![Page 1: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/1.jpg)
GENETIC CHARACTERIZATION OF mtDNA
FROM SARAIKI POPULATION OF
PAKISTAN
SIKANDAR HAYAT
DEPARTMENT OF ZOOLOGY
UNIVERSITY OF THE PUNJAB
LAHORE, PAKISTAN
(2014)
![Page 2: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/2.jpg)
GENETIC CHARACTERIZATION OF mtDNA
FROM SARAIKI POPULATION OF
PAKISTAN
A THESIS SUBMITTED TO
THE UNIVERSITY OF THE PUNJAB
IN PARTIAL FULFILLMENT OF THE
REQUIREMENTS
FOR THE DEGREE OF DOCTOR OF
PHILOSOPHY
IN
ZOOLOGY
BY
SIKANDAR HAYAT
SUPERVISOR:
PROF. DR. TANVEER AKHTAR
DEPARTMENT OF ZOOLOGY
UNIVERSITY OF THE PUNJAB
LAHORE, PAKISTAN
(2014)
![Page 3: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/3.jpg)
![Page 4: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/4.jpg)
![Page 5: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/5.jpg)
DEDICATED
TO
MY LOVING FATHER
WHOSE LOVE IS MORE PRECIOUS,
THAN PEARLS AND DIAMONDS
BY THE VIRTUE OF WHOSE PRAYS,
HAD BEEN ABLE TO REACH
AT THIS HIGH POSITION
MY SWEET MOTHER
WHO IS HEAVEN FOR ME
WHOSE HANDS ARE ALWAYS
RAISED FOR MY WELL-BEING
EVEN AT THIS MOMENT OF TIME
MY BELOVED SWEET
BROTHERS&SISTERS
WHO ARE THE WORLDS FOR ME,
WHOSE LOVE ENCOURAGED ME
AT EVERY STEP FOR MY HIGHER
IDEALS OF LIFE
![Page 6: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/6.jpg)
CONTENTS
Title Page #
ACKNOWLEDGEMENTS i
SUMMARY iv
1. INTRODUCTION AND LITERATURE REVIEW 1
1.1 MITOCHONDRIA 4
1.2 MITOCHONDRIAL MORPHOLOGY 5
1.3 NUCLEAR AND MITOCHONDRIAL DNA 7
1.4 mtDNA GLOBAL PHYLOGENY 10
1.5 THE IMPORTANT CHARACTERISTICS OF HUMAN 10
MITICHONDRIAL DNA
1.6 SIGNIFICANCE OF mtDNA 18
1.7 mtDNA POLYMORPHISMS 20
2. MATERIALS AND METHODS 24
2.1 POPULATION STUDY 24
2.2 Blood SAMPLES COLLECTION 24
2.3 DNA EXTRACTION 27
2.4 PRIMER DSIGNING 27
2.5 PCR AMPLIFICATION OF THE mtDNA 28
2.6 GEL ELECTROPHORESIS 29
2.7 PURIFICATION OF PCR PRODUCTS 30
2.8 mtDNA SEQUENCING 30
2.9 SEQUENCING ANALYSIS 31
![Page 7: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/7.jpg)
2.10 STATISTICAL ANALYSIS 31
2.11 PHYLOGENETIC ANALYSIS 32
3. RESULTS 34
4. DISCUSSION 79
5. REFRENCES 86
![Page 8: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/8.jpg)
LIST OF FIGURES
Figure #
Title Page #
1.1
Internal structural features of the mitochondria.
6
1.2 Genes, rRNA and tRNA coded in Human mitochondrial DNA.
8
1.3 Schematic diagram of mtDNA control region.
9
1.4 Mitochondrial DNA, Schematic diagram of the 16.6-kb, circular,
double-stranded mtDNA molecule.
12
1.5 Phylogenetic tree of major languages in Pakistan. 15
2.1-A Consent form for Saraiki donor‟s record in national language
from Pakistan.
25
2.1-B
2.2
2.3
3.1
Consent form for Saraiki donor‟s record from Pakistan.
Thermal cycling profile for mtDNA control region amplification
of Saraiki population from Pakistan.
Summary of Research work plan for the Saraiki population
mtDNA control region analysis from Pakistan.
Map of Pakistan showing study area of Saraiki Population.
26
29
33
38
3.2 Showing sampling areas along with numbers of samples from
the Saraiki donors of Pakistan. 39
3.3 Showing total samples including males and females of Saraiki
population from Pakistan.
39
3.4 Showing donors of different age groups (18-60 years) along with
number of samples from Saraiki population of Pakistan.
40
3.5 Consanguinity % age of parents in Saraiki population of 85
samples collected from different areas of Pakistan.
40
![Page 9: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/9.jpg)
3.6 Agarose gel electrophoresis showing the bands of extracted
genomic DNA of different quantity.
44
3.7 Agarose gel electrophoresis showing the bands of extracted
genomic DNA of different quantity.
44
3.8 PCR product size of the samples, 010, 011, 012, 013,014 loaded
on 2% agarose gel.
45
3.9 PCR product size of the samples, 015, 016, 019, 020,021 loaded
on 2% agarose gel.
45
3.10 Sequence showing haplotype variations in sample SS-054.
46
3.11 Sequence showing haplotype variations in sample SS-035.
51
3.12 Sequence showing haplotype variations in sample SS-010.
56
3.13 Sequence showing haplotype variations in sample SS-011.
60
3.14 Sequence showing haplotype variations in sample SS-012.
64
3.15 Different Haplogroups frequency % age found in 85 Saraiki
population sample from different areas of Pakistan.
68
3.16 Comparison of genetic diversity among Saraiki population and
others various ethnic groups of Pakistan.
69
3.17 Dendrogram showing genetic affinities among various Saraiki 78
samples from different areas of Pakistan.
![Page 10: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/10.jpg)
LIST OF TABLES
Table #
Title Page #
1.1
Characteristics comparison between mitochondrial DNA and
nuclear DNA.
13
2.1 Primers used for PCR amplification and sequencing of mtDNA
control region. 27
2.2 Cycling conditions for mtDNA control region amplification of
Saraiki population from Pakistan.
28
3.1
3.2
Showing consent form summarized data of Saraiki population
from Pakistan.
Occurrence and distribution of nucleotide substitutions, deletions
and insertions in the hypervariable regions I, II and III of
mitochondrial DNA control region from unrelated Saraiki persons
of Pakistan.
34
41
3.3 Estimated haplotypes and haplogroups in Saraiki population from
different areas of Pakistan.
69
3.4 Haplogroups (%) frequency in Saraiki population from Pakistan.
74
3.5 Population genetics parameters of Saraiki population from
different areas of Pakistan
75
![Page 11: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/11.jpg)
ABBREVIATIONS/ UNIT ABBREVIATIONS
ºC Degree Centigrade
EDTA Ethylene diamine tetra acetic acid
Fig. Figure
KPk Khyber Pakhtunkhawa
ATP Adenosine tri phosphate
nDNA Nuclear DNA
mtDNA Mitochondrial DNA
DNA Deoxyribo Nucleic Acid
L-strand Light strand
H-strand Heavy Strand
D-loop Displacement loop
STR Short tandem repeat
bp Base pair
SNP Single nucleotide polymorphism
RFLPs Restriction Fragment Length Polymorphisms
PCR Polymerase chain reaction
HVR Hyper Variable region
pM Paicomol
µl Micro liter
MgCl2 Magnesium Chloride
mM Milli mole
V Voltage
![Page 12: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/12.jpg)
U.V Ultra violet
Rpm Revolution per minute
-ve Negative
CEMB Center of Excellence in Molecular Biology
M. Garh Muzaffar Garh
D. I. Khan Dera Ismail Khan
N Hyplotypes numbers
HG haplogroup
HGT Haplogroup Type
SA South Asian
WEA West Eurasian
SEA South East Asian
EEA East Eurasian
WA West Asian
SWA South West Asia
EA East Asia
AF Africa
Mg Muzaffar Garh
Ly Layyah
Bk Bhakar
Mi Mianwali
DIK Dera Ismail Khan
UK Umar kot
![Page 13: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/13.jpg)
GC Guanine-Cytosine
KYA Thousand Years Ago
MCL Maximum Composite Likelihood
rCRS revised Cambridge Reference Sequence
A Adenine
C Cytosine
G Guanine
T Thymine
HVI Hypervariable region I
HVII Hypervariable region II
HVIII Hypervariable region III
![Page 14: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/14.jpg)
i
ACKNOWLEDGEMENTS
I indebted to Almighty Allah, the propitious, the benevolent and sovereign whose
blessing and glory flourished my thoughts and thrived my ambitions, giving me talented
teachers, affectionate parents, sweet brothers, sweet sisters and unique friends. Trembling
lips and wet eyes praise for Holy Prophet Muhammad (S.A.W) for enlightening our
conscience with the essence of faith in Allah, converging all His kindness and mercy upon
him.
If there were dreams to sell, marry and sad to tell and crier rings the bell, what would
you buy, I will say that “University Charming Days”. Actually it is impossible, but it shows
my blind love to this institution, which is homeland of knowledge, wisdom and intellectually.
I love my Alma–Mater with the soul of heart, because it is just like the lap of mother. I am
proud of being student of this university.
My research work was accomplished under enthusiastic guidance, sympathetic
attitude, encouragements, inexhaustible inspiration and enlightened supervision of
Prof. Dr. Tanveer Akhtar. I offer my heartiest gratitude to my caring and kind supervisor
for her untiring help, sagacious suggestions, step-to-step guidance and close supervision
during the conduct of these investigations and in preparation of this manuscript. Thanks are
also to Prof. Dr. Muhammad Akhtar Chairman of Zoology Department University of the
Punjab, Lahore for continuous constructive criticism, co-operation and sympathetic attitude.
I am grateful to all my teachers of my academic career, who provide me their
shoulder to rise above and there will be shareholder of each and every success of my life. I
will be failing in my duties if do not extend my zealous thanks to Mr. Muhammad Hassan
Siddiqi who helped me a lot in practical work and provide me moral support in the
![Page 15: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/15.jpg)
ii
preparation of this manuscript. I am thankful to Dr. Muhammad Ayub Director
General Fisheries, Punjab and Malik Muhammad Ramzan, Deputy Director Fisheries, who
provide me moral support in the preparation of this manuscript. My cordial thanks goes to
Dr. Allah Rakha, Dr. Muhammad Akram Tariq and Dr. Abdul Razaq for their guidance
and help in data analysis.
Friends are the assets of life especially when together also express my gratitude to
Muhammad Arif Bhutta, Syed Aoun Raza, Muhammad Tayyab, Ghulam Hussain,
Muhammad Naeem Haider, Muhammad Sajid and Ghazanfar Abbas for their sincere
help and inspiring cooperation. I would like to take this opportunity to extend my thanks
from the core of my heart to my fellows Sana Shahbaz and Afia Muhammad Akram
without their cooperation and encouragement; I would never fulfill my work. I am thankful
to lab. Attendant Mr. Ghulam Abbas Anjum who helped me much during practical work.
I am unable to express my deepest gratitude towards my affectionate Uncle
Mian Muhammad Iqbal for the strenuous efforts done by him to enable me for developing
higher ideas of life for his patience and prayers he made for my success.
I find a great desire to mention cordial thanks to my wife for whom I regret to have
no better word than „Thanks a lot” for her sincere help and everlasting cooperation. My
acknowledgement will remain incomplete if don‟t acknowledge my sisters whose love is
more precious than diamonds and pearls. Nothing is completed for me without expressing my
deepest love, obligation and sincerity to my brothers Mian Ghulam Abbas,
Qari Khizzar Hayat and Mian Zulfaqar Ali for their moral support, who has always
motivated me to carry myself through the noble ideals of life. I am also thankful to all those
who pray and help me in the completion of this research work.
![Page 16: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/16.jpg)
iii
Finally, I will like to pay my sincere thanks to my adorable and affectionate Father
and Mother for their financial, moral support and valuable assistance in my academic
pursuits. Here I can say without reservation that whatever I am, it is because of prayers of my
beloved parents. Their unfathomable love, prayers and help, both moral and financial, have
rendered me sound environment during my studies.
Sikandar Hayat
![Page 17: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/17.jpg)
iv
SUMMARY
The analysis of mitochondrial DNA (mtDNA) control region was carried in 85
unrelated Saraiki males and females of different age groups inhabiting the different areas of
Pakistan. DNA was extracted from blood preserved in EDTA vacutainers. Hypervariable
regions I, II and III (HVRI, HVRII & HVRIII) were PCR amplified and sequenced.
Sequencing results were aligned and compared with revised Cambridge Reference Sequence
(rCRS) which showed the presence of total 63 different haplotypes, 58 of them were unique
and 05 were common haplotypes in more than one individual. The most common haplotype
observed was (W6) with a frequency 12.9% of population samples. The Saraiki population
was detected with genetic diversity 0.9570 and 0.9458 power of discrimination. High
molecular diversity and low match probabilities confirmed the value of control region data in
the investigation of maternal genetic lineages in Saraiki population. The Saraiki individuals
showed similarities in their mtDNA lineage composition which may be the result of
endogamy. This study aimed to investigate the sequences of mitochondrial DNA (mtDNA)
control region in Saraiki population and contribute in extension of forensic mtDNA reference
data for Saraiki population in Pakistan. Moreover, this research will develop the knowledge
about Saraiki population in understanding of geographic and linguistic factors on population
diversity and structure in this region which will provide a base for future work in this field.
![Page 18: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/18.jpg)
1. INTRODUCTION AND LITERATURE REVIEW
Pakistan came into its existence in 14 August 1947 and this area already has been
remained very important in the human history. Moreover, Pakistan is located in that area
which has been the way of numerous invaders and those have took part in the cultural and
linguistic diversity found in this country. Pakistan is located, near Afghanistan, Iran in the
west, India in the East and Arabian Sea in south, having latitude and longitude 33.6667oN
and 73.1667oE. Geographically Pakistan is divided into various regions on the basis of
physical characteristics. Those areas are Northern and Western mountainous areas, Salt hilly
areas, Potohari regions, upper and lower part of River Indus.
According to this distribution, the Northern Mountains are spread to Pakistan‟s northern
territory, Kashmir and Gilgit. While the western areas divide Khyber Pakhtunkhwa (KPK)
and Balochistan. The Potohari region and Salt ranges are part of the Punjab province.
Pakistani population is divided into more than 18 ethnic and 60 linguistic groups on the basis
of their origins and languages (Grimes, 1992; Larik, 2000).
The upper part of River Indus is the part of Punjab and is known by the Saraiki belt.
Anthropologists have distinct the existence of Saraiki Civilization near to the Indus valley on
the Western side and Harrapa Civilization on its Eastern side near about 40,000 years ago.
Similar to most of the other civilizations of the Indus Valley, the Saraiki culture represents
historic pre-Aryan people of a Semite origin (Shackle, 1977). In Pakistan, most of the ethnic
groups have their prehistoric basis but language is one of the important characteristics
markers. Every population differs from other population on the basis of language,
civilization, physical appearance and genetic characteristics. Based on the social structure,
people are divided into various tribes and caste. So, the Saraiki ethnic group distinguishes
1
![Page 19: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/19.jpg)
itself on the basis of Saraiki language. In addition to this, consanguineous marriages are the
customs of Saraiki peoples which make them an important subject of this study.
In Pakistan Saraiki area extended from central Punjab to adjoining areas of Sindh,
Khayber Pakhtunkhwa (KPK) and Balochistan. In Punjab the word Saraiki was first time
known in 1960's earlier to that it was known as Lehnda or Multani. Saraiki is mostly spoken
in those districts which are located in South Punjab. Saraiki language is spoken by the some
population of KPK district (Dera Ismail Khan) and in some areas of province Sindh and
Balochistan. Majority of Pakistanis from southern districts of Punjab speak Saraiki as a first
language.
The human progression begins with the introduction of genus Homo about 2.5 -1.5
million years ago whose early sign was found in Africa (Klien, 1989). With the passage of
time, various species of the genus Homo were identified including H. ergaster, H. erectus,
and the H. floresiensis (Swisher et al., 1994; Gabunia and Vekua, 1995; Brown et al.,
2004), all these species now have been disappeared with the entry of modern H. sapiens,
which is the fully developed species of human being that was appeared about 100,000 years
ago in East Africa (Klien, 1989). The scientific society believes that modern humans came
in Africa and many other waves of migrations help to explain their way out of Africa (Luis et
al., 2004; Macaulay et al., 2005). Fossils and archaeological record explained that scattering
of modern humans became possible at that time when weather conditions become suitable for
life. The discovery of 125,000 old pieces in Eritrea`s Red Sea coast suggested that people
from the Horn of Africa moved across the Arabian headland to the south part of the Red Sea
(Walter et al., 2000). From Arabia, people migrated towards West, East and reached Western
Europe and Siberia and East Asia about 39 KYA. These migrations of people resulted in the
2
![Page 20: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/20.jpg)
development of several different populations and various races of modern humans that are
differentiated on the base of differences in their physical characteristics, culture and
language. In addition to fossil and archaeological evidence in the favour of African origin for
modern humans, molecular genetics records are also in the favour of this idea (Batzer et al.,
1996; Tattersall, 1997; Shiver et al., 1997; Scozzari et al., 1988; Stringer and Andrew, 1988).
The social divisions are very inflexible and have been remained with no disturbance
by increasing urbanization and cultural changes in the different societies of modern human
(Tamang and Thangaraj, 2012). Pakistan lies on the postulated shoreline which was
followed by modern humans during coming out of Africa and therefore it is recognized as
one of the first region that was occupied by the humans (Qamar et al., 1999). Pakistani
population diversity is measurable on the basis of civilization, languages, religions and
genetic lineages. On the basis of customs and languages Pakistani population has been
divided into various18 ethnic groups having different origins, among which endogamy is
generally accomplished (Ayub et al., 2009). The endogamy of populations generates a high
degree of genetic discrimination (Murci et al., 2004). In order to achieve the best and
resourceful knowledge for forensic purposes it requires that on regional or ethnic basis a
reliable data should be developed.
Pakistani culture is generally organized in the tribal form, which is more common in
the rural areas of Pakistan than in the cities. Normally, the tribe names are inherent and do
not change after marriage. However, females do not pass their tribe name to their children.
