![Page 1: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/1.jpg)
EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA
PNEUMONIAE AND MYCOBACTERIUM AVIUM SUBSPECIES
PARATUBERCULOSIS: TWO PATHOGENS ASSOCIATED WITH THE
DAIRY INDUSTRY IN NEWFOUNDLAND
by
© Milka P. Podder
A Thesis submitted to the
School of Graduate Studies
in partial fulfillment of the requirements for the degree of
Masters of Science
Department of Biology
Memorial University of Newfoundland
May, 2015
St. John‘s, Newfoundland and Labrador
![Page 2: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/2.jpg)
i
Abstract
Klebsiella pneumoniae and Mycobacterium avium subspecies
paratuberculosis (Map) are two important pathogens of cattle causing clinical
mastitis (CM) and Johne‘s disease (JD), respectively. Information regarding the
molecular diversity of these two pathogens is lacking from Newfoundland. The aim
of this study was to evaluate the ability of different molecular techniques for bacterial
species identification and strain discrimination, within and between dairy farms from
Newfoundland. For CM, results demonstrate that molecular approaches were able to
detect K. variicola and Enterobacter cloacae, which were misidentified as K.
pneumoniae by standard biochemical/phenotypic tests. In the case of Map, fragment
analysis of 4 short sequence repeats (SSRs) enhanced the capability to accurately
differentiate between apparently identical isolates. Polyclonal infection patterns were
observed for K. pneumoniae and Map in the current study. Therefore, the molecular
identification of bacteria, along with precise genotyping analysis using contemporary
and improved methods will be useful in future epidemiological studies. (149 words)
![Page 3: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/3.jpg)
ii
Acknowledgements
Foremost, I would like to express my sincere gratitude to my supervisor Prof.
Dr. Kapil Tahlan (Department of Biology, Memorial University of Newfoundland)
and co-supervisor Dr. Hugh G. Whitney (Animal Health Division, Newfoundland and
Labrador Department of Natural Resources) for the continuous support of my
graduate study and research, for their patience, motivation, enthusiasm, and immense
knowledge. Their guidance helped me with my research and the writing of this thesis.
The initial design of the research project and funding for the work were provided by
both of them.
Besides my advisors, I would like to thank the rest of my supervisory
committee members: Dr. Greg P. Keefe (Department of Health Management, Atlantic
Veterinary College, University of Prince Edward Island or UPEI) and Dr. Dawn
Marshall (Department of Biology, Memorial University of Newfoundland) for their
encouragement, insightful comments, and suggestions regarding the writing of this
thesis. I sincerely thank Dr. Marcel Behr (McGill University Health Centre) for
providing me the Map K-10 reference strain and Dr. Peter K. Daley (Faculty of
Medicine, Memorial University of Newfoundland) for providing me the mass
spectrometry results. I would like to express my special gratitude towards Dr. Laura
Rogers, Cathy Keane and Kelly S. Dyer (Animal Health Division, Newfoundland and
Labrador Department of Natural Resources) for collecting samples, diagnosis,
supplying materials that were needed for the experiments, and for gathering
![Page 4: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/4.jpg)
iii
farm/animal information data. I am also grateful to Dr. Tara Paton (Genetic Analysis
Facility, The Centre for Applied Genomics, The Hospital for Sick Children) for
providing advice and insight regarding sequencing and fragment analysis and to Dr.
Dawn R. D. Bignell (Department of Biology, Memorial University of Newfoundland)
for giving me the access to use specialized laboratory equipment. Last but not least, I
like to express gratitude to my family for their immense support.
![Page 5: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/5.jpg)
iv
Table of Contents
Abstract ....................................................................................................................................... i
Acknowledgements ....................................................................................................................ii
Table of Contents ...................................................................................................................... iv
List of Tables ...........................................................................................................................vii
List of Figures ........................................................................................................................ viii
List of Abbreviations and Symbols........................................................................................... ix
List of Appendices ..................................................................................................................... x
Chapter 1: General Introduction ................................................................................................ 1
1.1 The importance of the dairy industry in Newfoundland ............................................. 1
1.2 Bacterial pathogens associated with the dairy industry .............................................. 1
1.3 Mastitis and Klebsiella species ................................................................................... 2
1.3.1 K. pneumoniae transmission and diagnosis ......................................................... 4
1.3.2 Economic impact of CM ...................................................................................... 5
1.3.3 Pathogenesis and pathology ................................................................................. 6
1.3.4 Diagnostic and molecular tools for research on Klebsiella spp. associated with
CM………………………………………………………………………………………..6
1.3.5 Drugs used for the treatment of CM .................................................................... 8
1.4 Map and JD ................................................................................................................. 9
1.4.1 Map transmission ............................................................................................... 10
1.4.2 Cell structure and metabolism ........................................................................... 11
1.4.3 Pathogenesis and pathology ............................................................................... 12
1.4.4 Diagnosis............................................................................................................ 13
1.4.5 Molecular tools used for diagnosis and research ............................................... 16
1.4.6 Epidemiological aspects of Map ........................................................................ 17
1.4.7 Strain typing method for analyzing Map strain diversity .................................. 18
1.4.8 Map and CD ....................................................................................................... 20
![Page 6: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/6.jpg)
v
1.5 Purpose of thesis........................................................................................................ 21
1.6 References ................................................................................................................. 22
Chapter 2: Klebsiella species associated with bovine mastitis in Newfoundland ................... 35
Co-authorship statement ....................................................................................................... 35
Abstract ................................................................................................................................ 36
2.1 Introduction ............................................................................................................... 37
2.2 Materials and Methods .............................................................................................. 39
2.2.1 Ethics statement ................................................................................................. 39
2.2.2 Standard phenotypic/biochemical testing for pathogen identification ............... 39
2.2.3 Antibiotic susceptibility testing ......................................................................... 40
2.2.4 Genotyping of isolates ....................................................................................... 41
2.3 Results and Discussion .............................................................................................. 42
2.3.1 Identification of K. pneumoniae and other isolates ........................................... 42
2.3.2 Molecular typing by RAPD analysis ................................................................. 43
2.3.3 Antimicrobial activity and resistance profile ..................................................... 44
2.3.4 Conclusion ......................................................................................................... 45
2.4 References ................................................................................................................. 47
Chapter 3: Typing of Mycobacterium avium subspecies paratuberculosis isolates
from Newfoundland using fragment analysis .......................................................................... 62
Co-authorship statement ....................................................................................................... 62
Abstract ................................................................................................................................ 63
3.1 Introduction ............................................................................................................... 64
3.2 Materials and Methods .............................................................................................. 67
3.2.1 Ethics statement ................................................................................................. 67
3.2.2 Media, reagents and culture conditions ............................................................. 67
3.2.3 Chromosomal DNA isolation, SSR sequencing and fragment analysis ............ 68
![Page 7: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/7.jpg)
vi
3.3 Results and Discussion .............................................................................................. 71
3.3.1 Fragment analysis on Map isolates .................................................................... 71
3.3.2 Comparison with other epidemiological data .................................................... 73
3.3.3 Conclusions ........................................................................................................ 73
3.4 References ................................................................................................................. 75
Chapter 4: Summary ................................................................................................................ 86
4.1 K. pneumoniae ........................................................................................................... 86
4.2 Map............................................................................................................................ 87
4.3 Conclusion ................................................................................................................. 88
4.4 References ................................................................................................................. 89
Appendix A: Sequence analysis of 4 SSR loci for multiple standards used in Map
strain determination ................................................................................................................. 90
![Page 8: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/8.jpg)
vii
List of Tables
Table 1.3.5.1: Brief description of antibiotics used for treating CM cases in
Newfoundland. ............................................................................................................ 34
Table 2.3.1.1: Details of genus and species level identification of 45 coliform isolates
obtained from milk samples from 11 Newfoundland dairy farms using the different
identification methods described in the current study. ............................................... 50
Table 2.3.1.2: Results of tests using K. variicola isolates for their ability to
metabolize select carbohydrates including adonitol, using the API 50 CHE kit after 24
hours of incubation (bioMérieux, Inc.). ...................................................................... 53
Table 2.3.3.1: Details regarding animal/farm ID, sample collection date, infected
quarters sampled and California Mastitis Test (CMT) results.. .................................. 58
Table 3.2.2.1: Details of 18 animals from Newfoundland regarding assigned
identification numbers (IDs) and status of the animal from which the primary Trek-
ESP II liquid cultures were derived. ........................................................................... 78
Table 3.2.3.1: Fragment analysis results for the 4 SSR loci of all 88 Map isolates
derived from 18 Newfoundland animals.. ................................................................... 79
Table 3.3.1.1: Details of the 44 Map SSR-types that were isolated from five
Newfoundland farms in the current study and were analyzed using fragment analysis.
..................................................................................................................................... 82
![Page 9: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/9.jpg)
viii
List of Figures
Figure 2.3.1.1: Phylogenetic tree derived from the rpoB partial gene sequences of all
45 isolates built using the neighbour joining method in the Molecular Evolutionary
Genetic Analysis (MEGA) package (version 6.06).. .................................................. 52
Figure 2.3.2.1: Molecular epidemiology of CM associated coliform bacteria isolated
over a one year period from 11 dairy herds in Newfoundland.. ................................. 57
Figure 3.3.2.1: Dendrogram representing the genetic relationship between all Map
isolates based on the 4 SSRs loci used in the analysis.. .............................................. 84
Figure 3.3.2.2: Minimum spanning tree (MST) based on the SSR profiles of the 4 loci
for all 44 SSR-types identified in the current study.. .................................................. 85
![Page 10: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/10.jpg)
ix
List of Abbreviations and Symbols
Acronyms that are used commonly in molecular biology are not included in
this list.
AFLP Amplified fragment length polymorphism
CD Crohn‘s disease
CLSI Clinical and Laboratory Standards Institute
CM Clinical mastitis
CMT California mastitis test
DTP Days to positive (for detecting Map growth in cultures)
ELISA Enzyme-linked immunosorbent assay
FAM Fluorescein amidite
gyrA DNA gyrase subunit A
IMViC Indole-Methyl red- Voges-Proskauer-Citrate
JD Johne‘s disease
LJ Lowenstein-Jensen medium
MALDI-TOF Matrix-assisted laser desorption/ionization-time of flight
Map Mycobacterium avium subsp. paratuberculosis
MLST Multilocus sequence typing
MST Minimum spanning tree
NL Newfoundland and Labrador
parC Subunit of topoisomerase IV
PCR Polymerase chain reaction
PFGE Pulsed-field gel electrophoresis
RAPD Random amplified polymorphic DNA
rpoB Beta subunit of RNA polymerase
SCC Somatic cell count
SSR Short sequence repeat
TCAG The Centre for Applied Genomics
TMP-sulfa Trimethoprim sulfamethoxazole
UPEI University of Prince Edward Island
VNTR Variable number tandem repeat
![Page 11: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/11.jpg)
x
List of Appendices
Figure A.1: Sequence analysis of multiple standards (S1, S2 and S3) based on the 4
SSR loci used in the present study…...........................................................................95
![Page 12: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/12.jpg)
1
Chapter 1: General Introduction
1.1 The importance of the dairy industry in Newfoundland
The dairy industry, which includes dairy farms and dairy processing plants, is
a major contributor to the economy. Dairy farms are involved in the production of
raw milk, whereas dairy processing plants produce a variety of dairy products (such
as processed milk, cheese, butter, yogurt, ice cream, etc.). Based on farm cash
receipts, the dairy industry ranks third in the Canadian agriculture sector with
Newfoundland and Labrador (NL) having the fewest number of dairy farms of all the
provinces [1]. Although Quebec and Ontario are the major dairy producing provinces
in Canada, NL has the highest number of dairy cows per individual farm and some of
the largest farms in the country [1]. The close contact between large numbers of
animals within dairy farms can make them prone to the spread of infectious diseases,
which can cause substantial financial losses to the agricultural industry. Knowledge
regarding the causative agents of these diseases can help implement better prevention
and control programs, which can help to control and reduce disease occurrence.
1.2 Bacterial pathogens associated with the dairy industry
In addition to fungal, parasitic and viral agents, many diseases associated with
bovine dairy animals are caused by bacterial pathogens from the genera
Staphylococcus, Streptococcus, Escherichia, Corynebacterium, Klebsiella,
Pseudomonas, Mycobacterium and Mycoplasma, to name a few [2-4]. Differences in
herd management practices, environmental factors and host animal immune status can
contribute to an increase in the occurrence of bacterial diseases [5]. Furthermore,
![Page 13: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/13.jpg)
2
some diseases that infect dairy animals are zoonotic in nature and can therefore be
transmitted to humans [6], highlighting the importance of understanding them better.
The work described in this thesis will focus on two bacterial pathogens affecting
dairy animals: (i) Klebsiella species, one of the causative agents of environmental
clinical mastitis (CM, cases where the cow displays definitive symptoms of
inflammation of the mammary glands and udder tissue) and (ii) Mycobacterium
avium subspecies paratuberculosis (Map), which causes Johne‘s disease (JD), a
contagious bacterial disease of the intestine which is associated with inflammation.
1.3 Mastitis and Klebsiella species
Mastitis in dairy animals is caused by a number of microorganisms, with the
major ones being Streptococcus uberis, Staphylococcus aureus and E. coli [7]. Other
pathogens include Streptococcus agalactiae, Streptococcus dysgalactiae,
Corynebacterium bovis, Mycoplasma spp.,other Staphylococcus spp., Klebsiella spp.,
Citrobactor spp., Enterobacter spp., Pseudomonas aeruginosa, Pasteurella spp. and
Bacillus spp. [7]. Sometimes fungi, yeasts and molds are also present in the infected
tissues [7]. Major and minor pathogens can be distinguished by the difference in
somatic cell counts (SCCs, such as white blood cells) and clinical signs such as
reduced milk production and occasionally by animal mortality [5]. It has been
reported that reduction in milk production depends on the specific pathogen causing
CM, and that Gram negative bacteria are responsible for greater losses than Gram
positive bacteria and other microorganisms [8,9]. Presently, K. pneumoniae is
emerging as a pathogen of concern associated with veterinary and human medicine
![Page 14: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/14.jpg)
3
due to its ability to acquire and disseminate antibiotic resistance capabilities [10,11].
In a previous study, CM caused by Klebsiella spp. was responsible for significant
reduction in milk yields in multiparous animals (animals having experienced more
than one parturition) [12]. Therefore, precise knowledge of the infectious agent is
important for making decisions regarding treatment and control of the disease.
Mastitis-causing pathogens can spread either from one animal to another
(classified as contagious pathogens), or can be acquired from the environment
(classified as environmental pathogens, which includes K. pneumoniae) such as
animal bedding, manure and soil [13,14]. Contagious pathogens are usually present
on the udder and teats, and are transferred from infected to uninfected animals during
milking by the equipment or the handler. Environmental pathogens differ from
contagious pathogens as they do not normally adhere to the udder or the teats [7].
Animals infected with environmental pathogens usually have lower SCCs as
compared to those infected by contagious pathogens [15].
Klebsiella are rod-shaped Gram negative facultative anaerobes [16]. K.
pneumoniae and K. oxytoca are closely related opportunistic pathogens [7] which are
usually shed in the feces and milk of infected cows [10,17]. Generally cows with
mastitis (especially Klebsiella associated mastitis) do not regain their full milk
production levels post recovery, which leads to considerable economic losses [18].
Animals with Klebsiella associated mastitis are more likely to undergo mortality or to
be culled as compared to animals with other types of mastitis [14,16,19]. Vaccination
decreases the severity and occurrence of the clinical cases of coliform mastitis, but it
cannot reduce the total number of new CM cases caused by Klebsiella spp. [14,20].
![Page 15: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/15.jpg)
4
Therefore, it is important to know the source of the mastitis infection (as it can infect
both lactating and dry cows) for effective prevention or control programs.
1.3.1 K. pneumoniae transmission and diagnosis
In the majority of cases, signs of CM include abnormal milk (flakes, clots and
watery milk) and udder swelling [7]. Animals can also have a fever and display other
symptoms which include lack of appetite, sunken eyes, diarrhea, dehydration and
reduction in mobility [7]. There are also subclinical cases where the milk appears
normal and animals have no clinical signs of mastitis. These subclinical cases can be
a source of infection where transmission happens largely through fecal shedding [21].
CM is usually diagnosed through cultures of milk samples [10] as fecal shedding is
not associated with active/clinical infections [14]. Major outbreaks of CM have been
reported from numerous countries, mostly within the initial two weeks of lactation in
animals [22]. These infections were linked to environmentally contaminated wood
shavings or sawdust used in bedding and stalls [14]. In the environment, K.
pneumoniae can survive as an endophyte (an organism that lives within a plant
without causing any apparent disease) of wheat, corn and alfalfa, and aids in nitrogen
fixation. Consequently, plant parts that are consumed by animals can be a source of
infection even in the absence of contaminating animal feces [14]. Therefore, K.
pneumoniae can be acquired by animals through crops used for feed, or by fecal
contamination of the environment.
![Page 16: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/16.jpg)
5
1.3.2 Economic impact of CM
Worldwide economic losses due to mastitis are immense, though actual losses
vary from country to country [23]. The presence of animals with CM on Canadian
dairy farms, especially lactating animals, is of major concern to the dairy industry.
The deteriorating physical condition of infected animals and the decrease in milk
quality and production levels cause significant economic losses to farmers and the
dairy industry [7]. Other factors influencing financial losses are medication expenses,
removal of contaminated bulk milk, culling and replacement of infected cattle and
penalties for not meeting milk quality standards [7,24,25]. This has a huge impact not
only on the dairy farmers, but also on consumers [23].
In Canada, S. aureus is the main cause of contagious CM, whereas Klebsiella
associated environmental CM is not as prevalent [26]. However, when compared to
other Gram negative pathogens such as E coli, mastitis caused by Klebsiella spp. is
responsible for greater losses due to reduced milk production and longer periods of
infection [16]. According to a previous report on Canadian dairy farms, CM caused
by Klebsiella spp. occurs more frequently in animals housed in free stalls as
compared to those housed in tie-stalls (animal tied in by a neck-chain) [27].
Therefore, farm practices can play an important role in the prevalence of diseases
caused by particular pathogens, highlighting the importance of identifying an agent
and its source.
![Page 17: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/17.jpg)
6
1.3.3 Pathogenesis and pathology
Diverse groups of bacteria can cause CM, which include different or multiple
isolates within the same species. The teat canals of dairy animals have physical and
chemical barriers that inhibit the entrance of pathogens, but become vulnerable during
calving and lactation [7,28]. During this period, CM causing pathogens release toxins
that are recognized by the host immune system, which in response recruit more
specialized immune cells to the site of the infection to combat the invading bacteria,
causing inflammation and reduced milk production [7,28]. This leads to the
manifestation of noticeable signs characteristic of CM, such as the reddening of the
udder and the production of milk with watery appearance, which sometimes contains
clots and flakes [7,28]. In subclinical mastitis, there are no visible changes in the milk
or the udder, despite having inflammation in the mammary glands, and in cases of
chronic mastitis, inflammation progression can continue for months and may persist
from one lactation period to another [7].
