![Page 1: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/1.jpg)
Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1, for Flap
Cleavage During Okazaki Fragment Maturation*
Hui-I Kao ‡||, Judith L. Campbell§, and Robert A. Bambara‡¶
* This research was supported by National Institutes of Health Grant GM24441 (R.A.B.)
and GM25508 (J.L.C.).
From the ‡Department of Biochemistry and Biophysics, University of Rochester School
of Medicine and Dentistry, Rochester, New York 14642 and the §Braun Laboratories
147-75, California Institute of Technology, Pasadena, CA 91125
|| Present address: Department of Molecular Biology and Genetics, the Johns Hopkins
University School of Medicine, Baltimore, MD 21205
¶ To whom correspondence should be addressed: University of Rochester, School of
Medicine and Dentistry, Department of Biochemistry and Biophysics, 601 Elmwood
Avenue, Box 712, Rochester, New York 14642. Tel.: 585-275-3269; Fax: 585-275-
6007; E-mail: [email protected]
Running Title: Dna2p is a tracking enzyme
JBC Papers in Press. Published on September 22, 2004 as Manuscript M409231200
Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
![Page 2: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/2.jpg)
Summary
During cellular DNA replication the lagging strand is generated as discontinuous
segments called Okazaki fragments. Each contains an initiator RNA primer that is
removed prior to joining of the strands. Primer removal in eukaryotes requires
displacement of the primer into a flap that is cleaved off by flap endonuclease 1 (FEN1).
FEN1 employs a unique tracking mechanism that requires the recognition of the free 5′-
terminus and then movement to the base of the flap for cleavage. Abnormally long flaps
are coated by replication protein A (RPA), inhibiting FEN1 cleavage. A second nuclease,
Dna2p, is needed to cleave an RPA-coated flap producing a short RPA-free flap,
favored by FEN1. Here we show that Dna2p is also a tracking protein. Annealed
primers or conjugated biotin-streptavidin complex block Dna2p entry and movement.
SSB-coated flaps inhibit Dna2p cleavage. Like FEN1, Dna2p can track over substrates
with a non-Watson Crick base, such as a biotin, or a missing base within a chain. Unlike
FEN1, Dna2p shows evidence of a “threading-like” mechanism that does not support
tracking over a branched substrate. We propose that the two nucleases both track, Dna2p
first and then FEN1, to remove initiator RNA via long-flap intermediates.
2Dna2p is a tracking enzymeKao et al.
![Page 3: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/3.jpg)
Introduction
During cellular DNA replication, the lagging strand is primed frequently to
generate many RNA-initiated DNA segments called Okazaki fragments. In eukaryotes,
these segments are 100-150 nucleotides in length (1-3). The 8-12 ribonucleotide
primers (4) must be removed prior to joining of the DNA segments to make the
continuous lagging strand. The primer is cleaved off via a single-stranded flap
intermediate, a structure that increases the accessibility of the primers to nucleases. The
flap is created by the strand-displacement synthesis activity of DNA polymerase δ and
proliferating cell nuclear antigen (PCNA) (5-7).
Two nucleases that have been proposed to access and cleave flaps
md=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL><
/MDL></Cite></EndNote>(6,8-10). One is flap endonuclease 1 (FEN1). FEN1 is a
structure-specific endonuclease that
r′cogniz02</YEAR><VOLUME>277</VOLUME><NUMBER>17</NUMBER><PAGES>14379-
89.</PAGES></MDL></Cite></EndNote>(11-13).
Biochemical ′nalyses showed that FEN1 employs a unique tracking mechanism in
whichU.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(14). Crystal structures of FEN1 and its homologues reveal a
conserved flexible region, called the
hv't</KEYWORD><KEYWORD>*Thermus/en
[Enzymology]</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(15-18).
The term “threading” is taken to mean that the flap passes through a fully enclosed hole
in the protein. However, studies of substrate specificity indicated that the 601 Elmwood
Ave,Box 712, Rochester, NY 14642,
USA.</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(19). This indicates
3Dna2p is a tracking enzymeKao et al.
![Page 4: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/4.jpg)
that FEN1 tracking does not employ a threading mechanism. The obligatory nature of
tracking suggests that it is important for the protection of replication intermediates.
Studies of enzyme properties and reconstituted assays indicate that FEN1 prefers
short-
fmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL>
</MDL></Cite></EndNote>(6,10). These results suggest that within the cell, flaps are
removed when they are only a few nucleotides long. However, in some regions, stable
structures can form within the flap as soon as the flaps arise, inhibiting the accessibility
of the substrates to
Fmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL>
</MDL></Cite></EndNote>(10,20). In this situation, flaps may get long enough for
RPA coating, which inhibits FEN1 tracking for cleavage. These
flapmd=Retrieve&db=PubMed&dopt=Citation&list_uids=147474
′8<′URL></MDL></Cite></EndNote>(10,21).
Dna2p is a multi-functional enzyme that
possess00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGE
S>38022-31.</PAGES><. Dna2p is an essential gene in yeast, encoding a 172 kDa
protein ADDIN EN.CITE
<EndNote><Cite><Author>Budd</Author><Year>1997</Year><RecNum>618</RecN
um><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000000618
</REFNUM><AUTHORS><AUTHOR>Budd, M.
E.</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><YEAR>1997</YEAR><TITLE>A yeast replicative
helicase, Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying out its essential
function</TITLE><SECONDARY_TITLE>Molecular & Cellular
Biology</SECONDARY_TITLE><VOLUME>17</VOLUME><NUMBER>4</NUMB
4Dna2p is a tracking enzymeKao et al.
![Page 5: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/5.jpg)
ER><PAGES>2136-42</PAGES><KEYWORDS><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>DNA Helicases/ge
[Genetics]</KEYWORD><KEYWORD>*DNA Helicases/me
[Metabolism]</KEYWORD><KEYWORD>DNA
Repair</KEYWORD><KEYWORD>DNA
Replication</KEYWORD><KEYWORD>DNA, Fungal/bi
[Biosynthesis]</KEYWORD><KEYWORD>DNA, Fungal/ge
[Genetics]</KEYWORD><KEYWORD>Endodeoxyribonucleases/ge
[Genetics]</KEYWORD><KEYWORD>*Endodeoxyribonucleases/me
[Metabolism]</KEYWORD><KEYWORD>Genes,
Fungal</KEYWORD><KEYWORD>Mutation</KEYWORD><KEYWORD>Phenotyp
e</KEYWORD><KEYWORD>Protein Kinases/ge
[Genetics]</KEYWORD><KEYWORD>*Saccharomyces cerevisiae/en
[Enzymology]</KEYWORD><KEYWORD>Saccharomyces cerevisiae/ge
[Genetics]</KEYWORD><KEYWORD>Saccharomyces cerevisiae/me
[Metabolism]</KEYWORD><KEYWORD>Support, U.S. Gov't, Non-
P.H.S.</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Suppression,
Genetic</KEYWORD></KEYWORDS></MDL></Cite><Cite><Author>Budd</Author
><Year>2000</Year><RecNum>2460</RecNum><MDL><REFERENCE_TYPE>0</R
EFERENCE_TYPE><REFNUM>0000002460</REFNUM><URL>http://www.ncbi.nlm
.nih.gov/cgi-
bin/Entrez/referer?http://www.jbc.org/cgi/content/full/275/22/16518</URL><LABEL>2
0287512</LABEL><AUTHORS><AUTHOR>Budd, M.
