![Page 1: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/1.jpg)
Prof. Giulio Ghersi, Dipartimento di Scienze e TecnologieBiologiche Chimiche e FarmaceuticheViale delle Scienze, ed 16 – Palermo.
Vice Presidente ATeN CenterResponsabile polo CHABViale delle Scienze, ed 18 – Palermo
Presidente ed ADABIEL S.r.l.Via del Mare 3, Campobello di Mazara (TP)
Generation of recombinant collagenases class I & II. A new approach in cell
purification for research and clinical applications
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 2: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/2.jpg)
Clinical Hurdles in
Cell Transplantation
The need for standardized enzymes
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 3: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/3.jpg)
The solution: Recombinant collagenases
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 4: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/4.jpg)
Col_I_Optimizer_Ver4 (3053 nt) [ORDINATO BLUE Heron]
ccatgggatccatgatcgcgaacaccaatagtgagaaatacgactttgaatacttgaacggtctgagctacacggaactgactaacctg
atcaaaaacattaagtggaaccagatcaacggcctgttcaattattctactggctctcagaaattcttcggtgacaaaaaccgtgtaca
ggcgattatcaacgccctgcaggaatctggccgcacttataccgctaacgacatgaaaggcatcgagaccttcactgaagttctgcgtg
cgggtttttatctgggctactacaacgacggtctg......................tcgccactacgtcttcatttacaaacatgatt
ctgcctcgaacattagctattcactcaacatcaaaggtctgggtaacgaaaagctgaaagaaaaggaaaataacgattcttccgataaa
gcaaccgtgattccgaactttaacaccactatgcaggggtcgctgctgggtgacgattcccgcgattattactccttcgaagtaaaaga
agagggcgaagtgaacatcgaactggataaaaaagacgaatttggtgttacctggacgctgcacccggaatctaacatcaacgaccgta
tcacctatggccaggtggacggtaacaaagtttccaacaaggtcaaacttcgcccgggcaaatattatctgctggtctacaagtattct
ggatctggtaattacgaactgcgtgttaacaagtaagagctcaagctt
Optimized using Optimizer
COLH V5 (2970 bp) Cloning in pCR2.1 or pBluescript(without its promoter, to prevent
toxicity in E. coli)
ggatccaccATGGTTCAAAACGAAAGCAAACGTTACACCGTGAGCTATCTGAAGACCCTGAATTACTACGACCTGGTAGATCTGCTGGT
CAAGACGGAAATCGAGAACCTGCCGGACCTGTTCCAGTATAGTAGCGATGCCAAAGAGTTTTACGGGAACAAAACGCGCATGTCGTTCA
TTATGGATGAAATCGGTCGCCGTGCCCCGCAGTATACGGAAATCGATCATAAAGGGATTCCTACTCTGGTAGAAGTGGTCCGCGCTGGG
TTTTATCTGGGGTTTCACAATAAAGAACTGAATGAAATTAACAAGCGTAGTTTTAAGGAGCGCGTGATTCCAA................
............TGAAAATACCAGCGACCAGGACTATTTTTATTTTGATGTTATTACCCCAGGTGAGGTTAAAATTGACATTAACAAAC
TGGGCTACGGCGGCGCCACCTGGGTCGTGTATGATGAAAATAATAACGCGGTGAGCTACGCGACCGATGACGGGCAGAACCTGAGCGGC
AAATTCAAGGCCGATAAACCGGGCCGCTACTATATTCATCTGTATATGTTTAACGGCAGCTATATGCCGTATCGCATCAATATCGAAGG
CAGCGTGGGCCGCtaactcgagaagctt
Optimized with GENEius, codon usage of E.coli (semi HEG)
Class I - Collagenase G : optimized sequence (3053 nt)
Class II - Collagenase H - optimized sequence (2970 nt)
The solution: Recombinant collagenases
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 5: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/5.jpg)
The solution: Recombinant collagenases
Optimization by Codon Usage Escherichia coli K12
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 6: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/6.jpg)
The solution: Recombinant collagenases
Host: E. coli
• TOP10 (contain the gene Bla for the resistance to AMP)
• F- mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 nupG recA1
araD139 Δ(ara-leu)7697 galE15 galK16 rpsL(StrR) endA1 λ-
• BL21AI (induction by arabinose of T7-pol gene; absence of endogenes
proteases; contain the gene Tet to be resistant to tetracicline) Transformed
plasmids containing T7 promoter driven expression are repressed until L-
arabinose induction of T7 RNA polymerase.