1.3.4 Diagnostic and molecular tools for research on Klebsiella spp. associated
with CM
To reduce the cost of mastitis treatment, early and accurate detection of the
pathogen is very important. Assays used for CM diagnosis and pathogen
identification include measurement of SCCs in milk, immunoassays, multiplex
polymerase chain reaction (PCR), quantitative PCR, culture based tests, mass
spectroscopy based identification of the pathogen, electrical conductivity tests and
infra-red thermography of milk [7,28], most of which are expensive and labour
![Page 18: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/18.jpg)
7
intensive. Currently, culture based techniques, along with biochemical tests, are
considered the gold standard methods to detect mastitis-causing pathogens, but the
search for more robust methods continues.
Although molecular detection techniques are more complex and cumbersome
than culture based methods due to the involved equipment, protocols and reagents, in
many instances they provide faster and more accurate results. Numerous nucleic acid
sequence based testing methods such as multiplex PCR and quantitative PCR have
been developed for the detection of mastitis pathogens in milk [7,29], which are more
sensitive and faster than other diagnostic/molecular tools. Moreover, quantitative
multiplex PCR can detect up to 11 bovine mastitis pathogens within a few hours [30].
In addition, sequencing of the 16S rRNA, rpoB (beta subunit of RNA polymerase)
and other genes is commonly used to identify/type bacteria, mainly for research
purposes [19,31,32]. Nucleic acid sequence based amplification assays are being
perfected using information available from the whole genome sequences of
pathogenic bacteria, as they have the capability to distinguish between dead, spore-
forming, dormant and actively growing microorganisms in milk in a short period
[28,33].
Despite the prevalence of Klebsiella mastitis (CM caused by Klebsiella spp.
only) in dairy cattle [19], information regarding the transmission and molecular
diversity of the pathogen is still insufficient for successful control programs [34].
Molecular typing methods can differentiate strains and are able to track the
transmission of isolates between and within farms. Genotyping techniques for
Klebsiella spp. include pulsed-field gel electrophoresis (PFGE), random amplified
![Page 19: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/19.jpg)
8
polymorphic DNA (RAPD) analysis, repetitive DNA sequence PCR, ribotyping,
multilocus sequence typing (MLST), gyrA (DNA gyrase subunit A) and parC
(subunit of topoisomerase IV) gene sequencing and amplified fragment length
polymorphism (AFLP) analysis [31,32,35,36]. These methods can enhance the
discriminatory power for molecular typing analysis to provide deeper insight into
strain prevalence and relatedness.
1.3.5 Drugs used for the treatment of CM
At present, the following 11 drugs are used for treating CM caused by Gram
negative and Gram positive bacteria: oxytetracycline, trimethoprim-sulphadoxine,
ceftiofur, cephapirin, erythromycin, pirlimycin, procaine, penicillin G, streptomycin,
novobiocin, polymyxin B and cortisone [37]. Tetracycline (41%), cephalosporin
(78%) and most importantly penicillin (86%) are the most frequently used antibiotics
for CM treatment in dairy farms [7]. Trimethoprim sulfa or tetracycline is widely
used for treating calves, whereas ceftiofur (80%), tetracycline (31%) and penicillin
(32%) are used for adult cows [7,38]. In addition, cephalothin, ceftiofur, pirlimycin,
novobiocin, streptomycin, tetracycline, trimethoprim sulfamethoxazole or TMP-sulfa
are used for the treatment of CM cases in Newfoundland (Table 1.3.5.1) (Animal
Health Laboratory, Animal Health Division, Department of Natural Resources,
Newfoundland and Labrador, Canada).
Treatment of CM caused by Klebsiella spp. has a lower rate of success when
compared to infections caused by Gram positive pathogens [16]. Schukken et al.
(2011) reported that a third generation cephalosporin (ceftiofur hydrochloride) was
![Page 20: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/20.jpg)
9
successful in treating uncomplicated cases of Klebsiella associated CM in dairy
animals [38]. However, the majority of studies regarding antibiotic treatment
outcomes on Klebsiella mastitis demonstrated the inadequate effectiveness of
standard drug regimens [16]. Therefore, it is important to ensure that antibiotic
resistance does not arise for any agents showing even low to moderate levels of
efficacy; otherwise even the slightest hopes of treatment possibilities would be lost.
1.4 Map and JD
Map is the etiological agent of JD, which is associated with chronic
inflammation of the small intestine of cattle, sheep, goats, farmed deer and other
ruminants [39-44]. Map is an acid-fast, intracellular pathogenic bacterium [45], and
requires specific conditions for replication in vitro. However, Map can survive in a
dormant or non-replicating state under unfavorable conditions as well, which creates
severe problems for eradicating Map from herds with JD [46]. JD shares some
clinical and pathological features with human Crohn‘s disease (CD), making JD a
cause for public concern [47]. In addition, Map has also been isolated from some, but
not all patients with CD [48,49], HIV-AIDS [50-53] and type 1 diabetics [54],
causing some concern regarding its association with humans having abnormal
immune systems. Therefore, JD has become a major topic of discussion within the
agricultural industry due to the potential link between Map and public health [43].
JD causes reduced milk production in dairy animals, and severe cases can lead
to premature culling [55]. Owing to the economic impact of Map on the dairy
industry, it has been studied extensively [56-58]. In Canada, the assessed yearly
![Page 21: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/21.jpg)
10
losses caused by JD are CDN$ 15 million nationwide, and CDN$ 0.84 million for
Canadian Maritime Provinces [59]. However, actual losses can be underestimated due
to the lack of proper identification/diagnosis of infected animals and the absence of
clinical symptoms in many infected animals [59]. In addition, there is no report
regarding economic losses caused due to JD in NL to date.
1.4.1 Map transmission
Map transmission can occur through contaminated soil (such as pastures),
contaminated water and infected animal feces. Map can survive for more than two
years in the soil due to dormancy, which is responsible for bacterial survival under
unfavorable conditions until the bacteria is taken up by a susceptible host [46]. The
main animal to animal transmission pathways for Map are the fecal-oral route [60],
consumption of infected milk by calves [61], transmission during birth and/or
exposure to an infected animal [60,62]. Some epidemiological studies suggested that
transmission of Map occurs early in a calf‘s life [60]. Young calves are more
susceptible to infections than the adults, as adults require a substantial amount of
bacterial load in order to become infected [43,61]. Calf management has been
proposed for farm level Map eradication [63], but this was shown to be unsuccessful
due to the other routes of transmission. Bioaerosols have also been suggested as a
transmission route [64], as dust containing Map can be ingested and inhaled by
animals leading to infection and spread of the disease [62,65]. Map spreads between
and across species with no constraints, making it difficult to control. Moreover, wild
animals can act as reservoirs and may transfer the bacteria to and between farms [66].
![Page 22: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/22.jpg)
11
Waterborne Map is also known to be a source of infection and there are some reports
where large quantities of Map were washed into the rivers from farm lands in the
Midwest United States, which then reached some provinces of Canada (Manitoba,
Saskatchewan and Alberta) [67]. Therefore, it is important to investigate the source of
Map and its transmission in order to devise effective control programs.
1.4.2 Cell structure and metabolism
Mycobacterial species usually produce a secreted lipophilic siderophore called
mycobactin, which is involved in the binding of extracellular iron for transport into
the cell [68]. Iron is an essential nutrient for growth, and Map is unique amongst the
mycobacteria because it is not capable of producing mycobactin [69,70]. In vivo,
infected host macrophages usually provide the iron necessary for Map growth and
replication, but mycobactin is essential for culturing Map under in vitro conditions
[71]. However, the requirement for mycobactin can differ based on the media used
for culture purposes. In a previous study, isolates collected from clinical cases of
sheep paratuberculosis required mycobactin for growth on a Lowenstein-Jensen (LJ)
medium, but the same Map isolates did not require mycobactin when cultured on
Middlebrook 7H11 agar [72]. The reason for the differences in mycobactin
requirement might be due to strain variation or specific components present in the
different media [71,73]. Map is also unable to use iron and multiply in soil or water
environments [46,61].
Similar to other mycobacteria, the cell wall of Map has a highly impermeable
lipid rich barrier comprised of mycolic acids, which enables it to survive extreme
![Page 23: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/23.jpg)
12
environmental conditions [74]. In addition, the cell wall enables Map to escape from
host defenses and to survive within the phagosome of the host cell for up to two
weeks [45]. In bovine macrophages, Map cell wall components modulate host
responses for bacterial survival, such as intracellular multiplication and initiation of
pathogenesis [45,75]. Up to 60% of the Map cell wall is comprised of complex lipids,
due to which it exhibits the following properties: acid-fastness, increased
lipophilicity, and resistance to a number of adverse conditions/reagents (low pH,
ultraviolet light, high temperature, pasteurization, certain chemicals, hydrophilic
antibiotics, etc.) [61,75]. The growth rate of Map is one of the slowest of all
mycobacteria, which is partly attributed to the thick hydrophobic cell wall that acts as
a barrier for the flow of nutrients [74]. The cell wall characteristics of Map along with
its metabolism are important factors in diagnosis and for cultivating the bacterium.
1.4.3 Pathogenesis and pathology
Macrophages have the capability to kill a wide range of bacterial pathogens.
Map can avoid this killing activity, and can grow and replicate inside macrophages
[61]. This phenomenon is not only due to the chemically distinct cell wall of Map, but
is also attributed to effector molecules secreted by the pathogen that neutralize the
antibacterial chemicals produced by macrophages, thereby suppressing immune
reactions [76,77]. Therefore, pathology and host cell dysfunction due to Map occurs
because of the direct action of bacterial products combined with the host‘s immune
response to the pathogen.
![Page 24: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/24.jpg)
13
JD development can be divided into four stages: silent infection, subclinical,
clinical and advanced clinical disease [55]. Following ingestion, Map initially
establishes itself in the lymphoid tissue of the gastrointestinal tract of the animal
(silent infection) [45]. Clinical signs and symptoms of the disease will not be
noticeable during the initial years following infection, which can take up to ten years
[47]. During this time, some of the Map cells are engulfed by macrophages, which
initiate immune reactions such as lymphocyte instigation and clonal proliferation
(subclinical stage). In subclinical cases, infected cows shed Map without exhibiting
any clinical signs of the disease [43,57]. In addition, certain animals may never
display any clinical signs of JD due to the host‘s immune system, such that they
remain undetected and continue to infect other animals in the same herd [55,78].
After the initial immune response, infected animals start to display signs of the
disease (clinical stage) [55], which include diarrhea, weight loss, decline in milk
production and fatigue [3,43,79]. During this period the intestinal wall thickens due to
inflammation, and after some time intestinal cells stop functioning, leading to
malabsorption and enteropathy (advanced clinical stage) [61]. The pathology of JD
can provide information about the infected animal‘s disease history and status, which
when combined with analysis of Map isolates can provide a clearer picture on the
molecular epidemiology of the disease.
1.4.4 Diagnosis
As for any infectious disease, prompt and proper diagnosis is necessary for the
early detection and treatment of infected animals to prevent culling, along with the
![Page 25: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/25.jpg)
14
spread of JD. Diagnosis has been proven to be more successful when an entire herd is
examined rather than screening only suspected infected animals [43]. Unfortunately,
tests for inspecting an entire herd are costly, laborious and time consuming [47,80],
and vaccination can only reduce the rate of disease spread and not prevent JD
occurrence [61,67]. There are a number of test methods available for diagnosing JD,
such as: histopathology, microscopy, culture, PCR, agar gel immune-diffusion,
enzyme-linked immunosorbent assay (ELISA), complement fixation test, delayed-
type hypersensitivity and gamma interferon release assay [59,81-87].
Microscopy can be performed on fecal matter, fecal culture, and intestinal
mucosal smears after Ziehl-Neelsen staining [88]. However, microscopy cannot
distinguish Map from other mycobacterial species since all of them have acid-fast
properties. In addition, specific sample smears on a slide might not contain Map at
detectable levels. So, microscopy is not useful for confirmation of a negative case
based upon a single fecal sample.
Cultivation of Map from a live animal specimen is considered ‗the gold
standard‘ for diagnosis [88, 89]. Although Map requires a long time to grow in
culture media and is prone to contamination, culture results provide 100% specificity
and are regarded as the ‗definitive diagnosis of infection‘ [88]. The true infection
status of an individual animal can be determined through culturing multiple (up to
100 sites) samples of intestinal tissue [90]. Fecal culture is the best non-invasive and
most inexpensive diagnostic method for JD, but the rate of detecting Map in feces
from infected animals is not consistent [84]. When successful, fecal culture can detect
all the four stages of disease progression in an infected animal [88].
![Page 26: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/26.jpg)
15
Since fecal samples contain many microorganisms in addition to Map, they
require special treatments to enrich Map and to prevent the growth of contaminating
microorganisms during subsequent culturing. There are two main methods for sample
decontamination before Map culture: the first method uses oxalic acid combined with
sodium hydroxide, and the second method uses hexadecylpyridinium chloride [88].
Increasing treatment times during the decontamination process can prevent the
growth of unwanted bacteria and fungi, but it may also interfere with the subsequent
growth of Map [91,92].
Previous studies have suggested that certain media might be better suited for
cultivating and isolating colonies of Map. Various types of liquid, egg-based, and
agar-based culture media have been used for Map cultivation, some of which include:
Herrold‘s egg yolk medium, LJ medium, Middlebrook 7H9 broth, Middlebrook 7H10
agar, Middlebrook 7H11 agar, liquid BACTECTM
12B or Middlebrook 7H12
supplemented with egg yolk, Trek-ESP II liquid culture, Kirchner liquid medium,
Dubos Broth-base medium, Sauton‘s liquid medium, and the Proskauer and Beck
liquid medium [53,71,90,93,94]. On solid media, small colonies of Map become
visible after two to six months and liquid cultures show growth within 3-6 weeks,
when incubated at the optimal temperature (37°C) and under aerobic conditions
[3,75,88], although the time required for the appearance of isolated colonies varies
according to media and the specific isolate [71]. As mentioned previously, Map
generally requires exogenous mycobactin such as mycobactin J for growth in culture
medium. However, Map sub-cultures can grow in a medium that has no mycobactin
added because of iron carry-over from the primary culture [71,88]. For selective
![Page 27: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/27.jpg)
16
growth of mycobacteria, media supplements, such as oleic acid, albumin, dextrose
and catalase (OADC or ADC) are added to the medium, along with glycerol.
Contamination can be reduced by adding antimicrobial agents, such as polymyxin B,
amphotericin B, carbenicillin, trimethoprim lactate, nalidixic acid and azlocillin, to
the media [53]. The addition of detergents such as Tween 80 helps to prevent the
clumping of Map cells in liquid cultures so that dispersed growth can be attained [53].
Liquid supplements, such as sodium pyruvate that can function as a source of energy
and protects against toxic hydrogen peroxide, can have beneficial effects, but they can
also inhibit the growth of some Map strains [71,95]. Therefore, the proper selection of
growth media and supplements is crucial for successful Map cultivation in the
laboratory.
1.4.5 Molecular tools used for diagnosis and research
IS900, an insertion sequence (transposable DNA fragment) specific for Map,
is used as the target for PCR amplification to identify Map in milk and fecal samples
from infected animals [88,96]. Additional insertion sequences which are specific for
Map include: IS1311, ISMav2, f57 and ISMap02 [88,97,98]. However, IS900 is
commonly used as it can be easily detected due to the presence of 17 copies of the
sequence per Map cell [99]. PCR provides more rapid results when compared to most
other diagnostic assays, but it has lower sensitivity as compared to fecal culture due
to the presence of PCR inhibitors and low template DNA yields from samples
[55,100,101]. Therefore, IS900 PCR is commonly used for Map detection and
![Page 28: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/28.jpg)
17
identification in Canada in combination with culture [55]. Quantitative PCR has also
been reported to perform well for detecting Map from environmental sources [102].
The selection of appropriate sample collection, processing and DNA
extraction procedures are important factors when conducting PCR on samples from
animals infected with Map [102]. There are a number of methods for extracting high
quality DNA from Map to conduct PCR, which include rapid lysis, organic
extraction, silica particle-based and magnetic particle-based technologies [101]. The
particle-based technologies give better yields and higher quality Map DNA in a short
period of time for PCR analysis [101]. In addition, homogenization of samples by
bead-beating prior to DNA extraction improved PCR performance [43], a factor that
will be considered while performing the analysis described in chapter three of this
thesis.
1.4.6 Epidemiological aspects of Map
Studying the epidemiology of JD is extremely important due to the financial
losses caused by the disease [49,101,103] and the probable association between Map
and CD in humans [3,104,105]. In a number of studies, viable Map was detected in
certain dairy products such as pasteurized milk and cheese [106,107], which could
have implications on the health of consumers [49,108]. Molecular techniques have
been developed and applied to understand the transmission of Map and for identifying
predominant strains [3,99]. In many dairy herds, distinct strains of Map were found to
cause JD in different animals [3], but there are also reports where single or related
strains were responsible for infections [43]. Therefore, to implement successful
![Page 29: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/29.jpg)
18
control programs, it is necessary to find the source of the strain(s) in question. It is
important to determine whether the detected cases of JD are due to new infections
(acquired by introducing subclinically infected animal from another herd), or if the
responsible strain type was already present in that herd (infected resident animal or
environmental contamination) [43]. Therefore, there is value in conducting molecular
epidemiological studies on Map.
1.4.7 Strain typing method for analyzing Map strain diversity
Phenotypic diversity is described based on the culture characteristics (colour/
pigmentation duration of growth) of Map strains. Map strains have been divided into
two categories: sheep and cattle types [109,110]. Colonies of the sheep-types are
pigmented and slow growing, whereas cattle-types are non-pigmented and fast
growing [71]. Moreover, sheep-type strains are harder to cultivate than the cattle-
types strains [71]. Standard tests such as ELISA cannot discriminate between Map
isolates collected from different hosts [109], which requires more detailed molecular
analysis.
Various molecular techniques are currently able to identify different Map
strain-types with high confidence. Map epidemiological studies have been
significantly impacted by genotyping techniques such as: restriction fragment length
polymorphism, PFGE, multiplex PCR for IS900 loci, representational differentiating
analysis (RDA)-PCR and PCR-restriction endonuclease analysis (PCR-REA) [109].
These methods can successfully differentiate between Map isolates belonging to the
sheep- and cattle-type strains [109]. One caveat is that the above mentioned
![Page 30: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/30.jpg)
19
molecular genotyping techniques are not capable of further resolving Map isolates
into subgroups, because of limited variations in the genomes of different Map isolates
[3]. More detailed methods used for further subtyping isolates include: variable
number tandem repeat (VNTR) analysis, large sequence polymorphism typing, single
nucleotide polymorphism typing, short sequence repeat (SSR) sequencing,
mycobacterial interspersed repetitive unit (MIRU) analysis and matrix-assisted laser
desorption/ionization-time of flight (MALDI-TOF) mass spectrometry
[3,99,111,112]. These tools are useful for analyzing Map isolates from different
geographical locations for analyzing isolates sources and dispersal patterns [109], and
also for differentiating between the different strain types (sheep vs. cattle) [113].