E.</AUTHOR><AUTHOR>Choe, Wc</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><TITLE>The nuclease activity of the yeast DNA2
5Dna2p is a tracking enzymeKao et al.
![Page 6: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/6.jpg)
protein, which is related to the RecB-like nucleases, is essential in
vivo</TITLE><KEYWORDS><KEYWORD>Amino Acid
Sequence</KEYWORD><KEYWORD>Baculoviridae/genetics</KEYWORD><KEYW
ORD>Base Sequence</KEYWORD><KEYWORD>DNA
Damage</KEYWORD><KEYWORD>DNA
Primers</KEYWORD><KEYWORD>DNA
Repair</KEYWORD><KEYWORD>Deoxyribonucleases/*metabolism</KEYWORD>
<KEYWORD>Exodeoxyribonucleases/*metabolism</KEYWORD><KEYWORD>Fung
al Proteins/genetics/*metabolism</KEYWORD><KEYWORD>Molecular Sequence
Data</KEYWORD><KEYWORD>Mutagenesis</KEYWORD><KEYWORD>Recomb
inant Proteins/genetics/metabolism</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/*metabolism</KEYWORD><KEYWORD>Support, U.S. Gov't, Non-
P.H.S.</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD></KEYWORDS><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><YEAR>2000</YEAR><VOLUME>275</VOLUME>
<NUMBER>22</NUMBER><PAGES>16518-
29.</PAGES></MDL></Cite><Cite><Author>Kang</Author><Year>2000</Year><Re
cNum>2163</RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><RE
FNUM>0000002163</REFNUM><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.genetics.org/cgi/content/full/155/3/1055</URL><LABEL
>20341310</LABEL><AUTHORS><AUTHOR>Kang, H.
Y.</AUTHOR><AUTHOR>Choi, E.</AUTHOR><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Lee, K. H.</AUTHOR><AUTHOR>Gim, B.
S.</AUTHOR><AUTHOR>Kim, H. D.</AUTHOR><AUTHOR>Park,
C.</AUTHOR><AUTHOR>MacNeill, S. A.</AUTHOR><AUTHOR>Seo, Y.
S.</AUTHOR></AUTHORS><TITLE>Genetic analyses of Schizosaccharomyces
6Dna2p is a tracking enzymeKao et al.
![Page 7: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/7.jpg)
pombe dna2(+) reveal that dna2 plays an essential role in Okazaki fragment
metabolism</TITLE><KEYWORDS><KEYWORD>Adenosinetriphosphatase/antagoni
sts & inhibitors/*genetics/metabolism</KEYWORD><KEYWORD>Cell Cycle
Proteins/genetics/metabolism</KEYWORD><KEYWORD>Cell
Line</KEYWORD><KEYWORD>Chromosomes/genetics</KEYWORD><KEYWOR
D>DNA/*metabolism</KEYWORD><KEYWORD>DNA Helicases/antagonists &
inhibitors/*genetics/metabolism</KEYWORD><KEYWORD>DNA Polymerase
I/genetics/metabolism</KEYWORD><KEYWORD>DNA
Replication/genetics</KEYWORD><KEYWORD>Fungal
Proteins/genetics/metabolism</KEYWORD><KEYWORD>Gene
Dosage</KEYWORD><KEYWORD>Genes, cdc</KEYWORD><KEYWORD>Genes,
Lethal</KEYWORD><KEYWORD>Mutagenicity
Tests</KEYWORD><KEYWORD>Proto-Oncogene
Proteins/genetics/metabolism</KEYWORD><KEYWORD>S
Phase/genetics</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/genetics</KEYWORD><KEYWORD>Schizosaccharomyces/*enzymology/*
genetics</KEYWORD><KEYWORD>Sequence Analysis,
DNA</KEYWORD><KEYWORD>Spores, Fungal/genetics/growth &
development</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Temperature</KEYWORD><KEYWORD>
Two-Hybrid System Techniques</KEYWORD><KEYWORD>Ultraviolet
Rays</KEYWORD></KEYWORDS><SECONDARY_TITLE>Genetics</SECONDAR
Y_TITLE><YEAR>2000</YEAR><VOLUME>155</VOLUME><NUMBER>3</NU
MBER><PAGES>1055-67</PAGES></MDL></Cite></EndNote>(9,23,24). Genetic
analyses indicated that FEN1 and Dna2p interact with each other both phos;t,
P.H.S.</KEYWORD><KEYWORD>Suppression,
7Dna2p is a tracking enzymeKao et al.
![Page 8: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/8.jpg)
Genetic</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(9). In addition,
Dna2p interacts with RPA biochemically and genetically, suggesting a model
md=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL></M
DL></Cite></EndNote>(6,10,21). Since both Dna2p and FEN1 act on flap intermediates
d′ring replication,
amd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</URL>
</MDL></Cite></EndNote>(22,25), we questioned whether Dna2p has evolved to track
on flaps like FEN1.
Preliminary biochemical analyses indicated that Dna2p endonucle′se activity
prefers ′sDNA as the point
00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGES>380
22-31.</. Cleavage of single-stranded DNA with no ends could occur ADDIN
EN.CITE
<EndNote><Cite><Author>Bae</Author><Year>1998</Year><RecNum>2267</RecNu
m><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000002267
</REFNUM><LABEL>98434607</LABEL><AUTHORS><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Choi, E.</AUTHOR><AUTHOR>Lee, K.
H.</AUTHOR><AUTHOR>Park, J. S.</AUTHOR><AUTHOR>Lee, S.
H.</AUTHOR><AUTHOR>Seo, Y. S.</AUTHOR></AUTHORS><TITLE>Dna2 of
Saccharomyces cerevisiae possesses a single-stranded DNA- specific endonuclease
activity that is able to act on double-stranded DNA in the presence of
ATP</TITLE><KEYWORDS><KEYWORD>Adenosine
Triphosphate/*metabolism</KEYWORD><KEYWORD>Amino Acid
Sequence</KEYWORD><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>DNA/*metabolism</KEYWORD><KEYWOR
D>DNA Helicases/*metabolism</KEYWORD><KEYWORD>DNA
8Dna2p is a tracking enzymeKao et al.
![Page 9: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/9.jpg)
Primers</KEYWORD><KEYWORD>DNA, Single-
Stranded/*metabolism</KEYWORD><KEYWORD>Endonucleases/*metabolism</KE
YWORD><KEYWORD>Hydrolysis</KEYWORD><KEYWORD>Molecular Sequence
Data</KEYWORD><KEYWORD>Recombinant
Proteins/metabolism</KEYWORD><KEYWORD>Substrate
Specificity</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD></KEYWORDS><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.jbc.org/cgi/content/full/273/41/26880
http://www.jb
c.org/cgi/content/full/273/41/26880</URL><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><YEAR>1998</YEAR><VOLUME>273</VOLUME>
<NUMBER>41</NUMBER><PAGES>26880-
90.</PAGES></MDL></Cite><Cite><Author>Bae</Author><Year>2000</Year><Rec
Num>2463</RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REF
NUM>0000002463</REFNUM><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.jbc.org/cgi/content/abstract/275/48/38022</URL><LABE
L>20545556</LABEL><AUTHORS><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Seo, Y.
