes
as the first induced line for plant in defense against pathogens (128). NADPH
oxidase acts as predominant enzymatic mechanism responsible for oxidative burst
(19). During the early stage of pathogen invasion, antioxidants appearing in
apoplast may prevent the occurring of sustained oxidation that contribute to
pathogen sensitivity (129). Oxidative signal inducible 1 (OXI1) kinase is induced
by H2O2 and is essential for signal transduction linking oxidative burst and
downstream responses (130).
NO was identified as a key signal in disease resistance in plants (131). The
interaction between NO and ROS signaling pathways is essential during plant
biotic interactions (132). However, how the ROS wave integrated with these
different stress-specific signals is poorly understand, although it is known that the
formation of a wave of ROS production leads to spatial and temporal responses
throughout different tissues (133).
1.5.3 Redox–phytohormone interactions
The crosstalks between biotic and abiotic stresses are regulated by ROS signaling
pathways, as well as hormone signaling pathways (134). These hormones include
defense-related signals containing JA and SA, as well as some classic hormones
including auxin, ABA, GA and ethylene (96). Both auxin and ROS are rapidly
12
stimulated by environmental stresses, and it was suggested that auxin links ROS
with developmental and physiological response to stress tolerance (135). For ABA,
under water deficit, salinity stress, and/or high light stress condition, OST1
directly intact with respiratory burst oxidase homolog F protein (RBOHF) to
regulate stomatal closure, but the systemic ROS/Ca2+/hydraulic/electric wave
could cause the opening of stomata and induce the ABA accumulation which may
turn on gene expression and eventually induce acclimation (114). ROS linked with
GA by the nuclear growth-repressing DELLA proteins. Stress induced DELLA
can stimulate upregulating of antioxidant genes, resulting in delaying cell death
and promoting tolerance (136). SA alters the cellular redox status and enhances
the oxidative burst (137).
1.5.4 MAPK cascades in oxidative stress response
Mitogen-activated-protein kinase (MAPK) cascade works with ROS signaling in
various biological pathways. MAPK cascade is activated to control a variety of
transcription factors to copy with the detected oxidative stress by regulating
expression of some corresponding genes, hormone responses networks, and
antioxidant systems (36). For example, MEK4 and MEK5 in Arabidopsis are
induced by H2O2 and eventually leading to HR cell death associated with plant
disease resistance (138). Some studies proposed that MAPK pathways might act
upstream of ROS signaling, such as the tobacco MEK2 pathway, the Arabidopsis
MPK3 and MPK6 (139). On the other hand, it is known that ROS can enhance
MAPK cascade by deactivating phosphatases through their oxidation (140). Many
phosphatases are known to be redox sensitive, such as the nuclear factor kappa B
(NF-κB), p38 in animal, the Arabidopsis ABI1 and ABI2 (141-144) .
In generally, ROS signaling is integrated with many different signaling
networks in plants, and accumulation of ROS could either precede the activation
of these signaling or activated by those networks (145).
13
1.6 Examples of redox signaling components
It is believed that ROS play their signaling roles largely by acting through
oxidative modifications of redox-sensitive proteins whose reduction and oxidation
can function as a molecular switch to link redox changes into physiological
responses (146). Proteins undergo oxidative modification in diverse amino acid
residues; however, irreversible modification is often associated with permanent
loss of function or damage to those proteins, although reversible modifications at
the cysteine residues can act as a molecular switch in redox regulation (147).
Many proteins have been known to sense cellular redox changes by using their
redox-sensitive thiols of cysteine residues (148). Protein thiols can be oxidatively
modified in different ways: some modifications, such as formation of sulfenic acid
and a disulfide bond are reversible whereas others such as oxidation to sulfonic
acid (P-SO3H) and sulfinic acid (P-SO2H) are irreversible (149). Recently,
gel-based and gel-free quantitative redox proteomics methods have been used to
identify proteins whose thiols underwent oxidative modifications in response to
redox perturbation (150-153).
1.6.1 Redox sensor in bacteria and yeast
Reversible modifications of cysteines such as disulfide bond formation,
glutathionylation, and nitrosylation can alter protein activities and/or protein
localization and act as a molecular switch (14, 108, 154). Redox control of
transcriptional activation of antioxidant genes by redox-sensitive transcription
factors was discovered from studies initially performed on Escherichia coli (155).
A bacterial transcription factor called OxyR is activated by its reversible oxidation
by H2O2, which enhances DNA binding and activates antioxidative genes (156).
Redox sensing protein OhrR in bacteria is a transcription suppressor in its reduced
form in normal condition which repress transcription of ohrA resistance gene, and
is inactivated by form a cysteine sulfenic acid in the presence of hydroperoxides,
which leads to the sensing of ROS and inducing of repair genes (157, 158).
14
In yeast, YAP1 is in a reduced status and localized in the cytoplasm under
normal conditions. Furthermore, it forms several disulfide bonds with the
glutathione peroxidase (GPx)-like enzyme Gpx3 under oxidative stress, and is
translocated to the nucleus to activate genes encoding oxidative stress defense
proteins (159-161). Multi-step formation of disulfide bonds are required for the
activation of Yap1 in response to H2O2, which include the formation of multiple
interdomain disulfide bonds to transduce redox signaling, and the intramolecular
disulfide bond that dependent on the forms of thionilate anion (162). Reduction of
YAP1 in the nucleus by a thioredoxin alters its conformation so that its nuclear
export signal (NES) is recognized by CRM1 (Exportin 1) and it is transported
back to the cytosol (163). In addition to a NLS recognized by an importin protein
for targeting to the nucleus, proteins that undergo nucleocytoplasmic shuttling
generally contain a leucine-rich NES which is recognized by an exportin protein
and are then exported across nuclear pore complexes (NPC) to the cytosol (164).
1.6.2 Redox sensitive proteins in human
Adult T cell leukemia–derived factor (ADF) is a human thioredoxin, which
subjects to nucleocytoplasmic shuttling through the reduction/oxidation of protein
cysteine residues in response to stress (165). p53 tumor repressor is an
well-characterized redox-sensitive protein. Moreover, the DNA-binding activity
of p53 is regulated through redox modification of its several cysteine residues
(166). NF-κB is known to be involved in transcriptional induction of their target
genes through redox-regulation (167, 168).
1.6.3 Redox sensors in plants
Although only few redox-sensitive proteins in plants have been characterized in
details, increasing evidences support that redox sensors play important role in
modulating redox-mediated biological processes in plants (169). The master
immune regulator NPR1 (non-expressor of pathogenesis-related gene 1) is a well
15
characterized redox sensor protein in Arabidopsis. Under stressed condition, the
reduced monomer of NPR1 translocate from cytoplasm to nuclear to induce
defense gene expression owing to the conformation changes via S-Nitrosylation
and Thioredoxins (170, 171). During SAR acclimation process, the redox
sensitive NPR1 could modulates the crosstalk between SA and JA in cytosol. In
addition, the SA induced response of translocation of NPR1 is dependent on the
interaction between NPR1 and basic leucine zipper protein transcription factors
AHBP-1b and TGA6. And then, after trigger the transcriptional reprogramming,
NPR1 subjects to degradation which mediated by the nuclear SA receptors NPR3
and NPR4 (172-174). Recent study shows that, NPR1 sensor the redox rhythm
interacts with the circadian clock in response to vigorous environmental stimuli in
order to alleviate the sacrifice of organism physiological activity (175).
1.7 bZIP transcription factors in Arabidopsis
Previously, we developed a redox proteomics approach termed oxiTRAQ for
identifying redox-sensitive proteins in Arabidopsis (176). basic leucine zipper
protein transcription factors bZIP68 and G-box binding factor 1 (GBF1) were
identified among the redox-sensitive proteins that underwent reversible oxidative
modifications in Arabidopsis suspension cells under the treatment of 5 mM
hydrogen peroxide for 15 minutes.
1.7.1 Overview of the bZIP factor family
Basic region/leucine zipper domain (bZIP) proteins constitute a major class of
eukaryotic transcriptional regulators (177). In plants, bZIP family proteins contain
a basic region involved in DNA binding and nuclear import, and a leucine zipper
dimerization domain. These proteins are found in all eukaryotes and implicated in
gene expression and regulation not only by transcriptional modification but also
through protein-protein interaction, protein degradation and intracellular
partitioning (178). bZIPs also control important processes in plants, such as
16
morphogenesis, seed formation, abiotic and biotic stress responses (179).
The Arabidopsis thaliana (At) genome encodes approximately 75 predicted
bZIP factors. On the basis of sequence similarity and conserved motifs, the
AtbZIP family can be subdivided into ten groups: A, B, C, D, E, F, G, H, I and S
(180). The group G GBF genes of Arabidopsis have been mainly linked to
ultraviolet, blue light signal transduction and the regulation of light-responsive
promoters. There are five members of G group genes: GBF1-3, AtbZIP16 and
AtbZIP68. Members in G group all have conservative protein structure: a highly
homological DNA binding domain and a proline-rich domain in the N-terminal
(181). Moreover, all five members of bZIPs can form homo- and heterodimers
with each other, which may specifically recognize the G-box motif (182, 183).
Additionally, through in vitro DNA binding assay, pull-down assay, and yeast one
hybrid screen, the G group bZIPs are found to bind to the cis elements with the
ATGC core, such as G-box, C-box, and the activation sequence-1 (as-1) element
that have been linked to responses to light, phytohormones, and oxidative stress
(184-188).
1.7.2 Functions of the Arabidopsis G-group bZIPs
In vitro assay showed that the DNA binding activity of bZIP16, bZIP68, and
GBF1 is inhibited by oxidant treatment and enhanced by DTT treatment (189).
AtbZIP16, AtbZIP68, andAtGBF1 could recognize and specifically bind to the
fragment of CACGTG G-box that derived from light-harvesting
chlorophylla/b-binding protein2.4 (LHCB2.4) promoter. Besides, AtbZIP16,
AtbZIP68 and AtGBF1 could also interact with each other in the yeast two-hybrid
system (190). Through transcriptome comparison between wild type and bzip16
mutant plants, and chromatin immunoprecipitation (ChIP) followed by qPCR
analysis, bZIP16 is reported to be a primarily transcriptional repressor that
regulating light-, GA-, and ABA-responsive genes (186). Modeling of the bZIP
domain of bZIP16 reveals that if the redox-sensitive thiols form a disulfide bond
17
between the dimer partners, the configuration of the zipper domain may not be
open or flexible enough to allow DNA binding (189).
AtGBF1 could bind to the CAT2 promoter in vitro. In addition, in vivo,
AtGBF1 negative regulates the expression of CAT2 at bolting time, and controls
leaf senescence through the content of H2O2 (191). Besides, AtGBF1 also exhibits
elongated hypocotyls in response to white and blue light (192). Indeed, GBF1
functions as a repressor for RBCS and CAT2 but an activator for LHCs (191, 192).
For other GBFs, AtGBF2 is known to undergo phosphorylation-dependent nuclear
translocation in response to light, and the expression of AtGBF3 is also regulated
by light (193).
1.7.3 Well known bZIPs in other groups
Increasing studies suggest that bZIP factors play crucial role in various pathways
and post-translational modifications are involved in regulating activities of many
bZIPs (178). ABI5 belongs to the A group bZIP proteins, and deficient ABI5 leads
to the insensitiveness to ABA responses including germination stage and embryos
period. The protein accumulation, phosphorylation, stability and activity of ABI5
are all highly regulated by ABA (194-196). During light-regulated development
process, the group H bZIP factor HY5 directly binds to the promoters of
light-inducible genes, promoting the photomorphogenic development (197, 198).
Under dark, HY5 subjects to degradation dependent on the interaction with a WD
protein COP1; but when illuminated, COP1 is exported from the nucleus to
cytosol leading to the accumulation of HY5 (199-201). A couple of TGA proteins
of the D group bZIPs are involved in plant’s defense against pathogens by directly
activating PR gene expression (202). NPR1 interaction protein TGA1 is also a
bZIP that binds to the as-1 element present in many pathogen-responsive genes,
leading to activation of defense mechanism (203, 204). Formation of a disulfide
bond in TGA1 under oxidizing conditions leads to an inactive conformation (203).
18
1.8 Objective
Our preliminary study on bZIP68 raises an intriguing possibility that bZIP68
might act as a transcriptional repressor that suppresses oxidative stress-responsive
genes under normal growth conditions. Sensing oxidative stress, bZIP68
undergoes a reversible oxidation and is shuttled from the nucleus to the cytosol,
leading to activation of the stress-responsible genes.
To unravel the possible function and molecular mechanisms of bZIP68 in
response to oxidative stress, experimental plants were designed to understand the
role of redox regulation of bZIP68 in its function and genes that are regulated by
bZIP68. Various mutational analyses were carried out to reveal molecular
mechanisms of transcriptional regulation by bZIP68 and its biological function.
19
Chapter 2 Materials and Methods
2.1 Plant Materials and Growth Conditions
Arabidopsis thaliana T-DNA insertion lines bzip68-1 (SALK_065543) and
bzip68-2 (SALK_094254C) (Col-0 background) were obtained from the
Arabidopsis Biological Resource Center (ABRC) (http://abrc.osu.edu/).
Homozygous insertion lines were confirmed by genomic PCR analysis using the
T-DNA left border primer LBb1 and the gene-specific primers (listed in Table 2.1).
The gene-specific primers were designed by using T-DNA Primer Design Tool of
Salk Institute Genomic Analysis Laboratory
(http://signal.salk.edu/tdnaprimers.2.html). Col-0 plants were used as the
wild-type control for phenotype analysis and transcript level analysis and for
transformation with various constructs used in this study.
Plants were grown in soil in an walk-in growth room with 23ºC ± 2ºC, 50%
humidity, and 125 mol m-2 sec-1 light intensity provided by cool-white fluorescent
bulbs under a 16 h light/8 h dark cycle. For growing seedlings on agar media,
surface sterilized seeds were plated on the medium with half-strength Murashige
and Skoog (MS) Basal Salts (Sigma, M5524-1L), 1% (w/v) sucrose, 0.7% agar,
and 0.05% MES, pH 5.7 (adjusted by 1M KOH). Seedlings in petri dishes were
placed in a growth chamber (SANYO, MLR-351H or CONVIRON, E7/2 ) at
23ºC or 15ºC with 50% humidity and a light intensity of 125 mol m-2 sec-1 under a
16h light/8h dark photoperiod.
2.2 Transformation of Arabidopsis
All constructs in binary vectors for Arabidopsis transformation were first
transformed into Agrobacterium tumefaciens strain GV3101 and then into
Arabidopsis by floral dipping (205). The T2 and/ or T3 generation stable
transgenic lines were selected and used for the subcellular localization analysis.
20
2.3 Constructs for Subcellular Localization Study of bZIP68-eYFP and its
point mutations and seedling treatment
To generate the bZIP68-eYFP fusion under the control of the 35S promoter, a
genomic region of bZIP68 was amplified with the primers SalI-35SAtbZIP68-F
and 35SAtbZIP68-BamHI-R from Col-0) genomic DNA and cloned into the
SalI/BamHI-digested pCAM35S::eYFP (206) vector to yield 35S::bZIP68-eYFP.
To place bZIP68-eYFP under the control of the bZIP68 promoter, a 3.4-kb (-1164
to +2270) genomic fragment of bZIP68 was amplified with the primers
BamHI-pAtbZIP68-F and pAtbZIP68-AgeI-R, subcloned into a
BamHI/AgeI-digested pBAR-eYFP vector to yield bZIP68p::bZIP68-eYFP.