Generally speaking, in Pakistan marriages within families are frequently followed by ethnic
and religious association and relationships. Cousin marriage is accomplished in the rural
parts of the population but is limited to the Muslims (Tadmouri et al., 2009).
3
![Page 21: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/21.jpg)
In many human populations from Pakistan the mtDNA control region remained
almost unknown due to insufficient data available from those populations. Due to this factor
a best quality data of mtDNA control region for forensic applications has not been developed
yet. So, missing of best quality mtDNA is challenging the country by the presence of many
various human groups with discrete genetic diversity level (Bobillo et al., 2010).
1.1 MITOCHONDRIA
Mitochondria are the most important organelles found in cytoplasm of eukaryotic
cells and play fundamental role in the respiration of the cells (Bandelt et al., 2006). Enzymes
within the outer and inner membranes of the mitochondria help in converting materials into
adenosine triphosphate (ATP) which is fuel for the metabolic activities of the cell (Davidson,
2010; Reece et al., 2011). The mitochondrion is the place in which the final stages of aerobic
respiration take place. This complex system empowers cells to use aerobic respiration to
generate approximately 15 times more ATP than anaerobic respiration (Davidson, 2010).
The mitochondrial genome is made up of approximately 17,000 base pairs (Butler,
2009). The main characteristic of mitochondria relevant to this study is that they possess their
own genome and contains highly informative polymorphic sites (Reljanovic et al., 2012).
These semi-autonomous organelles also possess the important RNA machinery for
mitochondrial DNA translation and transcription (Scheffler, 2008). Even though
mitochondria cannot survive independently of the cell in which they live but mitochondria
can replicate their own DNA autonomously of nuclear DNA (Hartl and Jones, 2005). Beside
the energy formation, mitochondria are very important machinery in signaling of calcium and
metabolism regulation within the cells (Giezen and Tovar, 2005).
4
![Page 22: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/22.jpg)
All eukaryotic cells contain at least some mitochondria which act as energy producing
organelle (WU et al., 2013). These mitochondria possess their own DNA, having important
proteins for oxidation systems (Smeitink et al., 2001). As all eukaryotic cells have the
mitochondria so, those species which possess the mitochodiria can be easily forensically
investigated on the basis of mtDNA analysis. On account of mtDNA analysis maximum
information are obtained from analyzed samples for forensic purpose.
Human cells have a different number of mitochondria, depending upon the metabolic
activities of the particular cells (Davidson, 2010) and typically the copy number of
mitochondrial DNA is 100-10000 copies/cell (Malyarchuk and Rogozin, 2004). Some cells
like that of ascidian spermatozoa contain one mitochondrion whereas humans, heart and
muscle cells contain thousands of mitochondria and the tissues that are high in respiratory
activity have mitochondria with a greater amount of folding which increase the surface area
for respiration (Hahn and Voth, 1994).
1.2 MITOCHONDRIAL MORPHOLOGY
The animal mitochondrion‟s structure is very complex (Fig.1.1) due to its vital
function in energy production. It has two membranes that separate into four distinct sections
in which each membrane-bound section is able to generate ATP (Mcbride et al., 2006). The
two membranes divide the organelle into a narrow inner membrane space and a large internal
matrix (Davidson, 2010). The outer membrane of the mitochondrion contains channel
proteins while the inner mitochondrial membrane consists of widespread folding called
cristae (Davidson, 2010). The inward folds of the cristae increases the surface area available
for enzymes concerned in cellular respiration (Davidson, 2010).
5
![Page 23: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/23.jpg)
Fig. 1.1: Internal structural features of the animal mitochondria (Davidson, 2010).
Mitochondria can be found in a variety of different morphologies in mammals
(Okamoto and Shaw, 2005). They range in shape from long tubules inter connected to one
another to small separate spheres (Okamoto and Shaw, 2005). Mitochondria also range in
size between approximately 1 to 10 micrometers but are known to vary in both size and
morphology regularly (Davidson, 2010).
The mtDNA, because of its circular structure and location inside the cell is more rigid
and strong than the nuclear DNA (nDNA), it is shown that mtDNA is secure from
degradation even when exposed to prolonged environmental conditions while such properties
have not been observed in the case of nDNA. That is why mtDNA is present even in older
and degraded samples. Hence, this property has made mtDNA more valuable than nDNA in
the field of forensic sciences.
6
![Page 24: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/24.jpg)
1.3 NUCLEAR AND MITOCHONDRIAL DNA
Multicellular organisms grow by slow process of progressive change that begins with
the fusion of very specialized cells an egg and a sperm. As the result of egg and sperm union
a zygote develops containing genetic information (nDNA) inherited from both parents that
articulate the fetus development (Gilbert, 2006). As the zygote divides mitotically to produce
all cells of the body, nuclear genes are not lost or changed and the genome of each cell is
equal to that of every other cell. Nuclear DNA is enveloped into individual chromosomes
having total twenty three pairs in normal cells. In every eukaryotic cell, its chromosome
possess a very long DNA molecule consisting of many genes which are known as the unit of
heritage (Richly and Leister, 2004).
Mitochondrial DNA is known as major source of important proteins in outside of the
eukaryotic cells nucleus. The human mtDNA was sequenced in 1981 first time by Anderson
(Hoong and Lek, 2005). As human mtDNA is double stranded so both of these strands are
differentiated from each other by nucleotides composition having heavy strand (H-strand)
and light strand (L-strand) (Fig. 1.2). Heavy strand is rich in guanine while light strand is
rich in cytosine. mtDNA has 16,569 bp in length (Ketmaier and Bernardini, 2005) and
possess many copies in human cells having high mutations, lacking recombination and
maternal heritage (Tsutsumi et al., 2006). Due to these properties of mtDNA, it has become
very easy to get maximum information about the ancient DNA by its analysis for certain
forensic cases (Witas and Zawicki, 2004; Tsutsumi et al., 2006). mtDNA has many copies
and according to some scientist that a cell contains100-10,000 copies of mtDNA on the basis
of energy demand by the cell, greater the demand of energy larger will be the numbers of
7
![Page 25: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/25.jpg)
copies of mtDNA. Mitochondrial DNA molecule contains 37 genes; out of 37 genes 28 are
present on heavy strand while 9 genes are present on light strand (Andrews et al., 1999).
Fig. 1.2: Genes, rRNA and tRNA coded in human mitochondrial DNA (Childs, 2003).
Large numbers of the mtDNA molecules are present in each cell of the organisms.
These molecules have different ranges in different cells for example a single oocyte cell
contains about 50,000 molecules while sperm cell contains only few hundred mtDNA
molecules. Normally epithelial cells are used for forensic cases and these cells commonly
contain 5000 mtDNA molecules (Bogenhagen and Clayton, 1974). This property of mtDNA
molecule has made it a vital and sensitive molecule for the detection of very low amount of
the DNA present in a sample or the detection of DNA from those samples which have been
badly degraded. In any individual mtDNA is derived from its mother because during
fertilization only small portion of sperm enter into the egg cell (Manfredi et al., 1997). As
mitochondria are present in the tail of sperm cell and during fertilization only head of sperm
cell incorporate into egg cell and tail remain outside that is why new organism obtained
mtDNA from its mother. So, mitochondrial DNA analysis is used to detect the maternal
inheritance in any generation (Gill et al., 1994). In some individuals mtDNA mutation rate is
8
![Page 26: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/26.jpg)
much higher than that of nuclear DNA (Schriner et al., 2000). Due to this mutation a
population shows significant diversity which can be helpful to know the evolutionary history
of the population, that is why nuclear and mitochondrial mutation rates for the human lineage
have been deeply discussed (Scally and Durbin, 2012).
Mammalian mitochondrial DNA is divided into two different replication origins. The
origin of the heavy strand is inside the D-loop of mtDNA and light strand originates within a
cluster of five tRNA genes nearly opposite of the D-loop. The single focus of current forensic
typing is the D-loop. The D-loop consists of about 1100 base pairs of non coding DNA and is
generally known as the hypervariable region. The hypervariable region is further divided into
three segments. Hypervariable region I (HVR1) spans nucleotide positions 16024-16365;
hypervariable region II (HVR2) span nucleotide positions 73-340 and hypervariable region
III (HVR3) spans nucleotide positions 438-576. HVRI and HVR2 are usually targeted
whereas HVR3 is hardly study in forensic case work (Fig.1.3). The hypervariable region
mutate at a rate of 10 to 17 times more than marked areas of the nuclear genome (Bar et al.,
2000).
Fig.1.3 Schematic diagram of human mtDNA control region (Rakha et al., 2011).
9
![Page 27: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/27.jpg)
The distinguishing character of human mitochondrial DNA (mtDNA) is that it
possesses a lot of information for population and evolutionary genetics studies
(Cavelier et al., 2000). Another important and main character is the maternal inheritance
(Giles et al., 1980). Mitochondrial DNA (mtDNA) has huge potential in forensic genetics,
allowing recognition of genetic material. Single Nucleotide polymorphism SNPs have a
number of characteristics that make it unique for forensic analysis (Bento et al., 2009).
1.4 mtDNA GLOBAL PHYLOGENY
Human maternal lineages have been classified into different haplogroups. Basal
haplogroups reveal continent specificity (Richards et al., 2000; Herrnstadt et al., 2002). The
possible root of human mtDNA tree is between haplogroups L0 and L1 separating the
phylogenetic tree into two basic clades (Chen et al., 2000; Salas et al., 2002; Salas et al.,
2004; Kivisild et al., 2004). Only L3 expand from Africa in the form M and N haplogroups,
giving rise to Eurasian variations and majority of western Eurasians are identified by N
haplogroup sub-clade (Finnila et al., 2001; Herrnstadt et al., 2002; Palanichamy et al., 2004).
It has been seen that M and N haplogroups almost equally contribute in the identification of
eastern Eurasian (Schurr and Wallace, 2002; Yao et al., 2002).
1.5 THE IMPORTANT CHARACTERISTICS OF HUMAN mtDNA
In human population mtDNA has been used in large number of fields like evolution,
anthropology, history, inheritance and in many forensic cases. With the knowledge of
mtDNA analysis inheritance history creation and verification has increased rapidly in the
field of forensic science. Due to this improvement every individual want to get more
knowledge about his ancestors and believe that mtDNA analysis will be very helpful in
giving the maximum information about the inheritance and in reorganization/identification of
unknown suspect (Chaitanya et al., 2014). mtDNA also play a key role to get the
10
![Page 28: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/28.jpg)
information about maternal inheritance. As Mitochondrial DNA is present in high numbers in
the cells as compared to nuclear DNA so it has become very easy to find it in greatly
degraded samples for forensic analysis (Adachi et al., 2014).
The basic aim of this study is to get knowledge about control region of human
mitochondrial DNA.
Followings are the important basic properties of human mtDNA (Scheffler, 2008).
• Human mtDNA molecule has small number of proteins and RNAs which very important
for mitochondrion functions and activities.
• mtDNA is double stranded molecule having large numbers of genes which ply key role in
the vital functions of the cell.
• mtDNA is only transferred from mother.
• It has no recombination and replicates quickly.
Mitochondria have a small circular genome (Fig. 1.4) which is made up of
approximately 17,000 base pairs (Butler, 2009). The main characteristic of mitochondria
relevant to this study is that they possess their own genome. High concentrations of mtDNA
are found in bones, teeth and hair which are very useful for forensic analysis. mtDNA is
circular in shape which means there are no free ends for exonuclease activity to use to
degrade the genome. It has been observed that mtDNA is widely used to know a specie
characters and phylogeny. Overall, mtDNA is forensically very small molecule with a high
mutation rate and conserved gene (Gray, 1989).
11
![Page 29: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/29.jpg)
Fig. 1.4: Mitochondrial DNA, Schematic diagram of the 16.6-kb, circular, double-stranded
mtDNA molecule and the outer circle represents the heavy strand and the inner circle the
light strand. The genes encoding the mitochondrial RC: MTND1–6, MTCOI–II, MTATP6
and MTCYB (Andrews et al., 1999).
Mitochondrial DNA is similar to nuclear DNA in a few ways but different in some
ways (Table 1.1). One major difference between nDNA and mtDNA is their inheritance
pattern within families. The genome of an individual consists of equal contributions of
chromosomes from both the maternal and paternal germ lines while mtDNA is inherited only
from the maternal line (Taanman, 1999). Displacement loop or D-Loop of mtDNA has been
extensively studied for its potential use in forensic applications. The D-Loop has also been
referred to as the control region because it regulates the gene products produced by the
coding regions of the mitochondrial genome (Parson and Coble, 2001).
12
![Page 30: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/30.jpg)
TABLE 1.1: Characteristics comparison between mitochondrial DNA and nuclear DNA
(Alonso et al., 2004).
Mitochondrial DNA Nuclear DNA
Close, Circular molecule Linear molecule
16, 569 base pairs in size 3 billion base pairs in length
1100 base pair non coding region A large portion of genome non coding
Maternaly inherited Biparental inherited
No recombination in mtDNA Recombination in nDNA
50 to many thousand copy per cell Two copies per cell
The D-Loop is also a region of polymorphism within the mitochondrial genome due
to high frequency of base changes (Bini et al., 2003). These highly polymorphic regions have
been called hypervariable regions and have been the focus of forensic DNA typing for
recognition purposes (Garritsen, 2001). Polymorphisms of the hypervariable regions in the
D-Loop structure have also been important in anthropological studies on the historic origins
and migratory patterns of early human populations (Pliss, 2007). Since mtDNA is inherited
matrilinearly, specific mtDNA haplotypes have also been useful in determining an
individual‟s ethnic origins (Herrnstadt et al., 2002).
With the improvement of knowledge in the field of molecular biology and molecular
genetics it became very easy to support the evidences about the evolution of modern human
from anthropological and archeological records (Ingman et al., 2000; Macaulay et al., 2005).
In recent times with the great development of genetic markers it has become very easy to test
diverse hypotheses about the genetic history and evolution of human populations (Rogers and
Jorde, 1995; Hammer et al., 1998; Templeton, 2002; Hebsgaard et al., 2007). Particularly,
13
![Page 31: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/31.jpg)
Anderson (1981) revolutionized the molecular genetics by completing the 16,569 base pairs
sequencing of human mitochondrial genome due to which it has become possible to get
knowledge about the time of origin and time of dispersal of human population out of Africa
to other various continents (Ingman et al., 2000; Macaulay et al., 2005).
How humans occupied the earth is one of very important indescribable story of
human race (Goebel, 2007)? Mitochondrial DNA is a key tool in order to know the
prehistory of human population. From the Phylogenetic tree analysis it becomes obvious that
modern humans have expanded out from Africa (Watson et al., 1997; Ingman et al., 2000).
According to some scientist the sub-Saharan Africa along the India has been remained the
migratory rote of modern human expansion from Africa (Forster and Matsumura, 2005;
Macaulay et al., 2005) and then it migrate to North Africa and Europe (Olivieri et al., 2006).
But still modern human expansion from Africa is still unclear due to lack of strong molecular
evidences about human history.
Genetic and paleoanthropological evidences expose that human population expanded
on account of geographic improvement that began approximately 60,000 years ago in Africa
and gradually started occupying all those regions of the Earth that were suitable for
habitation. Genetic data obtained from current humans recommend that due to continuous
loss of genetic diversity today expansion of human become possible. This great human
expansion from Africa can help to improve the evolutionary knowledge of modern human
(Brenna et al., 2012).
There is a significant similarity in the linguistic hierarchy (Fig. 1.5) which confirms
the Darwin‟s assumptions that if someone knew the human biological hierarchy, he can know
14
![Page 32: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/32.jpg)
about his languages (Darwin, 1860). Molecular Genetic evidences pointed out that all the
modern human population has common ancestry (Li and Durbin, 2011).
Fig. 1.5: Phylogenetic tree of major languages (Desmet et al., 2012).
With passage of time Different genetic adaptations were made by the modern human
when their ancestors came out of Africa (Ingman et al., 2000). A fossil was found about
50,000 years ago across the Eurasia whose morphology was similar to that of present day
humans (Fu et al., 2013). Different environmental factors are also affecting the human
genetics in different ways. With the change of environment many genetic adaptations have
been occurred in human population. As human came out of Africa he has to face numbers of
environmental challenges. In recent times, through genetic analysis it has came to know that
15
![Page 33: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/33.jpg)
large numbers of the genes have been changed in East Asian populations extensively
(Xu et al., 2009).
Many hypothesis support the anatomically single origin for modern humans
(Cann et al., 1987; Underhill and Kivisild, 2007). In order to know the maternal common
ancestor of modern human, phylogenetic data has played important role in this regard
(Mellars, 2006; Torroni et al., 2006). But still in spite of phylogenetic data improvement,
there are no strong evidences about the distribution of Homo sapiens population (Mellars,
2006; Hawks, 2007). According to some scientists the mtDNA molecules in human
population are same at the time of birth (Taylor and Turnbull, 2005) and each mitochondrion
contains an average of five copies of its genomic DNA. There are hundreds to thousands of
mtDNA molecules within a single cell (Kavlick et al., 2011).
Human mitochondrial DNA has been generally used to get the knowledge about its
evolution, migration and population history (Tambets et al., 2004). Human mtDNA is
inherited from mother and shows a minute rate of recombination. Due to this low rate of
recombination it has been widely used to improve the knowledge about the population
migration globally (Torroni et al., 2006). Mitochondrial DNA (mtDNA) variation has been
verified to be the most powerful genetic marker for investigating gene pools and tracing
maternal genetic similarities (Cavalli-Sforza and Feldman, 2003; Malyarchuk et al., 2008).
Due to great improvement in mtDNA analysis for forensic purpose now it has become
possible that on the base of this analysis missing and criminal persons can be easily identified
when short tandem repeat technique is not giving any information about those persons
(Chaitanya et al., 2014).
16
![Page 34: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/34.jpg)
mtDNA analysis has been used effectively in order to determine the family
relationships when there is a gap of several generations between ancestor and living person
(Gill et al., 1994; Weichhold et al., 1998). The maternal inheritance of animal‟s mtDNA is
almost worldwide and highly concentrated (Rawi et al., 2011; Luca and Farrell, 2012). An
individual genome consists of equal contributions of chromosomes from both the maternal
and paternal germ lines while mtDNA is inherited solely from the maternal line (Taanman,
1999). mtDNA is only inherited from mother and this property of mtDNA has many
important applications in the fields of evolution anthropology, population history, genetics,
genealogy and forensic science (Shriver and Kittles, 2004; Taylor and Turnbull, 2005;
Blansit, 2006; Torroni et al., 2006; Kayser, 2007; Underhill and Kivisild, 2007).