S.</AUTHOR></AUTHORS><TITLE>Characterization of the enzymatic properties of
the yeast dna2 Helicase/endonuclease suggests a new model for Okazaki fragment
processing</TITLE><KEYWORDS><KEYWORD>Adenosine
Triphosphate/metabolism</KEYWORD><KEYWORD>Adenosinetriphosphatase/*meta
bolism</KEYWORD><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>Biological
Transport</KEYWORD><KEYWORD>DNA/*metabolism</KEYWORD><KEYWOR
D>DNA Helicases/*metabolism</KEYWORD><KEYWORD>DNA
Primers</KEYWORD><KEYWORD>DNA, Single-
9Dna2p is a tracking enzymeKao et al.
![Page 10: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/10.jpg)
Stranded/metabolism</KEYWORD><KEYWORD>Hydrolysis</KEYWORD><KEYW
ORD>*Models, Biological</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/*enzymology</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS><
SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><YEAR>2000</YEAR><VOLUME>275</VOLUME>
<NUMBER>48</NUMBER><PAGES>38022-
31.</PAGES></MDL></Cite><Cite><Author>Budd</Author><Year>2000</Year><Re
cNum>2460</RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><RE
FNUM>0000002460</REFNUM><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.jbc.org/cgi/content/full/275/22/16518</URL><LABEL>2
0287512</LABEL><AUTHORS><AUTHOR>Budd, M.
E.</AUTHOR><AUTHOR>Choe, Wc</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><TITLE>The nuclease activity of the yeast DNA2
protein, which is related to the RecB-like nucleases, is essential in
vivo</TITLE><KEYWORDS><KEYWORD>Amino Acid
Sequence</KEYWORD><KEYWORD>Baculoviridae/genetics</KEYWORD><KEYW
ORD>Base Sequence</KEYWORD><KEYWORD>DNA
Damage</KEYWORD><KEYWORD>DNA
Primers</KEYWORD><KEYWORD>DNA
Repair</KEYWORD><KEYWORD>Deoxyribonucleases/*metabolism</KEYWORD>
<KEYWORD>Exodeoxyribonucleases/*metabolism</KEYWORD><KEYWORD>Fung
al Proteins/genetics/*metabolism</KEYWORD><KEYWORD>Molecular Sequence
Data</KEYWORD><KEYWORD>Mutagenesis</KEYWORD><KEYWORD>Recomb
inant Proteins/genetics/metabolism</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/*metabolism</KEYWORD><KEYWORD>Support, U.S. Gov't, Non-
10Dna2p is a tracking enzymeKao et al.
![Page 11: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/11.jpg)
P.H.S.</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD></KEYWORDS><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><YEAR>2000</YEAR><VOLUME>275</VOLUME>
<NUMBER>22</N, but it was inhibited by RPA ADDIN EN.CITE
<EndNote><Cite><Author>Bae</Author><Year>2000</Year><RecNum>2463</RecNu
m><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000002463
</REFNUM><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.jbc.org/cgi/content/abstract/275/48/38022</URL><LABE
L>20545556</LABEL><AUTHORS><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Seo, Y.
S.</AUTHOR></AUTHORS><TITLE>Characterization of the enzymatic properties of
the yeast dna2 Helicase/endonuclease suggests a new model for Okazaki fragment
processing</TITLE><KEYWORDS><KEYWORD>Adenosine
Triphosphate/metabolism</KEYWORD><KEYWORD>Adenosinetriphosphatase/*meta
bolism</KEYWORD><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>Biological
Transport</KEYWORD><KEYWORD>DNA/*metabolism</KEYWORD><KEYWOR
D>DNA Helicases/*metabolism</KEYWORD><KEYWORD>DNA
Primers</KEYWORD><KEYWORD>DNA, Single-
Stranded/metabolism</KEYWORD><KEYWORD>Hydrolysis</KEYWORD><KEYW
ORD>*Models, Biological</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/*enzymology</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS><
SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><YEAR>2000</YEAR><VOLUME>275</VOLUME>
<NUMBER>48</NUMBER><PAGES>38022-
11Dna2p is a tracking enzymeKao et al.
![Page 12: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/12.jpg)
31.</PAGES></MDL></Cite></EndNote>(22). Nuclease activity of Dna2p is maximal under conditions in
Mg2+ is high and ATP is low or absent, and the helicase activity is best observed when
nuclease activity is lowered by the presence of high ATP and lower Mg2+. One or the
other of the
twmd=Retrieve&db=PubMed&dopt=Citation&list_uids=1474′468</URL></MDL></Cite></
utilizes the 5(-end of single-stranded DNA as an
efficientmd=Retrieve&db=PubMed&do
′t=Citation&list_uids=12004053</URL></MDL></Cite></EndNote>(25). It
wa00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGES>3
8022-31.</PAGES></MDL></Cite></EndNote>(10,22). Although Dna2p could also
bind from the internal single-
md=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</URL><
/MDL></Cite></EndNote>(25). Generally helicases do not exhibit an end preference for
substrate binding since a substrate flanked by difference lengths of primers at
eithecmd=Retrieve&db=PubMed&dopt=Citation&list_uids=30074. By
this criterion, Dna2p is a unique helicase/nuclease ADDIN EN.CITE
<EndNote><Cite><Author>Bae</Author><Year>2002</Year><RecNum>4249</RecNu
m><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000004249
</REFNUM><ACCESSION_NUMBER>12004053</ACCESSION_NUMBER><VOL
UME>277</VOLUME><NUMBER>29</NUMBER><YEAR>2002</YEAR><DATE>
Jul 19</DATE><TITLE>Coupling of DNA helicase and endonuclease activities of yeast
Dna2 facilitates Okazaki fragment processing</TITLE><PAGES>26632-
41</PAGES><AUTHOR_ADDRESS>Department of Pharmacology, Dong-A
University Cllege of Medicine, Seo-Gu, Busan,
Korea.</AUTHOR_ADDRESS><AUTHORS><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Kim, D. W.</AUTHOR><AUTHOR>Kim,
12Dna2p is a tracking enzymeKao et al.
![Page 13: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/13.jpg)
J.</AUTHOR><AUTHOR>Kim, J. H.</AUTHOR><AUTHOR>Kim, D.
H.</AUTHOR><AUTHOR>Kim, H. D.</AUTHOR><AUTHOR>Kang, H.
Y.</AUTHOR><AUTHOR>Seo, Y.
S.</AUTHOR></AUTHORS><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><KEYWORDS><KEYWORD>Adenosinetriphosphatas
e/genetics/*metabolism</KEYWORD><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>DNA/*metabolism</KEYWORD><KEYWOR
D>DNA
Helicases/genetics/*metabolism</KEYWORD><KEYWORD>Deoxyribonuclease
I/*metabolism</KEYWORD><KEYWORD>Magnesium/metabolism</KEYWORD><K
EYWORD>Molecular Sequence Data</KEYWORD><KEYWORD>Nucleic Acid
Conformation</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/*enzymology</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD></KEYWORDS><URL>http://www.ncbi.nlm.nih.gov/entrez
/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004
053</URL></MDL></Cite></EndNote>(25).