The bZIP68C320S, bZIP68L157A, bZIP68L160A, and
AtbZIP68L157A&L160A point mutation were generated through site-directed
mutagenesis assay (207). The C320S, L157A, L160A and L157A&L160A
mutations were generated using the bZIP68 genomic fragment of
35S::bZIP68-pmD-T19 cloning vector as the template by using the following
primer pairs, respectively: C320S-F and C320S-R, L157A-F and L157A-R,
L160A-F and L160A-R, L157A&L160A-F and L157A&L160A-R. The clones
containing the point mutations were subcloned into the pCAM35S::eYFP vector
as described above to generate 35S::bZIP68C320S-eYFP,
35S:bZIP68L157A-eYFP, 35S:bZIP68L160A-eYFP and
35S::bZIP68L157&AL160A-eYFP that were transformed into Col-0. Homozygous
transgenic seedlings were identified and used for confocal microscopy
observation of eYFP.
2.4 Confocal Microscopy for subcellular localization of eYFP
For determining subcellular localization of the eYFP reporter, 4-d-old seedlings
expressing various eYFP reporter constructs were observed under a confocal
21
laser-scanning microscope (Leica TCS SP5 II) with 488nm excitation and
500-530nm emission. For the oxidant treatment, the seedlings were dipped in
5mM H2O2 solution and observed with the confocal microscope at different time
after the oxidant treatment. The seedlings dipped in water were served as a control.
The eYFP transgenic lines observed in the study carried one of the eYFP reporter
constructs described above. To determine the effect of Leptomycin B (LMB) on
bZIP68 subcellular localization, the 35S::bZIP68-eYFP lines were treated with
80ng/ml LMB (Sigma, L2913) for 24h as described previously (208) and then
treated with 5mM H2O2 before observation by confocal microscopy.
2.5 Phenotypic analysis under stress treatments
For the treatment with tert-Butyl hydroperoxide (TBHP), surface-sterilized seeds
were sowed on petri dishes (90mm) containing 15ml of solid 1/2 MS medium
with or without 0.4mM tert-Butyl TBHP. The plates were placed at 4ºC for 3d for
cold stratification to synchronize the germination and then placed in a growth
chamber for germination and seedling growth with 23ºC, 16 h light/8 h dark cycle,
and 125 mol m-2 sec-1 light intensity in growth chamber (SANYO, MLR-351H).
For the cold stress treatment, surface sterilized seeds were germinated and
seedlings were grown on the 1/2 MS medium at 15ºC for 10-14 days with 16 h
light/8 h dark cycle, and 125 mol m-2 sec-1 light intensity in a growth chamber
(SANYO, MLR-351H). For cold treatment on soil grown plants, seeds were
germinated and seedlings were grown in pots in the growth room (23ºC ± 2ºC) for
one week. The plants were then transferred to a growth chamber (CONVIRON,
E7/2) with 125 mol m-2 sec-1 light intensity provided by cool-white fluorescent
bulbs under a 16 h light/8 h dark cycle.
2.6 Genetic complementation of the bzip68 mutant
A 3.7-kb (-1170 to +2517) genomic fragment of bZIP68 was amplified with the
primers BamHI-combZIP68-F and combZIP68-PstI-R from Col-0 Arabidopsis
22
genomic DNA and cloned into a BamHI/ PstI-digested pCAMBIA1300 vector
(SnapGene). The construct was transformed into the bzip68-1 mutant. Similarly,
the other constructs investigated in the study were also transformed into the
mutant for complementation analysis. Multiple independent transgenic lines were
identified and used for phenotypic analysis under the stress treatments described
above.
2.7 GUS reporter assay
A 1.2 kb bZIP68 promoter fragment was amplified from Col-0 genomic DNA
using the primers KpnI-GusbZIP68-F and GusbZIP68-AgeI-R and subcloned into
the binary vector pBAR-GUS which harboring a GUS reporter gene (206) which
was then transformed into Col-0. Histochemical GUS activity staining of the GUS
reporter lines was performed as described previously (209). Stained tissues were
then observed under a dissecting microscope (Nikon, Eclipse Ti-S).
2.8 RNA isolation, RNA-seq and quantitative real-time RT-PCR
bzip68-1, bzip68-2 and Col were grown on 1/2 MS agar media (3% (w/v) sucrose,
and 0.7% agar, pH 5.7) for 14 days under 8 h light/16 h dark cycle, and 125 mol
m-2 sec-1 light intensity, and the leaves of seedlings were collected. Three
biological replication were collected for each sample. Total RNA was extracted
using the Plant RNA Isolation Mini kit (Agilent), RNA (1μg) was digested by
DNase I (NEB, M0203L) and then reverse transcribed using the M-MLV Reverse
Transcriptase (Affymetrix, 78306) with oligo (dT) primers according to the
manufacture’s instruction (Affymetrix, 77405). The quality of the RNA samples
were analyzed by spectrophotometer (Thermo, NANO drop, ND1000).
Barcoded mRNA libraries were constructed by BGI using Illumina reagents and
protocols. Samples were sequenced on 2500 Illumina HiSeq. Total reads were
mapped to the Arabidopsis genome (TAIR10; www.arabidopsis.org) using the
TopHat 2.2.0 and SOAP2 software (210, 211). Read counts for every gene were
23
generated using HTseq 0.6.1 with and other scripts (212). Differential expressed
genes between samples were defined by DEseq2, based on fold change>2 and
false discovery rate-adjusted P value < 0.05 (213). Gene Ontology analysis, and
the functional categories were identified by using the annotation of the
Arabidopsis genome (TAIR10; www.arabidopsis.org).
Primers bZIP68-qF-1 and bZIP68-qR-1 were used to determine the bZIP68
gene expression levels in bzip68-1 and bzip68-2 mutants. Quantitative PCR with
gene specific primers (listed in Table 2.2) were performed with the SYBR qPCR:
SYBR Premix Ex Taq (TaKaRa, DRR420A) on Mx3000P Real-Time PCR
detection system (Agilent Technologies). Signals were normalized to the
reference gene ACTIN2 using the ΔCT method and relative expression of a
candidate gene was calculated from the ratio of bzip68 mutants to wt. Three
biological replicates were included in the quantitative real-time RT-PCR analysis.
2.9 Accession Numbers
Sequence data for this study can be found in the Arabidopsis Genome Initiative
database under accession number At1g32150 (bZIP68), At5g09240.
24
Table 2.1 Information of the primers used for genotyping and construction of various constructs used in this study.
Purpose Primer pairs Oligo Sequence
genotyping for SALK_065543 bzip68-1-LP GTAACAGCCACTCCAGCACTC
bzip68-1-RP TTGCTAATTGCTATCATCGGAG
genotyping for SALK_094254C bzip68-2-LP CAGATGGGATCTTGCTTGAAG
bzip68-2-RP AACCTCTGCTCGTTGTGCTAG
35s::bZIP68-eYFP SalI-35SAtbZIP68-F GTCGACATCTGATTGTTGGATTTTGGTAGGT
35SAtbZIP68-BamHI-R GGATCCTTCGCAACATCCTGACGTGTACTT
bZIP68p::bZIP68-eYFP BamHI-pAtbZIP68-F GGATCCTAACTTTCACGCCCACCACTC
pAtbZIP68-AgeI-R ACCGGTAACGCAACATCCTGACGTGTACTT
35S::C320SbZIP68-eYFP C320S-F GCGGAGAGTGATGAGCTAGCAC
C320S-R GTGCTAGCTCATCACTCTCCGC
35S::L157AbZIP68-eYFP L157A-F GCGGGAAGTTTGAATATGATTATAGGA
L157A-R TCCTATAATCATATTCAAACTTCCCGC
35S::L160AbZIP68-eYFP L160A-F GAAGCTTGGGAAGTGCGAATAT
L160A-R ATATTCGCACTTCCCAAGCTTC
35S::L157A&L160AbZIP68-eYFP L157A&L160A-F AGGAAGCGCGGGAAGTGCGAATATGATTA
L157A&L160A-R TAATCATATTCGCACTTCCCGCGCTTCCT
25
chip assay BamHI-ChipbZIP68-F GGATCCTAACTTTCACGCCCACCACTC
ChipbZIP68-AgeI-R ACCGGTAACGCAACATCCTGACGTGTACTT
complementation BamHI-combZIP68-F GGATCCTAGGGTTAACTTTCACGCCCA
combZIP68-PstI-R CTGCATAAAGATTGAGAAGAAGACTCCGAAA
overexpression SmaI-OXbZIP68-F CCCGGGATCTGATTGTTGGATTTTGGTAGGT
OXbZIP68-ClaI-R ATCGATCTACGCAACATCCTGACGTGTACTT
GUS::bZIP68 KpnI-GusbZIP68-F GGTACCTAACTTTCACGCCCACCACTC
GusbZIP68-AgeI-R ACCGGTGAAGCTGCGTGGGCTTGAC
The underlined nucleotides indicate the position of mutagenesis, and nucleotides in red are the added resriction enzyme recognition
sequence.
26
Table 2.2 Information of the primers used for qRT-PCR analysis.
Primer pairs Oligo Sequence
bZIP68-qF-1 ATGGATTATTGGAGCGGTCATG
bZIP68-qR-1 GTTTACGCAACCTGGATCTACGA
PER62-qF-1 TCCGCTTTTCGCCTCAACACTC
PER62-qR-1 ATTCCTCTGTTACGGCTGAGATTGATG
WRKY18-qF-1 GGAAATACGGACAAAAGGTTACAAGAGA
WRKY18-qR-1 CAGATATAGCAGCAGCAAGAGCAGCT
CBF2-qF-1 AAGATGCGTTTTATATGGATGAAGAGG
CBF2-qR-1 TTTTACCATTTACATTCGTTTCTCACAA
JAZ10-qF-1 CTAATGAAGCAGCATCTAAGAAAGACGAG
JAZ10-qR-1 GAAATAAGCCAAATCCAAAAACGAACA
27
Chapter 3 Results
3.1 bZIP68 is localized in nuclei under normal conditions
bZIP68 is predicted to contain a nuclear localization signal (NLS). For
experimental verification of subcellular localization of bZIP68, transgenic
Arabidopsis plants expressing bZIP68 fused with eYFP at its C’ terminus were
generated. The chimeric gene was under the control of the 35S promoter
(35S::bZIP68-eYFP) or the bZIP68 promoter (bZIP68p::bZIP68-eYFP). The
bZIP68 promoter is active in roots mainly in the meristem and elongation zones,
in newly emerging leaves and guard cells (Fig 3.1A-3.1G).
The YFP signal was found to be primarily localized in nuclei under normal
growth conditions in the seedlings expressing bZIP68-eYFP under the control of
either the bZIP68 promoter (Fig 3.2A-3.2C) or the 35S promoter (Fig 3.2D-3.2F).
28
Figure 3.1 Expression patterns of AtbZIP68 revealed by the GUS reporter
assay.
GUS staining of bZIP68:GUS transgenic plants in 3-d-old seedlings (A), 7-d-old
seedlings (B), 14-d-old seedlings (C), plant at 6-8 true leaf stage (D), young
inflorescence and floral buds (E), inflorescence (F, G) and silique (G). Scale bars
= 500 μm.
29
Figure 3.2 bZIP68-eYFP is primarily localized in nuclei of Arabidopsis root
cells under the normal growth condition.
Location of bZIP68-eYFP in root cells of a transgenic plant carrying
bZIP68p::bZIP68-eYFP (A-C) and another line carrying 35S::bZIP8-eYFP (D-F).
The left panels show the fluorescence signal, the right panels are bright filed
images and the middle panels are merged images.
30
However, approximately 15 minutes after the roots were treated with 5mM H2O2,
the eYFP signal disappeared from the nuclei and instead accumulated in the
cytoplasm of many root cells (Fig 3.3A-3.3O). This redistribution of the eYFP
signal was not likely due to leakage of the protein from the nuclei to the
cytoplasm due to damage of nuclear membrane. In the seedling expression eYFP
fused with another nuclear protein (At5g09240), the eYFP signal remained in the
nuclei in the seedlings under the same ROS treatment (Fig 3.4A-3.4F).
31
32
Figure 3.3 bZIP68-eYFP became localized in the cytoplasm under the ROS
treatment.
The photos were taken from Arabidopsis roots treated with 5mM H2O2 for
approximately 15 minutes (A, B, C), 30 minutes (D, E, F), and 2 hours (G, H, I).
The plants are bZIP68P::bZIP68-eYFP transgenic lines. The nucleocytoplasmic
shuttling was also observed in the 35S::bZIP68-eYFP transgenic plants (J, K, L,
M, N, O) which were treated with 5mM H2O2 for about 15 minutes.
33
Figure 3.4 eYFP signal in the At5g09240-eYFP transgenic line.
The At5g09240-eYFP fusion protein was found to be remained in the nuclei under
the normal condition (A, B, C) and the oxidative stress condition (D, E, F).
34
3.2 Nucleocytoplasmic shuttling of bZIP68 is dictated by its redox-sensitive
Cys320 and requires its nuclear export signal
The change in bZIP68 subcellular distribution patterns in response to the
oxidative stress prompted us to examine whether bZIP68 undergoes
nucleocytoplasmic shuttling that is dictated by its redox states. To test the
hypothesis, the codon for the redox-sensitive Cys320 was mutagenized to the
serine codon and the mutated version was fused with eYFP to generate
bZIP68p::bZIP68C320S-eYFP, which was transformed into Arabidopsis to
generate stable transgenic lines. Like the wildtype bZIP68, bZIP68C320S-eYFP
was also localized in nuclei under the normal condition (Fig 3.5A-3.5C). However,
in contrast to the redistribution of bZIP68-eYFP following the ROS treatment,
bZIP68C320S-eYFP largely remained in the nuclei in the seedlings under the
same oxidative stress treatment (Fig 3.5D-3.5F).
35
Figure 3.5 bZIP68C320S-eYFP is retained in the nuclei under oxidative
stress.
Photos were taken from the transgenic plants of 35S: bZIP68C320S-eYFP mock
treatment (A, B, C) or with the treatment of 5mM H2O2 for 30 minutes (D, E, F).
36
Nuclear proteins that undergo nucleoplasmic shuttling often contain a nuclear
export signal (NES) for its transport from the nucleus to the cytoplasm through
nuclear pores. NES often have a consensus sequence of LxxxLxxLxL, where "L" is
a hydrophobic residue (often leucine) and "x" is any other amino acid. bZIP68 is
predicted by the NetNES algorithm (http://www.cbs.dtu.dk/services/NetNES/)
(214) to have a NES around AAs 148-162 (Fig 3.6A-3.6B). Leu157 and Leu160
are predicted to be critical residues for that region to function as a NES. The
Leu157 codon and Leu160 codon was mutated to an Ala codon, and the mutated
bZIP60L157A, bZIP68L160A, and bZIP68L157A&L160A in which both Leu157
and L160 were substituted with Ala were fused with eYFP. Subcellular
localization of these Leu-to-Ala substituted bZIP68-eYFP fusion proteins were
observed in the transgenic seedlings with and without the oxidative stress
treatment. The single mutation of bZIP68L157A and bZIP68L160A did not lead
to obvious difference in their nucleocytoplasmic shutting from the wildtype
bZIP68 in response to the oxidative stress treatment (Fig 3.7A-3.7L); however, the
dual mutation of both Leu157 and Leu160 largely blocked nucleocytoplasmic
shuttling of bZIP68L157A&L160A-eYFP following the oxidative stress treatment
(Fig 3.8A-3.8F).
37
Figure 3.6 bZIP68 is predicted to have a NES signal around AAs 157-162 (A,
B).
38
39
Figure 3.7 Both bZIP68L157A-eYFP and bZIP68L160A-eYFP were localized
in nuclei under the normal condition, and under the oxidative stress.
Photos were taken from transgenic plants of carrying bZIP68L157A-eYFP (A-F)
or bZIP68L160A-eYFP (G-L) under the normal condition (A-C, and G-I) and
under the ROS stressed condition (D-F, and J-L). For the oxidative stress
treatment, all of the seedlings were treated for 30 minutes with 5mM H2O2.