At present, sequencing of multiple SSRs (short repeating sequence of DNA) is
widely used for genotyping Map isolates [99]. There are 11 physically distinct SSR
loci present in the Map genome [3]. Among them, four SSR loci are highly
polymorphic but stable, making them good candidates for typing Map isolates
[3,50,114]. Determining the sequences of the four loci enables discrimination
between different Map isolates by assigning a specific SSR combination to each
isolate. Therefore, the development of SSR worldwide databases for analyzing
molecular diversity of Map isolates is possible through the use of this method. The
main disadvantage of multilocus SSR sequencing is the inaccurate assigning of Map
genotypes due to problems associated with determining the DNA sequences of
repeats using conventional methods [3]. However, this problem can be sometimes
overcome by repeating the sequencing multiple times or by sequencing both the DNA
strands [3]. Another cost effective method of genotyping Map isolates is to perform
![Page 31: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/31.jpg)
20
fragment analysis using instrumentation that has single nucleotide resolution
capability on target SSR regions instead of sequencing [115, 116]. This makes
fragment analysis a reliable method for accurately determining the sizes of the DNA
fragments, which in turn enables the calculation of the exact lengths of the SSRs that
they contain [116]. Therefore, SSR analysis using different molecular methods can
effectively provide valuable information regarding the source of infection, host
specificity, and inter-/intra-species transmission capabilities [3,43,50,114,117-119].
1.4.8 Map and CD
CD occurs due to abnormal immune responses within the gastrointestinal
mucosa in humans [120]. Previous studies have reported similarities between the
pathologies of CD and JD, including the presence of Map in breast milk [121] and
intestinal tissues of some CD patients [122]. In spite of pathological similarities
between the two diseases and similar responses to anti-microbial drugs in animals
with JD and humans with CD, argument regarding the association of Map with CD
still exists [120]. In previous sections, the risk of humans acquiring Map from animal
products has been discussed, but further research for substantiating transmission
through dairy products is warranted as there is a possibility that Map is zoonotic in
nature [123]. Collaborative multidisciplinary endeavors can further facilitate
epidemiological studies regarding the association between these two intestinal
diseases [123].
![Page 32: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/32.jpg)
21
1.5 Purpose of thesis
The purpose of the research conducted here was to evaluate fast, reliable and
inexpensive molecular methods for typing bacterial pathogens associated with the
dairy industry. Different methods were used for sub-typing K. pneumoniae and Map
isolates, the two pathogens that are the focus of the described work. Through the use
of these molecular tools, information was gathered for investigating the molecular
diversity of the two pathogens from the island of Newfoundland, which has not been
reported previously.
![Page 33: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/33.jpg)
22
1.6 References
1. Canadian Dairy Information Centre (2014). Dairy Facts and Figures. The Farm.
Number of Farms, Dairy Cows and Heifers. Government of Canada.
Available: http://www.dairyinfo.gc.ca. Accessed 3 January 2015.
2. Paul I, Ganguly S (2014) Molecular Detection of Etiology Causing Mastitis, a
Bacterial Infection of Cattle Udder: A Review. Int J Rec Biotech 2: 33-34.
3. Amonsin A, Li LL, Zhang Q, Bannantine JP, Motiwala AS, et al. (2004)
Multilocus short sequence repeat sequencing approach for differentiating
among Mycobacterium avium subsp. paratuberculosis strains. J Clin
Microbiol 42: 1694-1702.
4. Thacker TC, Harris B, Palmer MV, Waters WR (2011) Improved specificity for
detection of Mycobacterium bovis in fresh tissues using IS6110 real-time
PCR. BMC Vet Res 7: 50. Available: http://www.biomedcentral.com/1746-
6148/7/50. Accessed 3 January 2015.
5. Leelahapongsathon K, Schukken YH, Suriyasathaporn W (2014) Quarter, cow, and
farm risk factors for intramammary infections with major pathogens relative
to minor pathogens in Thai dairy cows. Trop Anim Health Prod 46: 1067-
1078.
6. Bannantine JP, Li L, Mwangi M, Cote R, Garay JAR, et al. (2014) Complete
genome sequence of Mycobacterium avium subsp. paratuberculosis,
isolated from human breast milk. Genome Announc 2: e01252-01213.
7. Awale MM, Dudhatra GB, Kumar A, Chauhan BN, Kamani DR, et al. (2012)
Bovine Mastitis: A Threat to Economy. Open Access Scientific Reports 1:
295. Available: http://omicsonline.org. Accessed 3 January 2015.
8. Schukken YH, Hertl J, Bar D, Bennett GJ, González RN, et al. (2009) Effects of
repeated gram-positive and gram-negative clinical mastitis episodes on milk
yield loss in Holstein dairy cows. J Dairy Sci 92: 3091-3105.
9. Gogoi SM, Mehtaz S, Saikia G, Das M (2014) Isolation of Candida Species from
Market Milk Samples. Sch Acad J Biosci 2: 202-204.
10. Ohnishi M, Okatani AT, Harada K, Sawada T, Marumo K, et al. (2013) Genetic
Characteristics of CTX-M-Type Extended-Spectrum-β-Lactamase (ESBL)-
Producing Enterobacteriaceae Involved in Mastitis Cases on Japanese Dairy
Farms, 2007 to 2011. J Clin Microbiol 51: 3117-3122.
![Page 34: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/34.jpg)
23
11. Leavitt A, Carmeli Y, Chmelnitsky I, Goren MG, Ofek I, et al. (2010) Molecular
epidemiology, sequence types, and plasmid analyses of KPC-producing
Klebsiella pneumoniae strains in Israel. Antimicrob Agents Chemother 54:
3002-3006.
12. Hertl JA, Schukken YH, Welcome FL, Tauer LW, Gröhn YT (2014) Pathogen-
specific effects on milk yield in repeated clinical mastitis episodes in
Holstein dairy cows. J Dairy Sci 97: 1465-1480.
13. Schreiner DA, Ruegg PL (2003) Relationship between udder and leg hygiene
scores and subclinical mastitis. J Dairy Sci 86: 3460-3465.
14. Zadoks RN, Griffiths HM, Munoz MA, Ahlstrom C, Bennett GJ, et al. (2011)
Sources of Klebsiella and Raoultella species on dairy farms: be careful
where you walk. J Dairy Sci 94: 1045-1051.
15. Sharma N, Singh NK, Bhadwal MS (2011) Relationship of somatic cell count and
mastitis: An overview. Asian-Aust J Anim Sci 24: 429-438.
16. Schukken Y, Chuff M, Moroni P, Gurjar A, Santisteban C, et al. (2012) The
―Other‖ Gram-Negative Bacteria in Mastitis: Klebsiella, Serratia, and More.
Vet Clin North Am Food Anim Pract 28: 239-256.
17. Munoz MA, Zadoks RN (2007) Short communication: Patterns of fecal shedding
of Klebsiella by dairy cows. J Dairy Sci 90: 1220-1224.
18. Grohn YT, Wilson DJ, Gonzalez RN, Hertl JA, Schulte H, et al. (2004) Effect of
pathogen-specific clinical mastitis on milk yield in dairy cows. J Dairy Sci
87: 3358-3374.
19. Munoz MA, Welcome FL, Schukken YH, Zadoks RN (2007) Molecular
epidemiology of two Klebsiella pneumoniae mastitis outbreaks on a dairy
farm in New York State. J Clin Microbiol 45: 3964-3971.
20. Wilson DJ, Grohn Y, Bennett G, Gonzalez R, Schukken Y, et al. (2007)
Comparison of J5 vaccinates and controls for incidence, etiologic agent,
clinical severity, and survival in the herd following naturally occurring cases
of clinical mastitis. J Dairy Sci 90: 4282-4288.
21. Munoz MA, Ahlstrom C, Rauch BJ, Zadoks RN (2006) Fecal shedding of
Klebsiella pneumoniae by dairy cows. J Dairy Sci 89: 3425-3430.
22. Ribeiro M, Motta R, Paes A, Allendorf S, Salerno T, et al. (2008) Peracute bovine
mastitis caused by Klebsiella pneumoniae. Arquivo Brasileiro de Medicina
Veterinária e Zootecnia 60: 485-488.
![Page 35: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/35.jpg)
24
23. Hogeveen H, Huijps K, Lam T (2011) Economic aspects of mastitis: New
developments. N Z Vet J 59: 16-23.
24. Bennedsgaard TW, Enevoldsen C, Thamsborg SM, Vaarst M (2003) Effect of
mastitis treatment and somatic cell counts on milk yield in Danish organic
dairy cows. J Dairy Sci 86: 3174-3183.
25. Hortet P, Seegers H (1998) Calculated milk production losses associated with
elevated somatic cell counts in dairy cows: review and critical discussion.
Vet Res 29: 497-510.
26. Reyher K, Dufour S, Barkema H, Des Côteaux L, DeVries T, et al. (2011) The
National Cohort of Dairy Farms—A data collection platform for mastitis
research in Canada. J Dairy Sci 94: 1616-1626.
27. Olde Riekerink RG, Barkema HW, Kelton DF, Scholl DT (2008) Incidence rate
of clinical mastitis on Canadian dairy farms. J Dairy Sci 91: 1366-1377.
28. Viguier C, Arora S, Gilmartin N, Welbeck K, O'Kennedy R (2009) Mastitis
detection: current trends and future perspectives. Trends Biotechnol 27:
486-493.
29. Gillespie BE, Oliver SP (2005) Simultaneous Detection of Mastitis Pathogens,
Staphylococcus aureus, Streptococcus uberis, and Streptococcus agalactiae
by Multiplex Real-Time Polymerase Chain Reaction. J Dairy Sci 88: 3510-
3518.
30. Koskinen MT, Holopainen J, Pyörälä S, Bredbacka P, Pitkälä A, et al. (2009)
Analytical specificity and sensitivity of a real-time polymerase chain
reaction assay for identification of bovine mastitis pathogens. J Dairy Sci
92: 952-959.
31. Diancourt L, Passet V, Verhoef J, Grimont PA, Brisse S (2005) Multilocus
sequence typing of Klebsiella pneumoniae nosocomial isolates. J Clin
Microbiol 43: 4178-4182.
32. Brisse S, Verhoef J (2001) Phylogenetic diversity of Klebsiella pneumoniae and
Klebsiella oxytoca clinical isolates revealed by randomly amplified
polymorphic DNA, gyrA and parC genes sequencing and automated
ribotyping. Int J Syst Evol Microbiol 51: 915-924.
33. Gore HM, Wakeman CA, Hull RM, McKillip JL (2003) Real-time molecular
beacon NASBA reveals hblC expression from Bacillus spp. in milk.
Biochem Biophys Res Commun 311: 386-390.
![Page 36: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/36.jpg)
25
34. Zadoks RN, Middleton JR, McDougall S, Katholm J, Schukken YH (2011)
Molecular epidemiology of mastitis pathogens of dairy cattle and
comparative relevance to humans. J Mammary Gland Biol Neoplasia 16:
357-372.
35. Jonas D, Spitzmüller B, Daschner FD, Verhoef J, Brisse S (2004) Discrimination
of Klebsiella pneumoniae and Klebsiella oxytoca phylogenetic groups and
other Klebsiella species by use of amplified fragment length polymorphism.
Res Microbiol 155: 17-23.
36. Paulin-Curlee GG, Singer RS, Sreevatsan S, Isaacson R, Reneau J, et al. (2007)
Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairy
cows. J Dairy Sci 90: 3681-3689.
37. Canadian Veterinary Medical Association (2008) Canadian veterinary medical
association antimicrobial prudent use guidelines: dairy cattle antimicrobial
treatment guidelines for select bacterial diseases. Canadian Veterinary
Medical Association, Ottawa, ON, Canada. Available: http://www.cahi-
icsa.ca/uploads/UserFiles/files/CVMA%20Prudent%20Use%20Guidelines
%20for%20Beef,%20Dairy,%20Poultry%20and%20Swine%202009.pdf.
Accessed 8 January 2015.
38. Schukken YH, Bennett GJ, Zurakowski MJ, Sharkey HL, Rauch BJ, et al. (2011)
Randomized clinical trial to evaluate the efficacy of a 5-day ceftiofur
hydrochloride intramammary treatment on nonsevere gram-negative clinical
mastitis. J Dairy Sci 94: 6203-6215.
39. Bannantine JP, Waters WR, Stabel JR, Palmer MV, Li L, et al. (2008)
Development and use of a partial Mycobacterium avium subspecies
paratuberculosis protein array. Proteomics 8: 463-474.
40. Castellanos E, Aranaz A, Gould KA, Linedale R, Stevenson K, et al. (2009)
Discovery of stable and variable differences in the Mycobacterium avium
subsp. paratuberculosis type I, II, and III genomes by pan-genome
microarray analysis. Appl Environ Microbiol 75: 676-686.
41. Ferrouillet C, Wells SJ, Hartmann WL, Godden SM, Carrier J (2009) Decrease of
Johne's disease prevalence and incidence in six Minnesota, USA, dairy
cattle herds on a long-term management program. Prev Vet Med 88: 128-
137.
42. Liu X, Feng Z, Harris NB, Cirillo JD, Bercovier H, et al. (2001) Identification of
a secreted superoxide dismutase in Mycobacterium avium ssp.
paratuberculosis. FEMS Microbiol Lett 202: 233-238.
![Page 37: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/37.jpg)
26
43. Pradhan AK, Mitchell RM, Kramer AJ, Zurakowski MJ, Fyock TL, et al. (2011)
Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis
in a longitudinal study of three dairy herds. J Clin Microbiol 49: 893-901.
44. Stabel JR (2000) Cytokine secretion by peripheral blood mononuclear cells from
cows infected with Mycobacterium paratuberculosis. Am J Vet Res 61:
754-760.
45. Chacon O, Bermudez LE, Barletta RG (2004) Johne's disease, inflammatory
bowel disease, and Mycobacterium paratuberculosis. Annu Rev Microbiol
58: 329-363.
46. Whittington RJ, Marshall DJ, Nicholls PJ, Marsh IB, Reddacliff LA (2004)
Survival and dormancy of Mycobacterium avium subsp. paratuberculosis in
the environment. Appl Environ Microbiol 70: 2989-3004.
47. Collins MT (2003) Paratuberculosis: review of present knowledge. Acta Vet
Scand 44: 217-221.
48. Ghadiali AH, Strother M, Naser SA, Manning EJ, Sreevatsan S (2004)
Mycobacterium avium subsp. paratuberculosis strains isolated from Crohn's
disease patients and animal species exhibit similar polymorphic locus
patterns. J Clin Microbiol 42: 5345-5348.
49. Motiwala AS, Janagama HK, Paustian ML, Zhu X, Bannantine JP, et al. (2006)
Comparative transcriptional analysis of human macrophages exposed to
animal and human isolates of Mycobacterium avium subspecies
paratuberculosis with diverse genotypes. Infect Immun 74: 6046-6056.
50. Harris NB, Payeur JB, Kapur V, Sreevatsan S (2006) Short-sequence-repeat
analysis of Mycobacterium avium subsp. paratuberculosis and
Mycobacterium avium subsp. avium isolates collected from animals
throughout the United States reveals both stability of loci and extensive
diversity. J Clin Microbiol 44: 2970-2973.
51. Karakousis PC, Moore RD, Chaisson RE (2004) Mycobacterium avium complex
in patients with HIV infection in the era of highly active antiretroviral
therapy. Lancet Infect Dis 4: 557-565.
52. Lauzi S, Pasotto D, Amadori M, Archetti IL, Poli G, et al. (2000) Evaluation of
the specificity of the gamma-interferon test in Italian bovine tuberculosis-
free herds. Vet J 160: 17-24.
![Page 38: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/38.jpg)
27
53. Parish T, Stoker NG (1998) Mycobacteria Protocols (Methods in Molecular
Biology): Humana Press. 472 p.
54. Gill CO, Saucier L, Meadus WJ (2011) Mycobacterium avium subsp.
paratuberculosis in dairy products, meat, and drinking water. J Food Prot
74: 480-499.
55. Tiwari A, VanLeeuwen JA, McKenna SL, Keefe GP, Barkema HW (2006)
Johne's disease in Canada Part I: clinical symptoms, pathophysiology,
diagnosis, and prevalence in dairy herds. Can Vet J 47: 874-882.
56. Ott SL, Wells SJ, Wagner BA (1999) Herd-level economic losses associated with
Johne's disease on US dairy operations. Prev Vet Med 40: 179-192.
57. Crossley BM, Zagmutt-Vergara FJ, Fyock TL, Whitlock RH, Gardner IA (2005)
Fecal shedding of Mycobacterium avium subsp. paratuberculosis by dairy
cows. Vet Microbiol 107: 257-263.
58. Pradhan AK, Van Kessel JS, Karns JS, Wolfgang DR, Hovingh E, et al. (2009)
Dynamics of endemic infectious diseases of animal and human importance
on three dairy herds in the northeastern United States. J Dairy Sci 92: 1811-
1825.
59. McKenna SL, Keefe GP, Barkema HW, McClure J, Vanleeuwen JA, et al. (2004)
Cow-level prevalence of paratuberculosis in culled dairy cows in Atlantic
Canada and Maine. J Dairy Sci 87: 3770-3777.
60. Sweeney RW (1996) Transmission of paratuberculosis. Vet Clin North Am Food
Anim Pract 12: 305-312.
61. Manning EJ, Collins MT (2001) Mycobacterium avium subsp. paratuberculosis:
pathogen, pathogenesis and diagnosis. Rev Sci Tech 20: 133-150.
62. Eisenberg SW, Nielen M, Santema W, Houwers DJ, Heederik D, et al. (2010)
Detection of spatial and temporal spread of Mycobacterium avium subsp.
paratuberculosis in the environment of a cattle farm through bio-aerosols.
Vet Microbiol 143: 284-292.
63. Benedictus A, Mitchell RM, Linde-Widmann M, Sweeney R, Fyock T, et al.
(2008) Transmission parameters of Mycobacterium avium subspecies
paratuberculosis infections in a dairy herd going through a control program.
Prev Vet Med 83: 215-227.
![Page 39: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/39.jpg)
28
64. Eisenberg S, Nielen M, Hoeboer J, Bouman M, Heederik D, et al. (2011)
Mycobacterium avium subspecies paratuberculosis in bioaerosols after
depopulation and cleaning of two cattle barns. Vet Rec 168: 587.
65. Corner LA, Pfeiffer DU, Abbott KA (2004) The respiratory tract as a hypothetical
route of infection of cattle with Mycobacterium avium subspecies
paratuberculosis. Aust Vet J 82: 170-173.
66. Beard PM, Stevenson K, Pirie A, Rudge K, Buxton D, et al. (2001) Experimental
paratuberculosis in calves following inoculation with a rabbit isolate of
Mycobacterium avium subsp. paratuberculosis. J Clin Microbiol 39: 3080-
3084.
67. Hermon-Taylor J (2009) Mycobacterium avium subspecies paratuberculosis,
Crohn's disease and the Doomsday scenario. Gut Pathog 1: 15. Available:
http://www.gutpathogens.com/content/1/1/15. Accessed 3 January 2015.
68. Lambrecht RS, Collins MT (1993) Inability to detect mycobactin in
mycobacteria-infected tissues suggests an alternative iron acquisition
mechanism by mycobacteria in vivo. Microb Pathog 14: 229-238.
69. Thorel MF (1984) Review of the occurrence of mycobactin dependence among
mycobacteria species. Ann Rech Vet 15: 405-409.
70. Thorel MF, Krichevsky M, Levy-Frebault VV (1990) Numerical taxonomy of
mycobactin-dependent mycobacteria, emended description of
Mycobacterium avium, and description of Mycobacterium avium subsp.
avium subsp. nov., Mycobacterium avium subsp. paratuberculosis subsp.
nov., and Mycobacterium avium subsp. silvaticum subsp. nov. Int J Syst
Bacteriol 40: 254-260.