Despite several reports on Dna2p substrate specificity, the mechanism behind the
free-end preference remains unanswered. We wanted to know the events that occur
when Dna2p encounters a flap substrate. We speculated that Dna2p employs a FEN1-
like tracking mechanism, since both enzymes share a similar pathway in replication. To
test this hypothesis, we utilized substrates capable of defining specific characteristics of
the tracking process. Our observations in vitro reveal that Dna2p does indeed track on
flap substrates. They suggest that this unique mechanism is used to protec
t against internal cleavage of replication intermediates during Okazaki
fragment processing.
13Dna2p is a tracking enzymeKao et al.
![Page 14: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/14.jpg)
Experimental Procedures
Materials––Oligonuγleotides were synthesized byαIntegrated DNA Technologies
(Coralville, IA). Radionucleotides [(-32P]ATP (6000Ci/mmol) and [(-32P]dCTP (6000
Ci/mmol) were from PerkinElmer Life Science Products (Boston, MA). The T4
polynucleotide kinase (labeling grade), the Klenow fragment of DNA polymerase I, and
ATP were from Roche Molecular Biochemicals. Nuclease-free solutions and reagents
were from Ambion, Inc. (Austin, TX). All other reagents were the best available
commercial grade.
Enzyme expression and purification––S. cerevisiae Dna2p was cloned into the sf9
baculovirus expression vector (Invitrogen-GIBCO, CA).
00</YEAR><VOLUME>275</VOLUME><NUMBER>22</NUMBER><PAGES>165
18-29.</PAGES></MDL></Cite></EndNote>(23), except that High Five cells were
utilized for the final expression step of the protein. S. cerevisiae FEN1 was
expres02</YEAR>
<VOLUME>277</VOLUME><NUMBER>17</NUMBER><PAGES>14379-89.</PAGES></MDL></Cit
cerevisiae RPA was expressed and purified according to Sibenaller et al., 1998 ADDIN
EN.CITE
<EndNote><Cite><Author>Sibenaller</Author><Year>1998</Year><RecNum>4265</
RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>00000
04265</REFNUM><ACCESSION_NUMBER>9730822</ACCESSION_NUMBER><
VOLUME>37</VOLUME><NUMBER>36</NUMBER><YEAR>1998</YEAR><DA
TE>Sep 8</DATE><TITLE>The 32- and 14-kilodalton subunits of replication protein
A are responsible for species-specific interactions with single-stranded
DNA</TITLE><PAGES>12496-506</PAGES><AUTHOR_ADDRESS>Department of
Biochemistry, University of Iowa College of Medicine, Iowa City 52242,
USA.</AUTHOR_ADDRESS><AUTHORS><AUTHOR>Sibenaller, Z.
14Dna2p is a tracking enzymeKao et al.
![Page 15: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/15.jpg)
A.</AUTHOR><AUTHOR>Sorensen, B. R.</AUTHOR><AUTHOR>Wold, M.
S.</AUTHOR></AUTHORS><SECONDARY_TITLE>Biochemistry</SECONDARY_
TITLE><KEYWORDS><KEYWORD>Binding
Sites</KEYWORD><KEYWORD>Comparative
Study</KEYWORD><KEYWORD>DNA
Helicases/chemistry/genetics</KEYWORD><KEYWORD>*DNA
Replication</KEYWORD><KEYWORD>DNA, Single-
Stranded/*metabolism</KEYWORD><KEYWORD>DNA-Binding
Proteins/*chemistry/genetics/*metabolism</KEYWORD><KEYWORD>Holoenzymes/c
hemistry/genetics</KEYWORD><KEYWORD>Human</KEYWORD><KEYWORD>
Molecular Weight</KEYWORD><KEYWORD>Peptide
Fragments/chemistry</KEYWORD><KEYWORD>Protein
Binding/genetics</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/enzymology/genetics/*metabolism</KEYWORD><KEYWORD>Species
Specificity</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD></KEYWORDS><URL>http://www.ncbi.nlm.nih.gov/entrez/quer
y.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list
_uids=9730822</URL></MDL></Cite></EndNote>(28), except that the Mono-Q column
was omitted.
Oligonucleotide substrates––Oligomer sequences are listed in Table I. Oligomers were
annealed as described in the figure legends to form various struc 601 Elmwood Ave,Box
712, Rochester, NY 14642,
USA.</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(19). The
biotinylated substrates were synthesized by Integrated DNA Technologies (Coralville,
IA), and the locations of the biotinylation are indicated as bolded
15Dna2p is a tracking enzymeKao et al.
![Page 16: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/16.jpg)
nucl2001</YEAR><VOLUME>21</VOLUME><NUMBER>15</NUMBER><PAGES
>4889-99.</PAGES></MDL></Cite></EndNote>(29), except that the annealing ratio is
1:4:8 (downstream:template:upstream) and 1:2:4 for the reactions containing SSB and
RPA. Blocking primers were present in 10-fold excess over the annealed flap substrates.
All radiolabeled primers were purified by gel isolation from 12%′or 15%
polyacrylamide, 7 M urea denaturing gels. The 10-nucleotide markers γere obtained by
5(-labeling the 10 base-pair markers from GIBCO (Invitrogen-GIBCO, CA) using [(-
32P]ATP (6000Ci/mmol) (PerkinElmer Life Science Products, MA), and they were heat-
denatured prior to loading of the gel.
Enzyme assays––Reactions were performed in 50 mM Tris-HCl (pH 8.0), 2 mM
dithiothreitol, 0.25 mg/ml bovine serum albumin, 30 mM NaCl, and various ratios of
MgCl2 and ATP. Enzyme stocks were diluted in 50 mM Tris-HCl (pH 8.0), 2 mM
dithiothreitol, 0.5 mg/ml bovine serum albumin, 10 % glycerol, 0.5 M NaCl, and 0.02 %
Nonidet P-40. The “maximum-nuclease” assays include excess MgCl2 over ATP (2mM
MgCl2 and 1 mM ATP) whereas the “maximum-helicase” assays contain excess ATP
over MgCl2 (1 mM MgCl2 and 2 mM ATP). Most assays wµre performed under one of
these conditions. Each reaction contains 5 fmol substrates in a 20-(l reaction volume
with different amo°nts of the enzymes as indicated in the figure legends. All the assays
were preincubated at 37(C for 5 min (maximum-helicase conditions with substrates,
enzyme, and ATP, o° maximum-nuclease conditions with substrates and enzymes). The
reactions were initiated at 37(C for 10 min with the addition of MgCl2 (for maximum-
nuclease conditions, ATP was added with MµCl2 at the end of the preincubation time).
Reactions were then stopped by the addition of 20 (l 2X termination dye (95% formamide
(v/v) with bromophenol blue and xylene cyanole). The denatured reactions were resolved
on 12% or 15% polyacrylamide, 7 M urea denaturing gels. Each gel was quantitated
using a PhosphorImager (Molecular Dynamics) and analyzed using ImageQuant v1.2
16Dna2p is a tracking enzymeKao et al.