40
41
Figure 3.8 The L157A&L160A mutation partially hinders bZIP68’s shuttling
to the cytosol under oxidative stress.
The localization of the eYFP signal in the bZIP68L157A&L160A-eYFP transgenic
plants without (A, B, C) and with (D, E, F) the treatment by H2O2 for 30 minutes.
42
Leptomycin B (LMB) is a nuclear export inhibitor by modifying CRM1 (exportin
1), which recognizes NES to mediate transport of proteins from nuclei to
cytoplasm. The Arabidopsis Exportin 1 (AtXPO1/AtCRM1) can also be inhibited
by LMB (215). In the transgenic seedlings expressing bZIP68-eYFP, after the
seedlings were incubated with LMB first and then treated with the oxidative stress,
nucleocytoplasmic shuttling was also pronouncedly compromised (Fig
3.9A-3.9F).
43
.
Figure 3.9 The LMB treatment partially inhibited the nuclearcytoplasmic
shuttling of bZIP68-eYFP under oxidative stress.
eYFP signal in the bZIP68:bZIP68-eYFP seedlings after treatment with 80ng/ml
LMB for 24h of (A-C) and after 1 hour treatment with 5mM H2O2 (D, E, F)
following the LMB treatment.
44
3.3 The bzip68 mutation leads to elevated levels of expression of
stress-responsive genes including antioxidant genes
We obtained two T-DNA insertion lines for the bZIP68 gene. bzip68-1 carries a
T-DNA insertion at its promoter (-16 related to the putative transcription start site)
whereas bzip68-2 has an insertion in the eleventh exon (Fig 3.10A). The insertion
in bzip68-2 is expected to cause a deletion of 76 amino acid in the C’ terminus of
bZIP68 just after the basic domain of the protein. Using a pair of the primers
located in the 10th and 11th exons. The bZIP68 transcript level was found to be 74
fold and 163 folds reduced in bzip68-1 and bzip68-2, respectively. Indicating that
bzip68-1 and bzip68-2 are severe knockdown alleles (Fig 3.10B-3.10C). However,
it is remains to be determined whether the truncated protein of bzip68-2 allele
might have any function.
45
Figure 3.10 Structural organization of bZIP68 and the bzip68-1 and bzip68-2
mutants and the bZIP68 transcript levels in the wt and mutant plants.
(A) Diagram of bZIP68 gene organization and the location of T-DNA insertion
sites in bzip68-1 (SALK_065543) and bzip68-2 (SALK_094254C). The black
bars represent exons and the grey bars are the UTR regions. qF1 and qR1
represent the relative positions of primers used in quantitative real time PCR
analysis to detect AtbZIP68 transcripts. (B) and (C) QRT-PCR analysis results of
the AtbZIP68 expression levels in WT, bzip68-1 (B) and bzip68-2 (C) using
primers qF1 and qR1.
Error bars indicate standard deviation from three biological replicates. (t test;
*P<0.05,**P<0.01).
46
We employed high throughput RNA-sequencing (RNA-seq) to generate
transcriptome profiles from these two insertion lines and wt seedlings growing
under the normal agar medium for 14 days. Three biological replicates were
included for wt, bzip68-1, and bzip68-2. The average count of bZIP68 transcript
level in the three replicates of the bzip68-1 samples was 4 whereas the average
count in the three wt samples was 320, again indicating that the bzip68-1 is a
severe knock-down allele under the normal growth condition. The transcript level
were reduced by 2.3 folds in bzip68-2 mutant and 48.1 folds in bzip68-1
compared to the wt seedlings. It remains to be determined whether the truncated
protein from the bzip68-2 allele is functional. However, the bzip68-2 apparently
causes a similar effect to that by the bzip68-1 mutation on the overall the
transcriptome profiles (Fig 3.11).
47
Figure 3.11 A heat map of transcriptome profiles of wt and the mutant
seedlings of bzip68-1 and bzip68-2.
The heat map show of the differential expressed genes based on comparisons
between the wt and the bzip68 mutants. Their relative expression levels in each of
the three replicates are shown in color with red pixels as an indication of a higher
transcript level and green a lower level in the mutants. The genes expressed
differentially tended to show more similar expression profiles in the mutants than
48
in the wt seedlings and the difference between bzip68-1 and wt was more striking
than that between bzip68-2 and wt.
49
The genes whose expression levels differed more than 2 folds (with a FDR of
smaller than 0.05) are regarded as “differentially expressed genes” in the thesis.
Overall, bzip68-1 and bzip68-2 exhibited more similar global gene expression
profiles compared to the wt profile. However, the differences in the expression
levels of those differentially expressed genes tended to be more striking between
bzip68-1 and wt than those between bzip68-2 and wt (Fig 3.11), indicating that
bzip68-1 is a stronger allele than bzip68-2.
Gene ontology (GO) enrichment analysis (Table 3.1) revealed that the most
significantly enriched GO terms among the genes expressed at a higher level in
the bzip68-1 are “oxidative stress responsive genes and defense responsive genes”.
Table 3.2 lists the differentially expressed genes that belong to the GO terms
related to stress response such as defense response and oxidative stress responses.
These groups of genes showed similar profiles in bzip68-1 and bzip68-2 mutants
compared to that of wt (Fig 3.12A-3.12B).
Among the genes encoding for antioxidant system are two methionine
sulfoxide reductase which are involved in reducing oxidized methionines of a
protein, a GST, two peroxidases, two myo-inositol oxygenases (MIOXs) that are
involved in ascorbate synthesis, and several Abscisic acid (ABA) and
pathogen-responsive genes (Table 3.3). The expression levels of the few
differentially expressed genes were further examined by quantitative real time
RT-PCR (qPCR), the results were consistent with those from the RNA-seq
analysis (Fig 3.13).
50
Table 3.1 Gene ontology (GO) categories enriched among the genes expressed at higher levels in bzip68-1 and bzip68-2 than in wildtype.
Data set GO ID Term Count PValue Fold
Enrichment Benjamini
bzip68-1/
wildtype
GO:0019825 oxygen binding 31 3.07E-06 2.59 2.24E-04
GO:0006952 defense response 99 5.97E-09 1.81 6.89E-07
GO:0006955 immune response 39 2.70E-07 2.51 1.76E-05
GO:0045087 innate immune response 36 1.25E-06 2.47 6.84E-05
GO:0006979 response to oxidative stress 31 2.85E-04 2.04 8.67E-03
bzip68-2/
wildtype
GO:0045454 cell redox homeostasis 13 2.88E-03 2.74 9.83E-02
GO:0006979 response to oxidative stress 20 3.11E-03 2.11 9.76E-02
GO:0006800
oxygen and reactive oxygen species metabolic
process 11 3.16E-03 3.06 9.57E-02
GO:0042744 hydrogen peroxide catabolic process 10 1.89E-03 3.56 8.31E-02
GO:0070301 cellular response to hydrogen peroxide 10 1.89E-03 3.56 8.31E-02
GO:0006955 immune response 24 1.09E-04 2.48 7.46E-03
GO:0016667
oxidoreductase activity, acting on sulfur group of
donors 13 1.24E-04 3.89 5.29E-03
GO:0015035 protein disulfide oxidoreductase activity 10 4.23E-05 5.87 2.72E-03
GO:0030613
oxidoreductase activity, acting on phosphorus or
arsenic in donors 6 4.78E-05 13.59 2.63E-03
GO:0055114 oxidation reduction 72 5.00E-07 1.84 8.24E-05
51
Significantly enriched GO terms with FDR of enrichment scores is less than 0.05 among the high-confidence bZIP68 regulation genes by
Molecular Function. Numbers of “count” means the median read count of genes in category. “Fold enrichment” indicates the function of
intensity.
52
53
Figure 3.12 The heat maps of expression profiles of the differentially
expressed genes between wt and bzip68-1 and bzip68-2 in the categories of
oxidative stress response (A) and defense response (B).
54
Table 3.2 Differentially expressed genes between wt and the bzip68 mutants that were shown in the heat map (Fig 3.12).
Gene ID Gene names 68-1/WT 68-2/WT Gene Description
Antioxidant system
AT1G14540 PER4 16.2 8.3 Peroxidase superfamily protein
AT1G68850 PER11 1.2 0.0 Peroxidase superfamily protein
AT2G18150 PER15 1.8 0.3 Peroxidase superfamily protein
AT2G24800 PER18 4.2 0.5 Peroxidase superfamily protein
AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein
AT2G38380 PER22 2.7 1.1 Peroxidase superfamily protein
AT2G38390 PER23 2.2 0.5 Peroxidase superfamily protein
AT3G01420 ALPHA-DOX1 2.0 2.2 Peroxidase superfamily protein
AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1
AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein
AT4G08770 Prx37 0.0 2.2 Peroxidase superfamily protein
AT4G30170 PER45 0.6 7.3 Peroxidase family protein
AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein
AT4G36430 PER49 2.1 0.6 Peroxidase superfamily protein
AT5G05340 PER52 0.3 1.1 Peroxidase superfamily protein
AT5G17820 PER57 0.0 3.5 Peroxidase superfamily protein
AT5G19880 PER58 0.0 5.8 Peroxidase superfamily protein
AT5G39580 PER62 23.3 18.3 Peroxidase superfamily protein
AT5G47000 PER65 2.9 8.2 Peroxidase superfamily protein
55
AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein
Redox response
AT1G06620
5.1 1.3 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily
protein
AT1G13080 CYP71B2 1.3 0.4 cytochrome P450, family 71, subfamily B, polypeptide 2
AT1G17420 LOX3 6.1 1.4 lipoxygenase 3
AT1G17745 PGDH 0.4 1.3 D-3-phosphoglycerate dehydrogenase
AT1G19630 CYP722A1 1.7 1.1 cytochrome P450, family 722, subfamily A, polypeptide 1
AT1G25230 PAP4 1.2 0.5 Calcineurin-like metallo-phosphoesterase superfamily protein
AT1G29690 CAD1 2.3 2.2 MAC/Perforin domain-containing protein
AT1G64500
1.3 0.5 Glutaredoxin family protein
AT1G65860 FMO GS-OX1 1.4 1.1 flavin-monooxygenase glucosinolate S-oxygenase 1
AT1G66540
1.4 0.3 Cytochrome P450 superfamily protein
AT1G72520 LOX4 8.0 4.0 PLAT/LH2 domain-containing lipoxygenase family protein
AT1G72610 GLP1 2.3 0.9 germin-like protein 1
AT1G77760 NIA1 0.5 1.6 nitrate reductase 1
AT2G06050 OPR3 5.8 1.3 oxophytodienoate-reductase 3
AT2G19800 MIOX2 12.6 7.2 myo-inositol oxygenase 2
AT2G22330 CYP79B3 3.5 1.7 cytochrome P450, family 79, subfamily B, polypeptide 3
AT2G27690 CYP94C1 3.9 1.6 cytochrome P450, family 94, subfamily C, polypeptide 1
AT2G29090 CYP707A2 1.3 0.7 cytochrome P450, family 707, subfamily A, polypeptide 2
AT2G29350 SAG13 0.0 3.6 senescence-associated gene 13
AT2G34770 FAH1 2.3 1.0 fatty acid hydroxylase 1
AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein
AT2G42580 TTL3 2.6 1.1 tetratricopetide-repeat thioredoxin-like 3
56
AT3G03470 CYP89A9 0.0 1.1 cytochrome P450, family 87, subfamily A, polypeptide 9
AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1
AT3G26290 CYP71B26 1.1 0.5 cytochrome P450, family 71, subfamily B, polypeptide 26
AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein
AT3G30775 ERD5 5.8 2.7 Methylenetetrahydrofolate reductase family protein
AT4G04840 ATMSRB6 2.3 1.7 methionine sulfoxide reductase B6
AT4G12290
0.1 1.3 Copper amine oxidase family protein
AT4G14690 ELIP2 0.0 1.5 Chlorophyll A-B binding family protein
AT4G15690 GRXS5 0.8 1.5 Thioredoxin superfamily protein
AT4G15700 GRXS3 1.1 1.9 Thioredoxin superfamily protein
AT4G20830
1.3 0.8 FAD-binding Berberine family protein
AT4G21850 ATMSRB9 4.4 1.5 methionine sulfoxide reductase B9
AT4G22880 LDOX 1.1 0.5 leucoanthocyanidin dioxygenase
AT4G30210 ATR2 1.3 0.8 P450 reductase 2 [Source:TAIR__Acc:AT4G30210]
AT4G31500 CYP83B1 1.0 0.1 cytochrome P450, family 83, subfamily B, polypeptide 1
AT4G33040 GRXC6 2.3 2.2 Thioredoxin superfamily protein
AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein
AT4G37320 CYP81D5 1.1 0.5 cytochrome P450, family 81, subfamily D, polypeptide 5
AT4G37370 CYP81D8 1.2 0.1 cytochrome P450, family 81, subfamily D, polypeptide 8
AT5G05600
5.0 0.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily
protein
AT5G06690 WCRKC1 1.3 0.5 WCRKC thioredoxin 1
AT5G07440 GDH2 3.6 1.6 glutamate dehydrogenase 2
AT5G15350 ENODL17 1.5 1.6 early nodulin-like protein 17
AT5G20230 ATBCB 3.5 2.1 blue-copper-binding protein
57
AT5G24030 SLAH3 8.3 4.4 SLAC1 homologue 3
AT5G36220 CYP81D1 0.0 1.0 cytochrome p450 81d1
AT5G44070 CAD1 1.2 0.7 phytochelatin synthase 1 (PCS1)
AT5G45340 CYP707A3 1.5 2.8 cytochrome P450, family 707, subfamily A, polypeptide 3
AT5G52320 CYP96A4 3.5 0.5 cytochrome P450, family 96, subfamily A, polypeptide 4
AT5G57220 CYP81F2 2.3 1.9 cytochrome P450, family 81, subfamily F, polypeptide 2
AT5G61440 ACHT5 0.5 1.8 atypical CYS HIS rich thioredoxin 5
AT5G63450 CYP94B1 7.2 2.1 cytochrome P450, family 94, subfamily B, polypeptide 1
AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein
Defense response
AT1G14870 PCR2 2.7 0.4 PLANT CADMIUM RESISTANCE 2
AT1G17380 JAZ5 3.1 0.9 jasmonate-zim-domain protein 5
AT1G17420 LOX3 6.1 1.4 lipoxygenase 3
AT1G19020
3.2 1.8 unknown protein
AT1G19180 TIFY10A 1.5 0.3 jasmonate-zim-domain protein 1
AT1G19630 CYP722A1 1.7 1.1 cytochrome P450, family 722, subfamily A, polypeptide 1
AT1G21250 WAK1 0.0 2.2 cell wall-associated kinase
AT1G27770 ACA1 2.2 1.8 autoinhibited Ca2+-ATPase 1
AT1G28380 NSL1 1.6 0.7 MAC/Perforin domain-containing protein
AT1G29690 CAD1 2.3 2.2 MAC/Perforin domain-containing protein
AT1G52200 PCR8 2.5 0.2 PLAC8 family protein
AT1G52410 TSA1 1.0 0.1 TSK-associating protein 1
AT1G56510 WRR4 1.8 1.0 Disease resistance protein (TIR-NBS-LRR class)
AT1G59870 PEN3 2.1 0.4 ABC-2 and Plant PDR ABC-type transporter family protein
AT1G61100
2.6 1.5 disease resistance protein (TIR class), putative
58
AT1G63750
3.3 2.6 Disease resistance protein (TIR-NBS-LRR class) family
AT1G63860
5.8 3.1 Disease resistance protein (TIR-NBS-LRR class) family
AT1G64760
1.8 1.4 O-Glycosyl hydrolases family 17 protein
AT1G66090
0.3 1.2 Disease resistance protein (TIR-NBS class)
AT1G70700 JAZ9 2.0 0.4 TIFY domain/Divergent CCT motif family protein
AT1G72060
2.6 0.3 serine-type endopeptidase inhibitors
AT1G72520 LOX4 8.0 4.0 PLAT/LH2 domain-containing lipoxygenase family protein
AT1G72920
1.8 0.2 Toll-Interleukin-Resistance (TIR) domain family protein