71. Whittington RJ, Marsh IB, Saunders V, Grant IR, Juste R, et al. (2011) Culture
phenotypes of genomically and geographically diverse Mycobacterium
avium subsp. paratuberculosis isolates from different hosts. J Clin
Microbiol 49: 1822-1830.
72. Aduriz JJ, Juste RA, Cortabarria N (1995) Lack of mycobactin dependence of
mycobacteria isolated on Middlebrook 7H11 from clinical cases of ovine
paratuberculosis. Vet Microbiol 45: 211-217.
73. Merkal RS, Curran BJ (1974) Growth and metabolic characteristics of
Mycobacterium paratuberculosis. Appl Microbiol 28: 276-279.
![Page 40: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/40.jpg)
29
74. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, et al. (2005) The complete
genome sequence of Mycobacterium avium subspecies paratuberculosis.
Proc Natl Acad Sci U S A 102: 12344-12349.
75. Rowe MT, Grant IR (2006) Mycobacterium avium ssp. paratuberculosis and its
potential survival tactics. Lett Appl Microbiol 42: 305-311.
76. Valentin-Weigand P, Goethe R (1999) Pathogenesis of Mycobacterium avium
subspecies paratuberculosis infections in ruminants: still more questions
than answers. Microbes Infect 1: 1121-1127.
77. Hermon-Taylor J, Bull T (2002) Crohn's disease caused by Mycobacterium avium
subspecies paratuberculosis: a public health tragedy whose resolution is
long overdue. J Med Microbiol 51: 3-6.
78. Zurbrick BG, Czuprynski CJ (1987) Ingestion and intracellular growth of
Mycobacterium paratuberculosis within bovine blood monocytes and
monocyte-derived macrophages. Infect Immun 55: 1588-1593.
79. Martinson SA, Hanna PE, Ikede BO, Lewis JP, Miller LM, et al. (2008)
Comparison of bacterial culture, histopathology, and immunohistochemistry
for the diagnosis of Johne's disease in culled dairy cows. J Vet Diagn Invest
20: 51-57.
80. Serraino A, Arrigoni N, Ostanello F, Ricchi M, Marchetti G, et al. (2014) A
screening sampling plan to detect Mycobacterium avium subspecies
paratuberculosis-positive dairy herds. J Dairy Sci 97: 3344-3351.
81. Morris JA, Stevens AE (1977) An improved antigen for the paratuberculosis
complement fixation test. J Biol Stand 5: 315-319.
82. Sherman DM, Gay JM, Bouley DS, Nelson GH (1990) Comparison of the
complement-fixation and agar gel immunodiffusion tests for diagnosis of
subclinical bovine paratuberculosis. Am J Vet Res 51: 461-465.
83. Reichel MP, Kittelberger R, Penrose ME, Meynell RM, Cousins D, et al. (1999)
Comparison of serological tests and faecal culture for the detection of
Mycobacterium avium subsp. paratuberculosis infection in cattle and
analysis of the antigens involved. Vet Microbiol 66: 135-150.
84. Nielsen SS, Toft N (2008) Ante mortem diagnosis of paratuberculosis: a review
of accuracies of ELISA, interferon-gamma assay and faecal culture
techniques. Vet Microbiol 129: 217-235.
![Page 41: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/41.jpg)
30
85. Sweeney RW, Whitlock RH, Buckley CL, Spencer PA (1995) Evaluation of a
commercial enzyme-linked immunosorbent assay for the diagnosis of
paratuberculosis in dairy cattle. J Vet Diagn Invest 7: 488-493.
86. Eamens GJ, Whittington RJ, Marsh IB, Turner MJ, Saunders V, et al. (2000)
Comparative sensitivity of various faecal culture methods and ELISA in
dairy cattle herds with endemic Johne's disease. Vet Microbiol 77: 357-367.
87. Kalis CH, Collins MT, Hesselink JW, Barkema HW (2003) Specificity of two
tests for the early diagnosis of bovine paratuberculosis based on cell-
mediated immunity: the Johnin skin test and the gamma interferon assay.
Vet Microbiol 97: 73-86.
88. Gwozdz J (2008) Paratuberculosis (Johne‘s disease). World Organisation for
Animal Health (ed) OIE terrestrial manual: 276-291. Available:
http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.01.11_PA
RATB.pdf. Accessed 3 January 2015.
89. Whitlock RH, Wells SJ, Sweeney RW, Van Tiem J (2000) ELISA and fecal
culture for paratuberculosis (Johne's disease): sensitivity and specificity of
each method. Vet Microbiol 77: 387-398.
90. Whitlock RH, Rosenberger AE, Sweeney R, Spencer PA (1996) Distribution of
M. paratuberculosis in tissues of cattle from herds infected with Johne's
disease. In: Chiodini RJ, Hines ME, Collins MT, editors. Proceedings of the
Fifth International Colloquium on Paratuberculosis, Madison, WI, USA,
September 29–October 4. Pp. 168–174.
91. Nielsen SS, Kolmos B, Christoffersen AB (2004) Comparison of contamination
and growth of Mycobacterium avium subsp. paratuberculosis on two
different media. J Appl Microbiol 96: 149-153.
92. Reddacliff LA, Vadali A, Whittington RJ (2003) The effect of decontamination
protocols on the numbers of sheep strain Mycobacterium avium subsp.
paratuberculosis isolated from tissues and faeces. Vet Microbiol 95: 271-
282.
93. Collins MT, Kenefick KB, Sockett DC, Lambrecht RS, McDonald J, et al. (1990)
Enhanced radiometric detection of Mycobacterium paratuberculosis by
using filter-concentrated bovine fecal specimens. J Clin Microbiol 28: 2514-
2519.
94. Stich RW, Byrum B, Love B, Theus N, Barber L, et al. (2004) Evaluation of an
automated system for non-radiometric detection of Mycobacterium avium
paratuberculosis in bovine feces. J Microbiol Methods 56: 267-275.
![Page 42: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/42.jpg)
31
95. Juste RA, Marco JC, Saez de Ocariz C, Aduriz JJ (1991) Comparison of different
media for the isolation of small ruminant strains of Mycobacterium
paratuberculosis. Vet Microbiol 28: 385-390.
96. Vary PH, Andersen PR, Green E, Hermon-Taylor J, McFadden JJ (1990) Use of
highly specific DNA probes and the polymerase chain reaction to detect
Mycobacterium paratuberculosis in Johne's disease. J Clin Microbiol 28:
933-937.
97. Strommenger B, Stevenson K, Gerlach GF (2001) Isolation and diagnostic
potential of ISMav2, a novel insertion sequence-like element from
Mycobacterium avium subspecies paratuberculosis. FEMS Microbiol Lett
196: 31-37.
98. Vansnick E, De Rijk P, Vercammen F, Geysen D, Rigouts L, et al. (2004) Newly
developed primers for the detection of Mycobacterium avium subspecies
paratuberculosis. Vet Microbiol 100: 197-204.
99. Bannantine J, Li LL, Sreevatsan S, Kapur V (2013) How does a Mycobacterium
change its spots? Applying molecular tools to track diverse strains of
Mycobacterium avium subspecies paratuberculosis. Lett Appl Microbiol 57:
165-173.
100. Englund S, Bolske G, Johansson KE (2002) An IS900-like sequence found in a
Mycobacterium sp. other than Mycobacterium avium subsp.
paratuberculosis. FEMS Microbiol Lett 209: 267-271.
101. Chui LW, King R, Lu P, Manninen K, Sim J (2004) Evaluation of four DNA
extraction methods for the detection of Mycobacterium avium subsp.
paratuberculosis by polymerase chain reaction. Diagn Microbiol Infect Dis
48: 39-45.
102. Cook KL, Britt JS (2007) Optimization of methods for detecting Mycobacterium
avium subsp. paratuberculosis in environmental samples using quantitative,
real-time PCR. J Microbiol Methods 69: 154-160.
103. Mobius P, Hotzel H, Rassbach A, Kohler H (2008) Comparison of 13 single-
round and nested PCR assays targeting IS900, ISMav2, f57 and locus 255
for detection of Mycobacterium avium subsp. paratuberculosis. Vet
Microbiol 126: 324-333.
104. Grimes DS (2003) Mycobacterium avium subspecies paratuberculosis as a cause
of Crohn's disease. Gut 52: 155. Available:
http://gut.bmj.com/content/52/1/155.long. Accessed 5 January 2015.
![Page 43: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/43.jpg)
32
105. Stabel JR, Goff JP, Ackermann MR (1998) Dietary calcium modulates
Mycobacterium paratuberculosis infection in beige mice. Vet Immunol
Immunopathol 66: 377-390.
106. Carvalho I, Pietralonga P, Schwarz D, Faria A, Moreira M (2012) Short
communication: Recovery of viable Mycobacterium avium subspecies
paratuberculosis from retail pasteurized whole milk in Brazil. J Dairy Sci
95: 6946-6948.
107. Ikonomopoulos J, Pavlik I, Bartos M, Svastova P, Ayele WY, et al. (2005)
Detection of Mycobacterium avium subsp. paratuberculosis in retail cheeses
from Greece and the Czech Republic. Appl Environ Microbiol 71: 8934-
8936.
108. Juste RA, Elguezabal N, Pavon A, Garrido JM, Geijo M, et al. (2009)
Association between Mycobacterium avium subsp. paratuberculosis DNA
in blood and cellular and humoral immune response in inflammatory bowel
disease patients and controls. Int J Infect Dis 13: 247-254.
109. Sohal JS, Singh SV, Singh AV, Singh PK (2010) Strain diversity within
Mycobacterium avium subspecies paratuberculosis--a review. Indian J Exp
Biol 48: 7-16.
110. Stevenson K, Hughes VM, de Juan L, Inglis NF, Wright F, et al. (2002)
Molecular characterization of pigmented and nonpigmented isolates of
Mycobacterium avium subsp. paratuberculosis. J Clin Microbiol 40: 1798-
1804.
111. Semret M, Alexander DC, Turenne CY, de Haas P, Overduin P, et al. (2005)
Genomic polymorphisms for Mycobacterium avium subsp. paratuberculosis
diagnostics. J Clin Microbiol 43: 3704-3712.
112. Ahlstrom C, Barkema HW, De Buck J (2014) Improved Short-Sequence-Repeat
Genotyping of Mycobacterium avium subsp. paratuberculosis by Using
Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass
Spectrometry. Applied and environmental microbiology 80: 534-539.
113. Castellanos E, Aranaz A, Romero B, de Juan L, Alvarez J, et al. (2007)
Polymorphisms in gyrA and gyrB genes among Mycobacterium avium
subsp. paratuberculosis type I, II, and III isolates. J Clin Microbiol 45:
3439-3442.
114. El-Sayed A, Hassan AA, Natour S, Abdulmawjood A, Bulte M, et al. (2009)
Evaluation of three molecular methods of repetitive element loci for
![Page 44: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/44.jpg)
33
differentiation of Mycobacterium avium subsp. paratuberculosis (MAP). J
Microbiol 47: 253-259.
115. Oakey J, Gavey L, Singh SV, Platell J, Waltisbuhl D (2014) Variable-number
tandem repeats genotyping used to aid and inform management strategies
for a bovine Johne‘s disease incursion in tropical and subtropical Australia.
J Vet Diagn Invest 26: 651-657.
116. Simon M, Kind P, Kaudewitz P, Krokowski M, Graf A, et al. (1998) Automated
high-resolution polymerase chain reaction fragment analysis: a method for
detecting T-cell receptor gamma-chain gene rearrangements in
lymphoproliferative diseases. Am J Pathol 152: 29-33.
117. Castellanos E, Romero B, Rodriguez S, de Juan L, Bezos J, et al. (2010)
Molecular characterization of Mycobacterium avium subspecies
paratuberculosis Types II and III isolates by a combination of MIRU-
VNTR loci. Vet Microbiol 144: 118-126.
118. Motiwala AS, Amonsin A, Strother M, Manning EJ, Kapur V, et al. (2004)
Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis
isolates recovered from wild animal species. J Clin Microbiol 42: 1703-
1712.
119. Motiwala AS, Li L, Kapur V, Sreevatsan S (2006) Current understanding of the
genetic diversity of Mycobacterium avium subsp. paratuberculosis.
Microbes Infect 8: 1406-1418.
120. Prantera C, Scribano ML (1999) Crohn's disease: the case for bacteria. Ital J
Gastroenterol Hepatol 31: 244-246.
121. Naser SA, Schwartz D, Shafran I (2000) Isolation of Mycobacterium avium
subsp paratuberculosis from breast milk of Crohn's disease patients. Am J
Gastroenterol 95: 1094-1095.
122. Chiodini RJ, Chamberlin WM, Sarosiek J, McCallum RW (2012) Crohn's
disease and the mycobacterioses: a quarter century later. Causation or
simple association? Crit Rev Microbiol 38: 52-93.
123. Waddell LA, Rajic A, Sargeant J, Harris J, Amezcua R, et al. (2008) The
zoonotic potential of Mycobacterium avium spp. paratuberculosis: a
systematic review. Can J Public Health 99: 145-155.
![Page 45: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/45.jpg)
34
Table 1.3.5.1: Brief description of antibiotics used for treating CM cases in Newfoundland
Antibiotic Antibiotic class Mode of action Effective against Common mode of
resistance
Cephalothin/
Cefalotin
β-lactam (first
generation
cephalosporin)
Disrupts bacterial cell
wall synthesis
Staphylococcus
isolates
Enzymatic
deactivation of
antibiotic molecule
Ceftiofur
β-lactam (third
generation
cephalosporin)
Disrupts bacterial cell
wall synthesis
Broad spectrum
activity against
Gram negative
organisms
Enzymatic
deactivation of
antibiotic molecule
Pirlimycin Lincosamide Prevents protein synthesis
in prokaryotes
Gram positive
bacteria
Eliminates or reduces
binding of antibiotic to
cell target
Novobiocin Aminocoumarin
antibiotic
Inhibits the chromosome
replication
Gram positive
bacteria
Point mutation in the
DNA gyrase subunit
Streptomycin Aminoglycoside Inhibits the protein
synthesis of bacteria
Gram negative
bacteria
Enzymatic
deactivation of
antibiotic molecule
Tetracycline Polyketide Inhibits the protein
synthesis of bacteria
Gram negative
bacteria
Active efflux from the
cell
Trimethoprim
sulfamethoxazole
Combination of a
sulfonamide antibiotic
and a methoprim
Inhibits the biosynthesis
of essential tetrahydrofolic
acid
Bacterial, fungal
and prokaryotic
infections
Alteration of
metabolic pathway
![Page 46: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/46.jpg)
35
Chapter 2: Klebsiella species associated with bovine mastitis in Newfoundland
Co-authorship statement
Project design and development: Drs. Kapil Tahlan (Department of Biology,
Memorial University of Newfoundland) and Hugh G. Whitney (Animal Health Division,
Newfoundland and Labrador Department of Natural Resources). Experiments were
performed by: Milka P. Podder (Department of Biology, Memorial University of
Newfoundland) and Dr. Kapil Tahlan. Data was analyzed by: Milka P. Podder and Dr.
Kapil Tahlan. Reagents/materials/analysis tools were contributed by: Drs. Hugh G.
Whitney, Laura Rogers (Animal Health Division, Newfoundland and Labrador
Department of Natural Resources), Peter K. Daley (Faculty of Medicine, Memorial
University of Newfoundland) and Greg P. Keefe (Department of Health Management,
Atlantic Veterinary College, University of Prince Edward Island). Manuscript was
written by: Milka P. Podder and Dr. Kapil Tahlan with input from Drs. Hugh G. Whitney
and Greg P. Keefe.
This chapter has been published in the PLoS One journal (Podder MP, Rogers L,
Daley PK, Keefe GP, Whitney HG, et al. (2014) Klebsiella Species Associated with
Bovine Mastitis in Newfoundland. PLoS One 9: e106518. Available:
http://www.plosone.org. Accessed 3 January 2015).
![Page 47: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/47.jpg)
36
Abstract
Klebsiella spp. is a common cause of bovine mastitis, but information regarding
its molecular epidemiology is lacking from many parts of Canada. By using mass
spectrometry and partial sequencing of the rpoB gene, it was found that over a one year
period, K. variicola and Enterobacter cloacae were misidentified as K. pneumoniae in a
small number of clinical mastitis (CM) cases from Newfoundland. Results suggest that
the currently used standard biochemical and phenotypic tests lack the sensitivity required
to accurately discriminate among these three Gram negative bacteria. In addition, a single
strain of K. variicola was associated with CM from one farm as demonstrated by random
amplified polymorphic DNA (RAPD) PCR. To the best of our knowledge, K. variicola,
which is normally found in the environment, has not been isolated previously from milk
obtained from cows with CM. Therefore, it is possible that K. variicola was not detected
in milk samples in the past due to the inability of standard tests to discriminate it from
other Klebsiella species. (168 words)
![Page 48: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/48.jpg)
37
2.1 Introduction
Klebsiella pneumoniae is an important opportunistic human pathogen
predominantly affecting immunocompromised or elderly human patients. Recently a
hypervirulent K. pneumoniae strain was reported to be capable of causing fatal infections
in healthy individuals [1]. Drug resistant forms of K. pneumoniae, especially those
resistant to the β-lactam family of antibiotics are also a cause for concern due to the
limited therapeutic options available for the treatment of such infections and the ability of
these strains to rapidly spread and transfer the resistance phenotype [2-4]. In the dairy
industry, K. pneumoniae is one of the known causes of primarily environment derived
Klebsiella mastitis and has been the subject of numerous studies [3,5-7]. Clinical mastitis
(CM) is classified as the condition where an animal displays the physical symptoms of
mastitis [8] and milk production and quality is also affected [9]. Whilst most studies
show limited impact of treatment, Schukken et al. [10] reported a significant increase in
bacteriological cure after the use of antimicrobials for treating non-severe cases of
Klebsiella associated CM. Mastitis adversely affects milk production and generally cows
do not regain full production levels post recovery [11], leading to considerable economic
losses. It has also been reported that the amount of decrease in milk production depends
on the specific pathogen causing the infection and that Gram negative bacteria are
responsible for greater reduction than Gram positive bacteria and other non-bacterial
organisms [11-14]. Although, not routinely performed for diagnostic purposes, further
characterization of bacterial isolates from infected animals helps to better identify the
sources of the infection and to determine if herd infections are primarily clonal or
polyclonal in nature [3,5,7]. These data allow clinicians to understand the nature of
![Page 49: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/49.jpg)
38
transmission within herds and to implement targeted prevention strategies. Therefore,
there is value in identifying the causative agent for quick action to prevent losses and also
for surveillance purposes.
In the current study, we used multiple methods to identify and analyze Gram
negative coliforms associated with bovine CM from Newfoundland, Canada. Our results
suggest that the currently used standard biochemical laboratory identification techniques
were not sensitive enough to accurately identify the etiological agent in certain cases. In
addition, we found that all CM cases from one farm were associated with K. variicola,
which had been misidentified as K. pneumoniae using routine testing procedures.
![Page 50: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/50.jpg)
39
2.2 Materials and Methods
2.2.1 Ethics statement
This study was carried out in cooperation with dairy farmers in the province and
formalized by an agreement between their representative organization, the Dairy Farmers
of Newfoundland and Labrador (NL), and the Chief Veterinary Officer for the Province
of NL (HGW). Endangered species were not involved in the study and all samples were
collected from the island of Newfoundland. The report is not intended to be a field study;
instead it describes the application and accuracy of laboratory and molecular tests for the
identification of coliform bacteria associated with bovine mastitis. Therefore, coordinates
and details regarding the geographical origins of the samples are not included. Approval
from an Institutional Animal Care and Use Committee (IACUC), or equivalent animal
ethics committee, was not obtained as the samples used in the current study were
obtained from routine veterinary diagnostic submissions unrelated to this research. The
report is focused on the microbiological analysis following the isolation of bacteria from
the milk samples, and did not directly involve any animals.