![Page 17: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/17.jpg)
software from Molecular Dynamics. In all studies, the quantitated amount of substrates
and products were utilized to calculate the percentage of product formation from the
product/(substrate plus product) ratio. The % product formation is indicated underneath
each gel in the figures. This method allows for the correction of any loading errors
among lanes. All assays were performed at least in triplicate, and representative assays
are shown.
17Dna2p is a tracking enzymeKao et al.
![Page 18: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/18.jpg)
Results
To dissect out the multiple activities of Dna2p, we employed previously
developed reaction conditions. One favors “maximum-nuclease” (MgCl2 >ATP) in
which high MgCl2 supports nuclease activity, masking the helicase activity by cutting the
flap substrate. The other favors “maximum-helicase” (ATP> MgCl2 and with a 5 min
preincubation of the enzyme and substrate) in which excess ATP sequesters
frmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL
></MDL></Cite></EndNote>(10). Controlling these conditions, we can examine the
cleavage properties of Dna2p nuclease and the influence of the helicase activity on Dna2p
nuclease on different substrates. These conditions also allow us to monitor the tracking
mechanism in the presence and absence of helicase activity with the wild-type protein.
Dna2p Makes Multiple Cuts on a Long Flap––It was previously shown that
Dna2p possesses a weak, distributive helicase activity. This is able to influence the
positiomd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</
URL></MDL></Cite></EndNote>(10,22,26). We first examined the patterns of
nuclease cleavage under nuclease versus helicase conditions. Specifically we wanted to
know whether Dna2p cleaves a long flap in a progressive fashion by making a series of
cuts that shorten the flap in a stepwis′ manne′. To accomplish this we employed 38-
nucleotide flap substrates labeled at either t′e 3(- or 5(-end of ′he downstream primer (Fig. 1).
Lanes 1-7 and 8-14 show cleavages of the 5′-radiolabeled and 3(-radiolabeled
substrates, respectively, compared under both conditions. 5(-radiolabeled substrates
show that longer cleavage products are released under
mmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL
></MDL></Cite></EndNote>(10,22). This indicates that Dna2p progresses further
towards the flap junction before allowing the first cleavage or that inhibiting the nuclease
allows further translocation before cleavage. This is
18Dna2p is a tracking enzymeKao et al.
![Page 19: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/19.jpg)
also</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(30). H′wever,
most initial cleavages are not close to the base of the flap (38 nucleotides from the 5(-
labeled end) under either condition. The downstream
duplex98</YEAR><VOLUME>273</VOLUME><NUMBER>41</NUMBER><PAGE
S>26880-90.</PAGES></MD′></Cite></EndNote>(10,26). Cleavages beyond the flap
base by Dna2p are only obser′ed when 3(-labeled substrates are utilized in a maximum-
helicase assay.
Examination of the 3( substrates (lanes 8-14) shows that majorit′ of the products
represent cleavages near the base of the flap. Since the products from the 3( substrates
reflect the sum of all cleavage events occurring on one substrate, the fact that these are
distributed closer to the flap base under both conditions implies that each substrate
sustained multiple progressive cuts by the nuclease. These results show progression but
do not define whether the cleavage process is processive, i.e carried out by the same
protein. Sever′l Dna2p proteins may collaborate to reduce ′he
flamd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL
></MDL></Cite></EndNote>(10,22,25), and primers
an00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGES>3
8022-31.</PAGES></MDL></Cite></EndNote>(22). We asked whether the end
preference was influenced by the helicase function since the helicase had been reported to
allow Dna2p to load
00</YEAR><VOLUME>275</VOLUME><NUMBER>22</NUMBER><PAGES>165
18-29.</PAGES></MDL></Cite></EndNote>(23,25,26). We tested substrates that
contain a downstream primer with′a 25-nucleotide flap (Fig. 2A). On one substrate a
17-nucleotide primer was annealed at the 5(-end of the flap (lanes 8-14). Under both
maximal-nuclease and maximal-helicase conditions, Dna2p was able to cleave the 25-
19Dna2p is a tracking enzymeKao et al.
![Page 20: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/20.jpg)
nucleotide flap (lanes 1-7). However, the presence of the 17-nucleotide terminal duplex
prevented cleavage within the 8-nucletoide gap (lanes 8-14). The helicase activity
moves the Dna2p on these substrates because we see cleavage closer to the flap base
under helicase conditions (compare lanes 2-4 to 5-7). However, th′ presence of ATP in
excess over MgCl2 and helicase function does not allow the bypass of the 5(-end
requirement for Dna2p loading onto a substrate. A larger gap between the blocking
primer and the flap base (53 nucleotides) also shows similar results as described below (Fig.
3A), ruling out the′possibility that the eight nucleotides is too short for effective Dna2p
binding. Apparently 5(-end loading is also a requirement for cleavage on these
substrates even when the helicase ′s maximally active (compare lanes 5-7 to 12-14).
A bubble substrate is defined as having the 5(-e′d of the flap
ann2001</YEAR><VOLUME>21</VOLUME><NUMBER>15</NUMBER><PAGES
>4889-99.</PAGES></MDL></Cite></EndNote>(20,29). The b′bble structure creates a
particularly convincing substrate for testing the requirement for a 5(-end. Primers
annealed to flaps allow some FEN1 access presumably because annealing is not 100%
efficient (data not shown). However, the two-site annealing of the bubble primer appears
to make it a stable configuration. Bubble substrates were tested with Dna2p (Fig. 2B).
Alternative structures were created that simulate Okazaki fragment intermediates either
with no upstream primer, a fully annealed upstream primer, or an upstream primer that
forms a double flap. In all three cases the single-stranded bubble region is long enough
to ensure space for enzyme binding (50 nucleotides). Even though a 53-nucleotide
control flap substrate sustained expected cleavages under both conditions (lanes 1-7),
Dna2p failed to cleave any of ′he bubble structures (lanes 8-28), supporting an absolute
requirement for Dna2p to load at a 5(-end. This result is fully consistent with the
blocking effect of a primer annealed on the flap and indicates that Dna2p is not
designed′for internal access to single-stranded DNA.
20Dna2p is a tracking enzymeKao et al.
![Page 21: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/21.jpg)
Dna2p Cleavage Employs a Tracking Mechanism––The 5(-end requirement is
consistent with′two alternative mechanisms. One is a tracking mechanism in which the
enzyme enters from the 5(-end, and then traverses the single-stranded region t′ the point
of cleavage. The other is a looping mechanism. In this scenario, binding to the 5(-end of
the flap activates the enzyme for subsequent functions. It is then abl′ to bind the single
stranded region for movement or cleavage by looping the flap so that the 5(-end is near
the site of cleavage. During this process the enzyme is bound at two sites on the flap. To
delineate these two meU.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(14) (Fig. 3). A ′3-nucleotide flap substrate was constructed, and
an oligomer was annealed to the flap at its 5(-end, in the middle, or at its base (Fig. 3A).