AT1G73080 PEPR1 2.1 0.8 PEP1 receptor 1
AT1G74950 JAZ2 2.2 0.4 TIFY domain/Divergent CCT motif family protein
AT1G75230
1.6 0.4 DNA glycosylase superfamily protein
AT1G76650 CML38 2.6 2.9 calmodulin-like 38
AT1G77760 NIA1 0.5 1.6 nitrate reductase 1
AT1G80130
0.9 1.4 Tetratricopeptide repeat (TPR)-like superfamily protein
AT2G01180 ATPAP1 2.6 2.0 phosphatidic acid phosphatase 1
AT2G13790 ATSERK4 1.5 0.3 somatic embryogenesis receptor-like kinase 4
AT2G17480 MLO8 1.4 0.5 Seven transmembrane MLO family protein
AT2G22330 CYP79B3 3.5 1.7 cytochrome P450, family 79, subfamily B, polypeptide 3
AT2G26560 PLP2 4.0 0.0 phospholipase A 2A
AT2G27500
1.7 1.0 Glycosyl hydrolase superfamily protein
AT2G27690 CYP94C1 3.9 1.6 cytochrome P450, family 94, subfamily C, polypeptide 1
AT2G34600 JAZ7 3.5 1.7 jasmonate-zim-domain protein 7
AT2G34770 FAH1 2.3 1.0 fatty acid hydroxylase 1
AT2G34930
2.1 0.4 disease resistance family protein / LRR family protein
AT2G35930 PUB23 1.1 1.0 plant U-box 23
59
AT2G37130 PER21 1.0 0.3 Peroxidase superfamily protein
AT2G41100 TCH3 2.9 2.3 Calcium-binding EF hand family protein
AT2G41110 CAM2 1.7 1.0 calmodulin 2
AT2G43290 MSS3 1.6 1.2 Calcium-binding EF-hand family protein
AT2G43530 ATTI3 1.4 0.0 Scorpion toxin-like knottin superfamily protein
AT2G43550 ATTI6 1.5 1.0 Scorpion toxin-like knottin superfamily protein
AT3G03190 ATGSTF11 1.2 2.2 glutathione S-transferase F11
AT3G03470 CYP89A9 0.0 1.1 cytochrome P450, family 87, subfamily A, polypeptide 9
AT3G10300 CML49 3.3 1.1 Calcium-binding EF-hand family protein
AT3G13750 BGAL1 1.4 0.5 beta galactosidase 1
AT3G15210 ATERF-4 2.1 1.0 ethylene responsive element binding factor 4
AT3G17860 JAZ3 2.6 0.6 jasmonate-zim-domain protein 3
AT3G28200 PER31 1.7 1.1 Peroxidase superfamily protein
AT3G30775 ERD5 5.8 2.7 Methylenetetrahydrofolate reductase family protein
AT3G44300 NIT2 0.0 3.7 nitrilase 2
AT3G47340 ASN1 7.1 3.2 glutamine-dependent asparagine synthase 1
AT3G48360 BT2 5.5 6.5 BTB and TAZ domain protein 2
AT3G52400 SYP122 2.4 1.4 syntaxin of plants 122
AT3G57530 CPK32 0.9 1.2 calcium-dependent protein kinase 32
AT4G01250 WRKY22 1.4 1.5 WRKY family transcription factor
AT4G02380 SAG21 1.4 0.4 senescence-associated gene 21
AT4G12720 NUDT7 1.4 1.0 MutT/nudix family protein
AT4G14400 ACD6 1.0 4.4 ankyrin repeat family protein
AT4G14690 ELIP2 0.0 1.5 Chlorophyll A-B binding family protein
AT4G19520
3.4 1.3 disease resistance protein (TIR-NBS-LRR class) family
60
AT4G19530
1.4 0.6 disease resistance protein (TIR-NBS-LRR class) family
AT4G20110 VSR7 0.0 1.6 VACUOLAR SORTING RECEPTOR 7
AT4G20260 ATPCAP1 1.1 0.2 plasma-membrane associated cation-binding protein 1
AT4G20830
1.3 0.8 FAD-binding Berberine family protein
AT4G23190 CRK11 1.7 1.1 cysteine-rich RLK (RECEPTOR-like protein kinase) 11
AT4G26850 VTC2 1.2 0.4 mannose-1-phosphate guanylyltransferase (GDP)s__GDP-galactose
AT4G31500 CYP83B1 1.0 0.1 cytochrome P450, family 83, subfamily B, polypeptide 1
AT4G31800 WRKY18 9.5 3.9 WRKY DNA-binding protein 18
AT4G33420 PER47 1.2 0.5 Peroxidase superfamily protein
AT4G34410 RRTF1 7.7 3.5 redox responsive transcription factor 1
AT4G35770 SEN1 3.5 0.6 Rhodanese/Cell cycle control phosphatase superfamily protein
AT5G06860 PGIP1 1.1 0.4 polygalacturonase inhibiting protein 1
AT5G06870 PGIP2 2.9 0.6 polygalacturonase inhibiting protein 2
AT5G07440 GDH2 3.6 1.6 glutamate dehydrogenase 2
AT5G13220 JAZ10 6.9 2.4 jasmonate-zim-domain protein 10
AT5G20230 ATBCB 3.5 2.1 blue-copper-binding protein
AT5G22690
3.6 2.3 Disease resistance protein (TIR-NBS-LRR class) family
AT5G26220
0.8 1.0 ChaC-like family protein
AT5G36220 CYP81D1 0.0 1.0 cytochrome p450 81d1
AT5G37770 TCH2 1.6 2.0 EF hand calcium-binding protein family
AT5G41740
0.6 1.5 Disease resistance protein (TIR-NBS-LRR class) family
AT5G41750
1.5 0.5 Disease resistance protein (TIR-NBS-LRR class) family
AT5G44070 CAD1 1.2 0.7 phytochelatin synthase 1 (PCS1
AT5G44420 PDF1.2 0.0 5.1 plant defensin 1.2
AT5G45340 CYP707A3 1.5 2.8 cytochrome P450, family 707, subfamily A, polypeptide 3
61
The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.
AT5G45380 ATDUR3 0.2 2.1 solute:sodium symporters__urea transmembrane transporters
AT5G47230 ERF5 2.8 0.6 ethylene responsive element binding factor 5
AT5G48850 ATSDI1 0.9 1.4 Tetratricopeptide repeat (TPR)-like superfamily protein
AT5G57220 CYP81F2 2.3 1.9 cytochrome P450, family 81, subfamily F, polypeptide 2
AT5G58120
0.9 1.0 Disease resistance protein (TIR-NBS-LRR class) family
AT5G59780 MYB59 0.4 1.4 myb domain protein 59
AT5G61600 ERF104 4.7 0.7 ethylene response factor 104
AT5G63450 CYP94B1 7.2 2.1 cytochrome P450, family 94, subfamily B, polypeptide 1
AT5G64120 PER71 2.9 0.8 Peroxidase superfamily protein
AT5G66210 CPK28 2.8 2.1 calcium-dependent protein kinase 28
AT5G67300 ATMYBR1 1.9 1.3 myb domain protein r1
62
Table 3.3 Examples of antioxidant genes and stress response genes that were expressed at the higher levels in the bzip68 mutants
compared with the WT plants.
Gene ID Gene names bzip68-1/WT bzip68-2/WT Functions
AT5G39580 PER62 18.4 11.3 Peroxidase superfamily protein
AT2G19800 MIOX2 9.2 5.3 myo-inositol oxygenase 2; ascorbate synthesis
AT1G35140 PHI-1 7.5 7.0 Phosphate-responsive 1 family protein
AT1G64380 ERF061 7.0 2.6 Integrase-type DNA-binding protein
AT4G31800 WRKY18 6.1 3.5 WRKY DNA-binding protein 18
AT4G21830 ATMSRB7 6.1 4.3 methionine sulfoxide reductase
AT1G09950 RAS1 6.1 2.8 RESPONSE TO ABA AND SALT 1
AT1G14540 PER4 5.7 5.3 Peroxidase superfamily protein
The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.
63
64
Figure 3.13 qRT-PCR analysis of selective stress-related genes.
(A), defense related gene (B), stress response genes (C, D) in wt, bzip68-1 and
bzip68-2 seedlings to identify the RNA-SEQ data. Error bars indicate standard
deviation from three biological repeats. (t test; *P< 0.05, **P<0.01).
65
We also generated transcriptome profiles of the wt and mutant seedlings that were
under the treatment with 5 mM H2O2 for 90 minutes. Many genes that were
expressed at higher levels in the bzip68 mutants under the normal condition were
found to be among the ROS-responsive genes (Fig 3.14). Table 3.1 list the
differentially expressed genes related to stress response under H2O2 treatment
between wt and bzip68 mutants, and the differences in their expression levels
between mock treated and H2O2-treated in wt seedlings (S Table 3.1).
Figure 3.14 Venn diagram comparisons of differentially expressed genes.
Numbers of defense related genes (left panel), antioxidant genes (middle panel),
and oxidative stress responses (right panel) that were expressed at a higher level
in the bzip68 mutants than in wt under the normal condition in comparison with
the numbers of those groups of genes that were induced by ROS in the wt
seedling.
66
3.4 The bzip68 mutant showed an enhanced response to the oxidative stress
treatment
When growing in soil or the solid growth medium under the normal growth
condition, the bzip68 mutant plants were slightly smaller than wt plants and
showed a slight delay in flowering (Fig 3.15A-3.15D). The bzip68-1 mutant
morphological phenotype under the normal condition was genetically
complemented by the genomic clone of bZIP68. (Fig 3.15E, 3.15F).
67
Figure 3.15 The morphology of the bzip68 mutants under the normal
conditions.
The bzip68-1 mutant plants were slightly smaller than WT plants and displayed a
delay in flowering time. The plant were grown for 3 weeks and 5 weeks under
long day (A and B, respectively), and short day (C and D, respectively) in soil.
The bzip68-1 mutant plant which carried the bZIP68 transgene showed no
morphological difference from the wt seedlings at 3 weeks (E) and 5 weeks (F)
under long day condition.
68
To determine whether the bzip68 mutations alter the oxidative stress response and
tolerance, oxidative stress was introduced to wt and the mutant seedlings by
growing them on the agar medium with or without tertiary-butyl hydroperoxide
(TBHP). TBHP causes oxidative stress by production of ROS and/or by depletion
of reduced form of GSH. TBHP is much more stable than H2O2, making it more
suitable than H2O2 for a phenotypic analysis described here which involve long
term oxidative stress treatment. In presence of 0.4 mM TBHP in the growth
medium, the seedlings accumulated more anthocyanin and showed growth
retardation for both the wt and mutant seedlings (Fig 3.16A-3.16B). Anthocyanins
and other flavonoids are known to act as antioxidants in plants and anthocyanin
accumulation is a characteristic response of plants to environmental stresses.
Genes involved in anthocyanin biosynthesis are regulated by hydrogen peroxide
and various stresses (Vanderauwera et al., 2005; Fini et al., 2011). More
anthocyanin accumulation was displayed in the bzip68-1 seedlings than in the wt
seedlings under the oxidative stress (Fig 3.16a1-3.16b3). Besides, under the stress,
the bzip68-1 seedlings showed more reduced growth than the wt seedlings. The
phenotypic difference between the bzip68-2 seedlings and the wt seedlings was
not very obvious. The bzip68-1 mutant transformed with a genomic clone of
bZIP68 was found to have a phenotype indistinguishable from the wt seedlings
under the normal conditions and under the TBHP treatment (Fig 3.16C-3.16D),
indicating again that the bzip68 phenotype is caused by a loss-of-function
mutation of the bZIP68 gene.
69
Figure 3.16 The morphological phenotypes of wt and bzip68-1 seedlings
under oxidative stress.
Wt and mutant seedlings on the growth medium without (A) and with (B) 0.4 mM
tert-Butyl hydroperoxide (TBHP). The bzip68-1 seedlings displayed enhanced
accumulation of anthocyanin and smaller than wt seedlings under the TBHP. (C)
The close up views of some seedlings shown in A and B. (D) and (E) shows the
bzip68-1 phenotype were complemented by transforming the mutant with the
bZIP68 genomic clone. The seedlings were 7 days old under the long day
condition.
70
3.5 The bzip68-1 mutant showed an enhanced stress response under cold
Anthocyanin accumulation is known to be induced by cold. When wt and bzip68
seeds were germinated and the seedling grew under 15C, more pronounced purple
pigmentation was seen in the bzip68-1 seedlings than in the wt seedlings (Fig
3.17A-3.17D). Seedling growth was also more reduced under the low temperature
for the mutant than the wt. The phenotypic difference was more obvious when
seedlings were grown on vertical plates (Fig 3.17E). The purple color
accumulation and grown retardation were also observed in soil grown bzip68-1
(Fig 3.17H-3.17M). The bzip68-1 mutant phenotype under the cold stress can also
be genetically complemented by the genomic clone of bZIP68 (Fig 3.17G).
To examine whether the subcellular localization of bZIP68 might alter under
the cold stress, the bZIP68-eYFP seedlings were placed under 4 ºC and the YFP
signal was observed. We observed some level of the YFP signal in both the
cytoplasm and nuclei after several hours of the cold treatment (Fig 3.17N).
71
72
73
Figure 3.17 The phenotypes of wt and bzip68-1 mutant under cold stress.
7-days and 15 days old seedlings under normal temperature (A, E) and 15 ºC (B,
C, F) respectively. (D) The close up views of some seedlings shown in A, B and C.
74
(G) Complementation of the mutant phenotype by the genomic clone of bZIP68.
(H-J) Seedlings grown under 15ºC in soil. (Q) A portion of a 10 days old seedling
of the 35S::bZIP68-eYFP line which was grown in normal temperature and then
placed at 4ºC for overnight before observing for YFP signal.
75
Chapter 4 Discussion
Aerobic organisms are under constant threat by ROS. Adverse environmental
conditions result in excessive production of ROS that damage biomolecules,
leading to oxidative stress. Living organisms have evolved complex mechanisms
to sense various oxidative stresses to activate an appropriate physiological and
developmental response. Redox signaling is apparently initiated by
redox-sensitive proteins whose function can be switched on and off by its
reduction/oxidation and eventually leads to activation of genes encoding for
proteins involved in enhancing the cellular reducing potential, in detoxification of
ROS, and in repairing ROS-induced damage.
In Escherichia coli a transcription factor called OxyR is required for the
induction of H2O2 response genes (156). H2O2 activates OxyR by formation of
intramolecular disulfide linkages between Cys-199 and Cys-208. Disulfide bond
formation presumably causes a conformational change in OxyR that results in
enhanced DNA binding and the activation of H2O2 response genes (216, 217). In
yeast, Yap1, which is a bZIP protein, is normally localized in the cytosol. Upon,
oxidative stress, Yap1 is oxidized that results in its translocation to nuclei and the
subsequent induction of a number of genes involved in combating oxidative stress
including thioredoxin system genes. As the levels of H2O2 subside, disulfides of
oxidized Yap1 protein are reduced by thioredoxin, resulting in cytoplasmic
localization of Yap1 and loss of Yap1-dependent gene expression.
4.1 bZIP68 directly or indirectly senses perturbation of cellular redox states
We previously found that Cys320 of the Arabidopsis bZIP68 underwent reversible
oxidation in Arabidopsis cells upon H2O2 treatment. In this study, it was found
bZIP68 is localized in nuclei under normal growth condition but some of them
were found in the cytoplasm in the seedlings treated with H2O2. The change of
subcellular localization of bZIP68 under oxidative stress is dependent on the
76
redox-sensitive Cys320 and the intact NES, and mutations in Cys320 and the NES
cause bZIP68 to be constitutively nuclear, indicating that the localization are
controlled through redox control and regulated nuclear export.