2.2.2 Standard phenotypic/biochemical testing for pathogen identification
Milk samples from animals with symptoms of CM were collected from 11 farms
by the Animal Health Division, Department of Natural Resources, Government of NL
between October, 2011 and October, 2012. Sample collection from dairy cattle was done
through the expression of milk from the teats into a sterile collection container for
submission to the diagnostic laboratory. For initial confirmation of CM status of the
![Page 51: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/51.jpg)
40
animal, milk samples originating from infected quarters of the udder were subjected to
the California mastitis test (CMT, Dairy Research Products Co., Canada). For isolation
and phenotypic identification of CM associated bacteria, milk samples were streaked on
tryptic soy agar with 5% sheep blood, MacConkey 3 agar with crystal violet and urea
agar (Oxoid Ltd., Canada) as recommended (National Mastitis Council, 1999). To further
characterize the isolates and to distinguish between members of Enterobacteriaceae, the
IMViC test was performed using tryptic soy broth (I, Oxoid Ltd., Canada), methyl red
(M), Voges-Proskauer (V) test (Becton Dickinson, Canada) and citrate test (C, Becton
Dickinson, Canada). The M test differentiates Klebsiella spp. from Enterobacter cloacae
and the I test differentiates between K. pneumoniae and K. oxytoca. Atypical results were
reanalyzed using the API 20E identification kit (bioMérieux Canada, Inc.). Later on, the
isolates were submitted to the Public Health Laboratory of the Government of NL (PHL-
NL, St. John‘s, NL, Canada) for classification using the matrix-assisted laser
desorption/ionization-time of flight (MALDI-TOF) Biotyper System (Bruker Corp.
USA). Certain isolates were also tested for their ability to metabolize adonitol using the
API 50 CHE kit according to the manufacturer‘s instructions (bioMérieux Canada, Inc.).
2.2.3 Antibiotic susceptibility testing
All isolates were subjected to routine drug susceptibility testing using
cephalothin, ceftiofur, streptomycin, tetracycline and trimethoprim sulfamethoxazole
(TMP-sulfa) using the Kirby Bauer Disc Diffusion method. Minimum inhibitory
concentrations were also determined for cephalothin, ceftiofur and tetracycline using the
![Page 52: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/52.jpg)
41
Sensititer microdilution system (Trek Diagnostic Systems Inc.). All analyses were
conducted according to the Clinical and Laboratory Standards Institute (CLSI) standards
[15].
2.2.4 Genotyping of isolates
The isolates were successfully grown in nutrient broth (Becton Dickinson, Sparks,
Md.) for molecular typing. Chromosomal DNA was extracted from 45 isolates and used
for direct amplification and sequencing of the rpoB gene as described in a previous study
[5] using the Thermo Scientific™ Phusion™ High-Fidelity PCR Kit. PCR products were
subjected to DNA sequencing at the Centre for Applied Genomics, University of
Toronto, Canada and the nucleotide sequences obtained were used to search the public
database (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The same 45 isolates were used for
strain typing by random amplified polymorphic DNA (RAPD) PCR as described in
previous studies [5,16]. The same primer pair (ERIC-2/1026) was designed to analyze
different species of Klebsiella [17]. Images of DNA banding patterns obtained after
agarose gel electrophoresis were analyzed using PyElph software [18] to prepare a
presence/absence band matrix which was subsequently used to prepare a dendrogram
using the neighbor joining method. Reproducibility of banding patterns for 45 isolates
was also evaluated by repeating the entire gel analysis twice.
![Page 53: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/53.jpg)
42
2.3 Results and Discussion
2.3.1 Identification of K. pneumoniae and other isolates
In the current study, Klebsiella spp. were detected in 61 milk samples that were
routinely collected from cows with symptoms of CM from 11 farms in Newfoundland
over a one year period. From these original 61 isolates that were identified as K.
pneumoniae based on standard biochemical and phenotypic tests, only 45 could be re-
cultured for further examination. Subsequent analysis of all the isolates by MALDI-TOF
Biotyper mass spectrometry reclassified two of the 45 isolates as Enterobacter cloacae
and the remaining 43 as K. pneumoniae (Table 2.3.1.1). To determine/confirm genus and
species identity, partial sequencing of the rpoB gene was carried out as it has been shown
to be a good candidate to discriminate between coliforms associated with CM in previous
studies [5]. The DNA sequences obtained were aligned after trimming and were used to
build a dendrogram (Figure 2.3.1.1). In this third round of analysis, all CM associated
samples from a single farm (farm 9) were identified as K. variicola and not K.
pneumoniae. In addition, two isolates from separate farms were confirmed to be E.
cloacae, as suggested previously by MALDI-TOF analysis (Table 2.3.1.1). Therefore, K.
pneumoniae, K. variicola and E. cloacae were identified to be associated with CM cases
from 11 farms in the current study.
Only K. variicola was isolated from cows with CM from farm 9, originating from
the left hind quarter of the udders of two animals. One of the strains (KM-49) was re-
isolated from the same quarter during a second sampling conducted after a one month
period. K. variicola was originally described to be unable to metabolize/ferment adonitol
[20]. When the two K. variicola isolates from the current study were used in carbohydrate
![Page 54: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/54.jpg)
43
fermentation assays, results demonstrated that both isolates could ferment adonitol (Table
2.3.1.2). Therefore, in the current study, K. variicola could only be identified based on
rpoB sequencing, as all other methods, including the adonitol fermentation test failed to
identify it.
2.3.2 Molecular typing by RAPD analysis
Many diverse K. pneumoniae strains are known to be present in dairy cattle feces
and infections are normally linked to contaminated organic bedding material [16].
Genotyping techniques such as RAPD, multilocus sequence typing (MLST) and pulsed-
field gel electrophoresis (PFGE) have been used in the past to successfully analyze K.
pneumoniae strain diversity associated with CM [5,21,22]. Of these, RAPD has many
advantages as it is fast, relatively inexpensive and technically less demanding as
compared to the other methods of analysis and was therefore chosen for the current study.
Limited strain clustering was observed between the K. pneumoniae strains subjected to
RAPD analysis (Figure 2.3.2.1A,B), which has also been reported in previous studies,
suggesting an environmental source of the infection [16,19,21], with the exception of
farm 6, where the two CM cases were associated with the same K. pneumoniae strain
(Figure 2.3.2.1A-C). Therefore, it is possible that there was either direct or indirect
animal to animal transmission on farm 6 or that a single environmental strain infected the
two animals independently. Chromosomal DNA from the laboratory K. pneumoniae
ATCC 15380 strain, was used as a control for RAPD analysis on two occasions, giving
identical profiles, showing that the assay used is reliable enough for strain typing and all
results were reproducible (Figure 2.3.2.1C). Examination of the two K. variicola isolates
![Page 55: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/55.jpg)
44
from farm 9 demonstrated that they were identical, which could again suggest animal to
animal transmission or that a single strain infected the two animals independently (Figure
2.3.2.1A-C). Similar results were also reported in previous studies where RAPD
demonstrated clear difference between Raoultella spp. and K. pneumoniae using the same
pair of primers as used in the current study [5]. The RAPD assay was repeated to check
for reproducibility and verify the DNA banding patterns between identical isolates
(Figure 2.3.2.1C). In addition, the two E. cloacae strains identified in the current study
from two different farms were not the same (Figure 2.3.2.1A and 2.3.2.1B).
2.3.3 Antimicrobial activity and resistance profile
All 45 isolates were also subjected to antimicrobial susceptibility testing using
five drugs commonly used to treat Gram negative infections in veterinary medicine
(cephalothin, ceftiofur, streptomycin, tetracycline and TMP-sulfa). CLSI guidelines were
used for determining the breakpoint concentration for each antibiotic. Cephalothin
resistance (a first-generation cephalosporin β-lactam) was only observed in the E. cloacae
isolates. Combined results from these analyses are superimposed on the dendrogram
shown in Figure 2.3.2.1B and 2.3.1.1, and are also included in Table 2.3.3.1. Varying
profiles/degrees of resistance against streptomycin and tetracycline were observed for the
K. pneumoniae isolates. In addition, three isolates from farm 1 (F1-1, F1-17 and F1-33)
were resistant to TMP-sulfa and the two K. variicola isolates were sensitive to all the
drugs tested (Figure 2.3.2.1B and Table 2.3.3.1).
![Page 56: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/56.jpg)
45
2.3.4 Conclusion
The insular nature of Newfoundland, its location and maritime climate pose
unique challenges and environments for the management of dairy herds. In this study,
bacteria were isolated from confirmed CM dairy animals from Newfoundland and were
initially identified as K. pneumoniae using standard phenotypic laboratory testing
protocols. MALDI-TOF finger printing further reclassified two isolates as E. cloacae,
suggesting that this method is more sensitive than phenotypic biochemical analysis in
discriminating between coliforms associated with CM [23]. MALDI-TOF has been used
for proteomic analysis in several studies related to bovine mastitis [24,25]. MALDI-TOF
is a rapid, precise and cost-effective method for bacterial identification compared to
conventional phenotypic/biochemical techniques [26], but its sensitivity is dependent on
the database used for matching the obtained spectra. Finally, partial rpoB gene
sequencing revealed the presence of K. variicola from one farm, which could not be
discriminated using the two previous methods. Similar results were also observed in
previous studies where Klebsiella oxytoca, Klebsiella variicola and Raoultella planticola
were isolated from environmental samples associated with CM [19]. Therefore, it is
possible that the prevalence of K. variicola associated with CM might be under-reported,
as the results suggest that routinely used identification tests are not sensitive enough to
discriminate it from K. pneumoniae.
K. pneumoniae is an opportunistic, environmental pathogen causing CM in dairy
cattle [16] and it is very rare to see a dominant strain associated with a herd [5]. Farm 1,
which had the highest incidence of CM over the period included in the study, displayed
large amounts of variation in K. pneumoniae strains and only farm 6 had infections
![Page 57: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/57.jpg)
46
caused by a single strain (Figure 2.3.2.1). Results also showed that both cases from farm
9 were associated with a single strain of K. variicola (Figure 2.3.2.1) as it was the only
bacterium cultured from the submitted milk samples (Table 2.3.3.1). The isolation of K.
variicola from milk samples from cows with CM has not been reported previously as this
organism is normally found in the environment [19]. In addition, K. variicola has also
been previously isolated from plants and certain hospital settings [19,20]. Other reports
have questioned the adonitol negative fermentation test for its ability to discriminate
between K. variicola and other coliforms [27], which was also demonstrated by our
results. The pathogenic potential of K. variicola is not well understood and there has been
some concern in the ability to accurately detect it in humans. In a recent report, an
incorrectly diagnosed K. variicola strain was responsible for human patient mortality,
even though antibiotics were administered to which the isolate was sensitive under
laboratory conditions [28]. To the best of our knowledge, this is the first report with
evidence that an isolate of K. variicola can cause CM in dairy cattle, as it is normally
found in soil and feed [19], and not in milk from infected animals. The relevance of the
finding that one adonitol positive strain of K. variicola was responsible for both CM
cases from a single farm will be investigated in future studies.
![Page 58: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/58.jpg)
47
2.4 References
1. Shon AS, Bajwa RP, Russo TA (2013) Hypervirulent (hypermucoviscous) Klebsiella
pneumoniae: a new and dangerous breed. Virulence 4: 107-118.
2. Tzouvelekis LS, Markogiannakis A, Psichogiou M, Tassios PT, Daikos GL (2012)
Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an
evolving crisis of global dimensions. Clin Microbiol Rev 25: 682-707.
3. Ohnishi M, Okatani AT, Harada K, Sawada T, Marumo K, et al. (2013) Genetic
Characteristics of CTX-M-Type Extended-Spectrum-β-Lactamase (ESBL)-
Producing Enterobacteriaceae Involved in Mastitis Cases on Japanese Dairy
Farms, 2007 to 2011. J Clin Microbiol 51: 3117-3122.
4. Dahmen S, Métayer Vr, Gay E, Madec J-Y, Haenni M (2013) Characterization of
extended-spectrum β-lactamase (ESBL)-carrying plasmids and clones of
Enterobacteriaceae causing cattle mastitis in France. Vet Microbiol 162: 793-799.
5. Munoz MA, Welcome FL, Schukken YH, Zadoks RN (2007) Molecular epidemiology
of two Klebsiella pneumoniae mastitis outbreaks on a dairy farm in New York
State. J Clin Microbiol 45: 3964-3971.
6. Haftu R, Taddele H, Gugsa G, Kalayou S (2012) Prevalence, bacterial causes, and
antimicrobial susceptibility profile of mastitis isolates from cows in large-scale
dairy farms of Northern Ethiopia. Trop Anim Health Prod 44: 1765-1771.
7. Zadoks RN, Middleton JR, McDougall S, Katholm J, Schukken YH (2011) Molecular
epidemiology of mastitis pathogens of dairy cattle and comparative relevance to
humans. J Mammary Gland Biol Neoplasia 16: 357-372.
8. Paul I, Ganguly S (2014) Molecular Detection of Etiology Causing Mastitis, a
Bacterial Infection of Cattle Udder: A Review. Int J Rec Biotech 2: 33-34.
9. Seegers H, Fourichon C, Beaudeau F (2003) Production effects related to mastitis and
mastitis economics in dairy cattle herds. Vet Res 34: 475-491.
10. Schukken YH, Bennett GJ, Zurakowski MJ, Sharkey HL, Rauch BJ, et al. (2011)
Randomized clinical trial to evaluate the efficacy of a 5-day ceftiofur
hydrochloride intramammary treatment on nonsevere gram-negative clinical
mastitis. J Dairy Sci 94: 6203-6215.
11. Grohn YT, Wilson DJ, Gonzalez RN, Hertl JA, Schulte H, et al. (2004) Effect of
pathogen-specific clinical mastitis on milk yield in dairy cows. J Dairy Sci 87:
3358-3374.
![Page 59: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/59.jpg)
48
12. Schukken YH, Hertl J, Bar D, Bennett GJ, González RN, et al. (2009) Effects of
repeated gram-positive and gram-negative clinical mastitis episodes on milk yield
loss in Holstein dairy cows. J Dairy Sci 92: 3091-3105.
13. Habrun B, Kompes G (2014) Rarely isolated mastitis pathogens. Veterinarska Stanica
45: 41-46.
14. Gogoi SM, Mehtaz S, Saikia G, Das M (2014) Research Article Isolation of Candida
Species from Market Milk Samples. Sch Acad J Biosci 2: 202-204.
15. CLSI (2013) Performance standards for antimicrobial disk and dilution susceptibility
tests for bacteria isolated from animals; approved standard-Fourth edition.
Clinical and Laboratory Standards Institute, Wayne, PA 33.
16. Munoz MA, Ahlstrom C, Rauch BJ, Zadoks RN (2006) Fecal shedding of Klebsiella
pneumoniae by dairy cows. J Dairy Sci 89: 3425-3430.
17. Vogel L, Jones G, Triep S, Koek A, Dijkshoorn L (1999) RAPD typing of Klebsiella
pneumoniae, Klebsiella oxytoca, Serratia marcescens and Pseudomonas
aeruginosa isolates using standardized reagents. Clin Microbiol Infect 5: 270-276.
18. Pavel AB, Vasile CI (2012) PyElph-a software tool for gel images analysis and
phylogenetics. BMC bioinformatics 13: 9. Available:
http://www.biomedcentral.com/1471-2105/13/9. Accessed 16 May 2014.
19. Zadoks RN, Griffiths HM, Munoz MA, Ahlstrom C, Bennett GJ, et al. (2011)
Sources of Klebsiella and Raoultella species on dairy farms: be careful where you
walk. J Dairy Sci 94: 1045-1051.
20. Rosenblueth M, Martinez L, Silva J, Martinez-Romero E (2004) Klebsiella variicola,
A Novel Species with Clinical and Plant-Associated Isolates. Syst Appl Microbiol
27: 27-35.
21. Paulin-Curlee GG, Singer RS, Sreevatsan S, Isaacson R, Reneau J, et al. (2007)
Genetic diversity of mastitis-associated Klebsiella pneumoniae in dairy cows. J
Dairy Sci 90: 3681-3689.
22. Gori A, Espinasse F, Deplano A, Nonhoff C, Nicolas MHln, et al. (1996) Comparison
of pulsed-field gel electrophoresis and randomly amplified DNA polymorphism
analysis for typing extended-spectrum-beta-lactamase-producing Klebsiella
pneumoniae. J Clin Microbiol 34: 2448-2453.
23. Esho FK, Enkhtuya B, Kusumoto A, Kawamoto K (2013) Microbial Assessment and
Prevalence of Foodborne Pathogens in Natural Cheeses in Japan. Biomed Res Int
2013.
![Page 60: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/60.jpg)
49
24. Boehmer JL, Bannerman DD, Shefcheck K, Ward JL (2008) Proteomic Analysis of
Differentially Expressed Proteins in Bovine Milk During Experimentally Induced
Escherichia coli Mastitis. J Dairy Sci 91: 4206-4218.
25. Tedeschi G, Taverna F, Negri A, Piccinini R, Nonnis S, et al. (2009) Serological
proteome analysis of Staphylococcus aureus isolated from sub-clinical mastitis.
Vet Microbiol 134: 388-391.
26. Carbonnelle E, Mesquita C, Bille E, Day N, Dauphin B, et al. (2011) MALDI-TOF
mass spectrometry tools for bacterial identification in clinical microbiology
laboratory. Clin Biochem 44: 104-109.
27. Brisse S, Van Himbergen T, Kusters K, Verhoef J (2004) Development of a rapid
identification method for Klebsiella pneumoniae phylogenetic groups and analysis
of 420 clinical isolates. Clin Microbiol Infect 10: 942-945.
28. Seki M, Gotoh K, Nakamura S, Akeda Y, Yoshii T, et al. (2013) Fatal sepsis caused
by an unusual Klebsiella species that was misidentified by an automated
identification system. J Med Microbiol 62: 801-803.