We reasoned that if Dna2p employs a looping mechanism, the substrate with the primer
in the middle of the flap would be cleaved in the 32-nucleotide ga′ region between the
primer and the flap base. This is because the Dna2p can access both the 5(-end and a
cleavable internal region. The con′rol substrate was cleaved well by Dna2p under both
conditions (lanes 1-7). As expected, the 5(-terminal blocking primer inhibited Dna2p
cleavage (lanes 8-14). We note that the 53-nucleotide region provides a large area of
access with a variety of sequences and structures, and yet virtually no cleavage is seen
(Lanes 8-14). With the flap containing a primer in the middle (lanes 15-21), the 32-
nucleotide gap is no′ cleaved. Instead, substantial cleavage is observed in the 20-
nucleotide region between the 5(-end and the prime′. This result argues against the
looping mechanism. It indicates that Dna2p loads onto the 5(-end and tracks to the point
where it is blocked by the primer. Results with the primer placed at the flap base
reinforce this conclusion (lanes 22-28). In that case, Dna2p appears to track the further
distance to the primer, cleaving throughout the single stranded region. Effective
blockage by the primer is consistent with the
21Dna2p is a tracking enzymeKao et al.
![Page 22: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/22.jpg)
notionmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</
URL></MDL></Cite></EndNote>(10,23,25,26). Note that Dna2p cleaves right up to
the site of the block (Fig. 3A) whereas it only gets to within 5-7 nucleotides of the flap
junction on other substrates. Perhaps the fork structure sterically hinders further
cleavages closer to the flap junctions.
In another approach to ′istinguish a tracking from a looping mechanism, we
placed biotin modifications either at the 5(-end or in the middle of 53-nucleotide flaps (Fig.
3B). The unmodified flaps are cleaved equally well by Dna2p in the absence or presence
of streptavidin (lanes 1-6), indicating that u′bound streptavidin does not interfere with
Dna2p catalysis. A substrate biotinylated at the 5(-end is cleaved by Dna2p in the
absence of streptavid′n (lanes 7-9), implying that the biotin
modific00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAG
ES>38022-31.</PAGES></MDL></Cite></EndNote>(22). Conjugation of streptavidin
to the biotinylated substrate inhibits cleavage (lanes 10-12), presumably by blocking the
entry of Dna2p. This is consistent with the results obtained from the blocking primers
used above. When streptavidin is conjugated to a biotin in the middle of the flap (lanes
16-18), cleavage occurs prior to the conjugation site, but not beyond it. In principle, this
substrate is similar to the substrate with a primer in the middle of the flap. In fact, the
biotin-streptavidin flap should be even more flexible than the primed flap to allow for
′ooping. The absence of cleavage beyond the conjugation site is additional evidence that
the 5(-end is an entry site for tracking and not an activation site for looping. This result
also verifies that the helicase function of Dna2p cannot force the dissociation of the
streptavidin.
Dna2p Can Track Over Alternative Structures and Does Not Require Contact with
a Continuous Series of Nucleotides–– Since cleavages by Dna2p occur on biotinylated
flaps in the absence of streptavidin (lanes 13-15), Dna2p must be able to track over a
22Dna2p is a tracking enzymeKao et al.
![Page 23: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/23.jpg)
bulky adduct on DNA. This suggests that tracking does not require Dna2p contact with a
series of unmodified nucleotides. To further assess the nucleotide structure requirement
of the flap for tracking, we tested 601 Elmwood Ave,Box 712, Rochester, NY 14642,
USA.</KEYWORD></KEYWORDS></MDL></Cite></ EndNote>(19) (Fig. 4A). Both
the un-modified (lanes 1-7) and modified substrates (lanes 8-14) were examined under
both maximum-nuclease and maximum-helicase conditions. Dna2p was similarly
capable of tracking and cleaving both substrates. This suggests that similar to FEN1, the
tracking of Dna2p does not require the contact of a perfect series of natural nucleotide
structures on the flap.
The Mechanism Appears To Involve Threading––As discussed above, the
tracking 601 Elmwood Ave,Box 712, Rochester, NY 14642,
USA.</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(19), indicating that
the flap is not threaded through a hole in the 601 Elmwood Ave,Box 712, Rochester, NY
14642, USA.</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(19) (Fig.
4B). The substrate has a 38-nucleotide flap. The 27th resid′e from the base of the flap is
a ribonucleo′ide with an 11-nucleotide br′nch attached at the 2(-position. The branch is
attached at its 3(-end and has a native free 5(-end. When the un-branched control
substrate was tested under both conditions, it was readily cleaved by Dna2p (lanes 3-8).
It was also susceptible to FEN1 (lane 2). The branched substrate was also effectively
cleaved by FEN1 (lane 10), which evidently tracks over the branch point. ′owever, the
cleavage pattern for Dna2p (lanes 11-16) suggests tracki′g from one or the other 5(-end
only up to the branch point. Cleavages were present from the 5(-end to the branch point.
No cleavages were observed after the branched point, suggesting that Dna2p exhibits a
“threading-like” mechanism. Presumably, the hole or cleft in the protein that allows
passage of the single –stranded DNA is too small of a diameter to allow entry of the
branch point.
23Dna2p is a tracking enzymeKao et al.
![Page 24: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/24.jpg)
Proteins Bound to the Flap Inhibit Dna2pU.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(14), most proteins bound to the flap would also inhibit the
tracking and cleavage by Dna2p. We tested prokaryotic single-stranded binding protein
(SSB) and also yeast RPA
01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PAGES>4
56-
61.</PAGES></MDL></Cite></EndNote>(21).01</YEAR><VOLUME>412</VOLUM
E><NUMBER>6845</NUMBER><PAGES>456-
61.</PAGES></MDL></Cite></EndNote>(21,31). We hypothesized that except for the
RPA-bound flaps, which
coordmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</U
RL></MDL></Cite></EndNote>(10,21), any other proteins bound to the DNA such as
SSB will block Dna2p activity. When we tested 53-nucleotide flap substrates in the
presence of SSB and RPA, we observed the stimulatory effects of RPA on Dna2p under
both conditions but SSB inhibited t′e Dna2p activity. The result is similar to a previous
report01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PAG
ES>456-61.</PAGES></MDL></Cite></EndNote>(21). This indicates that proteins
bound to the flap willU.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(10,14,21). The process by which RPA stimulates Dna2p without
blocking its entry onto the flap substrate needs to be further examined.
The Tracking Requirement of Dna2p Should Protect Replication Intermediates–-
Dna2p is a single strand DNA specific endonuclease, and there have been reports
indicating that it cleaves internally on a
stret00</YEAR><VOLUME>275</VOLUME><NUMBER>22</NUMBER><PAGES>
24Dna2p is a tracking enzymeKao et al.
![Page 25: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/25.jpg)
16518-29.</PAGES></MDL></Cite></EndNote>(22,23,26). This internal-binding
property would allow Dna2p to bypass the tracking mechanism and potentially cleave the
single-stranded regions between Okazaki fragments. To examine possible accessing of
substrate without tracking, we designed different lengths of gap substrates flanked by 2
primers and tested Dna2p cleavage on these substrates under both maximum-nuclease
and maximum-helicase conditions and in the presence and absence of RPA (Fig. 5).