All modern humans have a certain types of mtDNA. These types of mtDNA are
related with the SNP pattern within the mitochondrial genome and are called haplogroups.
Each person belongs to a definite haplogroup and a particular haplogroup can exhibit a
person‟s common female specific place of origin (Torroni et al., 2006). Haplogroup analysis
is also used to trace population relocation patterns (Santos, 2004).
mtDNA macrohaplogroups have been distributed broadly worldwide in different
regions on the basis of distinctive characteristics of that particular region. In this regard L is
primarily haplogroup found in Africa which shows the largest diversity of mtDNA
haplogroups. After L haplogroup, M and N haplogroups show highest diversity in South
Asia especially in India (Basu et al., 2003; Metspalu et al., 2004; Palanichamy et al., 2004;
Sun et al., 2006; Thangaraj et al., 2006; Chaubey et al., 2007). From this, it is clear that after
dispersal of human from Africa, India played important role in human evolution. Both M
17
![Page 35: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/35.jpg)
and N haplogroups are found in high frequency in India but among those haplogroups M is
more common as compared to N haplogroup.
Basically mitochondrial DNA haplogroups are divided into three major haplogroups
which are L, M and N whose distribution is very distinctive. Among these three major
haplogroups L haplogroup is oldest and is restricted to African populations. L haplogroup has
sub-clade like L0, L4, L6, L3 and L7 and with the passage of time L3 haplogroup came out
of Africa in the form of M and N haplogroup about 60,000 years ago (Mishmar et al., 2003).
Later on these haplogroups introduced in South East Asia, Australia and South Asia.
According to some scientist N haplogroup has been found in West Asia, East Asia, Australia,
Europe and South Asia (Salas et al., 2002; Mishmar et al., 2003; Kong et al., 2003).
In the beginning human mtDNA study was based on restriction fragment length
polymorphisms (RFLPs) (Cann et al., 1987; Scozzari et al., 1988), but with the passage of
time as polymerase chain reaction (PCR) and sequencing techniques developed, scientist
started both these techniques to study human mtDNA instead of RFLP analysis (Torroni et
al., 1996; Macaulay et al., 1999).
1.6 SIGNIFICANCE OF mtDNA
The highly recombination nature of mtDNA is very important in the analysis of
forensic casework, like identification of missing individuals and mother inheritance due to
which it has become possible to identifying suspects by mtDNA analysis, when STR analysis
cannot provide required information (Chaitanya et al., 2014).
Sequencing of mtDNA offers many advantages in forensic science applications. One
advantage is the abundance of mtDNA within the cell. There are 500 to 2,000 copies of
mtDNA in each human cell as compared to only two copies of nuclear DNA in most cells
18
![Page 36: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/36.jpg)
and some cells do not contain nuclear DNA at all (Parson and Coble, 2001). mtDNA analysis
data is very useful for species identification (Wells and Stevens, 2008). Thus, in a small
biological sample recovered from a crime scene, there will be excess quantity of mtDNA for
analysis as compared to nDNA. So, mtDNA is beneficial for those cases in which the
extracted DNA sample is very small (Kavlick et al., 2011). Moreover, some tissues in the
body that do not contain significant amounts of nDNA but contain sufficient amount of
mtDNA useful for forensic analysis. For example, hair shaft essentially lacks nDNA but
contains considerable amounts of mtDNA. Hair is a common type of forensic evidence. In
addition, finger and toe nails naturally lack nDNA but contain mtDNA (Saferstein, 2007).
Difference and variations in mitochondrial DNA provide major information in order
to get significant knowledge about human evolution and these information play a key role in
forensic cases. Usually, human mitochondrial DNA possesses diverse features such as single
nucleotide polymorphism, hypervariable regions and short tandem repeat (Lee et al., 2009)
which have made it more valuable. mtDNA is divided into two main sections, one of them is
large coding region responsible for the construction of various biological molecules involved
in the energy production for the cell and other is a small 1.2 kilobase pair fragment which is
called the control region. This control region is highly polymorphic and has different
hypervariable regions. These hypervariable regions have been broadly used in forensic
investigations (Parson et al., 1998).
The control a region is polymorphic within the mitochondrial genome due to high
frequency of base substitutions (Bini et al., 2003) and mtgenome in it are enriched in
sequence variation due to a higher mutation rate which allows researchers to create a mtDNA
profile (Kohnemann et al., 2008). This control region is also responsible for the defined
19
![Page 37: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/37.jpg)
binding of several nuclear encoded proteins that regulate mtDNA replication and
transcription (Falkenberg et al., 2007).
Mitochondrial control region DNA pattern have been recommended to express the
geographic origin as well as the migrations history of the populations (Irwin et al., 2008; Van
Oven and Kayser, 2008; Saunier et al., 2009; Zgonjanin et al., 2010). The hyper variable
regions are very helpful in forensic for identification purposes (Garritsen et al., 2001).
Polymorphisms of the hypervariable regions in the D-Loop structure have also been
important in anthropological studies on the historic origins and migratory patterns of early
human populations (Pliss, 2007). Since mtDNA is inherited matrilinearly, specific mtDNA
haplotypes have also been useful in determining an individual‟s ethnic origins. So, control
region is very important and is used in forensic cases and population genetics (Barbosa et al.,
2008). Thus mtDNA haplogroup typing has become a basic instrument for the study of
human evolution and ancestry (Lee et al., 2013).
1.7 mtDNA POLYMORPHISMS
In humans 99.9 % of the genome is identical and out of 99.9% only 0.1-2.0% of the
DNA sequence displays variations. These variations cause genotypic and phenotypic
differences between individuals. These variations arise due to polymorphisms which are non-
pathogenic changes that exist at significant frequencies. Different types of polymorphism
have been exposed in the coding as well as in non-coding regions of the human genome
which not only untie our evolutionary past but to determine our biological future. One of this
polymorphism single nucleotide polymorphism (SNPs) is most common polymorphism in
the human genome and it includes single base substitutions, deletions and insertions. The
base substitutions are categorized into two groups namely transitions and transversions.
During transition purine is replaced by a purine (A ↔ G) or a pyrimidine by a pyrimidine
20
![Page 38: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/38.jpg)
(C ↔ T). While in the case of transversion a purine is replaced by a pyrimidine. According to
Collins and Jukes (1994) the transition mutation mostly occurs in the mammalian genome as
compared to transversions mutations. According to the single nucleotide polymorphism
database more than 6 million SNPs lie within genes (Serre and Hodson, 2006). SNPs were
the first generation of polymorphic genetic markers. The use of SNPs was realized late
in1970‟s with the improvement of restriction fragment length polymorphism (RFLP)
(Roberts and Murray, 1976).
Polymorphisms are changes which occurred in nucleotides sequences of DNA control
region. Among different causes of polymorphisms in mtDNA one of them is lacking of
protective histone proteins. In support of mtDNA typing for forensic analysis, extensive
population research has shown that the haplotype of SNPs in the D-Loop are well correlated
with an individual‟s specific ethnicity (Pliss, 2007). This highly polymorphic nature of
mtDNA has made it more valuable and significant for biological evidence in forensic
casework (Maruyama et al., 2013). Mitochondrial DNA polymorphism has proved very
important in getting molecular genetics sketches of world populations as well as for the
explanation of the human evolutionary history and past migrations (Bermisheva et al., 2003).
The totally maternal inheritance, the absence of recombination and the high rate of mutation
in the control region mainly in hypervariable region I, II and III are the important properties
of mitochondrial DNA (Ge et al., 2010). In D-loop of mtDNA mutation occurs at high
frequency as compared other regions of mtDNA (Michikawa et al., 1992).
Analyses of the polymorphisms have enabled the identification of haplogroups and
construction of phylogenetic trees to observe the close association of different populations
(Nagai et al., 2003; Tanaka et al., 2004; Asari et al., 2007; Mabuchi et al., 2007; Sekiguchi et
21
![Page 39: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/39.jpg)
al., 2008; Nohira et al., 2010). Comparison of mtDNA polymorphisms among various ethnic
groups has been important in the identification of different populations. The presence of
different mtDNA genome in a cell is known as heteropasmy and it was firstly identified
during mitochondrial diseases study (Holt et al., 1988; Wallace et al., 1988). Different
studies revealed that heteroplasmy is not present only in defective individuals but it is also
present in normal individuals which can be easily observed in healthy samples (Santos et al.,
2005; Santos et al., 2008; Irwin et al., 2009). It has been observed that heteroplasmy levels
may be different between tissues (Grzybowski et al., 2003: Irwin et al., 2009; Goto et al.,
2011) and populations (Irwin et al., 2009). Due to its peculiar properties, heteroplasmy is
also used as genetic markers for forensics applications. At the time of oogenesis some
blockages occurred as result of which heteroplasmic alleles frequency vary from generations
to generations and not remain same. To know about the alterations in allele frequencies at
heteroplasmic sites, it has become very important to explore the dynamics of maternal
mtDNA transmission (Goto et al., 2011).
The unique property of heteroplasmy is that it explores the presence of two or more
unique mtDNA types within a single cell (Paneto et al., 2007). Researchers now consider
both length heteroplasmy and sequence heteroplasmy as prospects (Li et al., 2010). In
mitochondrial genome the pattern of heteroplasmy variations is not clear still, making
explanation of particular difficulty for forensic experts (Budowle et al., 2003; Naue et al.,
2011). Knowledge of human mitochondrial heteroplasmy level has become very significance
in the number of fields (Ramos et al., 2013).
The variations occurring in mitochondria variations play vital role in knowing the
human origin and aging process (Taylor and Turnbull, 2005). These variations occurring in
22
![Page 40: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/40.jpg)
mitochondrial DNA cause the development of diverse mitochondrial databases having
information related to human evolution and genetics (Kogelnik et al., 1996). Usually
hypervariable regions are analyzed for forensic and evolutionary purposes due to the high
polymorphic rate (Fridman et al., 2011).
To understand human origin and its evolution, nucleotide variations in mtDNA are
the chief subjects in this regard (Lell and Wallace, 2000). Particular nucleotide variants
perform a key role in maternal biogeographic ancestry (Kayser and Knijff, 2011). The most
polymorphic region of mtDNA is its control region which contains 3 hyper variable regions
HVR1, HVR2 and HRV3 (Bogenhagen and David, 1974). Besides HVR1 and HVR2, the
HVR3 provide extra information for haplotype purpose (Haslindawaty et al., 2010). The
investigation of the polymorphisms located in mtDNA genome allows tracing back the
evolutionary process in populations history and analysis of hypervariable region in the non-
coding region or D-Loop, allowed to detect specific characteristic of the populations (Bandelt
et al., 2003).
Considering the huge historical demographic patterns and present day structure of
Saraiki population, characterization of the genetic variation in Saraiki population will be
important in the establishment of representative forensic reference population databases for
the region. In present study mitochondrial DNA control region data of Saraiki population
from Pakistan has been generated for the forensic guidelines as mtDNA reference data using
the global mtDNA phylogeny background. This is the first study to evaluate the power of
discrimination of 85 unrelated Saraiki individuals with the simultaneous analysis of
hypervariable regions from Pakistan to aid human identification in forensic cases and to
investigate the sequences of mitochondrial DNA control region in the population.
23
![Page 41: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/41.jpg)
2. MATERIALS AND METHODS
2.1 POPULATION STUDY
Total 85 blood samples were collected from unrelated healthy males and females
belonging to Saraiki ethnic group from different areas of Pakistan. Out of 85 samples 75
were males and 10 were females belonging to different age groups. Information of donors
regarding family name, gender, age, ethnicity, birthplace of mother and father, consanguinity
of parents and their first language was recorded in consent form (Fig. 2.1-A, 2.1-B).
2.2 BLOOD SAMPLES COLLECTION
About 3ml blood sample was drawn by vein puncture with syringe from healthy
Saraiki males and females volunteers of Pakistan. For this purpose paramedic staff was
involved after approval from ethical committee of University of the Punjab Lahore. This
blood was collected in EDTA vacutainers. Information‟s were collected from all the
participants after the explaining the aims and procedures of the study. After the blood
collection it was store immediately into freezer at low temperature to protect the DNA from
degradation. Then this stored blood was brought to Zoology Department, Parasitolgy
Laboratory in University of the Punjab, Lahore for further process.
24
![Page 42: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/42.jpg)
Fig. 2.1-A: Consent form for Saraiki donor‟s record in national language from
Pakistan.
25
![Page 43: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/43.jpg)
Fig. 2.1-B: Consent form for Saraiki donor‟s record from Pakistan.
26
![Page 44: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/44.jpg)
2.3 DNA EXTRACTION
mtDNA was extracted from collected samples of blood using QIAamp DNA Mini Kit
(Qiagen, Hilden, Germany, Cat#51306) according to company protocol. The DNA quality
was determined by loading it on 0.8% agarose gel along with 100bp DNA marker through
gel electrophoreses. Before loading, the sample was mixed with 6x loading dye (Thermo
Scientific, USA). The extracted DNA was incubated at 70oC for I hour to avoid degradation
by nucleases then it was stored at -40oC in ultra low freezer for further process. For the
quantification of extracted genomic DNA Nano Drop™ 1000 Spectrophotometer (Thermo
Scientific, Wilmington, DE) was used (Sambrook and Russell, 2001).
2.4 PRIMER DSIGNING
Two primers for mtDNA control region amplification and sequencing were designed
using web-based primer designing (http://forensic.yonsei.ac.kr/protocol/mtDNA-CR.pdf).
Primers of required sequences were synthesized from Gene LinkTM USA (Table 2.1) to a
concentration of 100 pM/µl and were diluted to10 pM/µl for further process. These primers
were optimized for optimum reaction condition of temperature, buffer and dNTPs.
TABLE 2.1: Primers used for PCR amplification and sequencing of mtDNA control region.
Sr. No. Primers Name
Primers Sequences (5’→3’)
TM
(oC)
1
Amplification and
sequencing primer-
F15975
CTCCACCATTAGCACCCAAA
56.0
6
Amplification and
sequencing primer-
R635
GATGTGAGCCCGTCTAAACA
55.6
TM, Melting Temperature; F, Forward; R, Reverse
27
![Page 45: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/45.jpg)
2.5 PCR AMPLIFICATION OF mtDNA
The mtDNA control region was amplified by PCR using F15975 and R635 as
forward and reverse primer respectively in thermo cycler Applied Biosystems 2720 USA.
PCR reaction volume was 50μl containing 1-2 ng of genomic DNA, 3μl of 10pM
concentration of each forward and reverse primer, 5μl of 10 X PCR buffers (Thermo
Scientific, USA), 8μl MgCl2 25mM (Thermo Scientific, USA), 5μl dNTPs 7.5mM (Thermo
Scientific, USA, #R0181), 500U taq polymerase (5U/μl concentration) (Thermo Scientific,
USA, #EP0402) 1μl and 23μl dH2O (Vandegrift, 2010). Thermal cycling steps were
carefully optimized keeping in view melting temperature and percentage of GC contents used
in PCR primers. PCR protocol that was performed involved 35 cycling steps and different
annealing temperature and duration of time according to the primers and PCR product is
summarized in (Table 2.2) (Fig. 2.2).
TABLE 2.2: Cycling conditions for mtDNA control region amplification of Saraiki
population from Pakistan.
Cycling condition Temperature (°C) Duration
Pre- denaturation 95°C 11 minutes
Denaturation 95oC
30 Second
Annealing 56°C 30 Second
Annealing 72°C 90 Second
Extension 72°C 7 minutes
28
![Page 46: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/46.jpg)
Fig. 2.2: Thermal cycling profile for mtDNA control region amplification of Saraiki
population from Pakistan.
2.6 GEL ELECTROPHORESIS
After the completion of PCR reaction gel electrophoreses was carried out. Put 1gm of
agarose in a flask and final volume in flask was brought to 50ml by pouring the 0.5X TAE
buffer. The flask was heated in the microwave oven until the agarose was dissolved and the
solution in flask appears clear. After cooling the flask to 50°C, 1μl of ethidium bromide
(Sigma-Aldrich, St. Louis, USA) was added and flask was swirled gently before casting the
gel and set for 30 minutes. Once the gel was casted 5μl of PCR product and 2μl 6x loading
dye (Thermo Scientific, USA, #R0611) was added to the wells in the gel. In addition to this
5μl of 100bp ladder (Thermo Scientific, USA, #SM0323) was loaded as a DNA marker. The
gel was run at 100 V for 45 minutes using Power Pac (Bio-Rad) until it covered the 2/3 of the
distance. For required results gel was observed under ultra violet (U.V) light using and
Photographs were taken under UV transilluminator using (Photo Doc-It™ Imaging System,
UK) (Sambrook and Russell, 2001).
29
![Page 47: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/47.jpg)
2.7 PURIFICATION OF PCR PRODUCTS
After the successful PCR reactions, purification of PCR product was carried out using
Gene JET PCR Purification Kit #K0702 (Thermo Scientific USA) for sequencing. For this
purpose binding buffer was added in PCR products at the ratio of 1:1 by volume in this way a
solution of 800μl was prepared. Then this prepared solution was transferred in the Gene JET
purification column. Centrifuged it for 50 second at 10000 rpm using Sigma 2-16PK
refrigerated laboratory Centrifuge and discarded the flow through. Then added 700μl of
Wash Buffer to the purification column, centrifuged for 50 second at 10000 rpm. Discarded
the filtrate and put the purification column again into collection tube. Centrifuged empty
Gene JET purification column for 1 minute to completely remove any residual wash buffer
and it was essential because the presence of residual ethanol in the DNA sample may inhibit
subsequent reactions. Then, the Gene JET purification column was shifted to a clean micro
centrifuge tube. After that, added 50μL of Elution Buffer in the center of the Gene JET
purification column and centrifuge it for 1 minute at 10000 rpm. Remove Gene JET
purification column and store the purified DNA at -20°C.