There are several mechanisms to regulate signal/importin-dependent nuclear
protein transport, enhanced by phosphorylation, and inhibited by intermolecular
or phosphorylation masking of targeting signals (218). Short NES peptides can
mediate export when fused to the N-terminus of a reporter protein, and preference
of a-helical structure in NES regions, which may use for new protein interaction
(214). Importantly, in yeast, a bZIP transcription factor Pap1 is required for
inducing oxidative stress response gene on imposition of oxidative stress. Pap1 is
also regulated by changes in subcellular localization in response to oxidative
stress. The nuclear-cytoplasmic shuttling of Pap1 is mediated by CRM1/exportin1
(219). In addition, two cysteine (Cys278 and Cys501) in Pap1 are subject to
reversible modification during redox sensing (220). What’s more, bZIP10 in
Arabidopsis are also compromised by LMB treatment. bZIP10 is involved in
pathogen-induced HR and basal defense response and may be have a function in
oxidative stress signaling as it could partially rescues pap1 (221). The oxidative
stress of Yap1 leads to the modification of NES that can be recognized by export
receptor Crm1/Xpo1, which is important for the nuclear export of Yap1 (163). For
the well-known redox sensor in NPR1, the nuclear translocation which induced by
redox changes are required for the induction of defense gene.
Our findings suggests that bZIP68 might directly or indirectly sense cellular
redox status, and the Cys320 and NES dependent nucleocytoplasmic shuttling
involved in fulfilling the function of a redox sensor. Nucleocytoplasmic shuttling
is a common phenomenon for redox sensors as mentioned earlier in the case of
YAP1 mediated redox control.
77
4.2 bZIP68 links the redox change to activation of oxidative stress defense
genes through redox regulation of transcription
The loss-of-function mutation of bZIP68 causes elevated expression of many
stress-related genes, indicating that bZIP68 plays a role of a transcriptional
repressor that suppresses a range of oxidative stress response genes under the
normal growth conditions. Our results suggest that oxidation of bZIP68 under
oxidative stress apparently causes its conformational change and its NES is then
recognized by exportin, leading to its shuttling from nuclei to cytoplasm, resulting
in de-repression of the stress-responsive genes. The genes that are suppressed by
bZIP68 include those that encodes for antioxidant proteins such as methionine
sulfoxide reductases which are involved in reduced oxidized methionine
(ATMSRB7), a GST (ATGSTF11), two myo-inositol oxygenases (MIOX1, MIOX2)
that are involved in ascorbate synthesis. About 25% differentially expressed genes
between the bzip68 mutant and wt seedlings are predicted to be involved in
defense.
4.3 bZIP68 mediates plant abiotic stress responses
Different environmental stresses might lead to different oxidative stresses that
differ in ROS species, concentration, subcellular distribution, and duration of the
imposed stress. Therefore, cellular responses might be fine-tuned toward different
oxidative stresses through multiple pathways that coordinate to regulate shared
and different sets of target genes. Such a regulation might be coordinated by
several redox-sensitive transcription factors whose redox states might are
differentially altered under different ROS stresses.
The bZIP68 mutations was found to accumulate a much higher level of
anthocyanins under cold stress than wt plants, indicating a stronger oxidative
stress response caused by the cold treatment. bZIP-eYFP was also found to
undergo nucleocytoplasmic shuttling when the seedlings were placed under 4ºC
78
for several hours. These results also indicate that bZIP68 plays a role in
responding to cold stress. It is likely that the cold treatment also disturbs redox
homeostasis that is sensed by bZIP68. Its oxidation and translocation to the
cytoplasm helps transcriptional reprogramming to cope with the cold stress.
4.4 Conclusion and Working model
Figure 4.1 is our working to explain the mode of action of bZIP68. Under the
normal condition, bZIP68 is translocated to nuclei mediated by recognition of its
NLS by importin where it acts as a suppressor to inhibit the expression of some
oxidative stress response gene. Under oxidative stress, bZIP68 undergoes
reversible oxidative modification which may alter its conformation and exposes
its NES that is then recognized by exportin for its translocation to the cytoplasm.
Redistribution of bZIP68 can lead to some level of relieving of its suppressed
gene. The degree of its oxidation and relative nucleus-cytoplasm distribution are
likely dependent on types and severity of environmental stresses, thereby
fine-tuning transcription regulation of stress response genes. When the
environment returns to normal, oxidized bZIP68 may be reduced by another
protein (such as a thioredoxin) that results in its shuttling back to nuclei to again
suppress stress response genes.
79
Figure 4.1 A working model on the molecular mode of action of bZIP68.
bZIP68 is predicted to be in the nucleus as it contains a nuclear localization signal
(NLS). In normal condition, bZIP68 acts as a suppressor to inhibit the expression
of some ROS-responsive genes. While, bZIP68 also contains a nuclear export
signal (NES) which may be blocked under normal condition, under oxidative
stress, bZIP68 undergo reversible oxidative modification which may relieve the
block of those specific genes, leading to the expression of those genes for the
acclimation processes, the other consequence of the changes of conformation is:
the nuclear export signal (NES) was recognized in oxidized conformation, the
exposed NES allow the oxidized bZIP68 transport from the nucleus to the
cytoplasm through nuclear pores. In the cytoplasm, the oxidized bZIP68 may be
reduced by other proteins.
80
Although ours and previous studies on in vitro sensitivity of bZIP68 to ROS
suggests that bZIP68 could be a direct sensor of cellular redox states, we could
not rule out the possibility that another protein such as thioredoxin might sense
oxidative stress and becomes oxidized, which then causes oxidation of bZIP68.
Similarly, it is expected that oxidized bZIP68 will be reduced likely by another
protein when cellular redox state returns to normal. Reduced bZIP68 exposes its
NLS region which is recognized by importin for its shuttling back into nuclei.
Either directly or indirectly, bZIP68 apparently is a key player in sensing cellular
redox states and modulating expression of oxidative stress response genes.
In addition to bZIP68, we also identified GBF1 as a redox-sensitive protein
that underwent reversible oxidation of its thiol in the H2O2-stressed cells in
previous work. The redox-sensitive cysteines in bZIP68 and GBF1 are in the
conserved region. In addition, bZIP16 and other GBF proteins are also known to
be redox-sensitive at least in the in-vitro conditions. These bZIP proteins are
grouped into the F subgroup due to their high sequence similarity. These bZIP
subfamily members were found to form heterodimmers with each other. It is
possible that this bZIP transcriptional factors response to different oxidative
stresses to coordinate oxidative stress responses by redox control of transcription
of different target genes.
To further understand the role of bZIP68, we are carrying out chromatin
immunoprecipitation (ChIP) followed by high-throughput DNA sequencing
(ChIP-seq) to identify direct target genes controlled by bZIP68. The identification
of its direct targets and analysis of expression patterns of those target genes under
various stress conditions will further shed light on the mechanisms of
transcriptional regulation of the stress response mediated by bZIP68.
81
Supplementary Table 1 Differentially expressed genes between wt and the bzip68 mutants under H2O2 treatment and the differences in their
expression levels between mock and treated and ROS-treated seedlings.
Gene ID Gene names
WT
ROS
T/Mock
ROS
Treatment
bzip68-1/WT
ROS
Treatment
bzip68-2/WT
Gene Description
AT1G55010 PDF1.5 -8.6 6.9 8.9 plant defensin 1.5
AT3G25880
-10.0 5.2 7.4 NAD(P)-binding Rossmann-fold superfamily protein
AT1G63522
-7.6 5.9 7.3 Defensin-like (DEFL) family protein
AT4G11393
-7.9 5.7 5.7 Defensin-like (DEFL) family protein
AT5G18050
-4.0 4.0 5.5 SAUR-like auxin-responsive protein family
AT5G67010 ERF121 -3.2 3.3 5.4 Integrase-type DNA-binding superfamily protein
AT3G53200 AtMYB27 -5.5 4.9 4.9 myb domain protein 27
AT3G22360 AOX1B -4.2 3.8 4.4 alternative oxidase 1B
AT4G37500
-5.1 3.7 4.3 Aldehyde oxidase/xanthine dehydrogenase,
molybdopterin binding protein
AT5G57420 IAA33 -5.0 4.0 4.3 indole-3-acetic acid inducible 33
AT2G04395 POT1C -1.5 1.7 4.1 Nucleic acid-binding, OB-fold-like protein
AT5G18010
-2.8 3.4 3.9 SAUR-like auxin-responsive protein family
AT3G24510
-4.0 4.7 3.7 Defensin-like (DEFL) family protein
AT4G22217
-4.3 3.1 2.9 Arabidopsis defensin-like protein
AT2G21260
-2.1 0.3 2.8 NAD(P)-linked oxidoreductase superfamily protein
AT1G49715
-1.5 2.9 2.6 Defensin-like (DEFL) family protein
82
AT1G29420
-2.8 3.0 2.5 SAUR-like auxin-responsive protein family
AT1G55290 F6'H2 -2.2 0.7 2.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase
superfamily protein
AT1G26870 FEZ -2.5 1.6 2.4 NAC (No Apical Meristem) domain transcriptional
regulator superfamily protein
AT3G56700 FAR6 0.3 -2.3 2.4 fatty acid reductase 6
AT5G56550 OXS3 0.3 2.3 2.4 oxidative stress 3
AT3G49630
-1.2 1.2 2.2 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase
superfamily protein
AT1G66370 MYB113 2.6 3.1 2.2 myb domain protein 113
AT2G30670
-1.5 1.9 2.2 NAD(P)-binding Rossmann-fold superfamily protein
AT1G24010
-1.8 2.4 2.0 Polyketide cyclase/dehydrase and lipid transport
superfamily protein
AT2G45130 ATSPX3 -2.4 2.2 2.0 SPX domain gene 3
AT1G12630 ERF027 -1.9 2.5 1.9 Integrase-type DNA-binding superfamily protein
AT1G62886
-2.8 -6.2 1.9 Nucleotide excision repair, TFIIH, subunit TTDA
AT2G17770 BZIP27 -2.0 1.5 1.9 basic region/leucine zipper motif 27
AT1G63390
-3.0 0.6 1.9 FAD/NAD(P)-binding oxidoreductase family protein
AT2G24850 TAT3 -1.3 2.3 1.9 tyrosine aminotransferase 3
AT5G42580 CYP705A12 -1.8 1.4 1.8 cytochrome P450, family 705, subfamily A, polypeptide
12
AT1G51802
-0.3 0.7 1.8 Encodes a defensin-like (DEFL) family protein.
AT3G23240 ERF1 2.3 1.6 1.8 ethylene response factor 1
AT2G07727 MT-CYB -2.3 2.8 1.7 Di-haem cytochrome, transmembrane__Cytochrome
b/b6, C-terminal
83
AT3G21460 GRXS10 -1.8 2.6 1.6 Glutaredoxin family protein
AT2G42885
-1.1 -4.5 1.6 Defensin-like (DEFL) family protein
AT3G13403
-1.8 1.6 1.6 Defensin-like (DEFL) family protein
AT5G13220 JAZ10 0.5 1.1 1.6 jasmonate-zim-domain protein 10
AT4G22620
-0.2 1.6 1.5 SAUR-like auxin-responsive protein family
AT1G26410
0.5 0.9 1.5 FAD-binding Berberine family protein
AT2G24940 AtMAPR2 -1.8 1.8 1.5 membrane-associated progesterone binding protein 2
AT3G03820
-2.8 0.4 1.5 SAUR-like auxin-responsive protein family
AT3G27831
-0.7 1.5 1.4 Gamma-thionin family protein
AT5G57450 XRCC3 -1.3 1.4 1.4 homolog of X-ray repair cross complementing 3
(XRCC3)
AT1G13608
7.1 -7.1 1.4 Defensin-like (DEFL) family protein
AT4G15680 GRXS4 -2.0 0.7 1.4 Thioredoxin superfamily protein
AT3G62960 GRXC14 0.1 0.0 1.4 Thioredoxin superfamily protein
AT4G19050
-0.2 0.7 1.4 NB-ARC domain-containing disease resistance protein
AT5G45240
0.1 0.9 1.4 Disease resistance protein (TIR-NBS-LRR class)
AT1G47510 AT5PTASE11 2.6 0.6 1.3 inositol polyphosphate 5-phosphatase 11
AT1G19830
-1.2 -0.5 1.3 SAUR-like auxin-responsive protein family
AT2G38340 DREB19 0.4 1.1 1.3 Integrase-type DNA-binding superfamily protein
AT1G03020 GRXS1 -0.7 1.2 1.3 Thioredoxin superfamily protein
AT5G48170 SLY2 -1.0 0.9 1.3 F-box family protein
AT1G75490 DREB2D -0.1 1.9 1.3 Integrase-type DNA-binding superfamily protein
AT4G25560 AtMYB18 -1.7 2.5 1.3 myb domain protein 18
AT5G40090
-1.8 1.0 1.2 Disease resistance protein (TIR-NBS class)
AT1G64195
0.4 1.3 1.2 Defensin-like (DEFL) family protein
84
AT1G80555
0.2 0.8 1.2 Isocitrate/isopropylmalate dehydrogenase family protein
AT3G12955
-1.9 1.3 1.2 SAUR-like auxin-responsive protein family
AT1G29440
-2.7 1.4 1.2 SAUR-like auxin-responsive protein family
AT1G10810
-0.7 0.3 1.1 NAD(P)-linked oxidoreductase superfamily protein
AT3G61400
-2.2 1.3 1.1 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase
superfamily protein
AT3G02000 ROXY1 -0.5 0.7 1.1 Thioredoxin superfamily protein
AT2G30770 CYP71A13 0.2 0.8 1.1 cytochrome P450, family 71, subfamily A, polypeptide 13
AT5G25370 PLDALPHA3 -0.9 1.2 1.1 phospholipase D alpha 3
AT2G28085
-0.7 1.1 1.1 SAUR-like auxin-responsive protein family
AT2G45900
-2.0 1.2 1.1 Phosphatidylinositol N-acetyglucosaminlytransferase
subunit P-related
AT1G75590
-0.9 0.7 1.1 SAUR-like auxin-responsive protein family
AT5G04330
-0.9 1.0 1.1 Cytochrome P450 superfamily protein
AT1G29500
-1.8 0.5 1.1 SAUR-like auxin-responsive protein family
AT1G30135 JAZ8 2.3 0.1 1.0 jasmonate-zim-domain protein 8
AT2G47190 ATMYB2 3.6 -0.6 1.0 myb domain protein 2
AT2G01090
-1.5 1.0 1.0 Ubiquinol-cytochrome C reductase hinge protein
