Download - GFP – LacZ alpha fusion presentation
GFP – LacZ alpha fusion presentation
Overview of work done
Questions I plan to answer [1]
Scope of work [1]
[1] Based upon discussion with Austin Che
GFP – LacZ alpha fusion presentation
Overview of work done
Questions I plan to answer [1]
Scope of work [1]
[1] Based upon discussion with Austin Che
GFP ß-galactosidase (ß-gal)
Big picture : want dual reporter
[1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.
LacZ sub-units (purple and brown) :N-tern (yellow): missing three residues (MTM)C-term (red): none missing
GFP :N-term: missing two residues (MR)C-term : missing eight residues (HGMDELYK)
Hwang et al (2006)
1. Hwang et al GFP – full length LacZ fusion : Works
11 AA linker
C-terminal GFP (red)
N-terminal LacZ (yellow)
LacZ monomer 1
(Brown)
LacZ monomer 2
(Purple)
LacZ – alpha fragment (blue) :N-tern (yellow): missing three residues (MTM)C-term (red): none missing
GFP :N-term: missing two residues (MR)C-term : missing eight residues (HGMDELYK)
2. Austin Che GFP and N-terminal LacZ alpha fusion : Doesn’t workBba_E0050
No linker
C-terminal GFP (red)
N-terminal LacZ (yellow)
LacZ alpha (blue)
LacZ – alpha fragment (blue) :N-tern (yellow): missing three residues (MTM)C-term (red): none missing
GFP :N-term: missing two residues (MR)C-term : missing eight residues (HGMDELYK)
Bba_E0051
3. Austin Che LacZ-alpha and N-terminal GFP fusion : Works
18 AA linker
N-terminal GFP (yellow)
C-terminal LacZ (red)
Bba_E0051
4. Austin Che LacZ-alpha and N-terminal GFP variants
Have this with 12 promoter / RBScombinations
LacZ – alpha fragment (blue) :N-tern (yellow): missing three residues (MTM)C-term (red): none missing
GFP :N-term: missing two residues (MR)C-term : missing eight residues (HGMDELYK)
GFP – LacZ alpha fusion presentation
Overview of work done
Questions I plan to answer [1]
Scope of work [1]
[1] Based upon discussion with Austin Che
Questions1. Can E0051 be used to report promoter activity?
Scope of work1.Receive E0051 from Austin2.PCR with BBa sites on primers and with RBS on forward primer3.Insert into flipee vector, downstream of promoter
Questions2. Does re-designed E0050 fusion work?
Scope of work1.Receive E0051 primer designs from Austin2.Design primers for PCR of LacZ and GFP, with linker / RBS 3.PCR “stitch” to create E0050 with linker
Bba_E0050
Insert linker
Questions3. How d0 E0050 2.0, E0051, E0050, and full length fusion compare?
Scope of my work based upon discussions with Austin1.Receive full length GFP fusion from Hwang group and E0050.2.Compare performance of constructs.
Questions4. Are GFP/lacZ activities correlated independent of promoter/RBS?
Scope of my work based upon discussions with Austin1.Evaluate on microplate reader.
Questions1.Can E0051 be used to report promoter activity?2.Does re-designed E0050 fusion work?3.How d0 E0050 2.0, E0051, E0050, and full length fusion compare?4.Are GFP/lacZ activities correlated independent of promoter/RBS?
Scope of work1.Receive E0051, E0051, 12 E0051 variants, primer designs from Austin2.Receive full length GFP fusion from Hwang group3.PCR E0051 w/ BBa sites on primers and with RBS on forward primer4.Insert into flipee vector, downstream of promoter, test5.Design primers for PCR of LacZ and GFP, with linker / RBS 6.PCR “stitch” to create an E0050 with linker 7.Compare performance of E0050 2.0, E0051, E0050, Hwang fusion.8.Evaluate promoter/RBS variants on microplate reader.
Appendix I: Hwang et al
TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAG
+ LacZ excised from pMC1817 by Pst1
MCS
LacZLacZ
Pst1
GFPGFP
EcoR111 amino acid linker
1. LacZ – GFP fusion : Hwang et al [1] show fusion protein between GFP and the N-terminal alpha
fragment of full length lacZ
[1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.
GFP ß-galactosidase (ß-gal)
1. LacZ – GFP fusion : It works [1]
[1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.