2.8 mtDNA SEQUENCING
Mitochondrial DNA sequences are very significant because mtDNA sequence is
related with the geographic origin of the individuals (Maruyama et al., 2009). mtDNA
sequences covering the entire control region (16024-576) was analyzed according to
Irwin et al., 2007. Sequencing was carried out using Big Dye Terminator Cycle Sequencing
v3.1 Kit (Applied Biosystems; Carlsbad, CA, USA) according to the protocol as well as
Sequencing facilities were availed from Center of Excellence in Molecular Biology (CEMB)
Lahore, Pakistan and some other commercial facilities (www.base-asia.com) were also
30
![Page 48: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/48.jpg)
utilized for cost effectiveness. Sequencing reactions were performed using the same set of
forward F15975 and reverse R635 primers separately as for PCR amplification (Chen et al.,
2008).
2.9 SEQUENCING ANALYSIS
In order to know about mtDNA sequence data, I analyzed mitochondrial sequence
variations in Saraiki ethnic group. Investigations were based on HVRI, HVRII and HVRIII in
order to determine the mitochondrial haplogroups distribution and haplotype variations. The
nucleotide positions 16024-576 were analyzed for this purpose. Then aligned data was
compared with revised Cambridge Reference Sequence (Bar et al., 2000). Genious software
(Version 7.1.5, Biomatters Ltd, New Zealand) was used for this alignment and on the basis of
mtDNA control region polymorphisms, haplogroups were assigned (van Oven and Kayser,
2009). The mutations in sequences were thoroughly reviewed to verify their existence using
Geneious software (Drummond et al., 2009). All the samples were sequenced bi-
directionally. Two researchers checked the sequences for verification and individual profile
of each sample was generated. Mito tool and HaploGrep were used to access the quality of
mtDNA data (Fan and Yao, 2011; Kloss-Brandstatter et al., 2011) and for the assignment of
the haplogroups to the donors. In addition to mito tool and HaploGrep, mtDNA software was
also used to access the quality of mtDNA data. PhyloTree Build 16
(http://www.phylotree.org) (van Oven et al., 2008) as classification tree was also used to
assess the quality of mtDNA data (Fan and Yao, 2011, Yang et al., 2013).
2.10 STATISTICAL ANALYSIS
Polymorphic patterns in Saraiki population were performed using Genious software
(Version 7.1.5, Biomatters Ltd, New Zealand). The differences and comparison between
31
![Page 49: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/49.jpg)
mtDNA control regions polymorphism in Saraiki population and other previous studies in
this region were analyzed through statistical analysis. Haplotype diversity and random match
probability was calculated and power of discrimination was statistically evaluated according
to (Tajima, 1989).
2.11 PHYLOGENETIC ANALYSIS
Different methods like minimum spanning, neighbor-joining, maximum likelihood
and maximum parsimony are used for construction of a phylogenetic tree for the mtDNA
sequences. All these methods were characterized by the organized scientific community.
Evolutionary analyses were also carried out in MEGA6 (Tamura et al., 2013). In present
study evolutionary history was analyzed using the Maximum Likelihood method based on
the model presented by Jukes (Jukes and Cantor, 1969).
Plan of this research work is summarized in (Fig. 2.3).
32
![Page 50: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/50.jpg)
Fig. 2.3: Summary of Research work plan for the Saraiki population mtDNA control region
analysis from Pakistan.
Population Blood Sampling
DNA Extraction
DNA Quantification
mt DNA Optimization/Amplification
Complete Control Region Sequencing
Alignment of sequences and Comparison with reference mtDNA
Comparative Analysis with other mtDNA data bases
Phylogenetic Analysis
33
![Page 51: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/51.jpg)
3. RESULTS
Present study was conducted to seek the relationships of Saraiki population from
Pakistan with other populations based on mtDNA sequence data for forensic purpose. For
this study 85 samples of blood were collected from healthy unrelated Saraiki people living in
various areas of Pakistan (Fig. 3.1) and the number of samples collected from those areas had
shown graphically (Fig. 3.2). Out of 85 individuals male samples were 75(88.24%) and
10(11.76%) were females samples (Fig. 3.3). All of these donors were of different age group
ranging in age from 18-60 years (Fig. 3.4). The consanguinity (%) of donors was also
calculated (Fig. 3.5) and the demographic data of the Saraiki donors was summarized in
(Table 3.1).
TABLE 3.1: Showing consent form summarized data of Saraiki population from Pakistan.
Sample
ID
Gen.
Ethnic
Group
Age
(Yrs)
Place of
Birth
Consangui-
nity of
Parents
Mother's
Place of
Birth
Father's
Place of
Birth
Mother
Language
SS-001 M Saraiki 21 Layyah Within caste Layyah Layyah Saraiki
SS-002 M Saraiki 29 Layyah Out of Caste Layyah Layyah Saraiki
SS-003 M Saraiki 32 Layyah Out of Caste Layyah Layyah Saraiki
SS-004 M Saraiki 24 Layyah Out of Caste Layyah Layyah Saraiki
SS-005 F Saraiki 24 Layyah Mamozad Layyah Layyah Saraiki
SS-006 M Saraiki 32 Layyah Out of Caste Layyah Layyah Saraiki
SS-007 M Saraiki 22 Layyah Out of Caste Layyah Layyah Saraiki
SS-008 F Saraiki 24 Layyah Out of Caste Layyah Layyah Saraiki
SS-009 F Saraiki 31 Layyah Out of Caste Layyah Layyah Saraiki
34
![Page 52: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/52.jpg)
SS-010 F Saraiki 22 Layyah Out of Caste Layyah Layyah Saraiki
SS-011 M Saraiki 23 Layyah Out of Caste Layyah Layyah Saraiki
SS-012 M Saraiki 27 Layyah Out of Caste Layyah Layyah Saraiki
SS-013 M Saraiki 32
Layyah Khalazad Layyah Layyah Saraiki
SS-014 M Saraiki 23
Layyah Mamonzad Layyah Layyah Saraiki
SS-015 M Saraiki 60
M.Garh Phhopizad M.Garh M.Garh Saraiki
SS-016 M Saraiki 28
M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-017 M Saraiki 31
M.Garh Khalazad M.Garh M.Garh Saraiki
SS-018 M Saraiki 41
M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-019 M Saraiki 24 M.Garh Chachazad M.Garh M.Garh Saraiki
SS-020 M Saraiki 37 M.Garh Within caste M.Garh M.Garh Saraiki
SS-021 F Saraiki 22 M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-022 M Saraiki 34 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-023 M Saraiki 32 M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-024 M Saraiki 40 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-025 M Saraiki 22 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-026
F Saraiki 19 M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-027
F Saraiki 18 M.Garh Mamonzad M.Garh M.Garh Saraiki
SS-028
F Saraiki 19 M.Garh Chachazad M.Garh M.Garh Saraiki
SS-029 M Saraiki 40 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-030 M Saraiki 30
M.Garh Chachazad M.Garh M.Garh Saraiki
SS-031 M Saraiki 30 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-032
M Saraiki 50 M.Garh Mamonzad M.Garh M.Garh Saraiki
35
![Page 53: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/53.jpg)
SS-033 M Saraiki 25 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-034 M Saraiki 28 M.Garh Within caste M.Garh M.Garh
Saraiki
SS-035 M Saraiki 26 Mianwali Within caste Mianwali Mianwali
Saraiki
SS-036 M Saraiki 24 Mianwali Within caste Mianwali Mianwali Saraiki
SS-037 M Saraiki 30 Mianwali Within caste Mianwali Mianwali
Saraiki
SS-038 M Saraiki 23 Layyah Within caste Layyah Layyah
Saraiki
SS-039 M Saraiki 30 Mianwali Within caste Mianwali Mianwali
Saraiki
SS-040
F Saraiki 31 Bhakar Out of caste Bhakar Bhakar Saraiki
SS-041
F Saraiki 33 Bhakar Within caste Bhakar Bhakar Saraiki
SS-042 M Saraiki 50 Bhakar Within caste Bhakar Bhakar Saraiki
SS-043 M Saraiki 45 Bhakar Within caste Bhakar Bhakar
Saraiki
SS-044 M Saraiki 19 Layyah Within caste Layyah Layyah
Saraiki
SS-045 M Saraiki 15 Layyah Within caste Layyah Layyah
Saraiki
SS-046 M Saraiki 19 Layyah Within caste Layyah Layyah
Saraiki
SS-047 M Saraiki 55 Layyah Out of caste Layyah Layyah Saraiki
SS-048 M Saraiki 35 D.I.Khan
Chachazad D.I.Khan D.I.Khan Saraiki
SS-049 M Saraiki 19 D.I.Khan
Within caste D.I.Khan D.I.Khan Saraiki
SS-050 M Saraiki 38 D.I.Khan Within caste D.I.Khan D.I.Khan Saraiki
SS-051 M Saraiki 18 D.I.Khan Chachazad D.I.Khan D.I.Khan Saraiki
SS-052 M Saraiki 29 Mianwali Within caste Mianwali Mianwali
Saraiki
SS-053
M Saraiki 26 Mianwali Chachazad Mianwali Mianwali Saraiki
SS-054 M Saraiki 29 D.I.Khan
Out of caste D.I.Khan D.I.Khan Saraiki
36
![Page 54: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/54.jpg)
SS-055 M Saraiki 27 Mianwali Within caste Mianwali Mianwali
Saraiki
SS-056 M Saraiki 38 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-057 M Saraiki 28 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-058 M Saraiki 39 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-059 M Saraiki 20 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-060 M Saraiki 25 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-061 M Saraiki 60 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-062 M Saraiki 18 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-063 M Saraiki 22 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-064 M Saraiki 28 Umar
koat
Phhopizad Umar
koat
Umar
Koat
Saraiki
SS-065 M Saraiki 28 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-066 M Saraiki 45 Umar
koat
Phhopizad Umar
koat
Umar
Koat
Saraiki
SS-067 M Saraiki 18 Umar
koat
Khalazad Umar
koat
Umar
Koat
Saraiki
SS-068 M Saraiki 25 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-069 M Saraiki 20 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-070 M Saraiki 25 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-071 M Saraiki 21 Umar
koat
Out of caste Umar
koat
Umar
Koat
Saraiki
SS-072 M Saraiki 35 Umar
koat
within caste Umar
koat
Umar
Koat
Saraiki
SS-073 M Saraiki 45 Umar
koat
Khalazad Umar
koat
Umar
Koat
Saraiki
SS-074 M Saraiki 35 Umar
koat
within caste Umar
koat
Umar
Koat
Saraiki
SS-075 Male Saraiki 20 Umar
koat
Phhopizad Umar
koat
Umar
Koat
Saraiki
SS-076 Male Saraiki 35 Umar
koat
Mamonzad Umar
koat
Umar
Koat
Saraiki
37
![Page 55: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/55.jpg)
SS-077 Male Saraiki 30 Umar
koat
Chachazad Umar
koat
Umar
Koat
Saraiki
SS-078 Male Saraiki 45 D.I.Khan Chachazad D.I.Khan D.I.Khan Saraiki
SS-079 Male Saraiki 30 D.I.Khan within caste D.I.Khan D.I.Khan Saraiki
SS-080
Male Saraiki 35 D.I.Khan within caste D.I.Khan D.I.Khan Saraiki
SS-081 Male Saraiki 30 D.I.Khan within caste D.I.Khan D.I.Khan Saraiki
SS-082 Male Saraiki 30 D.I.Khan Chachazad D.I.Khan D.I.Khan Saraiki
SS-083 Male Saraiki 45 Umar
koat
Mamonzad Umar
koat
Umar
Koat
Saraiki
SS-084 Male Saraiki 39 Umar
koat
within caste Umar
koat
Umar
koat
Saraiki
SS-085 Male Saraiki 23 Umar
koat
within caste Umar
koat
Umar
koat
Saraiki
M. Garh, Muzaffar Garh; D. I. Khan, Dera Ismail Khan; Khalazad, 1st Maternal cousin;
Chachazad, 1st Paternal cousin; Mamonzad, 2
nd Maternal Cousin; Phhopizad, 2
nd Paternal
Cousin; Gen. Gender; M, Male; F, Female; Yrs, Years
Fig. 3.1: Map of Pakistan showing study areas of Saraiki population.
38
![Page 56: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/56.jpg)
M. Garh= Muzaffar Garh; D. I. Khan= Dera Ismail Khan
Fig. 3.2: Showing sampling areas along with numbers of samples from the Saraiki donors of
Pakistan.
Fig. 3.3: Showing total samples including males and females of Saraiki population from
Pakistan.
39
![Page 57: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/57.jpg)
Fig. 3.4: Showing donors of different age groups (18-60 years) along with number of
samples from Saraiki population of Pakistan.
Fig. 3.5: Consanguinity % age of parents in Saraiki population of 85 samples collected from
different areas of Pakistan.
40
![Page 58: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/58.jpg)
During this study the nucleotide sequences of the entire mtDNA control regions
(nt 16024-16569 and nt 1-576) were determined in 85 unrelated individuals from Saraiki
population after DNA extraction and PCR amplification. Presence of extracted DNA was
confirmed by the bands appeared on gel (Fig. 3.6-3.7). The PCR amplification products size
was also observed by gel electrophoresis and it was 1122bp (Fig. 3.8-3.9).
After the PCR amplification of the samples, the PCR products were subjected to
sequencing in order to observe the mutations in Saraiki population with reference to revised
Cambridge Reference Sequence (rCRS) (Fig. 3.10-3.14). The observed mutations in this
population samples compared to rCRS were, transition (75.58%) transversion (4.67%),
insertion (15.56%) and deletion (4.17%). The mutation types for each hypervariable region
were described in (Table 3.2).
TABLE 3.2: Occurrence and distribution of nucleotide substitutions, deletions and insertions
in the hypervariable regions I, II and III of mitochondrial DNA control region from unrelated
Saraiki persons of Pakistan.
Mutation type HV1 HVII HVIII
Substitutions
Number
of
positions
Total
number of
mutations
Number
of
positions
Total
number of
mutations
Number
of
positions
Total
number of
mutations
Transitions
A-G 7 39 9 203 2 2
G-A 7 34 2 13 2 4
C-T 24 122 6 42 6 17
T-C 19 144 10 92 4 31
Total 57 339 27 350 14 54
41
![Page 59: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/59.jpg)
Transversions
A–C 5 14 0 0 2 2
G–C 0 0 0 0 1 1
A–T 4 18 0 0 0 0
G–T 0 0 0 0 0 0
C–A 1 3 0 0 1 2
C–G 0 0 1 1 1 1
T–A 1 2 1 2 0 0
T–G 0 0 0 0 0 0
Total 11 37 2 3 5 6
Insertions
T 0 0 0 0 4 6
C 3 3 5 135 0 0
2CA 0 0 0 0 2 5
2C 0 0 1 4 0 0
Total 3 3 6 139 6 11
Deletion
A 0 0 0 0 2 18
C 0 0 1 1 4 21
G 0 0 0 0 1 1
Total 0 0 1 1 7 40
A, adenine; G, guanine; C, cytosine; T, thymine; HVI, hypervariable region I; HVII,
hypervariable region II; HVIII, hypervariable region III
42
![Page 60: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/60.jpg)
During this study total 983 polymorphic sites were detected in Saraiki population
data. Overall genetic diversity was high (0.9570) with 63 different haplotypes found in 85
individuals with high Power of discrimination (0.9458). Out of 63 haplotypes, 58 of them
were unique and 5 haplotypes were shared by more than one individual. Different
haplogroups having various haplotypes from the different Saraiki areas of Pakistan were
identified during this study (Table 3.3) and their %age frequency of was also calculated
(Table 3.4).
The commonly observed haplogroups in this population were West Asian haplogroup
W6 and East Eurasian haplogroup M5c1, each of these constitute the 12.9% and 11.7% of the
population respectively. The South Asian haplogroups have clear dominance (29.4%)
including U2b2 (9.4%), M2a1a (1.1%), R9 (1.1%), M4 (1.1%), U2c'd (2.3), U2+152 (1.1%),
M18a (2.3%), HV2a (1.1%), R31 (1.1), U8c (1.1%), U4a2a (1.1%), M30+16234 (1.1%) and
relevant subgroups.
The second major types of haplogroups were West Eurasian and South Asian, which
cover the 20% population including U7a (8.2%), U7 (7.0%), U2a1a (3.5%) and relevant
subgroups. East Eurasian and South Asian haplogroup also represented by the 20%
population including M5c1 (11.7%), M5a2a1a (3.5%), M5 (2.3%), L3e'i'k'x (2.3%), M5b2
(1.1%) and relevant subgroups.
Third most prevalent type of haplogroup was West Asian to claim the 16.4%
population including I (1.1%), W6 (12.9%), X2 (1.1%), X2d (1.1%). West Eurasian
haplogroups cover 3.5% population including, R2 (2.3%) and H2a2a1g (1.1%). Combining
HVR1, HVR2 and HVR3, the genetic diversity was found 0.9570 (Table 3.5) (Fig. 3.12)
thus providing a high level of identification.
43
![Page 61: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/61.jpg)
Fig. 3.6: Agarose gel electrophoresis showing the bands of extracted genomic DNA of
different quantity along with 100 bp DNA marker (M) and (-ve) negative control while 001,
002, 003, 004, 005 are samples ID.
Fig. 3.7: Agarose gel electrophoresis showing the bands of extracted genomic DNA of
different quantity along with 100 bp DNA marker (M) and (-ve) negative control while 053,
054, 055, 056, 057 are samples ID.
44
![Page 62: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/62.jpg)
Figure 3.8: PCR product size of the samples, 010, 011, 012, 013,014 loaded on 2% agarose
gel, (–ve) is negative control, (M) is 100bp DNA marker.
Figure 3.9: PCR product size of the samples, 015, 016, 019, 020,021 loaded on 2% agarose
gel, (–ve) is negative control, (M) is100bp DNA marker.
45
![Page 63: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/63.jpg)
46
![Page 64: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/64.jpg)
47
![Page 65: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/65.jpg)
48
![Page 66: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/66.jpg)
49
![Page 67: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/67.jpg)
Figure 3.10: Sequence showing haplotype variations in sample SS-054.