• F– ompT gal dcm lon hsdSB(rB- mB
-) araB::T7RNAP-tetA
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 7: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/7.jpg)
The solution: Recombinant collagenases
1000 bp
1500 bp
2000 bp
3000 bp ~3050 bp~3170 bp
Collagenasi G3050bp
M
Sequences codifying CollG and Coll H were optimized by silica application using the Codon Usage Database (http://www.kazusa.or.jp/codon) to be efficiently expressboth in the E.coliBL21A1 clone (which constitutively low express proteolytic enzymes).
Optimized sequence in “transport” plasmid.
Generation of chimera recombinant C. Hystolithicum collagenase G (Coll G) and H (Coll H), full length forms, in E.coli.
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 8: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/8.jpg)
The solution: Recombinant collagenases
1000 bp
1500 bp
2000 bp
3000 bp
~6700 bp
M C2 P2
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 9: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/9.jpg)
The solution: Recombinant collagenases
Chimera MBP-Collagenase Coll G (C. histolyticum)
Chimera MBP- Collagenase Coll H (C. histolyticum)
CommonsegmentCatalytic domain
Zn2+
H2N COOHPre-peptideCollagen binding
domainCollagen binding
domainMaltose Binding Protein
H2NCommonsegmentCatalytic domain
Zn2+
COOHPre-peptideCollagen binding
domainMaltose Binding Protein Common
segment
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 10: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/10.jpg)
The solution: Recombinant collagenases
205
116
97,4
66
45
29
205
116
97,4
66
45
29
IPTG ( ) ( ) ( ) ( ) _ _ + +
mock mock mock mock Rec.Rec.Rec.Rec. M M
S INS
Expression by IPTG induction and proteins solubilization
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 11: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/11.jpg)
The solution: Recombinant collagenases
M = Molecular weight Markers; 1, 3, 5 and 7 = IPTG non Induced cells; 2, 4, 6, and 8 = IPTG Induced cell. 1, 2, 5, and 6 = Comassie blue staining; 3,4, 7 and 8 = gelatin zymography.
Coll G and H expression in E. coli BL21AI
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 12: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/12.jpg)
The solution: Recombinant collagenases
M ML LUB UB BB
M = MarkersL = LysateUB = UnboundB = Bound
205
116
97,4
66
45
29
_
__
_
_
_
Coll G Coll H
Affinity chromatography purification of Chimera/Recombinant enzymes
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 13: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/13.jpg)
The solution: Fermentation production and scale up
• closed system
• no control on bacterial growth rate μ (h-1 )
• only PH, temperature and stirring speed can be regulated
Batch fermentation
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 14: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/14.jpg)
The solution: Fermentation production and scale up
• 6 L volume•10 % DO saturation• 1 M IPTG Single shot induction
• 18 OD final concentration• 2 gr. of col G• 1.8 gr.of col H
Batch fermentation
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 15: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/15.jpg)
The solution: Fermentation production and scale up
Batch fermentation output:• Final OD of 22 units• 6 gr. of col G and col H produced per experiment
6 L Batch fermentation Multiple shots induction system, DO 20%
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 16: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/16.jpg)
The solution: Fermentation production and scale up
Fed-batch fermentation
• Exponential feeding strategy
• Costant μ ( h-1 )
• Multiple shots induction system
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 17: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/17.jpg)
The solution: Fermentation production and scale up
Materials and methods:• 4 liters starting volume•800 ml of N feed solution•200 ml of P feed solution•200ml of C feed solution (glycerol)•3ml/min N/P feed pump speed•1,5ml/min C feed pump speed•Exponential growth method (pumps speeds increases in correlation with cell concentration increase)•Proportional multiple steps induction system
By applying a simple mass balance equation, it was possible to evaluate the right amount of each of three basic elements (C, N, and P) essential
for our recombinant bacteria growth.