AT2G12190
0.1 0.9 -1.0 Cytochrome P450 superfamily protein
AT4G37340 CYP81D3 -1.5 -0.8 -1.0 cytochrome P450, family 81, subfamily D, polypeptide 3
AT1G70860
-0.5 -0.6 -1.0 Polyketide cyclase/dehydrase and lipid transport
superfamily protein
AT5G56860 GNC -1.0 -0.4 -1.0 GATA type zinc finger transcription factor family protein
AT4G15380 CYP705A4 -1.2 -0.6 -1.0 cytochrome P450, family 705, subfamily A, polypeptide 4
AT1G48000 MYB112 -0.1 0.0 -1.1 myb domain protein 112
85
AT5G12870 ATMYB46 0.3 -0.3 -1.1 myb domain protein 46
AT3G61250 AtMYB17 0.0 -0.2 -1.1 myb domain protein 17
AT3G16360 AHP4 0.0 0.0 -1.1 HPT phosphotransmitter 4
AT1G31772
0.3 -7.1 -1.1 Defensin-like (DEFL) family protein
AT1G72950
1.6 -0.6 -1.2 Disease resistance protein (TIR-NBS class)
AT2G07671
-0.4 -0.1 -1.2 ATP synthase subunit C family protein
AT4G37580 HLS1 -0.3 0.1 -1.2 Acyl-CoA N-acyltransferases (NAT) superfamily protein
AT1G13150 CYP86C4 -0.1 -0.3 -1.2 cytochrome P450, family 86, subfamily C, polypeptide 4
AT2G02147 LCR73 1.2 0.7 -1.2 low-molecular-weight cysteine-rich 73
AT3G46130 ATMYB48-1 -1.2 -0.4 -1.2 myb domain protein 48
AT3G08040 FRD3 -1.0 0.0 -1.3 MATE efflux family protein
AT4G11210
-1.8 -0.5 -1.3 Disease resistance-responsive (dirigent-like protein)
family protein
AT5G16600 MYB43 -0.2 -0.8 -1.3 myb domain protein 43
AT5G19880 PER58 1.9 -0.3 -1.3 Peroxidase superfamily protein
AT3G61890 ATHB-12 0.8 -1.1 -1.3 homeobox 12
AT4G30064 LCR61 7.4 -0.8 -1.3 low-molecular-weight cysteine-rich 61
AT1G29450
-0.1 -1.1 -1.3 SAUR-like auxin-responsive protein family
AT3G53250
1.7 -0.8 -1.3 SAUR-like auxin-responsive protein family
AT3G46490
-0.1 0.2 -1.4 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase
superfamily protein
AT1G63370
-0.5 -1.5 -1.5 Flavin-binding monooxygenase family protein
AT1G80100 AHP6 -0.5 -1.4 -1.5 histidine phosphotransfer protein 6
AT5G63580 FLS2 0.3 -0.2 -1.5 flavonol synthase 2
AT2G37700
-1.5 0.5 -1.5 Fatty acid hydroxylase superfamily
86
AT1G33660
-0.3 -1.1 -1.6 peroxidase family protein
AT3G63360
0.1 -0.6 -1.7 defensin-related
AT3G26125 CYP86C2 1.1 -0.6 -1.7 cytochrome P450, family 86, subfamily C, polypeptide 2
AT1G03120 ATRAB28 0.1 -0.9 -1.8 responsive to abscisic acid 28
AT2G41480 PER25 -1.3 -1.0 -1.9 Peroxidase superfamily protein
AT1G47990 ATGA2OX4 1.5 -0.7 -2.0 gibberellin 2-oxidase 4
AT5G27780
7.8 -7.8 -2.0 SAUR-like auxin-responsive protein family
AT1G66030 CYP96A14P -1.3 -5.0 -2.1 cytochrome P450, family 96, subfamily A, polypeptide 14
pseudogene
AT1G53130 GRI -0.3 -0.4 -2.1 Stigma-specific Stig1 family protein
AT5G48905 LCR12 0.3 -0.9 -2.2 low-molecular-weight cysteine-rich 12
AT1G76190
1.3 -2.0 -2.3 SAUR-like auxin-responsive protein family
AT1G62580
1.0 -1.5 -2.3 Flavin-binding monooxygenase family protein
AT1G43040
2.0 -0.1 -2.5 SAUR-like auxin-responsive protein family
AT3G56380 ARR17 -1.5 0.6 -2.6 response regulator 17
AT1G79800 ENODL7 2.2 -2.0 -2.6 early nodulin-like protein 7
AT5G51310
-0.5 -1.1 -2.7 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase
superfamily protein
AT5G06470
2.6 -6.5 -2.9 Glutaredoxin family protein
AT2G45550 CYP76C4 1.3 0.1 -3.0 cytochrome P450, family 76, subfamily C, polypeptide 4
AT1G30990
-0.7 -1.0 -3.1 Polyketide cyclase/dehydrase and lipid transport
superfamily protein
AT3G55310
2.4 -1.4 -3.1 NAD(P)-binding Rossmann-fold superfamily protein
AT2G14920 ATST4A 1.0 -4.0 -3.3 sulfotransferase 4A
AT3G32920
-0.3 -2.9 -3.7 P-loop containing nucleoside triphosphate hydrolases
87
superfamily protein
AT1G48940 ENODL6 0.9 -4.4 -4.4 early nodulin-like protein 6
AT1G57850
-1.7 -0.1 -4.7 Toll-Interleukin-Resistance (TIR) domain family protein
AT4G18823
4.7 -4.7 -4.7 Defensin-like (DEFL) family protein
AT5G08315
4.9 -4.9 -4.9 Defensin-like (DEFL) family protein
AT1G35537
1.5 -0.7 -5.4 Defensin-like (DEFL) family protein
AT1G77093
5.5 -5.5 -5.5 Defensin-like (DEFL) family protein
AT2G20350 ERF120 1.4 -0.6 -5.8 Integrase-type DNA-binding superfamily protein
AT3G17675
5.8 -1.3 -5.8 Cupredoxin superfamily protein
AT3G04903
5.9 -5.9 -5.9 Defensin-like (DEFL) family protein
AT2G31953 LCR76 -0.5 -6.0 -6.0 low-molecular-weight cysteine-rich 76
AT1G66380 MYB114 1.4 -1.6 -6.6 myb domain protein 114
AT3G06985 LCR44 -0.3 -0.3 -6.9 low-molecular-weight cysteine-rich 44
AT1G64107
0.4 -0.4 -7.5 Putative membrane lipoprotein
The numbers indicate fold changes of the gene expression levels between bzip68 mutants and WT.
88
List of References
1. Apel K & Hirt H (2004) Reactive oxygen species: metabolism, oxidative
stress, and signal transduction. Annu Rev Plant Biol 55:373-399.
2. Dalton TP, Shertzer HG, & Puga A (1999) Regulation of gene expression
by reactive oxygen. Annu Rev Pharmacol Toxicol 39:67-101.
3. Nathan C & Ding A (2010) SnapShot: Reactive Oxygen Intermediates
(ROI). Cell 140(6):951-951 e952.
4. Niyogi KK (1999) PHOTOPROTECTION REVISITED: Genetic and
Molecular Approaches. Annu Rev Plant Physiol Plant Mol Biol
50:333-359.
5. Chinnusamy V, Zhu J, & Zhu JK (2007) Cold stress regulation of gene
expression in plants. Trends in Plant Science 12(10):444-451.
6. Lamb C & Dixon RA (1997) The Oxidative Burst in Plant Disease
Resistance. Annu Rev Plant Physiol Plant Mol Biol 48:251-275.
7. Jansen MAK, Gaba V, & Greenberg BM (1998) Higher plants and UV-B
radiation: balancing damage, repair and acclimation. Trends in Plant
Science 3(4):131-135.
8. Kotak S, et al. (2007) Complexity of the heat stress response in plants.
Curr Opin Plant Biol 10(3):310-316.
9. Ramachandra Reddy A, Chaitanya KV, & Vivekanandan M (2004)
Drought-induced responses of photosynthesis and antioxidant metabolism
in higher plants. J Plant Physiol 161(11):1189-1202.
10. Orozco-Cardenas ML, Narvaez-Vasquez J, & Ryan CA (2001) Hydrogen
peroxide acts as a second messenger for the induction of defense genes in
tomato plants in response to wounding, systemin, and methyl jasmonate.
Plant Cell 13(1):179-191.
11. Boudsocq M & Lauriere C (2005) Osmotic signaling in plants: multiple
pathways mediated by emerging kinase families. Plant Physiol
89
138(3):1185-1194.
12. Laloi C, Apel K, & Danon A (2004) Reactive oxygen signalling: the latest
news. Curr Opin Plant Biol 7(3):323-328.
13. Moller IM, Jensen PE, & Hansson A (2007) Oxidative modifications to
cellular components in plants. Annu Rev Plant Biol 58:459-481.
14. Scandalios JG (2005) Oxidative stress: molecular perception and
transduction of signals triggering antioxidant gene defenses. Braz J Med
Biol Res 38(7):995-1014.
15. Collins Y, et al. (2012) Mitochondrial redox signalling at a glance. J Cell
Sci 125(Pt 4):801-806.
16. Finkel T (2011) Signal transduction by reactive oxygen species. J Cell Biol
194(1):7-15.
17. Gechev TS, Van Breusegem F, Stone JM, Denev I, & Laloi C (2006)
Reactive oxygen species as signals that modulate plant stress responses
and programmed cell death. Bioessays 28(11):1091-1101.
18. Xiong L, Schumaker KS, & Zhu JK (2002) Cell signaling during cold,
drought, and salt stress. Plant Cell 14 Suppl:S165-183.
19. Torres MA, Jones JD, & Dangl JL (2006) Reactive oxygen species
signaling in response to pathogens. Plant Physiol 141(2):373-378.
20. Giorgio M, Trinei M, Migliaccio E, & Pelicci PG (2007) Hydrogen
peroxide: a metabolic by-product or a common mediator of ageing signals?
Nat Rev Mol Cell Biol 8(9):722-728.
21. Sierla M, Rahikainen M, Salojarvi J, Kangasjarvi J, & Kangasjarvi S
(2013) Apoplastic and chloroplastic redox signaling networks in plant
stress responses. Antioxid Redox Signal 18(16):2220-2239.
22. Murphy MP (2009) How mitochondria produce reactive oxygen species.
Biochem J 417(1):1-13.
23. Fleury C, Mignotte B, & Vayssiere JL (2002) Mitochondrial reactive
oxygen species in cell death signaling. Biochimie 84(2-3):131-141.
24. Jastroch M, Divakaruni AS, Mookerjee S, Treberg JR, & Brand MD (2010)
90
Mitochondrial proton and electron leaks. Essays Biochem 47:53-67.
25. Rochaix JD (2011) Reprint of: Regulation of photosynthetic electron
transport. Biochim Biophys Acta 1807(8):878-886.
26. Asada K (2006) Production and scavenging of reactive oxygen species in
chloroplasts and their functions. Plant Physiol 141(2):391-396.
27. Bedard K & Krause KH (2007) The NOX family of ROS-generating
NADPH oxidases: physiology and pathophysiology. Physiol Rev
87(1):245-313.
28. Sagi M & Fluhr R (2006) Production of reactive oxygen species by plant
NADPH oxidases. Plant Physiol 141(2):336-340.
29. Torres MA, Dangl JL, & Jones JD (2002) Arabidopsis gp91phox
homologues AtrbohD and AtrbohF are required for accumulation of
reactive oxygen intermediates in the plant defense response. Proc Natl
Acad Sci U S A 99(1):517-522.
30. Kawano T (2003) Roles of the reactive oxygen species-generating
peroxidase reactions in plant defense and growth induction. Plant Cell Rep
21(9):829-837.
31. del Rio LA, Sandalio LM, Corpas FJ, Palma JM, & Barroso JB (2006)
Reactive oxygen species and reactive nitrogen species in peroxisomes.
Production, scavenging, and role in cell signaling. Plant Physiol
141(2):330-335.
32. Chaki M, et al. (2009) Involvement of reactive nitrogen and oxygen
species (RNS and ROS) in sunflower-mildew interaction. Plant Cell
Physiol 50(2):265-279.
33. Wendehenne D, Pugin A, Klessig DF, & Durner J (2001) Nitric oxide:
comparative synthesis and signaling in animal and plant cells. Trends in
Plant Science 6(4):177-183.
34. Pallavi Sharma, Ambuj Bhushan Jha, Rama Shanker Dubey, & Pessarakli
aM (2012) Reactive Oxygen Species, Oxidative Damage, and
Antioxidative Defense Mechanism in Plants under Stressful Conditions.
91
Journal of Botany 10:26.
35. Valko M, et al. (2007) Free radicals and antioxidants in normal
physiological functions and human disease. Int J Biochem Cell Biol
39(1):44-84.
36. Mittler R (2002) Oxidative stress, antioxidants and stress tolerance. Trends
in Plant Science 7(9):405-410.
37. Rose RC & Bode AM (1993) Biology of free radical scavengers: an
evaluation of ascorbate. FASEB J 7(12):1135-1142.
38. Noctor G & Foyer CH (1998) ASCORBATE AND GLUTATHIONE:
Keeping Active Oxygen Under Control. Annu Rev Plant Physiol Plant Mol
Biol 49:249-279.
39. Alscher RG & Hess JL (1993) Antioxidants in higher plants (CRC Press,
Boca Raton) p 174 p.
40. Gupta SD (2011) Reactive oxygen species and antioxidants in higher
plants (Science Publishers; Distributed by CRC Press, Enfield, NH Boca
Raton, FL) pp xv, 368 p.
41. Nguyen T, Sherratt PJ, & Pickett CB (2003) Regulatory mechanisms
controlling gene expression mediated by the antioxidant response element.
Annu Rev Pharmacol 43:233-260.
42. Alscher RG, Donahue JL, & Cramer CL (1997) Reactive oxygen species
and antioxidants: Relationships in green cells. Physiol Plantarum
100(2):224-233.
43. Mittler R, Vanderauwera S, Gollery M, & Van Breusegem F (2004)
Reactive oxygen gene network of plants. Trends in Plant Science
9(10):490-498.
44. Scandalios JG (1993) Oxygen Stress and Superoxide Dismutases. Plant
Physiol 101(1):7-12.
45. Kliebenstein DJ, Monde RA, & Last RL (1998) Superoxide dismutase in
Arabidopsis: an eclectic enzyme family with disparate regulation and
protein localization. Plant Physiol 118(2):637-650.
92
46. Sunkar R, Kapoor A, & Zhu JK (2006) Posttranscriptional induction of
two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by
downregulation of miR398 and important for oxidative stress tolerance.
Plant Cell 18(8):2051-2065.
47. Halliwell B (2006) Reactive species and antioxidants. Redox biology is a
fundamental theme of aerobic life. Plant Physiology 141(2):312-322.
48. Bowler C, Vanmontagu M, & Inze D (1992) Superoxide-Dismutase and
Stress Tolerance. Annu Rev Plant Phys 43:83-116.
49. Rizhsky L, Liang HJ, & Mittler R (2003) The water-water cycle is
essential for chloroplast protection in the absence of stress. Journal of
Biological Chemistry 278(40):38921-38925.
50. Igor N. Zelko TJM, and Rodney J. Folz (2002) Superoxide dismutase
multigene family: a comparison of the CuZn-SOD (SOD1), Mn-SOD
(SOD2), and EC-SOD (SOD3) gene structures, evolution, and expression.
Free Radical Biology & Medicine 33.
51. Frugoli JA, et al. (1996) Catalase is encoded by a multigene family in
Arabidopsis thaliana (L) Heynh. Plant Physiology 112(1):327-336.
52. Willekens H, Inze D, Vanmontagu M, & Vancamp W (1995) Catalases in
Plants. Mol Breeding 1(3):207-228.
53. Du YY, Wang PC, Chen J, & Song CP (2008) Comprehensive functional
analysis of the catalase gene family in Arabidopsis thaliana. J Integr Plant
Biol 50(10):1318-1326.
54. Queval G, et al. (2007) Conditional oxidative stress responses in the
Arabidopsis photorespiratory mutant cat2 demonstrate that redox state is a
key modulator of daylength-dependent gene expression, and define
photoperiod as a crucial factor in the regulation of H2O2-induced cell
death. Plant J 52(4):640-657.
55. Pavet V, et al. (2005) Ascorbic acid deficiency activates cell death and
disease resistance responses in Arabidopsis. Plant Physiol
139(3):1291-1303.
93
56. Conklin PL (2001) Recent advances in the role and biosynthesis of
ascorbic acid in plants. Plant Cell and Environment 24(4):383-394.
57. Foyer CH & Shigeoka S (2011) Understanding oxidative stress and
antioxidant functions to enhance photosynthesis. Plant Physiol
155(1):93-100.