50
![Page 68: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/68.jpg)
51
![Page 69: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/69.jpg)
52
![Page 70: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/70.jpg)
53
![Page 71: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/71.jpg)
54
![Page 72: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/72.jpg)
55
![Page 73: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/73.jpg)
Figure 3.11: Showing haplotype variations with reference to rCRS in sample SS-035.
.
56
![Page 74: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/74.jpg)
57
![Page 75: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/75.jpg)
58
![Page 76: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/76.jpg)
Figure 3.12: Showing haplotype variations with reference to rCRS in sample SS-010.
59
![Page 77: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/77.jpg)
60
![Page 78: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/78.jpg)
61
![Page 79: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/79.jpg)
62
![Page 80: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/80.jpg)
63
![Page 81: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/81.jpg)
Figure 3.13: Showing haplotypes variation with reference to rCRS in sample SS-011.
64
![Page 82: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/82.jpg)
65
![Page 83: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/83.jpg)
66
![Page 84: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/84.jpg)
Figure 3.14: Showing haplotype variation with reference to rCRS in sample SS-012.
67
![Page 85: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/85.jpg)
Fig. 3.15: Different Haplogroups frequency % age found in 85 Saraiki population sample
from different areas of Pakistan.
68
![Page 86: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/86.jpg)
Fig. 3.16: Comparison of genetic diversity among Saraiki population and others various
ethnic groups of Pakistan (Murci et al., 2004; Rakha et al., 2011).
Table 3.3: Estimated haplotypes and haplogroups in Saraiki population from different areas
of Pakistan.
Sample
I.D
N Area HG HG T Haplotypes
SS-001
03
Ly
U2b2
SA
16051G 16209C 16239T 16352C
16353T 16362C 73G 146C 152C
189G 234G 263G 315.1C
513.1CACA
SS -002
01
Ly
U2b2
SA
16051G 16209C 16239T 16352C
16353T 16362C 73G 146C 152C
189G 234G 263G 315.1C
SS-003
01
Ly N10a
SEA
16129A 16183C 16184.1C 16189C
16210T 16223T 16266.1C 16362C
73G 185A 189G 263G 315.1C
69
![Page 87: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/87.jpg)
SS-004
01
Ly
D4j1b2
SEA 16129A 16182.1C 16183C 16189C
16223T 16362C 73G 185A 189G
263G 315.1C 489C
SS-005
01
Ly
M5
EEA/SA
16129A 16183C 16223T 73G 263G
315.1C 489C
SS-006
01
Ly
U2b2
SA
16051G 16209C 16239T 16352C
16353T 16362C 73G 146C 152C
189G 234G 263G 315.1C
517.1CACA
SS-007
01
Ly
U2a1a
WEA/SA
16051G 16154C 16206C 16230G
16311C 16325C 16519C 73G 263G
309.1C 315.1C
SS-008
01
Ly
U7a
WEA/SA
16309G 16318T 16519C 16527T
73G 151T 152C 263G 309.1C
315.1C 515d 516d
SS-009
01
Ly
M2a1a
SA
16223T 16270T 16319A 16352C
16519C 73G 195C 204C 263G
315.1C 447G 489C
SS-010
01
Ly
R9
SA
16129A 16304C 16519C 73G 152C
234G 263G 309.1C 315.1C 516d
517d
SS-011
01
Ly
U2a1a
WEA/SA
16051G 16154C 16206C 16230G
16311C 16519C 73G 195C 263G
309.1CC 312.1C
SS-012
01
Ly
I
WA
16129A 16223T 16311C 16391A
16519C 73G 199C 204C 250C
263G 309.1C 315.1C 454.1T
SS-013
01
Mg X2
WA
16189C 16323T 16519C 73G 153G
195C 263G 309.1C 315.1C
SS-014
01
Mg M30+16234 SA
16093C 16223T 16234T 16274A
16325C 16519C 73G 195A 263G
309.1C 315.1C 489C 514d 515d
SS-015
01
Mg U7
WEA/SA
16309G 16318T 16519C 73G 152C
263G 309.1CC 315.1C 515d 516d
525T
SS-016
10
Mg;
Ly
M5c1
EEA/SA
16129A 16223T 16519C 73G 150T
263G 309.1C 315.1C 333C 489C
575T
SS-017
01
Mg
U7a
WEA/SA
16318T 16519C 73G 151T 152C
263G 309.1C 315.1C 514d 515d
SS-018
01
Mg U7
WEA/SA
16092C 16183C 16309G 16318T
16519C 73G 152C 263G 315.1C
525T
70
![Page 88: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/88.jpg)
SS-019
01
Mg U7
WEA/SA
16309G 16318T 16519C 73G 152C
263G 309.1CC 315.1C 514d 515d
525T
SS-020
01
Mg L3e'i'k'x EEA/SA
16129A 16223T 16519C 73G 150T
263G 309.1CC 315.1C
SS-021
01
Mg L3e'i'k'x
EEA/SA
16129A 16223T 16519C 73G 150T
263G 309.1C 315.1C
SS-022
01
Mg M5a2a1a
EEA/SA
16129A 16218T 16223T 16264T
16265C 16319A 16519C 73G 263G
309.1C 315.1C 489C
SS -023
01
Mg X2d
WA
16183C 16189C 16210C 16223T
16278T 16311C 16519C 73G 195C
263G 315.1C
SS-024
01
Mg U2
WEA/SA
16051G 16172C 16184T 73G 263G
309.1C 315.1C
SS -025
01
Mi U2
WEA/SA
16051G 16172C 16184T 73G 263G
309.1C 315.1C 517d 518d
SS-026
01
Mi U7a
WEA/SA
16069T 16274A 16318T 16519C
73G 151T 152C 263G 315.1C 514d
515d
SS-027
01
Mi M5a2a1a
EEA/SA
16129A 16223T 16265C 16344T
16519C 73G 263G 315.1C 374G
489C
SS-028
01
Ly U2b2
SA
16051G 16209C 16239T 16278T
16352C 16353T 64d 73G 146C
152C 234G 263G 310.1C
SS-029
01
Mi U2+152
SA
16051G 16129A 16247G 16254G
73G 150T 152C 263G 309.1C
315.1C 456T
SS-030
01
Bk M18a
SA
16134T 16223T 16318C 16519C
73G 93G 194T 246C 263G 315.1C
489C
SS-031
01
Bk M18a
SA
16134T 16323T 16318C 16519C
73G 93G 194T 246C 263G 315.1C
489C
SS-032 01 Bk U2b2 SA 16051G 16209C 16239T 16352C
16353T 73G 146C 151T 152C
234G 263G 315.1C
SS-033
01
Bk U2b2
SA 16051G 16209C 16239T 16352C
16353T 73G 146C 152C 234G
263G 315.1C
71
![Page 89: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/89.jpg)
SS-034
01
Ly HV2a
SA
16214T 16217C 16335G 16519C
73G 152C 246C 263G 309.1C
315.1C 514G 527T 574C 576C
SS-035
01
Ly U2b2
SA
16051G 16209C 16239T 16352C
16353T 16362C 73G 146C 152C
189G 234G 263G 315.1C 320G
513.1CACA
SS-036
01
DIK M3a1+204 SA/AF
16223T 16311C 16519C 73G 204C
217C 263G 309.1C 315.1C 482C
489C
SS-037
01
DIK R31
SA
16129A 16213A 16362C 16519C
16525G 73G 263G 309.1C 315.1C
SS-038
01
DIK U2b2
SA
16051G 16209C 16239T 16352C
16353T 73G 146C 234G 263G
315.1C
SS-039
01
DIK
U2a1a
WEA/SA
16029A 16051G 16154C 16206C
16230G 16311C 16326C 16519C
73G 263G 309.1C 315.1C 569.1T
SS -040
01
Mi
H2a+152
16311
SWA
16311C 152C 263G 309.1C 315.1C
513A
SS-041
01
Mi J1b1b
EA
16069T 16126C 16145A 16186T
16263.1A 16519C 73G 263G 271T
295T 309.1C 315.1C 462T 489C
508G 514d 515d
SS-042
01
DIK U7a
WEA/SA
16309G 16318T 16519C 73G 151T
152C 263G 309.1C 315.1C 516d
517d
SS-043
01
Mi
W6
WA
16192T 16223T 16292T 16519C
73G 152C 189G 194T 195C 204C
207A 263G 309.1C 315.1C
SS-044
01
Uk M4
SA
16145A 16176T 16223T 16261T
16266T 16291T 16311C 16519C
73G 263G 315.1C 489C
SS-045
10
Uk,
DIk
W6
WA
16192T 16223T 16266T 16292T
16325C 16519C 73G 189G 194T
195C 204C 207A 263G 309.1C
315.1C
SS-046
01
Uk U2c'd
SA
16051G 16126C 16178C 16179T
16234T 16247G 73G 146C 152C
263G 315.1C 570d
72
![Page 90: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/90.jpg)
SS-047
01
Uk U2c'd
SA
16051G 16234T 16247G 16254G
16311C 16519C 73G 150T 152C
263G 315.1C 513d 514d
SS-048
01
Uk U7a
WEA/SA
16309G 16318C 16519C 73G 151T
152C 263G 309.1C 315.1C 514d
515d
SS-049
01
Uk
U7a
WEA/SA
16309G 16318T 16519C 73G 151T
152C 263G 309.1C 315.1C 515d
516d
SS-050
01
Uk U8c
SA
16168A 16309C 16318C 16519C
73G 151T 152C 263G 309.1C
315.1C
SS-051
01
Uk M5a2a1a
SA
16129A 16223T 16265C 16362C
16519C 73G 263G 315.1C 489C
516A
SS-052
01
Uk
R2
WEA
16071T 16111T 16278T 16311C
16519C 73G 150T 152C 263G
315.1C
SS-053
01
Uk D4a
EA
16129A 16223T 16362C 16519C
73G 152C 263G 315.1C 489C
516A
SS-054
01
Uk H2a2a
SWA
16243C 16519C 153G 200G 263G
309.1C 315.1C
SS -055
01
Uk
U7a
WEA/SA
16168A 16309G 16318C 16519C
73G 151T 152C 263G 309.1C
315.1C
SS -056
01
Uk R2
WEA
16071T 16111T 16519C 73G 150T
152C 263G 315.1C
SS -057
01
Uk U4a2a
SA
16519C 73G 195C 263G 310C
SS -058
01
DIK M5b2
EEA/SA
16048A 16129A 16223T 16519C
73G 263G 309.1C 315.1C 489C
509A 517d 518d
SS-059
02
Uk D4j1a EA
16086C 16189C 16223T 16266T
73G 263G 309.1C 315.1C 489C
SS-060
01
DIK
M30
SA
16223T 16519C 73G 152C 195A
263G 309.1C 315.1C 489C 514d
515d 569.1T
SS-061
01
Uk M5
EEA/SA
16029A 16037T 16129A 16223T
16519C 73G 263G 315.1C 489C
544.1T 550C 564C 569.1T 571T
73
![Page 91: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/91.jpg)
SS-062
01
Uk U7
WEA/SA
16309G 16318T 16519C 73G 152C
263G 268T 309.1C 315.1C 499A
SS-063
01
Uk U7
WEA/SA
16264T 16309G 16318T 16519C
73G 152C 263G 309.1C 315.1C
499A 514d 515d
SS-064
01 Uk U7
WEA/SA
16264T 16309G 16318T 16519C
73G 152C 263G 309.1C 315.1C
499A 514d 515d
Bold Italic characters in the table highlight those nucleotides that were used to define
haplogroups in the population.
N, Hyplotypes numbers; HG, haplogroup; HGT, Haplogroup Type; SA, South Asian; WEA,
West Eurasian; SEA, South East Asian; EEA, East Eurasian; WA, West Asian; SWA, South
West Asia; EA, East Asia; AF, Africa; Mg, Muzaffar garh,; Ly, Layyah; Bk, Bhakar; Mi, Mianwali;
DIK, Dera Ismail Khan; UK, Umar kot
TABLE 3.4: Haplogroups (%) frequency in Saraiki population from Pakistan.
Haplogroup Sample Frequency
(%)
Haplogroup Sample Frequency
(%)
U2b2
08 9.4 H2a2a
01 1.1
N10a
01 1.1 L3e'i'k'x 02 2.3
D4j1b2
01 1.1 M5a2a1a 03 3.5
M5
02 2.3 X2d
01 1.1
U2a1a
03 3.5 U2
01 1.1
U7a
07 8.2 H2a2a1g
01 1.1
M2a1a 01 1.1 U2+152 01
1.1
R9
01 1.1 M18a
02 2.3
I
01 1.1 HV2a
01 1.1
X2
01 1.1 M3a1+204 01 1.1
M30+16234 01 1.1 R31 01 1.1
74
![Page 92: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/92.jpg)
U7 06 7.0 H2a+152
16311
01
1.1
M5c1
10 11.7 J1b1b 01
1.1
W6
11 12.9 M4
01 1.1
U2c'd
02 2.3 U8c
02 2.3
R2
02 2.3 U4a2a
01 1.1
M5b2
01 1.1 D4j1a 02 2.3
M30
01 1.1 D4a
01 1.1
TABLE 3.5: Population genetics parameters of Saraiki population from different areas of
Pakistan.
Total no. of the samples 85
Haplotypes 63 (05 Shared)
Polymorphic sites 140
Random match probability 0.0542
Power of discrimination 0.9458
Genetic diversity 0.9570
This study characterize mtDNA control region data using the global mtDNA
phylogeny background (Parson and Bandelt, 2007; van Oven and Kayser, 2009), from the
Saraiki population and established forensic guidelines for mtDNA reference data generation
of the population.
CLUSTER ANALYSIS
A dendrogram was constructed of Saraiki population from Pakistan using maximum
likehood method to assess the genetic affinities among the individuals of Saraiki population
(Fig. 3.16). The bootstrap consent tree roundabout from the 100 replicates was taken to
75
![Page 93: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/93.jpg)
characterize the history of evolution from analyzed texa (Felsenstein, 1985). Initial tree for
basic evolution research was constructed by applying the Neighbor-Joining method to a
model of pair wise distances estimation using the Maximum Composite Likelihood method.
In order to model evolutionary rate differences among sites (5 categories (+G, parameter =
0.3762)) a discrete Gamma distribution was used. Total 557 positions were present in the
final dataset.
Dendrogram presented a picture of genetic relationship and variability among the
individuals of the population. According to dendrogram this population was grouped into
eleven clades. In the dendrogram it was observed that generally all the Saraiki individuals
showed genetically close association among each other‟s. The clade I includes samples 001,
003, 007, 008, 009, 013, 35, 49, 50, 54, 56, 71, 23, 39 and 60. The analysis of this clade
showed that samples 001, 007; 003, 008; 009, 013; 54, 56 and 60, 23 showed genetically
common behavior among each other‟s while 35, 39, 50, 49 and 71 showed some distance
from other individuals of this clade. Clade II consists of samples number 010, 017, 019, 24,
47, 51, 52, 57, 61, 31, 32, 40, 42, 58 and 63. In this clade samples number 057, 58; 47, 31;
51, 52; 63,42 and 010, 017 showed genetic similarities while 019, 32, 61 and 24 had some
distance from other individual of this clade and it was also observed that 40 is very close to
63 and 42 as compared to other outlier individuals of this clade. Clade III includes samples
015, 34, 66, 37 and 62. In this clade 66, 37 had similar genetic make-up while 015, 034
samples were separated from 127 to show different genetic behavior. Clade IV consists of
011, 016, 36, 55, 38, 44, 43, 41, 46 and 64 samples. According to this clade observation 46,
55; 43, 44; and 41, 64 each showed similar genetic structure. It has also been observed that
41 and 64 showed different genetic from 38 sample while 011, 016, 36 were at some distance
76
![Page 94: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/94.jpg)
from other members of this clade. Clade V include two samples 002 and 012 both of these
individuals expressed very closed genetic relationship. In clade VI 33 and 48 samples were
very similar while 006 was separate from 004 and 005 samples which were close to each
other‟s. In this clade analysis it was also observed that sample 45 showed distinct behavior
from other five samples. The clade VII include samples 14, 25 and 26 in which 14 and 26
samples were genetically very close to each other‟s while sample number 25 was at some
distance. The samples ID 018 and 59 of clade VIII genetically expressed very close
relationship and same expression had been shown by clades IX and XI samples but in clade
X, 22 and 30 showed close phylogenetic relationship while sample 27 showed separate
genetic behavior.
77
![Page 95: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/95.jpg)
Fig. 3.17: Dendrogram showing genetic affinities among various Saraiki samples from
different areas of Pakistan.
78
![Page 96: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/96.jpg)
4. DISCUSSION
Present day Pakistan is bounded by Iran and Afghanistan in west, India in east and
China in north. This study established the haplotype diversity of Saraiki population and
makes a distinction between Saraiki individuals living in different areas of Pakistan. Saraiki
people are divided into distinct haplogroups and lineages. Results of present investigation
conducted on 85 blood samples collected from unrelated healthy males and females of
different age groups. It was observed that different cultural groups were present in every
society and their origin was known from various records like fossils and archaeology records
(Ariffin et al., 2007). Saraiki population in Pakistan is ethnically and linguistically different
from other populations. In order to understand the genetic structure of Saraiki population,
this study was conducted because still no study has been accompanied in Saraiki population
from Pakistan. For this purpose mtDNA has been widely used to study the human migration,
evolution, ancestor identification and forensics cases (Pakendorf and Stoneking, 2005;
Ariffin et al., 2007).
This was the first study which published entire mtDNA control region sequences of
Sariki population from Pakistan. The most important properties of mtDNA D-loop that
formulate it more valuable for human identification and its evolutionary studies include the
large number of copies, maternal inheritance and very fast rate of development (Pereira et al.,
2010). mtDNA mutation rate is several times high as compared nuclear gene (Ingman et al.,
2000). On account of these and some other properties mitochondrial DNA could be used in
forensic investigations in the Asia (Hoong and Lek, 2005). Mitochondrial DNA D-loop
which is known as control region is very important for forensic cases and population study in
the region (Barbosa et al., 2008).
79
![Page 97: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/97.jpg)
mtDNA sequence analysis in Saraiki population from Pakistan showed high level of
genetic diversity (0.957) from Kalashi (0.851), Parsi (0.950) and Brahui (0.952) populations.