![Page 61: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/61.jpg)
50
Table 2.3.1.1: Details of genus and species level identification of 45 coliform isolates
obtained from milk samples from 11 Newfoundland dairy farms
using the different identification methods described in the current
study
a Number of pure culture isolates from CM cases from each farm are shown in
parenthesis b Final identification using a combination of the methods (biochemical/phenotypic tests,
MALDI-TOF and rpoB sequencing) are shown c Farms showed the presence of cephalothin-resistant E. cloacae
d E. cloacae could be identified using both MALDI-TOF and rpoB sequencing, but not
by standard biochemical/phenotypic methods e All isolates from this farm were identified as adonitol fermenting K. variicola
f K. variicola could be only identified by rpoB sequencing, but not by standard
biochemical/phenotypic methods or by MALDI-TOF
Farm of origin and
number of isolates a
Identification b
Farm 1 (26)
All K. pneumoniae
Farm 2 (1) All K. pneumoniae
Farm 3(5) c 4 K. pneumoniae and 1 E. cloacae
d
Farm 4 (2) All K. pneumoniae
Farm 5(3) c 2 K. pneumoniae and 1 E. cloacae
d
Farm 6 (2) All K. pneumoniae
Farm 7 (1) All K. pneumoniae
Farm 8 (1) All K. pneumoniae
Farm 9 (2) e All K. variicola
f
Farm 10 (1) All K. pneumoniae
Farm 11 (1) All K. pneumoniae
![Page 62: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/62.jpg)
51
![Page 63: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/63.jpg)
52
Figure 2.3.1.1: Phylogenetic tree derived from the rpoB partial gene sequences of all 45
isolates built using the neighbour joining method in the Molecular Evolutionary Genetic
Analysis (MEGA) package (version 6.06). Grouping of sequences of all the isolates were
based on % confidence obtained by using a boot-strap value of 1000. The isolates were
assigned labels based on the farm or origin (F1 to F11) followed by a number to identify
the infected animal. The results of antibiotic susceptibility testing are also shown beside
each isolate. S: sensitive, I: intermediate and R: resistant, based on Clinical and
Laboratory Standards Institute (CLSI) interpretation. The S/I/R designations for each
antibiotic are in the following order: cephalothin, ceftiofur, streptomycin, tetracycline and
trimethoprim sulfamethoxazole, respectively. The isolates identified as K. variicola, E.
cloacae and K. pneumoniae are also indicated.
![Page 64: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/64.jpg)
53
Table 2.3.1.2: Results of tests using K. variicola isolates for their ability to metabolize select carbohydrates including
adonitol, using the API 50 CHE kit after 24 hours of incubation (bioMérieux, Inc.)
Sample K. pneumoniae (cont)a F9-49 F9-58
No. Test Colourb Result
c Bubbles
d Colour Result Bubbles Colour Result Bubbles
0 0 R ⁻ A R ⁻ A R ⁻ A
1 GLY Y ⁺ P Y ⁺ P Y ⁺ A
2 ERY R ⁻ A R ⁻ A R ⁻ A
3 DARA R ⁻ A R ⁻ A R ⁻ A
4 LARA Y ⁺ P Y ⁺ P Y ⁺ P
5 RIB Y ⁺ A Y ⁺ P Y ⁺ A
6 DXYL Y ⁺ P Y ⁺ P Y ⁺ P
7 LXYL R ⁻ A R ⁻ A R ⁻ A
8 ADOe Y ⁺ P Y ⁺ A Y ⁺ A
9 MDX R ⁻ A R ⁻ A R ⁻ A
10 GAL Y ⁺ P Y ⁺ P Y ⁺ P
11 GLU Y ⁺ P Y ⁺ P Y ⁺ P
12 FRU Y ⁺ P Y ⁺ P Y ⁺ P
13 MNE Y ⁺ P Y ⁺ P Y ⁺ P
14 SBE Y ⁺ P Y ⁺ P Y ⁺ P
15 RHA Y ⁺ A Y ⁺ P Y ⁺ A
16 DUL R ⁻ A Y ⁺ P Y ⁺ P
17 INO Y ⁺ P Y ⁺ A Y ⁺ P
18 MAN Y ⁺ P Y ⁺ P Y ⁺ P
19 SOR Y ⁺ P Y ⁺ A Y ⁺ P
20 MDM R ⁻ A R ⁻ A R ⁻ A
21 MDG Y ⁺ A Y ⁺ P Y ⁺ A
22 NAG O ⁺ P O ⁺ P O ⁺ A
![Page 65: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/65.jpg)
54
Sample K. pneumoniae (cont)a F9-49 F9-58
No. Test Colourb Result
c Bubbles
d Colour Result Bubbles Colour Result Bubbles
23 AMY R ⁻ A R ⁻ A R ⁻ A
24 ARB Y ⁺ P Y ⁺ P Y ⁺ P
25 ESC B ⁻ A B ⁻ P B ⁻ A
26 SAL Y ⁺ P Y ⁺ P Y ⁺ P
27 CEL Y ⁺ P Y ⁺ P Y ⁺ P
28 MAL Y ⁺ P Y ⁺ P Y ⁺ P
29 LAC Y ⁺ P Y ⁺ P Y ⁺ P
30 MEL Y ⁺ P Y ⁺ P Y ⁺ P
31 SAC Y ⁺ P Y ⁺ P Y ⁺ A
32 TRE Y ⁺ P Y ⁺ P Y ⁺ P
33 INU R ⁻ A R ⁻ A R ⁻ A
34 MLZ R ⁻ A R ⁻ A R ⁻ A
35 RAF Y ⁺ P Y ⁺ P Y ⁺ P
36 AMD Y ⁺ P R ⁻ A R/O V A
37 GLYG R ⁻ A R ⁻ A R ⁻ A
38 XLT R ⁻ A R ⁻ A R ⁻ A
39 GEN Y ⁺ P Y ⁺ P Y ⁺ A
40 TUR R ⁻ A O ⁺ A R ⁻ A
41 LYX R ⁻ A O ⁺ A R ⁻ A
42 TAG Y ⁺ P Y ⁺ P Y ⁺ P
43 DFUC R ⁻ A R ⁻ A R ⁻ A
44 LFUC Y ⁺ P Y ⁺ P Y ⁺ A
45 DARL Y ⁺ P Y ⁺ P Y ⁺ P
46 LARL R ⁻ A R ⁻ A R ⁻ A
47 GNT O ⁺ P O ⁺ P R ⁻ P
48 2KG O ⁺ A O ⁺ P R/O V P
49 5KG R ⁻ A Y/O V P O ⁺ P
![Page 66: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/66.jpg)
55
a Laboratory strain K. pneumoniae ATCC 15380 was used in the analysis as a control
b Colour: R = red and Y = yellow
c Result: ‗+‘ = positive, ‗-‘ = negative and V = variable
d Bubbles: A = absent and P = present
e ADO = adonitol
All interpretations are based on the manufacturer‘s recommendations
![Page 67: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/67.jpg)
56
![Page 68: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/68.jpg)
57
Figure 2.3.2.1: Molecular epidemiology of CM associated coliform bacteria isolated
over a one year period from 11 dairy herds in Newfoundland. (A) Results from RAPD
analysis employing 1.5% agarose gels to separate PCR products. Chromosomal DNA
from a laboratory strain (K. pneumoniae ATCC 15380) was included as the positive
control and sterile water functioned as negative control in the PCR assays. A 100 bp
ladder (GeneDirex, USA, Cat No. DM001-R500) was used as the molecular weight
marker. (B) Dendrogram based on RAPD results showing relatedness between strains
was subjected to analysis in the current study. The dendrogram was generated by the
neighbor joining method with the PyElph software. (A, B and C) The isolates were
assigned labels based on the farm or origin (F1 to F11) followed by a number to identify
the infected animal. The isolates determined to be E. cloacae (*) and K. variicola (▲
) are
also indicated. (B) The results from antibiotic susceptibility testing are also shown next to
each isolate. S: sensitive, I: intermediate and R: resistant designations are assigned based
on established break points. The S/I/R designations for each drug are in the following
order: cephalothin, ceftiofur, streptomycin, tetracycline and trimethoprim
sulfamethoxazole, respectively. The isolates identified as K. variicola and E. cloacae on
further analysis are also indicated. (C) Re-analysis of strains by RAPD PCR to verify the
accuracy of the assay and to confirm identities. PCR products generated independently
for the second time using DNA from identical strains along with the positive control were
reanalyzed, which confirmed results shown in A.
![Page 69: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/69.jpg)
58
Table 2.3.3.1: Details regarding animal/farm ID, sample collection date, infected quarters sampled and California Mastitis
Test (CMT) results. Information regarding bacterial identification by various methods (culture/biochemical
tests, rpoB sequencing and MALDI-TOF), and antibiotic susceptibility test results (by minimum inhibitory
concentrations and Kirby Bauer disc diffusion method according to CLSI guideline) are also included.
Other organisms that were present in the samples besides K. pneumoniae based on biochemical/phenotypic
methods are also indicated
Lab
ID
Farm
/Animal
ID
Collection
Date
Qua CMT
b Growth on
MacConkey 3
agar with
crystal violet
Identification of isolates by
various methodsc
Antibiotic susceptibility
Test resulte
Other
organisms
present (if
any) rpoB Pheno
-type
MALDI-TOF
(Score value)d
CEFf CF
g S
h TE
i TS
j
1 001-007 6-Oct-11 LH 3+ Heavy + + + (2.397) S S I S R Streptococcus
uberisk
2 002-001 6-Oct-11 RH NA Very light + + + (2.526) S S S S S None
3 001-022 10-Nov-11 LH 3+ Light + + + (2.435) S S S S S Mixedk
4 004-001 12-Nov-11 RF 2+ Very light + + + (2.43) S S S S S None
5 001-001 21-Nov-11 NG 3+ Heavy + + + (2.18) S S I S S None
6 001-002 17-Nov-11 LF 3+ Heavy + + + (2.234) S S I S S None
7 001-004 15-Nov-11 RF NA Light + + + (2.456) S S I S S None
10 003-006a 13-Dec-11 LH 3+ Scanty + + + (2.382) S S R R S None
12 005-003 3-Jan-12 RH 3+ Heavy + + + (2.488) S S S S S None
13 006-004 28-Dec-11 RF 2+ Heavy + + + (2.446) S S R S S None
14 003-002 6-Jan-12 RH NA Heavy + + + (2.516) S S S S S None
15 003-005 6-Jan-12 RH NA Heavy + + + (2.504) S S R R S E. colik
16 007-001 17-Jan-12 RH NA Very scanty + + + (2.334) S S S S S None
17 001-015 16-Feb-12 RH NA Heavy + + + (2.473) S S S S R None
18 008-001 28-Feb-12 NG 2+ Light + + + (2.236) S S S S S Mixedk
![Page 70: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/70.jpg)
59
Lab
ID
Farm
/Animal
ID
Collection
Date
Qua CMT
b Growth on
MacConkey 3
agar with
crystal violet
Identification of isolates by
various methodsc
Antibiotic susceptibility
Test resulte
Other
organisms
present (if
any) rpoB Pheno
-type
MALDI-TOF
(Score value)d
CEFf CF
g S
h TE
i TS
j
19 001-014 25-Feb-12 RH NA Heavy + + + (2.466) S S R S S None
20 003-004 7-Mar-12 1Q 3+ Moderate + + + (2.425) S S S S S None
21 005-002 9-Mar-12 LF 2+ Very light + + + (2.494) S S R S S None
22 006-001 23-Mar-12 NA NA Scanty + + + (2.385) S S R I S Mixedk
25 003-006b 28-Mar-12 LH 3+ Scanty + + + (2.444) S S R R S None
27 001-009 5-Apr-12 RF NA Moderate + + + (2.481) S S I S S None
28 001-024 6-Apr-12 LF NA Moderate + + + (2.485) S S I S S None
29 001-011 15-Apr-12 RF NA Moderate NA + + (2.528) S S I I S None
30 001-006 10-May-12 RF NA Heavy + + + (2.426) S S I S S None
31 003-003 29-May-12 LH 3+ Heavy - + - (2.027) R S S S S None
32 001-008 16-May-12 RH NA Very light + + + (2.39) S S S S S None
33 001-010 20-May-12 LH NA Heavy + + + (2.477) S S I S R None
34 001-017 22-May-12 RF NA Very light + + + (2.507) S S S S S None
35 004-002 21-Jun-12 LH 3+ Light + + + (2.448) S S S S S Mixedk
36 001-025 21-Jun-12 RH NA Scanty + + + (2.481) S S R S S None
38 001-023 23-Jul-12 RF NA Very scanty + + + (2.443) S S R S S None
39 005-004 2-Aug-12 NG 3+ Moderate - + - (2.348) R S S S S coagulase
Neg.
Staphylococc
usk
41 001-018 14-Aug-12 RF NA Very light + + + (2.483) S S S S S None
42 001-027 13-Sep-12 RF NA Heavy + + + (2.396) S S S S S None
43 001-012 13-Sep-12 RF NA Scanty + + + (2.487) S S R S S None
44 001-013 13-Sep-12 LH NA Scanty + + + (2.481) S S S S S None
45 001-016 13-Sep-12 LH NA Moderate NA + + (2.423) S S S S S E.colik
46 001-019 13-Sep-12 RF NA Heavy + + + (2.358) S S R R S Mixedk
47 001-020 13-Sep-12 RF NA Scanty + + + (2.499) S S S S S None
![Page 71: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/71.jpg)
60
a Infected quarter of the udder sampled: RF = right forward, LF = Left forward, RH = right hind, LH = Left hind, 1Q = one quarter
and NG = not given b California Mastitis Test result: N/A = not applicable (as milk samples were frozen upon arrival), 2+/ 3+ = positive result. The
reaction of CMT is scored on a scale of 0 (mixture liquid, no precipitate) to 3 (almost-solid gel forms) where 2+ means distinct
gel formation and 3+ is strong gel formation that tends to adhere to paddle c Identification of isolates by various methods: + = positive for K. pneumoniae and - = negative for K. pneumoniae
d MALDI-TOF (Range of score value): 2.3-3.00 = highly probable species identification, 2.00-2.99 = secure genus identification,
probable species identification e Antibiotic susceptibility Test result: S = sensitive, I = intermediate and R = resistant
f CEF: ceftiofur
g CF: cephalothin
h S: streptomycin
i TE: tetracycline
j TS: trimethoprim sulfamethoxazole
Lab
ID
Farm
/Animal
ID
Collection
Date
Qua CMT
b Growth on
MacConkey 3
agar with
crystal violet
Identification of isolates by
various methodsc
Antibiotic susceptibility
Test resulte
Other
organisms
present (if
any) rpoB Pheno
-type
MALDI-TOF
(Score value)d
CEFf CF
g S
h TE
i TS
j
48 001-026 13-Sep-12 RH NA Scanty + + + (2.475) S S R S S None
49 009-001a 20-Sep-12 LH 3+ Scanty - + + (2.385) S S S S S None
50 005-001 25-Sep-12 RH 1+ Heavy + + + (2.447) S S S S S None
53 006-006 13-Aug-12 LH NA Scanty + + + (2.508) S S R S S None
54 010-001 3-Oct-12 NG 3+ Light + + + (2.422) S S S S S None
55 001-029 1-Oct-12 LF NA Moderate + + + (2.446) S S S S S None
56 009-001b 16-Oct-12 LH 3+ Light + + + (2.379) S S S S S None
58 009-004 27-Oct-12 LH 2+ Moderate - + + (2.372) S S S S S None
59 001-030 10-Oct-12 LF NA Light + + + (2.521) S S S S S None
60 011-001 26-Oct-12 LH 3+ Scanty + + + (2.449) S S S S S None
61 001-031 19-Oct-12 RF NA Heavy + + + (2.48) S S S S S None
![Page 72: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/72.jpg)
61
k In some cases other organisms were also detected in the milk samples, which could not be identified in certain instances
![Page 73: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/73.jpg)
62
Chapter 3: Typing of Mycobacterium avium subspecies paratuberculosis isolates
from Newfoundland using fragment analysis
Co-authorship statement
Study design and development: Drs. Kapil Tahlan (Department of Biology,
Memorial University of Newfoundland), Hugh G. Whitney (Animal Health Division,
Newfoundland and Labrador Department of Natural Resources) and Greg P. Keefe
(Department of Health Management, Atlantic Veterinary College, University of Prince
Edward Island). Initial diagnosis and establishment of Map cultures for subsequent
analysis were performed in the laboratories of Drs. Hugh G. Whitney and Greg P. Keefe.
Experiments were conducted by: Milka P. Podder (Department of Biology, Memorial
University of Newfoundland) and Susan E. Banfield (Department of Biology, Memorial
University of Newfoundland). Data was analyzed by: Milka P. Podder.
Reagents/materials/analysis tools were contributed by: Dr. Hugh G. Whitney and Dr.
Greg P. Keefe. Manuscript was written by: Milka P. Podder and Dr. Kapil Tahlan with
input from Drs. Hugh G. Whitney and Greg P. Keefe.
Portions of this chapter will be included in a manuscript currently under
preparation.
![Page 74: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/74.jpg)
63
Abstract
Short sequence repeat (SSR) typing of Mycobacterium avium subspecies
paratuberculosis (Map) isolates is one of the most discriminatory methods available for
genotyping this pathogen. Currently used techniques have challenges in analyzing
mononucleotide repeats >15 bp, which include some of the Map SSRs. Fragment analysis
is a relatively simple technique, which can measure the size of DNA fragments and can
be used to calculate the repeat length of the target SSR loci. In the present study,
fragment analysis was used to analyze 4 Map SSR loci known to provide sufficient
discriminatory power to determine the relationship between Map isolates. Eighty-eight
Map isolates from 18 animals from the island of Newfoundland were successfully
genotyped using fragment analysis. To the best of our knowledge, this is the first report
on Map SSR diversity from Newfoundland dairy farms. In addition, multiple Map SSR-
types were isolated from a single animal in many cases, which is not a common finding.
(154 words)
![Page 75: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/75.jpg)
64
3.1 Introduction
Mycobacterium avium subspecies paratuberculosis (Map) is a slow growing
bacterium and is the cause of Johne‘s disease, which is associated with chronic
debilitating granulomatous enteritis that affects the small intestine of cattle, sheep, goats,
farmed deer and other ruminants [1-6]. Johne‘s disease is a major cause of concern to the
dairy industry and there is also some concern regarding the association of Map with
Crohn‘s disease in humans [7-9]. Treatment of dairy animals infected with Map is
impractical because it can be only achieved by using a combination of antibiotics, many
of which are very expensive, not licensed for food animals and require long term dosing
[10]. Therefore, infected animals are culled, which is also a part of the Johne‘s disease
control/management practice [5]. Because diagnosis is very challenging early on in the
disease process, animals can still get infected by Map through exposure to shedding
asymptomatic animals and environmental contamination [11,12]. The long incubation
period of Map and the non-specific clinical symptoms in infected animals makes the
diagnosis, management and control of Johne‘s disease difficult. To decrease the spread of
Johne‘s disease, surveillance programs are being established throughout the world for
determining the sources of infections, the prevalence of the causative agent and the
relationship(s) between Map isolates from dairy farms. Studies are also being conducted
to examine the role of host genetics in determining the susceptibility of individual
animals and their clinical course once infected. Such programs are vital for devising
effective control strategies against this devastating disease [13].
More recently, there have been a number of reports on the molecular
epidemiology of Map. In previous studies, single or combined molecular methods have
![Page 76: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/76.jpg)
65
been used to obtain epidemiological data regarding Map strain types [14-16]. Most of the
previously used strain typing methods are expensive, time consuming, and lack
discriminatory capabilities [14,15,17]. Despite these limitations, the information obtained
from such studies is essential for identifying sources and transmission routes more
accurately. When combined with information on host genetics, strain typing studies can
also be used to determine strain pathogenicity and host resistance. Molecular techniques,
especially DNA-based short-sequence-repeat (SSR) analysis, have been shown to be
powerful tools for discriminating between Map isolates at the genetic level
[5,14,15,16,18]. Due to differences in the numbers of nucleotide repeats associated with
SSRs from different Map isolates, the relatedness and prevalence of Map strains can be
monitored within/between farms and the environment [14,18]. One major problem with
conventional methods for SSR analyses such as the use of Sanger sequencing, is that they
are prone to artifacts and failure due to challenges associated with determining the DNA
sequences of the repeats, with the most recent technology being capable of analyzing
repeats up to 15 bp using a mass spectrometry based approach [17]. Therefore, there is a
need to develop cheap, reliable and reproducible methods for Map SSR analysis, which
can accurately measure repeats totaling over 15 bp in length.