58. Purr A (1934) The influence of vitamin C (ascorbic acid) on plant and
animal amylases. Biochem J 28(3):1141-1148.
59. Ishikawa T & Shigeoka S (2008) Recent advances in ascorbate
biosynthesis and the physiological significance of ascorbate peroxidase in
photosynthesizing organisms. Biosci Biotechnol Biochem
72(5):1143-1154.
60. Conklin PL, Williams EH, & Last RL (1996) Environmental stress
sensitivity of an ascorbic acid-deficient Arabidopsis mutant. Proc Natl
Acad Sci U S A 93(18):9970-9974.
61. Smirnoff N, Conklin PL, & Loewus FA (2001) Biosynthesis of ascorbic
acid in plants: A renaissance. Annu Rev Plant Phys 52:437.
62. Dowdle J, Ishikawa T, Gatzek S, Rolinski S, & Smirnoff N (2007) Two
genes in Arabidopsis thaliana encoding GDP-L-galactose phosphorylase
are required for ascorbate biosynthesis and seedling viability. Plant J
52(4):673-689.
63. Gao Y, et al. (2011) Expression analysis of the VTC2 and VTC5 genes
encoding GDP-L-galactose phosphorylase, an enzyme involved in
ascorbate biosynthesis, in Arabidopsis thaliana. Biosci Biotechnol Biochem
75(9):1783-1788.
64. Linster CL & Clarke SG (2008) L-Ascorbate biosynthesis in higher plants:
the role of VTC2. Trends in Plant Science 13(11):567-573.
65. Foyer CH & Halliwell B (1976) The presence of glutathione and
glutathione reductase in chloroplasts: A proposed role in ascorbic acid
metabolism. Planta 133(1):21-25.
66. May MJ, Vernoux T, Leaver C, Van Montagu M, & Inze D (1998)
94
Glutathione homeostasis in plants: implications for environmental sensing
and plant development. Journal of Experimental Botany 49(321):649-667.
67. Noctor G, Gomez L, Vanacker H, & Foyer CH (2002) Interactions
between biosynthesis, compartmentation and transport in the control of
glutathione homeostasis and signalling. Journal of Experimental Botany
53(372):1283-1304.
68. Rotruck JT, et al. (1973) Selenium: biochemical role as a component of
glutathione peroxidase. Science 179(4073):588-590.
69. Noctor G, Arisi ACM, & Foyer CH (1997) Interactions between
glutathione biosynthesis and photorespiration in poplar. Plant Physiology
114(3):198-198.
70. Ball L, et al. (2004) Evidence for a direct link between glutathione
biosynthesis and stress defense gene expression in Arabidopsis. Plant Cell
16(9):2448-2462.
71. Chen W, Chao G, & Singh KB (1996) The promoter of a H2O2-inducible,
Arabidopsis glutathione S-transferase gene contains closely linked OBF-
and OBP1-binding sites. Plant J 10(6):955-966.
72. Dixon DP, Lapthorn A, & Edwards R (2002) Plant glutathione transferases.
Genome Biol 3(3):REVIEWS3004.
73. Dixon DP, Skipsey M, Grundy NM, & Edwards R (2005) Stress-induced
protein S-glutathionylation in Arabidopsis. Plant Physiol
138(4):2233-2244.
74. Bela K, et al. (2015) Plant glutathione peroxidases: emerging role of the
antioxidant enzymes in plant development and stress responses. J Plant
Physiol 176:192-201.
75. Miao Y, et al. (2006) An Arabidopsis glutathione peroxidase functions as
both a redox transducer and a scavenger in abscisic acid and drought stress
responses. Plant Cell 18(10):2749-2766.
76. Moller IM (2001) PLANT MITOCHONDRIA AND OXIDATIVE
STRESS: Electron Transport, NADPH Turnover, and Metabolism of
95
Reactive Oxygen Species. Annu Rev Plant Physiol Plant Mol Biol
52:561-591.
77. Asada K (1999) THE WATER-WATER CYCLE IN CHLOROPLASTS:
Scavenging of Active Oxygens and Dissipation of Excess Photons. Annu
Rev Plant Physiol Plant Mol Biol 50:601-639.
78. Noctor G, et al. (2012) Glutathione in plants: an integrated overview.
Plant Cell Environ 35(2):454-484.
79. Ushimaru T, et al. (1997) Induction of enzymes involved in the
ascorbate-dependent antioxidative system, namely, ascorbate peroxidase,
monodehydroascorbate reductase and dehydroascorbate reductase, after
exposure to air of rice (Oryza sativa) seedlings germinated under water.
Plant and Cell Physiology 38(5):541-549.
80. Shigeoka S, et al. (2002) Regulation and function of ascorbate peroxidase
isoenzymes. J Exp Bot 53(372):1305-1319.
81. Panchuk, II, Zentgraf U, & Volkov RA (2005) Expression of the Apx gene
family during leaf senescence of Arabidopsis thaliana. Planta
222(5):926-932.
82. Davletova S, et al. (2005) Cytosolic ascorbate peroxidase 1 is a central
component of the reactive oxygen gene network of Arabidopsis. Plant Cell
17(1):268-281.
83. Pnueli L, Liang H, Rozenberg M, & Mittler R (2003) Growth suppression,
altered stomatal responses, and augmented induction of heat shock
proteins in cytosolic ascorbate peroxidase (Apx1)-deficient Arabidopsis
plants. Plant J 34(2):187-203.
84. Karpinski S, Escobar C, Karpinska B, Creissen G, & Mullineaux PM
(1997) Photosynthetic electron transport regulates the expression of
cytosolic ascorbate peroxidase genes in Arabidopsis during excess light
stress. Plant Cell 9(4):627-640.
85. Burlakova EB, Krashakov SA, & Khrapova NG (1998) The role of
tocopherols in biomembrane lipid peroxidation. Membr Cell Biol
96
12(2):173-211.
86. Vanlerberghe GC (2013) Alternative oxidase: a mitochondrial respiratory
pathway to maintain metabolic and signaling homeostasis during abiotic
and biotic stress in plants. Int J Mol Sci 14(4):6805-6847.
87. Vanlerberghe GC & McIntosh L (1997) ALTERNATIVE OXIDASE:
From Gene to Function. Annu Rev Plant Physiol Plant Mol Biol
48:703-734.
88. Maxwell DP, Wang Y, & McIntosh L (1999) The alternative oxidase
lowers mitochondrial reactive oxygen production in plant cells. Proc Natl
Acad Sci U S A 96(14):8271-8276.
89. Umbach AL, Ng VS, & Siedow JN (2006) Regulation of plant alternative
oxidase activity: a tale of two cysteines. Biochim Biophys Acta
1757(2):135-142.
90. Wilson KE, et al. (2006) Energy balance, organellar redox status, and
acclimation to environmental stress. Can J Bot 84(9):1355-1370.
91. Dietz KJ (2011) Peroxiredoxins in plants and cyanobacteria. Antioxid
Redox Signal 15(4):1129-1159.
92. Hayashi M & Nishimura M (2003) Entering a new era of research on plant
peroxisomes. Curr Opin Plant Biol 6(6):577-582.
93. Baier M, Noctor G, Foyer CH, & Dietz KJ (2000) Antisense suppression
of 2-cysteine peroxiredoxin in Arabidopsis specifically enhances the
activities and expression of enzymes associated with ascorbate metabolism
but not glutathione metabolism. Plant Physiol 124(2):823-832.
94. Foreman J, et al. (2003) Reactive oxygen species produced by NADPH
oxidase regulate plant cell growth. Nature 422(6930):442-446.
95. Foyer CH & Noctor G (2005) Oxidant and antioxidant signalling in plants:
a re-evaluation of the concept of oxidative stress in a physiological context.
Plant, Cell & Environment 28(8):1056-1071.
96. Foyer CH & Noctor G (2009) Redox regulation in photosynthetic
organisms: signaling, acclimation, and practical implications. Antioxid
97
Redox Signal 11(4):861-905.
97. Buchanan BB & Balmer Y (2005) Redox regulation: a broadening horizon.
Annu Rev Plant Biol 56:187-220.
98. Buchanan BB (1991) Regulation of CO2 assimilation in oxygenic
photosynthesis: the ferredoxin/thioredoxin system. Perspective on its
discovery, present status, and future development. Arch Biochem Biophys
288(1):1-9.
99. Buchanan BB, Schurmann P, Decottignies P, & Lozano RM (1994)
Thioredoxin: a multifunctional regulatory protein with a bright future in
technology and medicine. Arch Biochem Biophys 314(2):257-260.
100. Grant CM (2001) Role of the glutathione/glutaredoxin and thioredoxin
systems in yeast growth and response to stress conditions. Mol Microbiol
39(3):533-541.
101. Sen CK & Packer L (1996) Antioxidant and redox regulation of gene
transcription. FASEB J 10(7):709-720.
102. Chiu J & Dawes IW (2012) Redox control of cell proliferation. Trends
Cell Biol 22(11):592-601.
103. Couturier J, Chibani K, Jacquot JP, & Rouhier N (2013) Cysteine-based
redox regulation and signaling in plants. Front Plant Sci 4:105.
104. Tu BP, Kudlicki A, Rowicka M, & McKnight SL (2005) Logic of the yeast
metabolic cycle: temporal compartmentalization of cellular processes.
Science 310(5751):1152-1158.
105. Schmidt R & Schippers JH (2015) ROS-mediated redox signaling during
cell differentiation in plants. Biochim Biophys Acta 1850(8):1497-1508.
106. Tsukagoshi H, Busch W, & Benfey PN (2010) Transcriptional regulation
of ROS controls transition from proliferation to differentiation in the root.
Cell 143(4):606-616.
107. De Pinto MC, Locato V, & De Gara L (2012) Redox regulation in plant
programmed cell death. Plant Cell Environ 35(2):234-244.
108. Foyer CH & Noctor G (2005) Redox homeostasis and antioxidant
98
signaling: a metabolic interface between stress perception and
physiological responses. Plant Cell 17(7):1866-1875.
109. Delledonne M, Zeier J, Marocco A, & Lamb C (2001) Signal interactions
between nitric oxide and reactive oxygen intermediates in the plant
hypersensitive disease resistance response. Proc Natl Acad Sci U S A
98(23):13454-13459.
110. Colavitti R & Finkel T (2005) Reactive oxygen species as mediators of
cellular senescence. IUBMB Life 57(4-5):277-281.
111. Khanna-Chopra R (2012) Leaf senescence and abiotic stresses share
reactive oxygen species-mediated chloroplast degradation. Protoplasma
249(3):469-481.
112. Scherz-Shouval R & Elazar Z (2007) ROS, mitochondria and the
regulation of autophagy. Trends Cell Biol 17(9):422-427.
113. Foyer CH & Noctor G (2013) Redox signaling in plants. Antioxid Redox
Signal 18(16):2087-2090.
114. Mittler R & Blumwald E (2015) The roles of ROS and ABA in systemic
acquired acclimation. Plant Cell 27(1):64-70.
115. Sticher L, Mauch-Mani B, & Metraux JP (1997) Systemic acquired
resistance. Annu Rev Phytopathol 35:235-270.
116. Durrant WE & Dong X (2004) Systemic acquired resistance. Annu Rev
Phytopathol 42:185-209.
117. Wang W, Vinocur B, & Altman A (2003) Plant responses to drought,
salinity and extreme temperatures: towards genetic engineering for stress
tolerance. Planta 218(1):1-14.
118. Suzuki N, Koussevitzky S, Mittler R, & Miller G (2012) ROS and redox
signalling in the response of plants to abiotic stress. Plant Cell Environ
35(2):259-270.
119. Atkin OK & Macherel D (2009) The crucial role of plant mitochondria in
orchestrating drought tolerance. Ann Bot 103(4):581-597.
120. Zer H & Ohad I (2003) Light, redox state, thylakoid-protein
99
phosphorylation and signaling gene expression. Trends Biochem Sci
28(9):467-470.
121. Dietzel L & Pfannschmidt T (2008) Photosynthetic acclimation to light
gradients in plant stands comes out of shade. Plant Signal Behav
3(12):1116-1118.
122. Murata N (1969) Control of excitation transfer in photosynthesis. I.
Light-induced change of chlorophyll a fluorescence in Porphyridium
cruentum. Biochim Biophys Acta 172(2):242-251.
123. Prasad TK, Anderson MD, & Stewart CR (1994) Acclimation, Hydrogen
Peroxide, and Abscisic Acid Protect Mitochondria against Irreversible
Chilling Injury in Maize Seedlings. Plant Physiol 105(2):619-627.
124. Jacoby RP, Taylor NL, & Millar AH (2011) The role of mitochondrial
respiration in salinity tolerance. Trends in Plant Science 16(11):614-623.
125. Vellosillo T, Vicente J, Kulasekaran S, Hamberg M, & Castresana C (2010)
Emerging complexity in reactive oxygen species production and signaling
during the response of plants to pathogens. Plant Physiol 154(2):444-448.
126. Low PS & Merida JR (1996) The oxidative burst in plant defense:
Function and signal transduction. Physiol Plantarum 96(3):533-542.
127. Levine A, Tenhaken R, Dixon R, & Lamb C (1994) H2O2 from the
oxidative burst orchestrates the plant hypersensitive disease resistance
response. Cell 79(4):583-593.
128. Apostol I, Heinstein PF, & Low PS (1989) Rapid Stimulation of an
Oxidative Burst during Elicitation of Cultured Plant-Cells - Role in
Defense and Signal Transduction. Plant Physiology 90(1):109-116.
129. Vanacker H, Carver TL, & Foyer CH (1998) Pathogen-induced changes in
the antioxidant status of the apoplast in barley leaves. Plant Physiol
117(3):1103-1114.
130. Rentel MC, et al. (2004) OXI1 kinase is necessary for oxidative
burst-mediated signalling in Arabidopsis. Nature 427(6977):858-861.
131. Delledonne M, Xia Y, Dixon RA, & Lamb C (1998) Nitric oxide functions
100
as a signal in plant disease resistance. Nature 394(6693):585-588.
132. Scheler C, Durner J, & Astier J (2013) Nitric oxide and reactive oxygen
species in plant biotic interactions. Curr Opin Plant Biol 16(4):534-539.
133. Baxter A, Mittler R, & Suzuki N (2014) ROS as key players in plant stress
signalling. Journal of Experimental Botany 65(5):1229-1240.
134. Fujita M, et al. (2006) Crosstalk between abiotic and biotic stress
responses: a current view from the points of convergence in the stress
signaling networks. Current Opinion in Plant Biology 9(4):436-442.
135. Krishnamurthy A & Rathinasabapathi B (2013) Oxidative stress tolerance
in plants. Plant Signaling & Behavior 8(10):e25761.
136. Achard P, Renou JP, Berthome R, Harberd NP, & Genschik P (2008) Plant
DELLAs restrain growth and promote survival of adversity by reducing
the levels of reactive oxygen species. Curr Biol 18(9):656-660.
137. Shirasu K, Nakajima H, Rajasekhar VK, Dixon RA, & Lamb C (1997)
Salicylic acid potentiates an agonist-dependent gain control that amplifies
pathogen signals in the activation of defense mechanisms. Plant Cell
9(2):261-270.
138. Ren D, Yang H, & Zhang S (2002) Cell death mediated by MAPK is
associated with hydrogen peroxide production in Arabidopsis. The Journal
of biological chemistry 277(1):559-565.
139. Pitzschke A & Hirt H (2006) Mitogen-activated protein kinases and
reactive oxygen species signaling in plants. Plant Physiol 141(2):351-356.
140. Ray PD, Huang BW, & Tsuji Y (2012) Reactive oxygen species (ROS)
homeostasis and redox regulation in cellular signaling. Cell Signal
24(5):981-990.
141. Meinhard M & Grill E (2001) Hydrogen peroxide is a regulator of ABI1, a
protein phosphatase 2C from Arabidopsis. Febs Letters 508(3):443-446.