By comparing among above populations it was concluded that the observed high genetic
diversity in Saraiki population as compared to others population be due to cultural practices
and strong endogamy in those populations as compared to Saraiki population (Ghosh et al.,
2011). In the same way some other populations Pathan (0.993), Baluch (0.974), Hazara
(0.992), Hunza Burusho (0.980), Makrani (0.975), Pakistani Karachi (0.992) and Sindhi
(0.992) from Pakistan showed high genetic diversity than that of kalashi, Brahui and Saraiki
populations (Murci et al., 2004; Rakha et al., 2011) because they may be less endogamous as
compared to Kalashi and Saraiki populations. During this study genetic structure, genetic
variations and genetic distances were investigated among different samples of the population
on base of haplotypes data (Adams et al., 2008).
During the present study, it was observed that the South Asian haplogroups had clear
dominance having 29.4% frequency including U2b2 9.4% and some other relevant sub
groups. U haplogroup is the second most haplogroup found in India and is known as a
complex mtDNA lineage with an age of 51000-67000 years. It has been observed that sub-
clade U2 of U haplogroup is most common in South Asia (Metspalu et al., 2004) and is less
common in West Asia and Europe (Maji et al., 2008). This indicates that Saraiki population
is more close to South Asian haplogroup as compared to others haplogroup.
The second major types of haplogroups in the present study were West Eurasian and
South Asian, which cover the 20% population including U7a 8.2%, U7 7.0% and relevant
subgroups. The presence of the haplogroup U7 in other populations indicates that Saraiki
population has some association with those populations. U7 is Eastern and Indian haplogroup
80
![Page 98: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/98.jpg)
(Murci et al., 2004). I was observed that in many European populations haplogroup U7 was
absent (Richards et al., 2000) showing the limited association of European populations with
Asian populations. It has been noted that in West Asia U7 frequency is 4% Near East and
10% in Iran while in South Asia its frequency is 12% in Gujarat and in whole India its
frequency remained 2% (Metspalu et al., 2004). While during present study its frequency
was noted up to 7% (Sikandar et al., 2014). Haplogroup U7 has a sub clade U7a whose
frequency in Sri has been found up to 13.3% (Ranaweera et al., 2014) while in Makrani
population from Pakistan its frequency has been found up to 6% (Siddiqi et al., 2014), this
low frequency indicate that Makrani population is more endogamous. It has been observed
that haplogroup U7a is found nearly in all those populations where the U7 haplogroup has
been found. It has also been observed that these variations in haplogroups frequency are
based upon geographic distribution (Rosser et al., 2000).
East Eurasian and South Asian haplogroups are also represented by the 20%
population in present study including M5c1 11.7% and relevant subgroups. Traces of gene
flows from the Indian subcontinent to Pakistan had been reported and it was confirmed by
the presence of sub-haplogroup M5C1 about which it is thought that it was originated
probably in central India and from India it spread out to its eastern and western regions
(Chandrasekar et al., 2009). The Asian mtDNA phylogeny is subdivided into two major
haplogroups one of them is haplogroup M and other is N haplogroup. The most common
haplogrou in Indian population is M haplogrou and is rare outside Southern Asia
(Kalaydjieva et al., 2005). The higher distribution of haplogroups M and N all over the world
indicates that when humans migrate out of Africa both M and N haplogroups were part of the
that colonization (Macaulay et al., 2005). There are different hypothesis about the origin of
81
![Page 99: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/99.jpg)
M haplogroup. Some scientists claimed that m haplogroup was originated from South West
Asian and followed back migration to Africa (Kivisild et al. 2003) while others other
scientists believe in African ancestry for M haplogroup (Murci et al., 1999).
Third most prevalent type of haplogroup in present study was West Asian which
claims the 16.4% population including W6 12.9%. Although haplogroup W is not found in
high frequency in European populations but at low frequency it is common in that population
(Richards et al., 2000). Haplogroup W6 was found to be 5.3% in Georgia (Olivieri et al.,
2013) while during present study its frequency was found 12.9% (Sikandar et al., 2014). W6
haplogroup is also found in German individuals which belonging to the Corded Ware culture
(Adler, 2012). It has been observed that variations in the haplogroup are due to geographic
differences (Rosser et al., 2000).
Results of present study show that West Eurasian haplogroups cover 3.5% population
including, R2 2.3% and H2a2a1g 1.1%. R2 Haplogroup is abundantly present in southern
Pakistan because its frequency in Kalashi and Makrani population has been calculated 6.3%
and 6% respectively (Siddiqi et al., 2014). It has also been observed that haplogroup R2 was
also present in India population while its low frequency was recorded in some regions like,
Near East, Iran, Central Asia and Arabian Peninsula (Murci et al., 2004; Metspalu et al.,
2004; Al-Abri et al., 2012). The presence of R2 haplogroup in European population is
limited (Bermisheva et al., 2002). Collectively U7, W and R2 comprise about 14% of the
mother gene pool in India (Metspalu et al., 2004)) and while in Iran and Pakistan it was 13%
and 10% respectively but it declined in the Central Asia and reached upto 5% (Metspalu et
al., 2004). Moreover in Western India, haplogrou R2 was found with the frequency of 9.5%
(Khurana et al., 2014). But this R2 haplogroup frequency gradually decreases gradually as it
82
![Page 100: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/100.jpg)
goes on toward the western part of India and then its frequency become insignificant in
Europe. This low frequency of clade R2 in Saraiki population is due geographic distribution.
J1b1b is one sub clade of haplogroup J and its frequency was 1.1% in present study which
confirms that Saraiki population has some association with, North Africa, Western Asia,
Europe and Central Asia (Karafet et al., 2008). The frequency of haplogroup D4a in Japanese
samples was found to be 7.3% (Tanaka et al., 2004) while in Pakistan its frequency in Saraiki
population has been noted 1.1% which indicate some association between these two
populations. mtDNA haplogroups diversity depends more upon geographic distribution of
the population (Mogentale-Profizi et al., 2001).
Results of present study confirm that all individuals of Saraiki population from
Pakistan show common maternal lineages although significant regional differences are
present. However, the fact that most of the closest phylogenetic branches of haplogroups of
Saraiki population mtDNAs have also been found in Indian population which suggests that
the Saraiki mtDNAs have close association with them. It has been pointed out that the
frequency and diversity of a haplogroups is indication of possible common origin of that
particular haplogroup (Barbujani, 2000).
This study had carried out the first extensive analysis of mtDNA diversity within
Saraiki population of Pakistan. This study allowed comparing the Saraiki population
diversity with that previously reported populations in Pakistan, to investigate differences
within Pakistani populations and to evaluate the population histories. In a worldwide
comparison, Saraiki population mostly clusters around a South Asian samples. It was
observed that maximum Pakistani populations clustered with South Asian and Middle
Eastern populations (Qamar et al., 2002). Mitochondrial DNA sequences analysis exposed
83
![Page 101: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/101.jpg)
the very high level of genetic diversity in the Saraiki population which can be compared with
the others population from South Asia and West Eurasia. The Saraiki populations studied
exhibit similar mtDNA lineage composition with many haplogroups. Comparisons of
mtDNA haplogroup frequencies between the Saraiki populations of different areas revealed
that the genetic structure of the Saraiki people was very similar which may be the result of
endogamy.
In this study it has been found that South Asian haplogroup was dominant over others
haplogroups in Saraiki population so the unique geographical location of Saraiki poplulation
among West Eurasian and South East Asian may be due to heterogonous mitochondrial DNA
haplogroups make-up. The results of this study point out strong genetic affinities of Saraiki
population with other populations. Mitochondrial DNA analysis will be helpful for forensic
cases and genetic study.
CONCLUSION
Overall, this study provides broad mtDNA variations survey of Saraiki population
from Pakistan.
The molecular analysis of the Saraiki population is providing better knowledge of its
ancestry and diversity from other population on the basis of haplogroup distribution.
This study also emphasized the importance of gene migration between various
populations.
It also highlights the genetic affiliation of the Saraiki individuals with each other from
different areas of Pakistan.
84
![Page 102: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/102.jpg)
It has been calculated that this study will be valuable for creating a useful data of
Saraiki people inhabiting in different areas of Pakistan and will hand out as a
background for forensics data base of different Pakistani populations.
ACKNOWLEDGMENTS: Financial assistance provided by the Vice Chancellor‟s Lump
sum grant (2010-2011) is gratefully acknowledged.
85
![Page 103: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/103.jpg)
5. REFERENCES
Adams, S. M., Bosch, E., Balaresque, P. L. Ballereau, S. J., Lee, A. C., Arroyo, E., Lopez-
Parra, A. M., Aler, M., Grifo, M. S., Brion, M., Carracedo, A. Lavinha, J., Martinez-
Jarreta, B., Murci, Q. L., Picornell., A. Ramon, M., Skorecki., K., Behar, D. M.,
Calafell, F. and Jobling, M. A., 2008. The genetic legacy of religious diversity and
intolerance: paternal lineages of Christians, Jews, and Muslims in the Iberian
Peninsula. Am. J. Hum. Genet., 83: 725–736.
Adachi, N., Umetsu, K. and Shojo, H., 2014. Forensic strategy to ensure the quality of
sequencing data of mitochondrial DNA in highly degraded samples. Leg. Med., 16:
52-55.
Adler, C. J., 2012. Ancient DNA studies of human evolution. Ph. D Thesis: University of
Adelaide.
Al-Abri, A., Podgorna, E., Rose, J. L., Pereira, L. and Mulligan, C. J., 2012. Pleistocene-
Holocene boundary in Southern Arabia from the perspective of human mtDNA
variation. Am. J. Phys. Anthropol., 149: 291-298.
Alonso, A. P., Martin, C., Albarran, P., Gracia and Gracia, O., 2004. Real time PCR designs
to estimate nuclear and mitochondrial DNA copy number in forensic and ancient
DNA studies. Forens. Sci. int., 139: 141-149.
Andrews, R. M., Kubacka, L. and Chinnery, P. F., 1999. Reanalysis and revision of the
Cambridge reference sequence for human mitochondrial DNA. Nat. Genet., 23: 147.
Anderson, S. A., Bankier, T. B., Barrell, G. M., BRUIJN, H. L., Coulson, A. R., Drouin, J.,
Eperon, L. C., Nierlich, D. P., Roe, B. A., Sanger, F., Schreier, P. H., Smith, A. J. H.,
Staden, R. and young, L. G., 1981. Sequence and organization of the human
86
![Page 104: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/104.jpg)
mitochondrial Genome. Nature, 290: 457-465 (09 April 1981); doi: 10.
1038/290457a0
Ariffin, S. H. Z., Wahab, R. M. A., Zamrod, Z., Sahar, S., Razak, M. F. A., Arffin., E. J. and
Senafi, S., 2007. Molecular archeology of ancient bone from 400 years old
shipwreck. Asia Pacific J. Mol. Biol. Biotechnol., 15: 27-3.
Asari, M., Umetsu, K., Adachi, N., Azumi, J., Shimizu, K. and Shiono, H., 2007. Utility of
haplogroup determination for forensic mtDNA analysis in the Japanese population.
Leg. Med., 9: 237–240.
Ayub, Q. and Tyler-Smith, C., 2009. Genetic variation in South Asia, assessing the
Influences of geography, language and ethnicity for understanding history and disease
risk. Brief Funct. Genom Proteom., 8(5): 395–404.
Bandelt, H. J., Herrnstadt, C., Yao, Y. G., Kong, Q. P., Kivisild, T., Rengo, C., Scozzari, R.,
Richards, M., Villems, R., Macaulay, V., Howell, N., Torroni, A. and Zhang, Y. P.,
2003. Identification of Native American founder mtDNAs through the analysis of
complete mtDNA sequences: some caveats. Ann. Hum. Genet., 67: 512-524.
Bandlet, H. J., Macaulay, V. and Richards, M. B., 2006. Mitochondrial DNA and the
evolution of Homo sapiens. Berlin: Springer Verlage: Berlin Heidelberg, vol. 18.
ISBN: 978-3-540-31788-3 (Print) 978-3-540-31789-0 (Online)
Bar, W., Brinkmann, B. and Budwole, B., 2000. DNA commission of the International
Society for Forensic Genetics: guidelines for mitochondrial DNA typing. Int. J. Legal
Med., 113: 193-6.
87
![Page 105: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/105.jpg)
Barbujani, G., 2000. Geographic patterns: how to identify them and why. Hum. Biol.,
72:133–153.
Barbosa, A. B. G., Silva, L. A. F., Azevedo, D. A., Balbino, V. Q. and Silva, M. L., 2008.
Mitochondrial DNA control region polymorphism in the population of Alagoas state,
north-eastern Brazil. J. of Foren. Sci., 51: 142-146.
Basu, A., Mukherjee, N., Roy, S., Sengupta, S., Banerjee, S. and Chakraborty, M., 2003.
Ethnic India: a genomic view, with special reference to peopling and structure.
Genome, Res., 13: 2277-2290.
Batzer, M. A., Acrot, S. S., Phinney, J. W., Alegria-Hartman, M., Kass, D. H, Milligan, S.
M., Kimpton, C., Gill, P., Hochmeister, M., Ioannou, P. A, Herrera, R. J, Boudreau,
D. A., Scheer, W. D., Keats, B. J., Deininger, P. L. and Stoneking, M., 1996. Genetic
variation of recent Alu insertion in human populations. J. mol. Evol., 42: 22-29.
Bento, A. M., Lopes, V., Serra, A., Costa, A. H., Balsa, F., Andrade, L., Oliveira, C., Batista,
L., Anjos, M. J., Carvalho, M. and Corte-Real, F., 2009. Forensic application of
mitochondrial DNA SNPs. Forensic Science International. Gen. Supp. Ser., 2: 215–
21.
Bermisheva, M., Tambets, K., Villems, R. and Khusnutdinova, E. K., 2002. Diversity of
mitochondrial DNA haplotypes in ethnic populations of the Volga-Ural region of
Russia. Mol. Bio. (Mosk)., 36(6): 990-1001.
Bermisheva, M. A., Viktorova, T. V. and Khusnutdinova, E. K., 2003. Polymorphism of
human mitochondrial DNA. Russ. J. of Genet., 39 (8): 1013-1025.
88
![Page 106: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/106.jpg)
Bini, C., Ceccardi, S., Luiselli, G., Pelotti, S., Colalongo, C., Falconi, M. and Pappalardo,
G., 2003. Different informativeness of the three hypervariable mitochondrial DNA
regions in the population of Bologna (Italy). Foren. Sci. Int., 135: 48-52.
Blansit, B. D. 2006. Resources for genetic genealogy. J. of Elec. Res. in Med. Lib., 3: 23-35.
Bobillo, M. C., Zimmermann, B., Sala, A., Huber, G., Rock, A. H., Bandelt, J., Corach, D.
and Parson, W., 2010. Amerindian mitochondrial DNA haplogroups predominate in
the population of Argentina: towards a first nationwide forensic mitochondrial DNA
sequence database. Int. J. Legal Med., 124: 263–268.
Bogenhagen, D. and David, C. A., 1974. The number of mitochondrial deoxyribonucleic acid
genomes in mouse L and human Hela cells. Quantitative isolation of mitochondrial
deoxyribonucleic acid. J. Biol. Chem., 249: 7991–7995.
Brenna, M., Henn, L. L., Sforza, C. and Marcus, W., 2012. The great human expansion.
PANS, 109: 7758–17764.
Brown, P., Sutikna, T., Morwood, M. J, Soejono, R. P., Jatmiko, Saptomo, E. W. and Due,
R. A. 2004. A new small-bodied hominin from the late Pleistocene of Flores,
Indonesia. Nature, 431:1055-1061.
Budowle, B., Allard, M. W., Wilson, M. R. and Chakraborty, R., 2003. Forensics and
mitochondrial DNA: Applications, debates, and foundations. Annu. Rev. Genomics
Hum. Genet., 4: 119-141.
Butler, J. M., 2009. Fundamentals of forensic DNA typing. Burlington, MA: Academic
Press. Pages: 500. www.amazon.ca
Cann, R. L., Stoneking, M. and Wilson, A. C., 1987. Mitochondrial DNA and human
evolution. Nature, 325: 31-36.
89
![Page 107: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/107.jpg)
Cavelier, L., Jazin, E., Jalonen, P. and Gyllensten, U. 2000. mtDNA substitution rate and
segregation of heteroplasmy in coding and noncoding regions. Hum. Genet., 107:
45–50.
Cavalli-Sforza, L. L. and Feldman M. W., 2003. The application of molecular genetics
approaches to the study of human evolution. Nat. Genet., 33: 266-275.
http://dx.doi.org/10.1038/ng1113
Chandrasekar. A., Kumar, S., Sreenath, J., Sarkar, B. N. and Urade, B. P. 2009. Updating
phylogeny of mitochondrial DNA macrohaplogroup M in India: dispersal of modern
human in South Asian corridor. PLoS One, 4: e7447.
Chaubey, G., Metspalu, M., Kivisild, T. and Villems, R., 2007. Peopling of South Asia:
investigating the caste-tribe continuum in India. Bio. Essays, 29: 91-100.
Chen, Y. S., Olckers, A., Schurr, T. G., Kogelnik, A. M., Huoponen, K. and Wallace, D. C.,
2000. mtDNA variation in the South African Kung and Khweand their genetic
relationships to other African populations. Am. J. Hum. Genet., 66: 1362-1383.
Chaitanya, L., Van Oven, M., Weiler, N., Harteveld, J., Wirken, L., Sijen, T., Knijff, P., and
Kayser, M., 2014. Developmental validation of mitochondrial DNA genotyping
assays for adept matrilineal inference of biogeographic ancestry at a continental level.
Foren. Sci. Int. Genet., 11: 39-51.
Chen, F., Wang, S.Y., Zhang, R. Z., Hu, Y. H., Gao, G. F., Liu, Y. H. and Kong, Q. P., 2008.
Analysis of mitochondrial DNA polymorphisms in Guangdong Han Chinese,
Forens. Sci. Int. Genet., 2: 150–153.
Childs, G. V., 2003. The mitochondrial life cycle. Retrieved from
http://www.cytochemistry.net/cellbiology/ mitochondria_lifecycle_graduate.htm
90
![Page 108: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/108.jpg)
Collins, D. W. and Jukes, T. H., 1994. Rates of transition and transversion in coding
sequences since the human- rodent divergence. Genomics, 20: 386-396.