Fed-batch fermentation
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 18: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/18.jpg)
The solution: Fermentation production and scale up
• Final cell concentration: 34 OD• 8,2 gr of purified col G and 7,2 gr of purified col H per experiment
4 L Fed-batch fermentation output
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 19: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/19.jpg)
The solution: Fermentation production and scale up
•64 OD units per fermentation• 12,5 gr of Col G and 12,1 of Col H purified by each production
8 L animal free medium fed-batch fermentation grow curve
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 20: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/20.jpg)
The solution: Fermentation production and scale up
Downstrem purification processing
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 21: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/21.jpg)
The solution: Fermentation production and scale up
Up to 98%
Col G purified enzyme on Size Exclusion HPLC - purity evaluation
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 22: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/22.jpg)
Roche Serva
Wunsch Units
Vitacyte Sigma
FALGPA Units
Sigma Worthington
CDU
Abiel
Grassman Units
Measured activity: class I + class II + proteasesVariability of class I:class II ratio. batch-to-bacth variation.!
COLLAGENASES
ACTIVITY
SYNTHETIC
PEPTIDES
NATIVE
COLLAGEN
WUNSCH FALGPA GRASSMAN CDULABELING
WITH 3H
CII >>CI CI >CIICII >CI
Remember: Units are not easily comparable, especially if you compare a mix of enzymes and a pure collagenase.
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
Quantification of collagenase classes a critical step
![Page 23: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/23.jpg)
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
Quantification of collagenase classes a critical step
![Page 24: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/24.jpg)
The Applications: Preclinical applications
Human Langherans’ islets
hMSC from adipose tissue
Murine Langherans’ islets
Osteoblasts for bone regeneration
Fibroblasts for dermis regeneration
Hepatocytes for liver regeneration and BAL
Condrocytes for cartilage regeneration
Murine MSCs from adipose tissue
Pre-clinical studies to validate COL G and COL H enzymatic activity and efficiency
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 25: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/25.jpg)
The Applications: Preclinical applications
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 26: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/26.jpg)
Puridied isletson dencity gradient system
Prepurification Islets from rat pancreas stained with dithizone
Enzymatic Digestion using recombinant enzymes
Optimization of Islets from rat pancreas in extraction/purification and storage/transport procedurres.
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
![Page 27: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/27.jpg)
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH) R
elea
sed
insu
lin (u
g/li
ter)
15
30
45
60
Time from induction (min)
15 30 60
Figure 3: Islet insulin response to glucose
induction after 1 week from isolation
![Page 28: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/28.jpg)
Using a calibrate mix of class I (Col G) and class II (Col H) collagenases together thermolysin in defined proportion of enzymatic activities (New patent submission February 2016) we obtain 1.250 +/- 250 IEQ from a pancreas of Wistar rat having a weight of 150-180 gr.
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
0"50"
100"150"200"250"300"350"400"450"
Rat$D5$glycemia$evalua0on$before$and$a7er$islets$transplanta0on$$
Glucose"m
g/dl"
![Page 29: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/29.jpg)
Enzymatic Digestion using recombinant enzymes
Extraction of functional adult cardiomyocytes from rat heart
1 day
a-actinin Troponin Merge + DAPI
a-actinin Troponin Merge + DAPI
1 day
10 days
![Page 30: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/30.jpg)
Monica SalamoneLorenzo VolpeAlessandra Lo CiceroSilvia RigogliusoSimona Campora
Giorgia AdamoLucrezia Pinnavaia
![Page 31: Generation of recombinant collagenases class I & II. A new ... · Prof. Giulio Ghersi, Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche Viale delle Scienze,](https://reader030.vdocuments.us/reader030/viewer/2022020416/5c69b99009d3f21a048b8c04/html5/thumbnails/31.jpg)
Summer School in Advanced Biotechnologies 2017 –September 3-6, 2017 SION (CH)
Grazie
Thank You