142. Meinhard M, Rodriguez PL, & Grill E (2002) The sensitivity of ABI2 to
hydrogen peroxide links the abscisic acid-response regulator to redox
signalling. Planta 214(5):775-782.
101
143. Pantano C, Reynaert NL, van der Vliet A, & Janssen-Heininger YM (2006)
Redox-sensitive kinases of the nuclear factor-kappaB signaling pathway.
Antioxid Redox Signal 8(9-10):1791-1806.
144. Robinson KA, et al. (1999) Redox-sensitive protein phosphatase activity
regulates the phosphorylation state of p38 protein kinase in primary
astrocyte culture. J Neurosci Res 55(6):724-732.
145. Mittler R, et al. (2011) ROS signaling: the new wave? Trends in Plant
Science 16(6):300-309.
146. Wang H, Wang S, & Xia Y (2012) Identification and verification of
redox-sensitive proteins in Arabidopsis thaliana. Methods Mol Biol
876:83-94.
147. Ghezzi P & Bonetto V (2003) Redox proteomics: identification of
oxidatively modified proteins. Proteomics 3(7):1145-1153.
148. Poole LB, Karplus PA, & Claiborne A (2004) Protein sulfenic acids in
redox signaling. Annu Rev Pharmacol Toxicol 44:325-347.
149. Eaton P (2006) Protein thiol oxidation in health and disease: techniques for
measuring disulfides and related modifications in complex protein
mixtures. Free Radic Biol Med 40(11):1889-1899.
150. Leichert LI, et al. (2008) Quantifying changes in the thiol redox proteome
upon oxidative stress in vivo. Proc Natl Acad Sci U S A
105(24):8197-8202.
151. Brandes N, Reichmann D, Tienson H, Leichert LI, & Jakob U (2011)
Using quantitative redox proteomics to dissect the yeast redoxome. J Biol
Chem 286(48):41893-41903.
152. McDonagh B, et al. (2012) Application of iTRAQ Reagents to Relatively
Quantify the Reversible Redox State of Cysteine Residues. Int J
Proteomics 2012:514847.
153. Ong SE & Pandey A (2001) An evaluation of the use of two-dimensional
gel electrophoresis in proteomics. Biomol Eng 18(5):195-205.
154. Rinalducci S, Murgiano L, & Zolla L (2008) Redox proteomics: basic
102
principles and future perspectives for the detection of protein oxidation in
plants. J Exp Bot 59(14):3781-3801.
155. Marshall HE, Merchant K, & Stamler JS (2000) Nitrosation and oxidation
in the regulation of gene expression. FASEB J 14(13):1889-1900.
156. Storz G, Tartaglia LA, & Ames BN (1990) Transcriptional regulator of
oxidative stress-inducible genes: direct activation by oxidation. Science
248(4952):189-194.
157. Fuangthong M & Helmann JD (2002) The OhrR repressor senses organic
hydroperoxides by reversible formation of a cysteine-sulfenic acid
derivative. Proc Natl Acad Sci U S A 99(10):6690-6695.
158. Panmanee W, et al. (2002) OhrR, a transcription repressor that senses and
responds to changes in organic peroxide levels in Xanthomonas campestris
pv. phaseoli. Mol Microbiol 45(6):1647-1654.
159. Delaunay A, Isnard AD, & Toledano MB (2000) H2O2 sensing through
oxidation of the Yap1 transcription factor. EMBO J 19(19):5157-5166.
160. Wood MJ, Storz G, & Tjandra N (2004) Structural basis for redox
regulation of Yap1 transcription factor localization. Nature
430(7002):917-921.
161. Delaunay A, Pflieger D, Barrault MB, Vinh J, & Toledano MB (2002) A
thiol peroxidase is an H2O2 receptor and redox-transducer in gene
activation. Cell 111(4):471-481.
162. Okazaki S, Tachibana T, Naganuma A, Mano N, & Kuge S (2007)
Multistep disulfide bond formation in Yap1 is required for sensing and
transduction of H2O2 stress signal. Mol Cell 27(4):675-688.
163. Kuge S, Toda T, Iizuka N, & Nomoto A (1998) Crm1 (XpoI) dependent
nuclear export of the budding yeast transcription factor yAP-1 is sensitive
to oxidative stress. Genes Cells 3(8):521-532.
164. Macara IG (2001) Transport into and out of the nucleus. Microbiol Mol
Biol Rev 65(4):570-594.
165. Nakamura H, Nakamura K, & Yodoi J (1997) Redox regulation of cellular
103
activation. Annu Rev Immunol 15:351-369.
166. Hainaut P & Mann K (2001) Zinc binding and redox control of p53
structure and function. Antioxid Redox Signal 3(4):611-623.
167. Flohe L, Brigelius-Flohe R, Saliou C, Traber MG, & Packer L (1997)
Redox regulation of NF-kappa B activation. Free Radic Biol Med
22(6):1115-1126.
168. Hirota K, et al. (1999) Distinct roles of thioredoxin in the cytoplasm and
in the nucleus. A two-step mechanism of redox regulation of transcription
factor NF-kappaB. The Journal of biological chemistry
274(39):27891-27897.
169. Dietz KJ (2008) Redox signal integration: from stimulus to networks and
genes. Physiol Plant 133(3):459-468.
170. Tada Y, et al. (2008) Plant immunity requires conformational changes
[corrected] of NPR1 via S-nitrosylation and thioredoxins. Science
321(5891):952-956.
171. Kinkema M, Fan W, & Dong X (2000) Nuclear localization of NPR1 is
required for activation of PR gene expression. Plant Cell
12(12):2339-2350.
172. Fu ZQ, et al. (2012) NPR3 and NPR4 are receptors for the immune signal
salicylic acid in plants. Nature 486(7402):228-232.
173. Zhang Y, Fan W, Kinkema M, Li X, & Dong X (1999) Interaction of
NPR1 with basic leucine zipper protein transcription factors that bind
sequences required for salicylic acid induction of the PR-1 gene. Proc Natl
Acad Sci U S A 96(11):6523-6528.
174. Spoel SH, et al. (2003) NPR1 modulates cross-talk between salicylate- and
jasmonate-dependent defense pathways through a novel function in the
cytosol. Plant Cell 15(3):760-770.
175. Zhou M, et al. (2015) Redox rhythm reinforces the circadian clock to gate
immune response. Nature 523(7561):472-476.
176. Liu P, Zhang H, Wang H, & Xia Y (2014) Identification of redox-sensitive
104
cysteines in the Arabidopsis proteome using OxiTRAQ, a quantitative
redox proteomics method. Proteomics 14(6):750-762.
177. Ellenberger T (1994) Getting a grip on DNA recognition: structures of the
basic region leucine zipper, and the basic region helix-loop-helix
DNA-binding domains. Current Opinion in Structural Biology 4(1):12-21.
178. Schutze K, Harter K, & Chaban C (2008) Post-translational regulation of
plant bZIP factors. Trends in Plant Science 13(5):247-255.
179. Alves MS, et al. (2013) Plant bZIP Transcription Factors Responsive to
Pathogens: A Review. Int J Mol Sci 14(4):7815-7828.
180. Jakoby M, et al. (2002) bZIP transcription factors in Arabidopsis. Trends
in Plant Science 7(3):106-111.
181. Williams ME, Foster R, & Chua NH (1992) Sequences flanking the
hexameric G-box core CACGTG affect the specificity of protein binding.
Plant Cell 4(4):485-496.
182. Schindler U, Menkens AE, Beckmann H, Ecker JR, & Cashmore AR
(1992) Heterodimerization between Light-Regulated and Ubiquitously
Expressed Arabidopsis Gbf Bzip Proteins. Embo Journal 11(4):1261-1273.
183. Shen HS, Cao KM, & Wang XP (2008) AtbZIP16 and AtbZIP68, two new
members of GBFs, can interact with other G group bZIPs in Arabidopsis
thaliana. Bmb Rep 41(2):132-138.
184. Jakoby M, et al. (2002) bZIP transcription factors in Arabidopsis. Trends
in Plant Science 7(3):106-111.
185. Garreton V, Carpinelli J, Jordana X, & Holuigue L (2002) The as-1
promoter element is an oxidative stress-responsive element and salicylic
acid activates it via oxidative species. Plant Physiol 130(3):1516-1526.
186. Hsieh WP, Hsieh HL, & Wu SH (2012) Arabidopsis bZIP16 transcription
factor integrates light and hormone signaling pathways to regulate early
seedling development. Plant Cell 24(10):3997-4011.
187. Shen H, Cao K, & Wang X (2008) AtbZIP16 and AtbZIP68, two new
members of GBFs, can interact with other G group bZIPs in Arabidopsis
105
thaliana. BMB Rep 41(2):132-138.
188. Schindler U, Terzaghi W, Beckmann H, Kadesch T, & Cashmore AR (1992)
DNA binding site preferences and transcriptional activation properties of
the Arabidopsis transcription factor GBF1. EMBO J 11(4):1275-1289.
189. Shaikhali J, et al. (2012) Redox-mediated mechanisms regulate DNA
binding activity of the G-group of basic region leucine zipper (bZIP)
transcription factors in Arabidopsis. J Biol Chem 287(33):27510-27525.
190. Shaikhali J, et al. (2012) Redox-mediated Mechanisms Regulate DNA
Binding Activity of the G-group of Basic Region Leucine Zipper (bZIP)
Transcription Factors in Arabidopsis. Journal of Biological Chemistry
287(33):27510-27525.
191. Smykowski A, Zimmermann P, & Zentgraf U (2010) G-Box binding
factor1 reduces CATALASE2 expression and regulates the onset of leaf
senescence in Arabidopsis. Plant Physiol 153(3):1321-1331.
192. Mallappa C, Yadav V, Negi P, & Chattopadhyay S (2006) A basic leucine
zipper transcription factor, G-box-binding factor 1, regulates blue
light-mediated photomorphogenic growth in Arabidopsis. The Journal of
biological chemistry 281(31):22190-22199.
193. Terzaghi WB, Bertekap RL, Jr., & Cashmore AR (1997) Intracellular
localization of GBF proteins and blue light-induced import of GBF2
fusion proteins into the nucleus of cultured Arabidopsis and soybean cells.
Plant J 11(5):967-982.
194. Finkelstein RR & Lynch TJ (2000) The Arabidopsis abscisic acid response
gene ABI5 encodes a basic leucine zipper transcription factor. Plant Cell
12(4):599-609.
195. Lopez-Molina L, Mongrand S, McLachlin DT, Chait BT, & Chua NH
(2002) ABI5 acts downstream of ABI3 to execute an ABA-dependent
growth arrest during germination. Plant J 32(3):317-328.
196. Lopez-Molina L, Mongrand S, & Chua NH (2001) A postgermination
developmental arrest checkpoint is mediated by abscisic acid and requires
106
the ABI5 transcription factor in Arabidopsis. Proc Natl Acad Sci U S A
98(8):4782-4787.
197. Oyama T, Shimura Y, & Okada K (1997) The Arabidopsis HY5 gene
encodes a bZIP protein that regulates stimulus-induced development of
root and hypocotyl. Genes Dev 11(22):2983-2995.
198. Chattopadhyay S, Ang LH, Puente P, Deng XW, & Wei N (1998)
Arabidopsis bZIP protein HY5 directly interacts with light-responsive
promoters in mediating light control of gene expression. Plant Cell
10(5):673-683.
199. Ang LH, et al. (1998) Molecular interaction between COP1 and HY5
defines a regulatory switch for light control of Arabidopsis development.
Mol Cell 1(2):213-222.
200. Osterlund MT, Hardtke CS, Wei N, & Deng XW (2000) Targeted
destabilization of HY5 during light-regulated development of Arabidopsis.
Nature 405(6785):462-466.
201. Hardtke CS, et al. (2000) HY5 stability and activity in arabidopsis is
regulated by phosphorylation in its COP1 binding domain. EMBO J
19(18):4997-5006.
202. Fobert PR & Despres C (2005) Redox control of systemic acquired
resistance. Curr Opin Plant Biol 8(4):378-382.
203. Lindermayr C, Sell S, Muller B, Leister D, & Durner J (2010) Redox
regulation of the NPR1-TGA1 system of Arabidopsis thaliana by nitric
oxide. Plant Cell 22(8):2894-2907.
204. Mou Z, Fan W, & Dong X (2003) Inducers of plant systemic acquired
resistance regulate NPR1 function through redox changes. Cell
113(7):935-944.
205. Clough SJ & Bent AF (1998) Floral dip: a simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J
16(6):735-743.
206. Lu Y, et al. (2011) AtPPR2, an Arabidopsis pentatricopeptide repeat
107
protein, binds to plastid 23S rRNA and plays an important role in the first
mitotic division during gametogenesis and in cell proliferation during
embryogenesis. Plant J 67(1):13-25.
207. Ho SN, Hunt HD, Horton RM, Pullen JK, & Pease LR (1989)
Site-directed mutagenesis by overlap extension using the polymerase chain
reaction. Gene 77(1):51-59.
208. Jang BC, et al. (2003) Leptomycin B, an inhibitor of the nuclear export
receptor CRM1, inhibits COX-2 expression. The Journal of biological
chemistry 278(5):2773-2776.
209. Xia Y, Nikolau BJ, & Schnable PS (1996) Cloning and characterization of
CER2, an Arabidopsis gene that affects cuticular wax accumulation. Plant
Cell 8(8):1291-1304.
210. Trapnell C, Pachter L, & Salzberg SL (2009) TopHat: discovering splice
junctions with RNA-Seq. Bioinformatics 25(9):1105-1111.
211. Li R, et al. (2009) SOAP2: an improved ultrafast tool for short read
alignment. Bioinformatics 25(15):1966-1967.
212. Anders S, Pyl PT, & Huber W (2015) HTSeq--a Python framework to
work with high-throughput sequencing data. Bioinformatics
31(2):166-169.
213. Love MI, Huber W, & Anders S (2014) Moderated estimation of fold
change and dispersion for RNA-seq data with DESeq2. Genome Biol
15(12):550.
214. la Cour T, et al. (2004) Analysis and prediction of leucine-rich nuclear
export signals. Protein Eng Des Sel 17(6):527-536.
215. Haasen D, Kohler C, Neuhaus G, & Merkle T (1999) Nuclear export of
proteins in plants: AtXPO1 is the export receptor for leucine-rich nuclear
export signals in Arabidopsis thaliana. Plant J 20(6):695-705.
216. Zheng M, Aslund F, & Storz G (1998) Activation of the OxyR
transcription factor by reversible disulfide bond formation. Science
279(5357):1718-1721.
108
217. Zheng M & Storz G (2000) Redox sensing by prokaryotic transcription
factors. Biochem Pharmacol 59(1):1-6.
218. Jans DA, Xiao CY, & Lam MH (2000) Nuclear targeting signal
recognition: a key control point in nuclear transport? Bioessays
22(6):532-544.
219. Toone WM, et al. (1998) Regulation of the fission yeast transcription
factor Pap1 by oxidative stress: requirement for the nuclear export factor
Crm1 (Exportin) and the stress-activated MAP kinase Sty1/Spc1. Genes
Dev 12(10):1453-1463.
220. Castillo EA, et al. (2002) Diethylmaleate activates the transcription factor
Pap1 by covalent modification of critical cysteine residues. Mol Microbiol
45(1):243-254.
221. Kaminaka H, et al. (2006) bZIP10-LSD1 antagonism modulates basal
defense and cell death in Arabidopsis following infection. EMBO J
25(18):4400-4411.
109
Curriculum Vitae
Academic qualifications of the thesis author, Ms. LI Yimin:
Received the degree of Bachelor of Plant Protection from Northwest A&F
University of China, July 2007
Received the degree of Master of Plant Pathology from Northwest A&F
University of China, July 2010
June 2016