Darwin, C., 1860. The Origin of Species, 2nd ed. pp. 392–393. John Murray, London
Davidson, M. W., 2010. Cell biology: Mitochondria. Retrieved from
http://micro.magnet.fsu.edu/cells/mitochondria/mitochondria.html
Desmet, K., Ortuno-Ortin, I. and Wacziarg, R., 2012. The political economy of linguistic
cleavages. J. of Dev. Econ., 97: 322–338.
Drummond, A. J., Ashton, B. and Cheung, M., 2009. Geneious v4.8,
http://www.geneious.com
Fan, L. and Yao, Y. G., 2011. Mito Tool: A web server for the analysis and retrieval of
human mitochondrial DNA sequence variations. Mitochondrian, 2: 351-356.
Falkenberg, M., Larsson, N. G. and Gustafsson, C. M., 2007. DNA replication and
transcription in mammalian mitochondria. Annu. Rev. Biochem., 76: 679-699.
Felsenstein, J., 1985. Confidence limits on phylogenies: An approach using the bootstrap.
Evolution, 39: 783-791.
Finnila, S., Lehtonen, M. S. and Majamaa, K., 2001. Phylogenetic network for European
mtDNA. Am. J. Hum. Genet., 68: 1475-1484.
Forster, P. and Matsumura, S. 2005. Evolution, did early humans go north or south? Scien.,
308: 965-966.
Fridman, C., Cardena, M. M. S. G., Kanto, E. A., Godinho, M. B. C. and Gonc, F.T., 2011.
SNPs in mitochondrial DNA coding region used to discriminate common sequences
in HV1-HV2–HV3 region. Forensic Science International: Genet. Suppl. Ser., 3: e75-
e76.
91
![Page 109: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/109.jpg)
Fu, Q., Meyer, M., Xing, G., Stenzel, U., Burbano, H. A., Kelso, J. and Paabo, S., 2013.
DNA analysis of an early modern human from Tianyuan Cave, China. PNAS, 110:
2223-2227.
Gabunia, L. and Vekua, A., 1995. A Plio-pleistocene hominid from Dmanisi, East Georgia,
Caucasus. Nature., 373: 509-512.
Garritsen, H., Hoerning, A., Hellenkamp, F., Cassens, U., Mittmann, K. and Sibrowski, W.,
2001. Polymorphisms in the non-coding region of the human mitochondrial genome
in unrelated plateletapheresis donors. Brit. J. Haematol., 112: 995-1003.
Ge, J., Budowle, B. and Chakraborty, R., 2010. DNA identification by pedigree likelihood
ratio accommodating population substructure and mutations. Invest. Genet., 1: 8.
Ghosh, T., Kalpana, D., Mukerjee, S., Mukherjee, M., Sharma, A. K., Nath, S., Rathod, V. R.
Thakar, M. K. and Jha., G. N., 2011. Genetic diversity of 17 Y-short tandem repeats
in Indian population. Forensic Sci. Int. Genet., 5: 363–367.
Gilbert, S. F., 2006. Developmental Biology, 8th ed. pp-25-41. Sunderland, MA USA:
Sinauer Associates, Inc.
Giezen, M. and Tovar, J., 2005. Degenerate mitochondria. EMBO. Rep., 6: 525–30.
Giles, R. E., Blanc, H., Cann, H. M. and Wallace, D. C., 1980. Maternal inheritance of
human mitochondrial DNA. Proc. Natl. Acad. Sci., 77: 6715–6719.
Goebel, T., 2007. Anthropology.The missing years for modern humans. Scien., 315: 194-
196.
Goto, H., Dickins, B., Afgan, E., Paul, I. M., Taylor, J., Makova, K. D. and Nekrutenko, A.,
2011. Dynamics of mitochondrial heteroplasmy in three families investigated via a
92
![Page 110: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/110.jpg)
repeatable re-sequencing study. Genome Biol., 12: R59
http://genomebiology.com/2011/12/6/R59
Gray, M. W., 1989. Origin and evolution of mitochondrial DNA. Annu. Rev. Cell. Biol., 5:
25–50.
Grimes, B. F., 1992. “Ethnologue: Languages of the World,” 12th ed., Summer Institute of
Linguistics, Inc., Dallas, Texas, USA.
Grzybowski, T., Malyarchuk, B. A., Czarny, J., Miscicka-Sliwka, D. and Kotzbach, R., 2003.
High levels of mitochondrial DNA heteroplasmy in single hair roots: reanalysis and
revision. Electrophoresis, 24: 1159–1165.
Hahn, B. J. and Voth, M., 1994. Dynamics of mitochondria in living cells: shape changes,
dislocations, fusion and fission of mitochondria. Micro. Rese. and tech., 27: 198-219.
Hammer, M. F., Karafet, T., Rasanayagam, A., Wood, E. T., Altheide, T. K. and Jenkins, T.,
1998. Out of Africa and back again: nested cladistic analysis of human Y
chromosome variation. Mol. Biol. Evol., 15: 427-441.
Hartl, D. L. and Jones, E. W., 2005. Genetics Analysis of Genes and Genomes, 6th
Ed.
pp-854. Massachusetts, Jones and Bartlett.
Haslindawaty, N. A. R., Panneerchelvam, S., Edinur, H. A., Norazmi, M. N. and Zafarina, Z.,
2010. Sequence polymorphisms of mtDNA HV1, HV2 and HV3 regions in the Malay
population of Peninsular Malaysia. Int. J. Legal Med., 124: 415-426.
Hawks, J., Wang, E.T., Cochran, G. M., Harpending, H. C. and Moyzis, R. K., 2007. Recent
acceleration of human adaptive evolution. Proc. Natl. Acad. Sci., 104: 20753–20758.
Hebsgaard, M. B., Wiuf, C. M., Gilbert, T. P., Glenner, H. and Willerslev, E., 2007.
Evaluating Neanderthal genetics and phylogeny. J. Mol. Evol., 64: 50–60.
93
![Page 111: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/111.jpg)
Herrnstadt, C., Elson, J. L., Fahy, E., Preston, G., Turnbull, D. M, Anderson, C., Ghosh, S.
S., Olefsky, J. M., Beal, M. F., Davis, R. E. and Howell, N., 2002. Reduced median
network analysis of complete mitochondrial DNA coding-region sequences for the
major African, Asian and European haplogroups. Am. J. Hum. Genet., 70: 1152-
1171.
Holt, I. J., Harding, A. E., and Morgan-Hughes, J. A., 1988. Deletions of muscle
mitochondrial DNA in patients with mitochondrial myopathies. Natu., 331: 717-719.
Hoong, L. L. and Lek, K. C., 2005. Genetic polymorphisms in mitochondrial DNA
hypervariable regions I, II and III of the Malaysian population. Asia Paci. J. Mol.
Biol. and Biotech., 13: 79-85.
Ingman, M., Kaessmann, H., Paabo, S. and Gyllensten, U., 2000. Mitochondrial genome
variation and the origin of modern humans. Natu., 408: 708-713.
Irwin, J., Saunier, J., Strouss, K., Sturk, K., Diegoli, T., Just, R., Coble, M., Parson, W. and
Parsons, T., 2007. Development and expansion of high quality control region
databases to improve forensic mtDNA evidence interpretation. Foren. Sci. Int.
Genet., 1: 154–157.
Irwin, J., Saunier, J., Strouss, K., Diegoli, T., Sturk. K. and Callaghan, J., 2008.
Mitochondrial control region sequences for Vietnam. Int. J. Legal Med., 122: 257–9.
Irwin, J. A., Saunier, J. L., Niederstatter, H., Strouss, K. M. and Sturk, K., 2009.
Investigation of heteroplasmy in the human mitochondrial DNA control region: a
synthesis of observations from more than 5000 global population samples. J. Mol.
Evol., 68: 516–527.
94
![Page 112: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/112.jpg)
Jukes T. H. and Cantor C. R., 1969. Evolution of protein molecules. In Munro HN, editor,
Mammalian Protein Metabolism, pp. 21-132. Academic Press, New York.
Kalaydjieva, L., Morar, B., Chaix, R. and Tang, H., 2005. A Newly Discovered Founder
Population: The Roma/Gypsies". BioEssays 27(10): 1084–1094.
doi:10.1002/bies.20287. PMID 16163730.
Karafet, T. M., Mendez, F. L., Meilerman, M. B., Underhill, P. A., Zegura, S. L., 2008. New
binary polymorphisms reshape and increase resolution of the humanY chromosomal
haplogroup tree. Genome Res., 18: 830–838.
Kavlick, M. F., Lawrence, H. S., Merritt, R. T., Fisher, C., Isenberg, A., Robertson, J. M. and
Budowle, B., 2011. Quantification of human mitochondrial DNA using synthesized
DNA standards. J. of foren. Scien., 56: 1457-63.
Kayser, M., 2007. Uniparental markers in human identity testing including forensic DNA
analysis. Biotech., 43: S16-S21.
Kayser, M. and Knijff, P., 2011. Improving human forensics through advances in genetics
genomics and molecular biology. Nat. Rev. Genet., 12: 179-92.
Ketmaier, V. and Bernardini, C., 2005. Structure of the mitochondrial control region of the
Eurasian Otter (Lutralutra; Carnivora, Mustelidae). Patterns of genetic heterogeneity
and implications for conservation of the species in Italy. J. Hered., 96: 318-328.
http://dx.doi.org/10.1093/jhered/esi037
Khurana, P., Aggarwal, A., Mitra, S., Italia, Y. M., Saraswathy, K. N., Chandrasekar, A. and
Kshatriya, G. K., 2014. Y Chromosome Haplogroup Distribution in Indo- European
Speaking Tribes of Gujarat, Western India. PLOS ONE, 9(3): e90414
95
![Page 113: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/113.jpg)
Kivisild, T., Rootsi, S., Metspalu, M., Mastana, S., Kaldma, K. and Parik J., 2003. The
genetic heritage of earliest settlers persists in both the Indian tribal and caste
populations. Am. J. Hum. Genet., 72: 313–332.
Kivisild, T., Reidla, M., Metspalu, E., Rosa, A., Brehm, A., Pennarun, E., Parik, J.,
Geberhiwot, T., Usanga, E. and Villems, R., 2004. Ethiopian mitochondrial DNA
heritage: tracking gene flow across and around the gate of tears. Am. J. Hum.
Genet.,75: 752-770.
Klein, R. G., 1989. The Human Career: Human Biological and Cultural Origin. Chicago:
Chicago University Press.
Kloss-Brandstatter, A., Pacher, D., Schonherr, S., Weissensteiner, H., Binna, R., Spechtand,
G. and Florian K., 2011. HaploGrep: a fast and reliable algorithm for automatic
classification of mitochondrial DNA haplogroups. Hum. Mutat., 32(1): 25-32.
Kohnemann, S., Sibbing, U., Pfeiffer, H. and Hohoff, C., 2008. A rapid mtDNA assay of 22
SNPs in one multiplex reaction increases the power of forensic testing in European
Caucasians. Int. J. of leg. Med., 122: 517-23.
Kong, Q. P., Yao, Y. G., Sun, C., Bandelt, H. J., Zhu, C. L. and Zhang, Y. P., 2003.
Phylogeny of East Asian mitochondrial DNA lineages inferred from complete
sequences. Am. J. Hum. Genet., 73: 671-676.
Kogelnik, A. M., Lott, M. T., Brown, M. D., Navathe, S. B. and Wallace, D. C., 1996.
MITOMAP: a human mitochondrial genome database. Nucl. acid res., 24:177–179.
Larik, N. M., 2000. Pakistan statistical year book, Federal Bureau of statistics, Government
of Pakistan, Karachi.
96
![Page 114: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/114.jpg)
Lell, J. T. and Wallace, D. C., 2000. The peopling of Europe from the maternal and
paternal perspectives. Am. J. Hum. Genet., 67: 1376–81.
Lee, Y. S., Kim, W. Y., Ji, M., Kim, J. H. and Bhak, J., 2009. MitoVariome: a variome data
base of human mitochondrial DNA. BMC Genom., 10(Suppl 3):S12 doi:
10.1186/1471-2164-10-S3-S12.
Lee, Y. H, Yoon, A, J, Yang,. L.W. and Shin, J. K., 2013. A one step multiplex PCR assay
for rapid screening of East Asian mtDNA haplogroups on forensic samples, Legal
Med., 15: 50–54.
Li, M., Schonberg, A., Schaefer, M., Schroeder, R., Nasidze, I. and Stoneking, M., 2010.
Detecting heteroplasmy from high-throughput sequencing of complete human
mitochondrial DNA genomes. Am. J. Hum. Genet., 87: 237–249.
Li, H. and Durbin, R., 2011. Inference of human population history from individual whole-
genome sequences. Nat., 475: 493–496.
Luca, D. S. Z. and Farrell, O. P. H., 2012. Barriers to male transmission of mitochondrial
DNA in sperm development. Dev. Cell, 22: 660–668.
Luis, J. R., Rowold, D. J., Regueiro, M., Caeiro, B., Cinnioglu, C., 2004. The Levant versus
the Horn of Africa: evidence for bidirectional corridors of human migrations. Am. J.
of human genet., 74: 532–544. doi: 10.1086/382286
Mabuchi, T., Susukida, R., Kido, A. and Oya, M., 2007. Typing the 1.1 kb control region of
human mitochondrial DNA in Japanese individuals. J. Forensic Sci., 52: 355–363.
Macaulay, V., Richards, M., Hickey, E., Vega, E., Cruciani, F. and Guida, V., 1999. The
emerging tree of West Eurasianmt DNAs: a synthesis of control region sequences and
RFLPs. Am. J. Hum. Genet., 64: 232-249.
97
![Page 115: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/115.jpg)
Macaulay, V., Hill, C. and Achilli, A. 2005. Single, rapid coastal settlement of Asia revealed
by analysis of complete mitochondrial genomes. Scien., 308: 1034-1036.
Maji, S., Krithika, S. and Vasulu, T. S., 2008. Distribution of Mitochondrial DNA
Macrohaplogroup N in India with Special Reference to Haplogroup R and its Sub-
Haplogroup U. Int. J. Hum. Genet., 8(1-2): 85-96.
Malyarchuk, B. A. and Rogozin, I. B., 2004. Mutagenesis by transient misalignment in the
human mitochondrial DNA control region. Ann. Hum. Genet., 68: 324–339.
Malyarchuk, B. A., Perkova, M. A., Derenko, M. V., Vanecek, T., Lazur, J. and Gomolcak,
P., 2008. Mitochondrial DNA variability in Slovaks, with application to the Roma
origin. Ann. of Hum. Gent., 72: 228-240.
Manfredi, G., Thyagarajan, D., Papadopoulou, L. C., Pallotti, F. and Schon, E. A.1997. The
fate of human sperm derived mtDNA in somatic cells. Am. J. Hum. Genet., 61:953-
60.
Maruyama, S., Nohira-Koike, C., Minaguchi, K. and Nambiar, P., 2009. mtDNA control
region sequence polymorphisms and phylogenetic analysis of Malay population
living in or around Kuala Lumpur in Malaysia. Int. J. Legal. Med., 124(2): 165-170.
Maruyama, S., Komuro, T., Izawa, H. and Tsutsumi, H., 2013. Analysis of human
mitochondrial DNA polymorphisms in the Japanese population. Biochem. Genet., 51:
33-70.
Mcbride, H. M., Neuspiel, M. and Wasiak, S., 2006. Mitochondria: more than just a
powerhouse. Current boil., 16(14): 551-60. doi:10.1016/j.cub.2006.06.054
Mellars, P., 2006. Going east: New genetic and archaeological perspectives on the modern
human colonization of Eurasia. Scien., 313: 796–800.
98
![Page 116: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/116.jpg)
Metspalu, M., Kivisild, T., Metspalu, E., Parik, J., Hudjashov, G. and Kaldma, K., 2004.
Most of the extant mtDNA boundaries in South and Southwest Asia were likely
shaped during the initial settlement of Eurasia by anatomically modern humans.
BMC. Genet., 5: 26.
Michikawa, Y., Mazzucchelli, F., Bresolin, N., Scarlato, G. and Attardi, G., 1992. Aging
dependent large accumulation of point mutations in the human mtDNA control region
for replication. Scien., 86: 774-779.
Mishmar, D., Ruiz-Pesini, E., Golik, P., Macaulay, V., Clark, A. G. and Hosseini, S., 2003.
Natural selection shaped regional mtDNA variation in humans. Proc. Natl. Acad. Sci.,
100: 171-6.
Mogentale-Profizi, N. 1., Chollet, L., Stevanovitch, A., Dubut, V., Poggi, C., Pradie, M, P.,
Spadoni, J. L. and Gilles, A., Beraud-Colomb, E., 2001. Mitochondrial DNA
sequence diversity in two groups of Italian Veneto speakers from Veneto. Ann. Hum.
Genet., 65(2):153-66.
Murci, Q. L., Semino, O., Bandelt, H. J., Passarino, G., Mcelreavey, K., Benerecetti, S. A. S.,
1999. Genetic evidence of an early exit of Homo sapiens sapiens from Africa through
eastern Africa. Nat. Genet., 23(4): 437-441.
Murci, Q. L., Chaix, R., Wells, R. S., Behar, D. M., Sayar, H., Scozzari, R., Rengo, C., Al-
Zahery, N., Semino, O., Santachiara- Benerecetti, A. S., Coppa, A., Ayub, Q.,
Mohyuddin, A., Tyler-Smith, C., Mehdi, S. Q., Torroni, A. and Mcelreavey, K., 2004.
Where west meets east, the complex mtDNA landscape of the southwest and Central
Asian corridor. Am. J. Hum. Genet., 74: 827-845.
99
![Page 117: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/117.jpg)
Nagai, A., Nakamura, I., Shiraki, F., Bunai, Y. and Ohya, I., 2003. Sequence polymorphism
of mitochondrial DNAin Japanese individuals from Gifu Prefecture. Leg. Med., 5:
210–213.
Naue, J., Sanger, T., Schmidt, U., Klein, R. and Bonengel, L. S., 2011. Factors affecting the
detection and quantification of mitochondrial point heteroplasmy using Sanger
sequencing and Snapshot mini sequencing. Int. J. of Leg. Med., 125(3): 427-436.