Recently, DNA fragment analysis of PCR products obtained using fluorescently
labeled primers was used for typing Map SSRs [16]. There is significant movement of
animals within the Newfoundland dairy industry, with new animals being brought onto
the island for entry into the production chain. In addition, some heifers are also shipped
to other Atlantic Canada provinces on the mainland for rearing, before they return as
adult cows, as it is economically more feasible to do so in some situations. Therefore,
![Page 77: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/77.jpg)
66
there is considerable interest in analyzing the diversity Map isolates infecting animals
from the island for comparison to those found elsewhere in North America. To achieve
this, in the current study we used fragment analysis to analyze Map isolates from five
Newfoundland dairy farms.
![Page 78: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/78.jpg)
67
3.2 Materials and Methods
3.2.1 Ethics statement
The described study was carried out under a formal agreement between the Dairy
Farmers of Newfoundland and Labrador (NL) and the Chief Veterinary Officer for the
Province of NL (HGW). The study was approved by the Institutional Animal Care
Committee (IACC, Memorial University of Newfoundland) as an ‗A‘ rated protocol
because the samples used in the study were obtained from routine veterinary diagnostic
submissions unrelated to this research. The report describes laboratory microbiological
analysis and did not directly involve any animals.
3.2.2 Media, reagents and culture conditions
All reagents and media used in the study were purchased from Sigma Aldrich,
Fisher Scientific or VWR International, Canada, unless otherwise mentioned. DNA
oligonucleotide primers were purchased from Integrated DNA Technologies (USA).
Fecal samples from 18 animals displaying varying clinical symptoms of Johne‘s disease
or suspected of being infected (Table 3.2.2.1) were collected by the Animal Health
Division, Department of Natural Resources, Government of NL and were sent to the
Atlantic Veterinary College, UPEI for diagnosis. Trek-ESP II liquid culture using Trek
ESP Para-JEM media (Thermo Scientific, Canada) was used to culture Map from bovine
fecal samples as described previously [19], and mycobacteria were verified by acid-fast
staining. Map cultures were grown at 37°C. To confirm the presence of Map in the
cultures, chromosomal DNA was isolated using the Tetracore Map extraction system and
was used as a template along with the Tetracore VetAlertTM
Johne‘s Real-Time PCR kit
![Page 79: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/79.jpg)
68
as per the manufacturer‘s instructions (Tetracore, USA). After the described analysis, the
culture samples were stored as frozen glycerol stocks and were sent to the Memorial
University of Newfoundland for further analysis.
The culture samples from UPEI were streaked out onto Middlebrook 7H11 agar
plates supplemented with oleic acid-albumin-dextrose-catalase (OADC) and mycobactin
J (2 mg/L, Allied Monitor, USA) to obtain isolated Map colonies as described previously
[14]. The PANTA (polymyxin B, amphotericin B, nalidixic acid, trimethoprim and
azlocillin) antibiotic mixture was also added to the medium to prevent the growth of other
contaminating microorganisms [20]. The plates were incubated for 4-6 months until
minute colonies were observed, which were confirmed to be Map by acid-fast staining.
Three to five isolated colonies from each plate (corresponding to each animal) were then
used to inoculate separate 5 mL Middlebrook 7H9 broth cultures supplemented with
albumin-dextrose-catalase (ADC) and mycobactin J (2 mg/L). To avoid the clumping of
cells, culture tubes contained sterile glass beads and were incubated with agitation.
Growth was observed for 88 isolates (3-5 isolates sampled from each animal) after 2-3
months of incubation based on an increase in the turbidity of the cultures, which were
then used to prepare glycerol stocks for storage and for chromosomal DNA isolation as
described below. Acid-fast staining was performed at different stages to ensure that the
cultures were axenic.
3.2.3 Chromosomal DNA isolation, SSR sequencing and fragment analysis
The QIAamp DNA Mini kit (Qiagen, Canada) was used for isolating
chromosomal DNA from the remaining 3.5 ml 7H9 cultures from above using 0.1 mm
![Page 80: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/80.jpg)
69
zirconia silica beads and a SpeedMill PLUS homogenizer (Analytik Jena, Germany)
according to the manufacturer‘s recommendations. All PCR reactions were performed
using the Phusion High-Fidelity PCR Kit along with 3% DMSO and the GC buffer (New
England Biolabs, Inc.). PCR products were visualized by agarose gel electrophoresis,
purified using the EZ-10 Spin Column PCR Products Purification Kit (Bio Basic,
Canada) and were sent for DNA sequencing or fragment analysis to The Centre for
Applied Genomics (TCAG), University of Toronto, Canada. The four SSR loci (L1-L4)
previously shown to provide good discriminatory power for subtyping Map isolates were
chosen for analysis [5,14]. The DNA sequences of the four SSR repeats were determined
for three Map isolates obtained as part of a separate study as described previously [5,14].
The sequences of the 4 loci for the Map K10 (genome sequenced strain) were obtained
from the database [21]. Sequences were obtained to determine the exact numbers of the
SSR repeats for each of the strains, for the strains to be used as standards (S) during
fragment analysis.
For fragment analysis, four primer pairs were designed which were specific for
each locus to give PCR products ranging from 127 to 255 bp, and one primer from each
pair was labeled with 6-fluorescein amidite (6-FAM). Primers that have the 6-FAM dye
next to a guanine base near the 5' end can have decreased fluorescence. Therefore, the
most appropriate of either the forward or the reverse primer from each pair was labeled to
avoid any complications. The DNA sequences of the primers used for obtaining PCR
products for fragment analysis for each locus were as follows: L1 (F:
GGTGTTCGGCAAAGTCGTT/R: TTGACGATCACCAGCCCG), L2 (F:
TCGCCTCAGGCTTTACTGAT/R: CACGTAGGTCCGCTGATGA), L3
![Page 81: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/81.jpg)
70
(AGGCCTTCTACGTGCACAAC/R: GAGATGTCCAGCCCTGTCTC) and L4 (F:
CTCGTGGAAACCCTCGAC/R: GGTGCTGAAATCCGGTGT). Unpurified PCR
products were sent to the TCAG facilities for fragment analysis using the ABI 3730XL or
3100 capillary electrophoresis instruments using the GeneScan™ 500 ROX™ Size
Standard, which is capable of accurately sizing DNA fragments ranging from 35 to 500
bp (http://www.tcag.ca/facilities/geneticAnalysis.html). The Peak Scanner software v1.0
(Applied Biosystems) was used to analyze the fragment profiles/peaks to determine the
sizes of the DNA fragments, which were used to calculate SSR copy numbers.
Comparison of the fragment sizes from Newfoundland isolates with those from the
sequenced standards, which were included in every fragment analysis run, enabled the
determination of the exact copy number of each repeat at the target SSR loci. If fragment
analysis showed a difference in 1 bp for L1 and L2 (mononucleotide repeats), and 3 bp
for L3 and L4 (tri-nucleotide repeats) between a fragment from an isolate and a standard,
it implied that there was a difference in one copy of the repeat between the two strains
(Table 3.2.3.1). In total 44 SSR-types were assigned on the basis of the combinations of
alleles for each locus and the information was used to build a dendrogram using the
BioNumerics 7.1 program (Applied Maths, Inc., USA). The unweighted pair group
method with arithmetic mean was used to create a minimum spanning tree using the same
program; this portrays the level of divergence between strains utilizing pairwise genetic
distances [22]. It was possible to directly compare SSRs up to 14 bps from the current
study with those reported previously. Longer SSRs identified in the current study were
deemed to be similar, but not the same as those from previous studies which were
reported as >14 bp.
![Page 82: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/82.jpg)
71
3.3 Results and Discussion
3.3.1 Fragment analysis on Map isolates
The sequencing of DNA repeats using conventional methods is often challenging
and is prone to artifacts, which is further exacerbated by repeats with high GC content
such as those found in Map. In addition, currently available technologies can only
determine the lengths of repeats up to ~15 bp accurately and often longer repeats cannot
be measured [17]. In the case of Map, it has been previously reported that the analysis of
4 SSRs (L1/L2: mononucleotide, and L3/L4 trinucleotide) provides enough sequence
information for strain discrimination, and that one of the mononucleotide SSRs (L1) can
be >14 bp in length depending on the isolate [5,14]. In our own studies we found that the
sequencing of PCR products containing SSRs 14 bp using the Sanger method was not
straightforward (Figure A.1). Previous reports also describe similar problems where the
L1 SSR had sequencing errors during analysis, leading to the misinterpretation of repeat
lengths [17]. Therefore, to overcome issues associated with the analysis of Map SSRs, we
adapted fragment analysis as a method to analyze Map isolates from 5 dairy farms from
Newfoundland [16]. Fecal samples were collected from 18 animals, some of which
showed clinical signs of Johne‘s disease, displayed an immune response against Map in
milk samples collected during previous surveys or were suspected of being infected
(Table 3.2.2.1). The samples were processed to obtain 18 primary fecal cultures, which
were then used to establish 88 axenic cultures for use in the current study.
Before using the fragment analysis based approach, three Map isolates (referred to
as control strains from hereon) that were obtained as part of another study were subjected
to SSR sequencing using the Sanger method as described previously [5,14,15,18].
![Page 83: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/83.jpg)
72
Multiple sequencing runs were carried out until we could reproducibly sequence across
the SSRs (Figure A.1). This was done to determine the exact numbers of repeats at the
four SSR loci for the respective isolates for subsequent use as standards for comparisons
during fragment analysis. Again, we could only obtain accurate and reliable sequences
for SSRs smaller than 14 bp using Sanger method (Figure A.1). The lengths of the SSRs
for the K10 strain were already known (L1:19, L2:10, L3:5 and L4:5) because its genome
has been sequenced [21]. Next, the four loci specific sets of fluorescently labeled primers
were used in separate PCR reactions along with chromosomal DNA as template from the
control strains described above. Since the exact numbers of SSRs present in each PCR
product were known from Sanger sequencing for the control strains, they were included
as size standards in all future fragment analysis experiments.
Chromosomal DNA was isolated from 88 axenic Map cultures established using
samples from Newfoundland, and were used as template to obtain fluorescently labeled
PCR products for fragment analysis. Comparison of each SSR PCR product with the
respective standards described above provided accurate data regarding the copy number
of the repeats at each locus for all 88 isolates in a short period of time (Table 3.2.3.1). In
the current study we were also able to analyze L2, which was not possible in a previous
report that also used fragment analysis [16]. Control strains were reanalyzed by fragment
analysis to rule out ambiguities. After excluding Map isolates from the same animal with
identical SSR profiles, a total of 70 isolates with 44 different SSR-types (M1-M44) were
identified from 18 animals from 5 different Newfoundland farms (Table 3.3.1.1). In
addition, in many cases Map with multiple SSR-types were isolated from the same
animal (Table 3.2.3.1).
![Page 84: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/84.jpg)
73
3.3.2 Comparison with other epidemiological data
The most predominant SSR-types were M1 and M4, which were isolated from 5
separate animals each from different farms (Table 3.3.1.1 and Figure 3.3.2.1). One reason
for this observation could be the random distribution of Map SSR-types within farms
following animal movement between farms, which is known to increase the probability
of detecting multiple and/or similar strains on the farms involved [23]. Most SSR-types in
the population were closely related to M4, differing from it by only 1-2 SSR loci (Figure
3.3.2.2). Overall, some farm based clustering of isolates was observed (Figure 3.3.2.1). A
high level of diversity was seen in isolates from farm A, which alone had 23 different
SSR-types out of the 44 detected. Eight SSR-types present on farm A were also present
on other farms (C, E, F; Figure 3.3.2.1) suggesting possible inter herd transmission or a
common source of infection. SSR-types from farm D were not detected on other farms,
although they showed some level of genetic similarity with isolates from farm C (Figure
3.3.2.1). Animals from farm F did not exhibit any clinical signs of Johne‘s disease, but
tested positive for Map with unique SSR-types, in addition to SSR-types found on other
farms also (Figure 3.3.2.1).
3.3.3 Conclusions
The resolution of long SSRs by fragment analysis and the recent report showing
that the technique can be multiplexed for analyzing multiple SSRs [16] further
demonstrates the power and versatility of this technique for typing Map isolates. Future
studies using techniques with better resolution capabilities and samples from other
regions of North America will help to explain if the previously unidentified Map SSRs-
![Page 85: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/85.jpg)
74
types reported in the current study are unique to Newfoundland or if they were not
detected due to technical limitations. In addition, results from the current study also
indicated Map co-infection with multiple genotypes within a single animal, which has
been reported as a rare event [18]. The isolation of multiple genotypes from the same
animal could be due to evolving SSR-types as a result of the instability associated with
long DNA repeats [24]. Alternatively they might represent true co-infections due to the
movement of animals within Newfoundland and between Atlantic Canada, which is
important in terms of source tracking and the status of the animals involved. As part of
another study we were also able to obtain Map isolates with different SSR copy numbers
from single animals from a farm in Atlantic Canada (unpublished data). Therefore,
studies are currently underway to address the significance and implications of these
findings.
![Page 86: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/86.jpg)
75
3.4 References
1. Bannantine JP, Waters WR, Stabel JR, Palmer MV, Li L, et al. (2008) Development
and use of a partial Mycobacterium avium subspecies paratuberculosis protein
array. Proteomics 8: 463-474.
2. Castellanos E, Aranaz A, Gould KA, Linedale R, Stevenson K, et al. (2009) Discovery
of stable and variable differences in the Mycobacterium avium subsp.
paratuberculosis type I, II, and III genomes by pan-genome microarray analysis.
Appl Environ Microbiol 75: 676-686.
3. Ferrouillet C, Wells SJ, Hartmann WL, Godden SM, Carrier J (2009) Decrease of
Johne's disease prevalence and incidence in six Minnesota, USA, dairy cattle
herds on a long-term management program. Prev Vet Med 88: 128-137.
4. Liu X, Feng Z, Harris NB, Cirillo JD, Bercovier H, et al. (2001) Identification of a
secreted superoxide dismutase in Mycobacterium avium ssp. paratuberculosis.
FEMS Microbiol Lett 202: 233-238.
5. Pradhan AK, Mitchell RM, Kramer AJ, Zurakowski MJ, Fyock TL, et al. (2011)
Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis in a
longitudinal study of three dairy herds. J Clin Microbiol 49: 893-901.
6. Stabel JR (2000) Cytokine secretion by peripheral blood mononuclear cells from cows
infected with Mycobacterium paratuberculosis. Am J Vet Res 61: 754-760.
7. Naser SA, Schwartz D, Shafran I (2000) Isolation of Mycobacterium avium subsp
paratuberculosis from breast milk of Crohn's disease patients. Am J Gastroenterol
95: 1094-1095.
8. Prantera C, Scribano ML (1999) Crohn's disease: the case for bacteria. Ital J
Gastroenterol Hepatol 31: 244-246.
9. Ghadiali AH, Strother M, Naser SA, Manning EJ, Sreevatsan S (2004) Mycobacterium
avium subsp. paratuberculosis strains isolated from Crohn's disease patients and
animal species exhibit similar polymorphic locus patterns. J Clin Microbiol 42:
5345-5348.
10. Hermon-Taylor J (2002) Treatment with drugs active against Mycobacterium avium
subspecies paratuberculosis can heal Crohn's disease: more evidence for a
neglected public health tragedy. Dig Liver Dis 34: 9-12.
11. Kalis CH, Collins MT, Barkema HW, Hesselink JW (2004) Certification of herds as
free of Mycobacterium paratuberculosis infection: actual pooled faecal results
versus certification model predictions. Prev Vet Med 65: 189-204.
![Page 87: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/87.jpg)
76
12. Settles M, Zanella R, McKay SD, Schnabel RD, Taylor JF, et al. (2009) A whole
genome association analysis identifies loci associated with Mycobacterium avium
subsp. paratuberculosis infection status in US holstein cattle. Anim Genet 40:
655-662.
13. Manning EJ, Collins MT (2001) Mycobacterium avium subsp. paratuberculosis:
pathogen, pathogenesis and diagnosis. Rev Sci Tech 20: 133-150.
14. Amonsin A, Li LL, Zhang Q, Bannantine JP, Motiwala AS, et al. (2004) Multilocus
short sequence repeat sequencing approach for differentiating among
Mycobacterium avium subsp. paratuberculosis strains. J Clin Microbiol 42: 1694-
1702.
15. El-Sayed A, Hassan AA, Natour S, Abdulmawjood A, Bulte M, et al. (2009)
Evaluation of three molecular methods of repetitive element loci for
differentiation of Mycobacterium avium subsp. paratuberculosis (MAP). J
Microbiol 47: 253-259.
16. Oakey J, Gavey L, Singh SV, Platell J, Waltisbuhl D (2014) Variable-number tandem
repeats genotyping used to aid and inform management strategies for a bovine
Johne‘s disease incursion in tropical and subtropical Australia. J Vet Diagn Invest
26: 651-657.
17. Ahlstrom C, Barkema HW, De Buck J (2014) Improved Short-Sequence-Repeat
Genotyping of Mycobacterium avium subsp. paratuberculosis by Using Matrix-
Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Appl
Environ Microbiol 80: 534-539.
18. Harris NB, Payeur JB, Kapur V, Sreevatsan S (2006) Short-sequence-repeat analysis
of Mycobacterium avium subsp. paratuberculosis and Mycobacterium avium
subsp. avium isolates collected from animals throughout the United States reveals
both stability of loci and extensive diversity. J Clin Microbiol 44: 2970-2973.
19. Tiwari A, VanLeeuwen JA, McKenna SL, Keefe GP, Barkema HW (2006) Johne's
disease in Canada Part I: clinical symptoms, pathophysiology, diagnosis, and
prevalence in dairy herds. Can Vet J 47: 874-882.
20. Whittington RJ, Marsh IB, Saunders V, Grant IR, Juste R, et al. (2011) Culture
phenotypes of genomically and geographically diverse Mycobacterium avium
subsp. paratuberculosis isolates from different hosts. J Clin Microbiol 49: 1822-
1830.
![Page 88: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/88.jpg)
77
21. Li L, Bannantine JP, Zhang Q, Amonsin A, May BJ, et al. GenBank; 2005 Database:
RefSeq: NCBI Reference Sequence Database [Internet]. Accessed:
http://www.ncbi.nlm.nih.gov/nuccore/AE016958.
22. Sohal JS, Arsenault J, Labrecque O, Fairbrother JH, Roy JP, et al. (2014) Genetic
structure of Mycobacterium avium subspecies paratuberculosis population in
Quebec cattle herds revealed by using a combination of multi-locus genomic
analysis. J Clin Microbiol 52: 2764-2775.
23. Ricchi M, Barbieri G, Taddei R, Belletti GL, Carra E, et al. (2011) Effectiveness of
combination of Mini-and Microsatellite loci to sub-type Mycobacterium avium
subsp. paratuberculosis Italian type C isolates. BMC Vet Res 7: 54. Available:
http://www.biomedcentral.com/1746-6148/7/54. Accessed 3 January 2015.
24. Kasnitz N, Köhler H, Weigoldt M, Gerlach GF, Möbius P (2013) Stability of
genotyping target sequences of Mycobacterium avium subsp. paratuberculosis
upon cultivation on different media, in vitro-and in vivo passage, and natural
infection. Vet Microbiol 167: 573-583.