Contrary to previous results, we found that Dna2p is not able to cleave single-stranded
DNA internally (lanes 6-10 and 16-20). The gaps of either 29 nucleotides or 70
nucleotides are not cleaved while the control substrates with flaps either 30 or 73
nucleotides long continue to exhibit characteristic cleavage patterns by Dna2p (lanes 1-6 and
11-16). RPA did not allow Dna2p to enter the substrate without a free single-stranded
end (lanes 8,
10md=Retrieve&db=PubMed&dopt=Citation&list_uids=12799426</URL
></MDL></Cite></EndNote>(31). The presence of RPA sometimes alters the cleavage
pamd=Retrieve&db=PubMed&dopt=Citat. We postulate that as with FEN1
ADDIN EN.CITE
<EndNote><Cite><Author>Murante</Author><Year>1995</Year><RecNum>32</Rec
Num><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>00000000
32</REFNUM><AUTHORS><AUTHOR>Murante, R.
S.</AUTHOR><AUTHOR>Rust, L.</AUTHOR><AUTHOR>Bambara, R.
A.</AUTHOR></AUTHORS><TITLE>Calf 5' to 3' exo/endonuclease
must slide from a 5' end of the substrate to perform structure-specific
cleavage</TITLE><SECONDARY_TITLE>Journal of Biological
Chemistry</SECONDARY_TITLE><YEAR>1995</YEAR><VOLUME>270</VOLU
ME><NUMBER>51</NUMBER><PAGES>30377-
83</PAGES><KEYWORDS><KEYWORD>Animal</KEYWORD><KEYWORD>Bas
25Dna2p is a tracking enzymeKao et al.
![Page 26: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/26.jpg)
e Sequence</KEYWORD><KEYWORD>Binding
Sites</KEYWORD><KEYWORD>Cattle</KEYWORD><KEYWORD>DNA
Helicases/me [Metabolism]</KEYWORD><KEYWORD>DNA
Primers</KEYWORD><KEYWORD>DNA Repair</KEYWORD><KEYWORD>DNA
Replication</KEYWORD><KEYWORD>*Endodeoxyribonucleases/me
[Metabolism]</KEYWORD><KEYWORD>*Exodeoxyribonucleases/me
[Metabolism]</KEYWORD><KEYWORD>Human</KEYWORD><KEYWORD>Kine
tics</KEYWORD><KEYWORD>Models,
Structural</KEYWORD><KEYWORD>Molecular Sequence
Data</KEYWORD><KEYWORD>Nucleic Acid
Conformation</KEYWORD><KEYWORD>Saccharomyces cerevisiae/en
[Enzymology]</KEYWORD><KEYWORD>Substrate
Specificity</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(14), the tracking requirement of Dna2p is designed to prevent the
nuclease from acc
essing the r
eplication intermediates that may cause double strand breaks during replication.
26Dna2p is a tracking enzymeKao et al.
![Page 27: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/27.jpg)
′iscussion
Removal of the RNA primers of Okazaki fragments requires formation and
cleavage of 5( single-stranded flaps. At least some of these are
expmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</UR
L></MDL></Cite></EndNote′(6,8,10). Considerable evidence supports a mechanism
by00</YEAR><VOLUME>275</VOLUME><NUMBER>14</NUMBER><PAGES>1
0498-505</PAGES></MDL></Cite></EndNote>(14,19,32).
The′nucleamd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</URL
></MDL></Cite></EndNote>(25,26). These observations suggested to us that Dna2p is
also a tracking enzyme. Here we have analyzed cleavage specificity of Dna2p using
substrates designed to define its tracking characteristics. Results of our analyses
uniformly support the conclusion that Dna2p nuclease moves for cleavage by a tracking
mechanism similar to that
of FEN1. This mechanism is not influenced substantially by the presence of
helicase activity.
Dna2p is a helicase with conserved
helimd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</UR
L></MDL></Cite></EndNote>(25). Under all the
comd=Retrieve&db=PubMed&dopt=Citation&list_uids=1474. In fact, the helicase
function of Dna2p is essential ADDIN EN.CITE
<EndNote><Cite><Author>Budd</Author><Year>1997</Year><RecNum>618</RecN
um><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000000618
</REFNUM><AUTHORS><AUTHOR>Budd, M.
E.</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><YEAR>1997</YEAR><TITLE>A yeast replicative
helicase, Dna2 helicase, interacts with yeast FEN-1 nuclease in carrying out its essential
27Dna2p is a tracking enzymeKao et al.
![Page 28: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/28.jpg)
function</TITLE><SECONDARY_TITLE>Molecular & Cellular
Biology</SECONDARY_TITLE><VOLUME>17</VOLUME><NUMBER>4</NUMB
ER><PAGES>2136-42</PAGES><KEYWORDS><KEYWORD>Base
Sequence</KEYWORD><KEYWORD>DNA Helicases/ge
[Genetics]</KEYWORD><KEYWORD>*DNA Helicases/me
[Metabolism]</KEYWORD><KEYWORD>DNA
Repair</KEYWORD><KEYWORD>DNA
Replication</KEYWORD><KEYWORD>DNA, Fungal/bi
[Biosynthesis]</KEYWORD><KEYWORD>DNA, Fungal/ge
[Genetics]</KEYWORD><KEYWORD>Endodeoxyribonucleases/ge
[Genetics]</KEYWORD><KEYWORD>*Endodeoxyribonucleases/me
[Metabolism]</KEYWORD><KEYWORD>Genes,
Fungal</KEYWORD><KEYWORD>Mutation</KEYWORD><KEYWORD>Phenotyp
e</KEYWORD><KEYWORD>Protein Kinases/ge
[Genetics]</KEYWORD><KEYWORD>*Saccharomyces cerevisiae/en
[Enzymology]</KEYWORD><KEYWORD>Saccharomyces cerevisiae/ge
[Genetics]</KEYWORD><KEYWORD>Saccharomyces cerevisiae/me
[Metabolism]</KEYWORD><KEYWORD>Support, U.S. Gov't, Non-
P.H.S.</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Suppression,
Genetic</KEYWORD></KEYWORDS></MDL></Cite></EndNote>(9), and the
deficient mutant only grows on media containing galactose that supports slow growth
ADDIN EN.CITE
<EndNote><Cite><Author>Formosa</Author><Year>1999</Year><RecNum>2459</R
ecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>000000
2459</REFNUM><LABEL>99203552</LABEL><AUTHORS><AUTHOR>Formosa,
28Dna2p is a tracking enzymeKao et al.