Nohira, C., Maruyama, S. and Minaguchi, K., 2010. Phylogenetic classification of Japanese
mtDNA assisted by complete mitochondrial DNA sequences. Int. J. Leg. Med., 124:
7–12.
Okamoto, K. and Shaw, J. M., 2005. Mitochondrial morphology and dynamics in yeast and
multicellular eukaryotes. Annu. Revi. of genet., 39: 503-36.
Olivieri, A., Achilli, A. and Pala, M., 2006. The mtDNA legacy of the Levantine early upper
Palaeolithic in Africa. Scien., 314: 1767–1770.
Olivieri, A., Pala, M., Gandini, F., Kashani, B. H., Perego, U. A., Woodward, S. R., Grugni,
V., Battaglia, V., Semino, O., Achilli, A. and Richards, M. B., Torroni, A., 2013.
Mitogenomes from Two Uncommon Haplogroups Mark Late Glacial/Postglacial
Expansions from the Near East and Neolithic Dispersals within Europe. PLOS ONE,
8(7): e70492
Pakendorf, B. and Stoneking, M., 2005. Mitochondrial DNA and human evolution. Ann. Rev.
Genomics, human Gent., 6: 165-183.
Palanichamy, M. G., Sun, C., Agrawal, S., Bandelt, H. J., Kong, Q. P. and Khan, F., 2004.
Phylogeny of mitochondrial DNA macro haplogroup N in India, based on complete
100
![Page 118: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/118.jpg)
sequencing: implications for the peopling of south Asia. Am. J. Hum. Genet., 75: 966-
978.
Paneto, G. G., Martins, J. A., Longo, L. V. G., Pereira, G. A., Freschi, A., Alvarenga, V. L.
S. and Chen, B., 2007. Heteroplasmy in hair: Differences among hair and blood from
the same individuals are still a matter of debate. Foren. Scien. Int., 173: 117-121.
Parson, W., Parsons, T. J., Scheithauer, R. and Holland, M. M., 1998. Population data for
101 Austrian Caucasian mitochondrial DNA D-loop sequences.Application of
mtDNA sequence analysis to a forensic case. Int. J. of Leg. Med., 111: 124-132.
Parson, T. J. and Coble, M. D., 2001. Increasing the forensic discrimination of mitochondrial
DNA testing through analysis of the entire mitochondrial DNA Genome. Croatian
Med. J., 42: 304-309.
Parson, W. and Bandelt, H. J., 2007. Extended guidelines for mtDNA typing of population
data in forensic science. Forensic Sci. Int. Genet., 1: 13–19.
Pereira, F., Carneiro, J. and Asch, V. B., 2010. A guide for mitochondrial DNA analysis in
non-Human forensic investigations. Open Forensic Scien. J., 3: 33-44.
http://dx.doi.org/10.2174/1874402801003020033
Pliss, L., 2007. Mitochondrial DNA (mtDNA) Variation and its role in ethnogenesis of
latvians.http://luis.lanet.lv/pls/pub/luj.fprnt?l=1&fn=F7930/Liana%20Pliss%202007.
Qamar, R., Ayub, Q., Khaliq, S., Mansoor, A., Karafet, T., Mehdi, S. Q. and Hammer, M. F.,
1999. African and Levantine origins of Pakistani YAP+Y chromosomes. Hum.
Biol., 71: 745–755.
101
![Page 119: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/119.jpg)
Qamar, R., Ayub, Q., Mohyuddin, A., Helgason, A., Mazhar, K., Mansoor, A., Zerjal, T.,
Tyler-Smith, C. and Mehdi, S. Q., 2002. Y-Chromosomal DNA Variation in
Pakistan. Am. J. Hum. Genet., 70: 1107–1124.
Rakha, A., Shin, K. J., Yoon, J. A., Kim, N. Y., Siddique, M. H., Yang, I. S., Yang, W. I. and
Lee, H. Y., 2011. Forensic and genetic characterization of mtDNA from Pathans of
Pakistan. Int. J. Leg. Med., 125(6): 841-848.
Ramos, A., Santos, C., Mateiu, L., Gonzalez, M. M. and Alvarez, L., 2013. Frequency and
pattern of heteroplasmy in the complete human mitochondrial genome. PLoS ONE 8:
e74636. doi:10.1371/journal.pone.0074636
Ranaweera, L., Kaewsutthi, S., Win Tun, A., Boonyarit, H., Poolsuwan, S. and Lertrit, P.,
2014. Mitochondrial DNA history of Sri Lankan ethnic people: their relations within
the island and with the Indian subcontinental populations. J. of Human Genet., 59:
28–36.
Rawi, A. S., Vallee, L. S., Djeddi, A., Sachse, M., Culetto, E., Hajjar, C., Boyd, L., Legouis,
R. and Galy, V., 2011. Post fertilization autophagy of sperm organelles prevents
paternal mitochondrial DNA transmission. Scien., 334: 1144-1147.
Reece, H. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V. and Jackson, R.
B., 2011. Campbell Biology, 9th ed. pp. 94-109. Boston Colombus Indianapolis
Tokyo: Benjamin Cummings.
Reljanovic, M., Curik, I., Sprem, N. and Cubric-Curik, V., 2012. Analysis of mitochondrial
DNA in Adriatic Sardine (SardinaPilchardus). A preliminary Study. Acta
Argiculturae Slovenica, Suppl., 3: 345–350.
102
![Page 120: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/120.jpg)
Richards, M., Macaulay, V., Hickey, E., Vega, E., Sykes, B., Guida, V., Rengo, C., Sellitto,
D., Cruciani, F. and Kivisild, T., 2000. Tracing European founder lineages in the
Near Eastern mtDNA pool. Am. J. Hum. Genet., 67(5): 1251-1276.
Richly, E. and Leister, D., 2004. NUMTs in sequenced eukaryotic genomes. Mol.
Biol. Evol., 21:1081–1084.
Rogers, A. R. and JORDE, L. B., 1995. Genetic evidence on modern human origins. Hum.
Biol., 67: 1-36.
Rosser, Z. H., Zerjal, T., Hurles, M. E., Adojaan, M., Alavantic, D., Amorim, A. and Amos,
W., 2000. Y-chromosomal diversity in Europe is clinal and influenced primarily by
geography, rather than by language. Am. J. Hum. Genet., 67: 1526–1543.
Saferstein, R., 2007. Criminalistics, an Introduction to Forensic Science, 9th
Ed. pp- 654.
New Jersey Pearson Education..
Sambrook, J. and Russell, D. W., 2001. Molecular cloning: A laboratory manual. 3rd Ed. pp-
2344. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Santos, C., Montiel, R., Angles, N., Lima, M., Francalacci, P., Malgosa, A., Abade, A. and
ALUJA, P. A., 2004. Determination of human Caucasian mitochondrial DNA
haplogroups by means of a hierarchical approach. Hum. Biol., 76.
Santos, C., Montiel, R., Sierra, B., Bettencourt, C. and Fernandez, E., 2005. Understanding
differences between phylogenetic and pedigree derived mtDNA mutation rate: a
model using families from the Azores Islands (Portugal). Mol. Biol. Evol., 22: 1490–
1505.
103
![Page 121: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/121.jpg)
Santos, C., Sierra, B., Alvarez, L., Ramos, A. and Fernandez, E., 2008. Frequency and
pattern of heteroplasmy in the control region of human mitochondrial DNA. J. Mol.
Evol., 67: 191–200.
Salas, A., Richards, M., Dela, F. T., Lareu, M. V., Sobrino, B., Sanchez, D. P, Macaulay, V.
and Carracedo, A., 2002. The making of the African mtDNA landscape. Am. J. Hum.
Genet., 71: 1082-1111.
Salas, A., Richards, M., Lareu, M. V., Scozzari, R., Coppa, A., Torroni, A., Macaulay, V.
and Carracedo, A., 2004. The African diaspora: mitochondrial DNA and the Atlantic
slave trade. Am. J. Hum. Genet.,74: 454-465.
Saunier, J. L., Irwin, J. A., Strouss, K. M., Ragab, H., Sturk, K. A. and Parsons, T. J., 2009.
Mitochondrial control region sequences from an Egyptian population sample. Foren.
Sci. Int. Genet., 3: e97–e103.
Scally, A. and Durbin, R., 2012. Revising the human mutation rate: implications for
understanding human evolution. Nat. Rev. Genet., 13: 745-753.
Schriner, S. E., Ogburn, C. E., Smith, A. C., Newcomb, T. G. and Ladiges, W. C., 2000.
Levels of DNA damage are unaltered in mice over expressing human catalase in
nuclei. Free Radic Biol. Med., 29: 664–673.
Schurr, T. G. and Wallace, D. C., 2002. Mitochondrial DNA diversity in South east Asian
populations. Hum. Biol.,74: 431-452.
Scheffler, I. E., 2008. Mitochondria 2nd ed. pp-484. Jonh Wiley & Sons, Inc: Hoboken,
New Jersey.
104
![Page 122: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/122.jpg)
Scozzari, R., Torroni, A., Semino, A., Sirugo, G., Brega, A. and Santachiara-Benerecetti, A.
S., 1988. Genetic studies on the Senegal population. I. Mitochondrial DNA
polymorphisms. Am. J. Hum. Genet., 43: 534–544.
Sekiguchi, K., Imaizumi, K., Kazuhiko, K., Fujii, K., Mizuno, N., Ogawa, Y., Akutsu, T.,
Nakahara, H., Kitayama, T. and Kasai, K., 2008. Mitochondrial DNA population data
of HVR1 and HVR2 sequences from Japanese individuals. Leg. Med., 10: 284-286.
Shackle, C., 1977. Siraiki: A Language Movement in Pakistan. Modern Asian Studies, 3(11):
(pp.379-403).
Shriver, M. D., Jin, L., Ferrell, R. E. and Deka, R., 1997. Micosatellite Data support an early
population expansion in Africa. Genomes, Res., 7: 586-591.
Shriver, M. D. and Kittles, R. A., 2004. Genetic ancestry and the search for personalized
genetic histories. Nat. Rev. Genet., 5: 611-618.
Siddiqi, M. H., Tanveer, A., Rakha, A., Ghazanfar, A., Akram, A., Naeem, H., Azam, A.,
Sikandar, H., Masooma, S., Jamil, A., Tariq, A. M., van Oven, M. and Khan, F. M.,
2014. Genetic characterization of the Makrani people of Pakistan from mitochondrial
DNA sequence data. LEGMED-D-14-00135 [in process].
Sikandar, H., Tanveer, A., Siddiqi, M. H., Rakha, A., Naeem, H., Tayyab, M., Ghazanfar, A.,
Azam, A., Yassir, A. and Tariq, A. M., 2014. Mitochondrial DNA Control Region
Sequences Study in Saraiki Population from Pakistan. LEGMED-D-14-00137 [in
process].
Smeitink, J., Van, D. H. L. and Dimauro, S., 2001. The genetics and pathology of oxidative
phosphorylation. Nat. Rev. Genet., 2: 342-352.
105
![Page 123: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/123.jpg)
Stringer, C. B. and Andrews, P., 1988. Genetic and fossils evidence for the origin of modern
humans. Science, 239: 1263-1268.
Sun, C., Kong, Q. P., Palinichamy, M. G., Agrawal, S., Bandelt, H. J. and Yao, Y. G., 2006.
The dazzling array of basal branches in the mtDNA macrohaplogroup M from India
as referred from complete genomes. Mol. Biol. Evol., 23: 683–690.
Swisher, C. C., Curtis, G. H., Jacob, T., Getty, A. G., Suprijo, A. and Widiasmoro., 1994.
Age of the earliest known hominids in Java, Indonesia. Science, 263: 1118-1121.
Taanman, J. W., 1999. The mitochondrial genome: structure, transcriptions, translation, and
replication. Biochim. Biophys. Acta., 1410: 103-123.
Tadmouri, G. O., Nair, P., Obeid, T., Ali, M. T., Khaja, N. and Hamamy, H. A., 2009.
Consanguinity and reproductive health among Arabs. Reprod Health, 6: 1-9.
Tajima, F., 1989. Statistical method for testing the neutral mutation hypothesis by DNA
polymorphism. Genet., 123: 585-95.
Tambets, K., Rootsi, S., Kivisild, T., Help, H. and Serk, P., 2004. The western and eastern
roots of the Saami–the story of genetic “outliers” told by mitochondrial DNA and Y
chromosomes. Am. J. Hum.Genet.,74: 661-82.
Tamang, R. and Thangaraj, K., 2012. Genomic view on the peopling of India. Invest. Genet.,
3: 20.
Tamura, K., Stecher G., Peterson D., Filipski A. and Kumar, S., 2013. MEGA6: Molecular
Evolutionary Genetics Analysis version 6.0. Mol. Biol. and Evol., 30: 2725-2729.
Tanaka, M., Cabrera, V. M., Gonzalez, A. M. 2004. Mitochondrial genome variation in
eastern Asia and the peopling of Japan. Genome Res., 14:1832-1850.
Tattersall, I., 1997. Out of Africa again ------ and again? Sci. Am., 276: 60-67.
106
![Page 124: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/124.jpg)
Taylor, R. W. and Turnbull, D. M. 2005. Mitochondrial DNA mutations in human disease.
Nat. Rev. Genet., 6: 389-402.
Templeton, A., 2002. Out of Africa again and again. Natu., 416: 45-51.
Thangaraj, K., Chaubey, G., Singh, V., Vanniarajan, A., Thanseem, I., Reddy, A. G. AND
SINGH, L., 2006. In situ origin of deep rooting lineages of mitochondrial
macrohaplogroup M in India. BMC. Genom., 7: 151.
Torroni, A., Huoponen, K., Francalacci, P., Petrozzi, M., Morelli, L. and Scozzari, R., 1996.
Classification of European mtDNAs from an analysis of three European populations.
Genet., 144: 1835-1850.
Torroni, A., Achilli, A., Macaulay, V., Richards, M. and Bandelt, H., 2006. Harvesting the
fruit of the human MtDNA tree. Trends in Genet., 22: 339-345.
Tsutsumi, H., Komuro, T., Mukoyama, R. and Nogami, H., 2006. Hypervariable region
structure and polymorphism of mtDNA from dental pulp and a family analysis. J.
Oral Sci., 48: 145-152. http://dx.doi.org/10.2334/josnusd.48.145.
Underhill, P. A. and Kivisild, T., 2007. Use of Y chromosome and mitochondrial DNA
population structure in tracing human migrations. Annu. Rev. Genet., 41: 539-564.
van Oven, M. and Kayser, M., 2008. Updated comprehensive phylogenetic tree of global
human mitochondrial DNA variation. Hum. Mutat., 29: E386-94.
van Oven, M. and Kayser, M. 2009. Updated comprehensive phylogenetic tree of global
human mitochondrial DNA variation. Hum. Mutat., 30: E386–94.
http://www.phylotree.org. doi:10.1002/ humu.20921
Vandegrift, E. A., 2010. Quantitation and characterization of Human nuclear and
mitochondrial DNA with PCR and capillary electrophoresis. M. Sc. Thesis.
107
![Page 125: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/125.jpg)
Wallace, D. C., Zheng, X. X., Lott, M. T., Shoffner, J. M. and Hodge, J. A., 1988. Familial
mitochondrial encephalomyopathy (MERRF): genetic, pathophysiological and
biochemical characterization of a mitochondrial DNA disease. Cell, 55: 601–610.
Wallace, D. C., 1994. Mitochondrial DNA sequence variation in human evolution and
disease. Proceedings ofthe National Academy of Sciences, 91: 8739-8746.
http://dx.doi.org/10.1073/pnas.91.19.8739
Walter, R. C., Buffler, R. T., Bruggemann, J. H., Guillaume, M. M., Berhe, S. M., Negassi,
B., Libsekal, Y., Cheng, H., Edwards, R. L, Cosel, V. R., Neraudeau, D. and Gagnon,
M., 2000. Early human occupation of Red sea coast of Eritrea during the last inter
giacial. Nature, 405: 65-69.
Watson, E., Forster, P., Richards, M. and Bandelt, H. J., 1997. Mitochondrial footprints of
human expansions in Africa. Am. J. Hum. Genet., 61: 691-704.
Weichhold, G. M., Berk, J. E., Korte, W., Eisenmenger, W. and Sullivan, K. M., 1998. DNA
analysis in the case of Kasper Hauser. Int. J. Legal. Med., 111: 287–291.
Wells, J. D. and Stevens, J. R., 2008. Application of DNA based methods in forensic
entomology. Annu. Rev. Entomol., 53: 103-120.
Witas, H. W. and Zawicki, P., 2004. Mitochondrial DNA and human evolution. A review.
Przeglad Antropologiczny Anthropological Review, 67: 97-110.
Wu, W., Kalyanasundaram, A., and Zhu, J., 2013. Structural and biomechanical basis of
mitochondrial movement in eukaryotic cells. Inter. J. of Nanomed., 8: 4033–4042.
Xu, S., Yin, X. and Li, S., 2009. Genomic dissection of population substructure of Han
Chinese and its implication in association studies. Am. J. Hum. Genet., 85 : 762-774.
Yang, I. S., Lee, H. Y., Yang, W. I., Shin, K. J., 2013. mtDNA Profiler, The tool is described
108
![Page 126: GENETIC CHARACTERIZATION OF mtDNA FROM SARAIKI …](https://reader034.vdocuments.us/reader034/viewer/2022051319/627ae350396d4f7a4310fa35/html5/thumbnails/126.jpg)
in: A Web Application for the Nomenclature and Comparison of Human
Mitochondrial DNA Sequences. J. of Foren. Sci. [Epub ahead of print].
Yao, Y. G. and Zhang, Y. P., 2002. Phylogeographic analysis of mtDNA variation in four
ethnic populations from Yunnan Province: new data and a reappraisal. J. Hum.
Genet., 47: 311-318.
Zgonjanin, D., Veselinovic, I., Kubat, M., Furac, I., Antov, M. and Loncar, E., 2010.
Sequence polymorphism of the mitochondrial DNA control region in the population
of Vojvodina Province. Serbia Leg. Med., 12: 104-7.
109