![Page 89: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/89.jpg)
78
Table 3.2.2.1: Details of 18 animals from Newfoundland regarding assigned
identification numbers (IDs) and status of the animal from which
the primary Trek-ESP II liquid cultures were derived
Farm/animal
IDa
Animal
status/symptomsb
A-001 Clinical signs
A-002 Clinical signs
A-005 Clinical signs
A-006 Milk Positive for Map
A-007 Milk Positive for Map
A-008 Milk Positive for Map
A-009 Milk Positive for Map
A-010 Milk Positive for Map
A-011 Clinical signs
C-001 Clinical signs
C-002 Clinical signs
C-003 Clinical signs
C-004 Clinical signs
C-005 Clinical signs
D-001 Clinical signs
E-001 Clinical signs
F-001 Normal
F-002 Normal
a
The first letter denotes the farm of origin followed by a identification number assigned
to each respective animal (ID: Identity) b The status of each animal sampled for Trek-ESP II liquid culture for Map analysis is
included. Animals were either asymptomatic (normal), showed clinical signs of Johne‘s
disease or had milk samples which showed a positive immune response against Map
during previous surveys
![Page 90: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/90.jpg)
79
Table 3.2.3.1: Fragment analysis results for the 4 SSR loci of all 88 Map isolates
derived from 18 Newfoundland animals. Strain types were
designated as M1-M44 based on their unique SSR combinations
Farm/animal/isolate
IDa
DTPb
L-1
(G)c
L-2
(G)c
L-3
(GGT)c
L-4
(TGC)c
SSR-
Type
A-001-1 27 21 10 5 5 M20
A-001-2 27 14 10 5 5 M1
A-001-3 27 19 11 5 5 M21
A-001-4 27 16 11 5 5 M2
A-001-5 27 20 9 5 5 M22
A-003-1d 32 17 11 5 5 M3
A-003-2d 32 17 11 5 5 M3
A-003-3d 32 17 11 5 5 M3
A-003-4 32 11 10 5 5 M16
A-003-5 32 11 11 5 5 M4
A-005-1d 13 11 12 5 5 M5
A-005-2 13 20 10 5 5 M23
A-005-3 13 16 11 5 5 M2
A-005-4d 13 11 12 5 5 M5
A-005-5 13 15 10 5 5 M11
A-006-1 28 12 10 5 5 M15
A-006-2 28 16 12 5 5 M10
A-006-3 28 7 10 5 5 M13
A-006-4 28 13 11 5 5 M14
A-006-5 28 16 12 5 5 M10
A-007-1d 22 11 11 5 5 M4
A-007-2 22 10 10 5 5 M33
A-007-3 22 15 10 5 5 M11
A-007-4 22 14 10 5 5 M1
A-007-5d 22 11 11 5 5 M4
A-008-1 46 18 11 5 5 M12
A-008-2 46 16 10 5 5 M19
A-008-3 46 20 11 5 5 M34
A-008-4 46 7 10 5 5 M13
A-008-5 46 7 11 5 5 M35
A-009-1d 36 13 11 5 5 M14
A-009-2 36 11 11 5 5 M4
A-009-3 36 14 11 5 5 M36
![Page 91: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/91.jpg)
80
Farm/animal/isolate
IDa
DTPb
L-1
(G)c
L-2
(G)c
L-3
(GGT)c
L-4
(TGC)c
SSR-
Type
A-009-4 36 18 11 5 5 M12
A-009-5d 36 13 11 5 5 M14
A-010-1d 49 12 10 5 5 M15
A-010-2 49 15 9 5 5 M37
A-010-3d 49 12 10 5 5 M15
A-010-4 49 12 9 5 5 M17
A-010-5 49 16 11 5 5 M2
A-011-1d 8 15 11 5 5 M18
A-011-2 8 11 11 5 5 M4
A-011-3d 8 15 11 5 5 M18
A-011-4 8 10 11 5 5 M44
A-011-5 8 15 10 5 5 M11
C-001-1d 28 14 10 5 5 M1
C-001-2d 28 14 10 5 5 M1
C-001-3 28 15 11 5 5 M18
C-001-4d 28 11 11 5 5 M4
C-001-5d 28 11 11 5 5 M4
C-002-1 28 5 11 4 4 M6
C-002-2d 28 14 10 5 5 M1
C-002-3d 28 14 10 5 5 M1
C-002-4 28 6 12 4 4 M24
C-002-5 28 5 11 4 4 M6
C-003-1d 17 15 14 5 5 M7
C-003-2 17 13 13 5 5 M8
C-003-3d 17 15 14 5 5 M7
C-003-4 17 6 13 5 5 M25
C-003-5 17 13 13 5 5 M8
C-004-1 32 8 11 4 5 M26
C-004-2d 32 9 12 4 5 M9
C-004-3 32 9 11 4 5 M27
C-004-4d 32 9 12 4 5 M9
C-004-5d 32 9 12 4 5 M9
C-005-1 40 11 10 5 5 M16
C-005-2 40 10 13 4 5 M28
C-005-3 40 11 10 5 5 M16
C-005-4 40 10 12 4 5 M29
C-005-5 40 11 10 5 5 M16
![Page 92: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/92.jpg)
81
Farm/animal/isolate
IDa
DTPb
L-1
(G)c
L-2
(G)c
L-3
(GGT)c
L-4
(TGC)c
SSR-
Type
D-001-1 13 5 15 4 4 M30
D-001-2 13 7 15 4 4 M31
D-001-3 13 7 14 4 4 M32
E-001-1 18 11 11 4 5 M38
E-001-2 18 18 11 5 5 M12
E-001-3 18 15 10 5 5 M11
E-001-4 18 11 9 5 5 M39
E-001-5 18 7 11 6 5 M40
F-001-1 19 18 9 5 5 M41
F-001-2 19 19 9 5 5 M42
F-001-3 19 16 7 5 5 M43
F-001-4 19 12 9 5 5 M17
F-001-5 19 12 10 5 5 M15
F-002-1 35 16 10 5 5 M19
F-002-2 35 14 10 5 5 M1
F-002-3 35 16 10 5 5 M19
F-002-4 35 16 11 5 5 M2
F-002-5 35 17 11 5 5 M3
a
The first letter denotes the farm of origin followed by a number assigned to the animal
and the last number corresponds to the single colony/isolate from 7H11 plates that were
used in the analysis. In every case, 3-5 colonies were picked for analysis from each
7H11 plate based on colony morphology and acid fast staining results
b DTP: Days to positive, days of incubation after which growth was detected in the
automated Trek-ESP II liquid culture system c Genotyping of SSRs (mononucleotide or trinucleotide) for the four loci (L): locus 1 (G
repeats), locus 2 (G repeats), locus 3 (GGT repeats) and locus 4 (TGC repeats). The
copy numbers of each SSR for all isolates are shown d Map with identical SSR-types isolated from the same animal are indicated and were
treated as duplicates during subsequent analysis
![Page 93: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/93.jpg)
82
Table 3.3.1.1: Details of the 44 Map SSR-types that were isolated from five
Newfoundland farms in the current study and were analyzed using
fragment analysis
L-1
(G)a
L-2
(G)a
L-3
(GGT)a
L-4
(TGC)a
SSR-typeb
No. of
Animals with
SSR-typec
Farm IDd
14 10 5 5 M1 5 A(2), C(2), F(1)
16 11 5 5 M2 4 A(3), F(1)
17 11 5 5 M3 2 A(1), F(1)
11 11 5 5 M4 5 A(4), C(1)
11 12 5 5 M5 1 A(1)
5 11 4 4 M6 2 C(2)
15 14 5 5 M7 1 C(1)
13 13 5 5 M8 1 C(1)
9 12 4 5 M9 1 C(1)
16 12 5 5 M10 1 A(1)
15 10 5 5 M11 4 A(3), E(1)
18 11 5 5 M12 3 A(2), E(1)
7 10 5 5 M13 2 A(2)
13 11 5 5 M14 2 A(2)
12 10 5 5 M15 3 A(2), F(1)
11 10 5 5 M16 2 A(1), C(1)
12 9 5 5 M17 2 A(1), F(1)
15 11 5 5 M18 2 C(1), A(1)
16 10 5 5 M19 2 A(1), F(1)
21 10 5 5 M20 1 A(1)
19 11 5 5 M21 1 A(1)
20 9 5 5 M22 1 A(1)
20 10 5 5 M23 1 A(1)
6 12 4 4 M24 1 C(1)
6 13 5 5 M25 1 C(1)
8 11 4 5 M26 1 C(1)
9 11 4 5 M27 1 C(1)
10 13 4 5 M28 1 C(1)
10 12 4 5 M29 1 C(1)
5 15 4 4 M30 1 D(1)
7 15 4 4 M31 1 D(1)
7 14 4 4 M32 1 D(1)
![Page 94: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/94.jpg)
83
L-1
(G)a
L-2
(G)a
L-3
(GGT)a
L-4
(TGC)a
SSR-typeb
No. of
Animals with
SSR-typec
Farm IDd
10 10 5 5 M33 1 A(1)
20 11 5 5 M34 1 A(1)
7 11 5 5 M35 1 A(1)
14 11 5 5 M36 1 A(1)
15 9 5 5 M37 1 A(1)
11 11 4 5 M38 1 E(1)
11 9 5 5 M39 1 E(1)
7 11 6 5 M40 1 E(1)
18 9 5 5 M41 1 F(1)
19 9 5 5 M42 1 F(1)
16 7 5 5 M43 1 F(1)
10 11 5 5 M44 1 A(1)
a The number/copies of repeats for each SSR detected in the current study are indicated.
b SSR-types were designated as M1-M44 based on the copy number of the repeats for the
4 SSR loci used in the analysis.
c The total number of animals are indicated from which Map with the respective SSR-
types (M1-M44) were isolated d
The assigned identity (ID) of each farm is indicated by capital letters followed by the
number of animals from that farm from which Map with the specific SSR-type was
isolated. For example, A(3) implies that 3 individual animals from Farm A had Map
with the specific SSR-type
![Page 95: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/95.jpg)
84
Figure 3.3.2.1: Dendrogram representing the genetic relationship between all Map isolates
based on the 4 SSRs loci used in the analysis. The dendrogram was built using the
unweighted pair group method with arithmetic mean (UPGMA) using the BioNumerics
7.1 multilocus sequence typing program. Genetic distance (Categorical coefficient) is
indicated at the top of the dendrogram. SSR-types, number of isolates (n) and farm ID are
displayed to the right side of the dendrogram.
![Page 96: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/96.jpg)
85
Figure 3.3.2.2: Minimum spanning tree (MST) based on the SSR profiles of the 4 loci for
all 44 SSR-types identified in the current study. The circles represent the different strain
types generated by the BioNumerics 7.1 multilocus sequence typing program. The number
of Map isolates (after omitting duplicates from the same animal) belonging to each SSR-
type is shown in parenthesis within the respective circles. Thick lines represent only one
variation amidst the 4 loci, whereas thin lines represent 2 differences between the 4 loci,
the latter of which is indicated.
![Page 97: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/97.jpg)
86
Chapter 4: Summary
4.1 K. pneumoniae
The purpose of the research conducted in chapter two was to apply molecular
methods for identifying and strain typing Gram-negative bacteria isolated from animals
with CM, thus broadening our knowledge regarding the diversity of Klebsiella spp.
present on a subset of Newfoundland dairy farms. Strain typing was performed using
RAPD analysis, which is a quick and cost-effective method and provided valuable
information regarding genetic relationship between different Klebsiella isolates.
Furthermore, drug sensitivity profiles of the isolates were also determined and mapped on
to the dendrograms, but relationships between resistance profiles/patterns and
transmission were not observed.
Through the use of mass spectrometry and gene sequencing, it was found that K.
variicola and E. cloacae were misidentified as K. pneumoniae in a small number of CM
cases from Newfoundland, during the one year study. K. variicola, which is normally
considered as an environmental and hospital-acquired opportunistic bacterium [1], had
not been isolated previously from animals with CM. Therefore, the standard tests to
discriminate Klebsiella species are not sensitive enough for detecting K. variicola and
other Gram negative pathogens. Overall, polyclonal infection patterns were observed in
the majority of farms, and a predominant or overrepresented strain was not observed in
any of the cases. In the future, whole genome sequencing of the K. variicola isolates will
be conducted, which will help to reveal the virulence factors and pathogenicity associated
mechanisms present in this newly emerging pathogen [2].
![Page 98: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/98.jpg)
87
4.2 Map
The goal of the research described in chapter three was to apply a cost effective
molecular method (fragment analysis) for SSR typing of Map strains isolated from five
dairy herds in Newfoundland. The information obtained using this method was useful for
differentiating/subtyping Map strains and for analyzing molecular diversity.
SSR typing of Map isolates by mass spectrometry and Sanger sequencing are
currently the most discriminatory genotyping methods used in epidemiological analyses,
although both techniques fail to accurately resolve mononucleotide repeats longer than 15
bp [3-7]. There is also a need for an inexpensive, fast and reliable method for
differentiating Map isolates, which could be fulfilled by fragment analysis. Fragment
analysis was conducted on 88 isolates form Newfoundland dairy farms based on SSRs of
4 loci, and 44 distinct strains were successfully genotyped and differentiated. A
polyclonal infection pattern was mostly observed between and within farms, and no
predominant or overrepresented strains were identified. The total number of Map SSR-
types found in animal isolates was higher in dairy herds from Newfoundland, compared
to farms from other geographical regions in related studies [5,6,8]. Thus, a fragment
analysis based approach for SSR-typing would be an improved strain typing method
compared to other molecular methods due to its high resolution capability and
discriminatory power. Thus, this method can be useful in generating and analyzing large
quantities of molecular epidemiologic data within a short time frame. In the future, Map
isolates from dairy herds from other provinces in Atlantic Canada (except Prince Edward
Island) will be subjected to fragment analysis for comparison to the SSR-types that were
identified in Newfoundland in the current study.
![Page 99: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/99.jpg)
88
4.3 Conclusion
Overall goal of this thesis was to genetically type two animal pathogens that cause
significant financial losses to the dairy industry in NL and other regions of the world. The
two molecular methods described in this study were easily adaptable and were robust
enough to differentiate among different isolates of Klebsiella and Map, respectively.
Results from the described work showed that a single genotype could not be associated
with large scale infections, suggesting a polyclonal pattern in the circulating isolates for
each pathogen, based on the techniques used in the current analysis. Thus, in the future
whole genome sequencing studies should be performed for more in-depth genetic
analysis of the Map isolates so that the questions regarding co- or multiple- infections
within/between animal(s) can be clarified, which is important in terms of source tracking
and the status of the animals involved. Future research will contribute to the significance
and implications of the described/current findings.
![Page 100: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/100.jpg)
89
4.4 References
1. Rosenblueth M, Martinez L, Silva J, Martinez-Romero E (2004) Klebsiella variicola,
A Novel Species with Clinical and Plant-Associated Isolates. Syst Appl Microbiol
27: 27-35.
2. Seki M, Gotoh K, Nakamura S, Akeda Y, Yoshii T, et al. (2013) Fatal sepsis caused by
an unusual Klebsiella species that was misidentified by an automated
identification system. J Med Microbiol 62: 801-803.
3. Amonsin A, Li LL, Zhang Q, Bannantine JP, Motiwala AS, et al. (2004) Multilocus
short sequence repeat sequencing approach for differentiating among
Mycobacterium avium subsp. paratuberculosis strains. J Clin Microbiol 42: 1694-
1702.
4. Forde T, Kutz S, De Buck J, Warren A, Ruckstuhl K, et al. (2012) Occurrence,
diagnosis, and strain typing of Mycobacterium avium subspecies paratuberculosis
infection in Rocky Mountain bighorn sheep (Ovis canadensis canadensis) in
southwestern Alberta. J Wildl Dis 48: 1-11.
5. Pradhan AK, Mitchell RM, Kramer AJ, Zurakowski MJ, Fyock TL, et al. (2011)
Molecular epidemiology of Mycobacterium avium subsp. paratuberculosis in a
longitudinal study of three dairy herds. J Clin Microbiol 49: 893-901.
6. Sohal JS, Arsenault J, Labrecque O, Fairbrother J-H, Roy J-P, et al. (2014) Genetic
structure of Mycobacterium avium subspecies paratuberculosis population in
Quebec cattle herds revealed by using a combination of multi-locus genomic
analysis. J Clin Microbiol 52: 2764-2775.
7. Ahlstrom C, Barkema HW, De Buck J (2014) Improved Short-Sequence-Repeat
Genotyping of Mycobacterium avium subsp. paratuberculosis by Using Matrix-
Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Applied
and environmental microbiology 80: 534-539.
8. Bannantine J, Li LL, Sreevatsan S, Kapur V (2013) How does a Mycobacterium
change its spots? Applying molecular tools to track diverse strains of
Mycobacterium avium subspecies paratuberculosis. Lett Appl Microbiol 57: 165-
173.
![Page 101: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/101.jpg)
90
Appendix A: Sequence analysis of 4 SSR loci for multiple standards used in
Map strain determination
![Page 102: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/102.jpg)
91
Forward sequencing Reverse sequencing
S1 (L1): G10
S1 (L2): G19
Reverse sequencing Forward sequencing
Forward sequencing Reverse sequencing
S1 (L1): G10 A
B
![Page 103: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/103.jpg)
92
S1 (L3): GGT5
Forward sequencing Reverse sequencing
S1 (L4): TGC5
Forward sequencing Reverse sequencing
S1 (L4): TGC5
Forward sequencing Reverse sequencing
S1 (L3): GGT5
Forward sequencing Reverse sequencing
C
D
![Page 104: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/104.jpg)
93
S2 (L1): G10
Forward sequencing Reverse sequencing
S2 (L2): G15
Forward sequencing Reverse sequencing
S2 (L1): G10
Forward sequencing Reverse sequencing
E
F
![Page 105: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/105.jpg)
94
S2 (L3): GGT5
Reverse sequencing Forward sequencing
S2 (L4): TGC5
Reverse sequencing
S2 (L3): GGT5
Reverse sequencing Forward sequencing
S2 (L4): TGC5
Reverse sequencing
S2 (L4): TGC5
Reverse sequencing
G
H
![Page 106: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/106.jpg)
95
S3 (L1): G11
Forward sequencing Reverse sequencing
S3 (L2): G14
Forward sequencing
S3 (L2): G14
Forward sequencing
I
J
![Page 107: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/107.jpg)
96
Figure A.1: Sequence analysis of multiple standards (S1, S2 and S3) based on the 4 SSR
loci used in the present study. (A-L) Each SSR locus (L) is mentioned in parenthesis,
S3 (L3): GGT5
Forward sequencing Reverse sequencing
S3 (L3): GGT5
Forward sequencing Reverse sequencing
S3 (L4): TGC5
Reverse sequencing
S3 (L4): TGC5
Reverse sequencing
S3 (L4): TGC5
Reverse sequencing
K
L
![Page 108: EXAMINATION OF THE MOLECULAR DIVERSITY OF KLEBSIELLA](https://reader035.vdocuments.us/reader035/viewer/2022062901/62b984f00f0c001c8a50ef50/html5/thumbnails/108.jpg)
97
followed by mononucleotide or trinucleotide repeats. Sequencing errors were observed in
either forward or reverse sequences of S2 and S3 for locus 4, and S3 for locus 2,
respectively.