![Page 29: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/29.jpg)
T.</AUTHOR><AUTHOR>Nittis, T.</AUTHOR></AUTHORS><TITLE>Dna2
mutants reveal interactions with Dna polymerase alpha and Ctf4, a Pol alpha accessory
factor, and show that full Dna2 helicase activity is not essential for
growth</TITLE><KEYWORDS><KEYWORD>Alleles</KEYWORD><KEYWORD>
Base Sequence</KEYWORD><KEYWORD>Chromosome
Mapping</KEYWORD><KEYWORD>Chromosomes,
Fungal/genetics</KEYWORD><KEYWORD>DNA
Helicases/*genetics/*metabolism</KEYWORD><KEYWORD>DNA Polymerase
I/*genetics/metabolism</KEYWORD><KEYWORD>DNA
Repair</KEYWORD><KEYWORD>DNA,
Fungal/genetics</KEYWORD><KEYWORD>DNA-Binding
Proteins/*genetics/metabolism</KEYWORD><KEYWORD>Fungal
Proteins/*genetics/metabolism</KEYWORD><KEYWORD>Genes,
Fungal</KEYWORD><KEYWORD>Mutation</KEYWORD><KEYWORD>Phenotyp
e</KEYWORD><KEYWORD>Saccharomyces cerevisiae/*genetics/growth &
development/*metabolism</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Telomere/genetics</KEYWORD></KEYWORDS
><URL>http://www.ncbi.nlm.nih.gov/cgi-
bin/Entrez/referer?http://www.genetics.org/cgi/content/full/151/4/1459
http://www.
genetics.org/cgi/content/full/151/4/1459</URL><SECONDARY_TITLE>Genetics</SE
CONDARY_TITLE><YEAR>1999</YEAR><VOLUME>151</VOLUME><NUMBE
R>4</NUMBER><PAGES>1459-70.</PAGES></MDL></Cite></EndNote>(33).
However, the helicase function is not robust, and it is not known whether its essential
property is manifested in Okazaki fragment processing. Previous
studiemd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</U
29Dna2p is a tracking enzymeKao et al.
![Page 30: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/30.jpg)
RL></MDL></Cite></EndNote>(10,25). However, our coupled nuclease-helicase
assays indicate that the helicase is not effective enough to move down the flap to its base
and then displace the annealed regions.
Most DNA helicases bind single-stranded DNA internally and then exhibit ATP
d′iven motion on that strand, dissociating adjacent annealed strands. Blocking primers on
the 5(-terminus of the flap substrates were able to inhibit Dna2p cleavage even though a
long gap was presented to Dna2p, which would create enough space for the enzyme to
bind d′rectly from the solution (Fig. 3A). Bubble substrates also prevent Dna2p cleavage
since the 5(-end of the flap is annealed ′o the template (Fig. 2B). These results show that
cleavage by Dna2p requires entry from the 5(-terminus of DNA, not typical of other
helicases.
Previously, it was shown
tha00</YEAR><VOLUME>275</VOLUME><NUMBER>22</NUMBER><PAGES>1
6518-29.</PAGES></MDL></Cite></EndNote>(23). However, evidence suggests that
this mode of cleavage is not biologically relevant. It is inhibited by
00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGES>380
22-31.</PAGES></MDL></Cite></EndNote>(22). Studies o′ helicase function of
Dna2p revealed t′at binding is greatly favored on substrates with free 5(-ends since the
enzyme could use the 5(-end as an efficient entry point. When the enzyme was given the
choice of unwinding a primer by binding the
adjacenmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053</
URL></MDL></Cite></EndNote>(25).
In all the substrates we
teste98</YEAR><VOLUME>273</VOLUME><NUMBER>41</NUMBER><PAGES>
26880-90.</PAGES></MDL></Cite></EndNote>(22,26), we did not observe internal
cleavages with single-stranded regions flanked by primers (Fig. 5) in the presence or
30Dna2p is a tracking enzymeKao et al.
![Page 31: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/31.jpg)
absence of RPA. We susU.S. Gov't,
P.H.S.</KEYWORD><KEYWORD>Templates</KEYWORD></KEYWORDS></MD
L></Cite></EndNote>(14). Numerous single-stranded regions are exposed during
replication, which, if cleaved, would make double strand breaks in the chromosome.
Production of a
md=Retrieve&db=PubMed&dopt=Citation&list_uids=11100718</URL><
/MDL></Cite></EndNote>(34).
Results with primers or biotin-streptavidin conjugations placed central′y on a
long flap reveal that Dna2p does not employ a looping mechanism, in which binding the
5(-terminus activates the protein for second-site binding internal to the single strand
(Fig. 3). The tracking process appears to require protein movement down the strand.
Additional results show that Dna2p could track over a biotinylated substrate, and a
substrate in which one nucleotide was substituted with 3-amino-thiocyano-1,2-
propanediol (Fig. 3B and 4A). This means that movement does not require the contact
with a series of adjacent unmodified nucleotides. In this way, it is different from
replicative DNA polymerase movement on DNA templates, which is inhibited by
damaged nucleotides. Most helicases, upon encountering a damaged nucleotide might be
expected to dissociate. Indeed, a benzo[a]pyrene-DNA
cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=8924589</URL><
/MDL></Cite></EndNote>(35). A recent study with the human Werner syndrome
helicase, a RecQ helicase, and benzo[c]phenanthrene diol epoxide dA adducts, also
revealed
thmd=Retrieve&db=PubMed&dopt′Citation&list_uids=12881525</URL></MDL></Cite></E
because of the 5(-entry requirement, Dna2p must be able to traverse the site′without
dissociation.
The tracking function may be only partly related to the helicase. A 5(-end
31Dna2p is a tracking enzymeKao et al.
![Page 32: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/32.jpg)
requirement is observed not only under conditions favoring the nuclease, but even when
ATP is totally absent from the reaction (data not shown). Unlike FEN1, Dna2p is able to
cleave after a branched point on a modified flap (Fig. 4B), indicating that the strand must
fit through a limited sized chamber in the enzyme. This suggests that the tracking
process involves an actual threading of the strand through the protein. Whether or not the
strand is fully encircled awaits evidence from future crystallographic analyses.
The
inhibiti01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PA
GES>456-61.</PAGES></MDL></Cite></EndNote>(21) (data not shown). SSB is
expected to block Dna2p movement on the flap and could also be blocking access to the
DNA for cleavage. Inhibition by SSB contrasts with the stimulatory effect of RPA,
which must facilitate tracking, cleavage, or both. It is difficult to envision how bound
RPA could facilitate threading movement, or even allow access for cleavage. It was
reported that
Rmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12799426</URL
></MDL></Cite></EndNote>(31). The fact that Dna2p and RPA interaction requires the
formation of a ternary complex with single-stranded DNA and that it affects catalysis
raises the possibility that RPA binding to DNA allows
the01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PAGES
>456-61.</PAGES></MDL></Cite></EndNote>(21). Our preliminary results do not
favor this mechanism (Fig. 5), however, further study is needed. Interaction of Dna2p
and RPA in the presence of various substrates, using both catalytic and binding assays,
should be analyzed. Future detailed examinations of RPA effects on both the helicase
and ATPase activities of Dna2p will permit more understanding of the underlying
mechanisms of this interaction. Analysis of the interaction of the two proteins by
structural approaches will also reveal valuable information on the functions of this
32Dna2p is a tracking enzymeKao et al.
![Page 33: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/33.jpg)
protein-protein contact. The very fact that the stimulation was not anticipated, based on
the expected inhibitory effect of bound
protein,01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PA
GES>456-61.</PAGES></MDL></Cite></EndNote>(21). The specific stimulation of
RPA on Dna2p and the inhibition by RPA of FEN1 tracking and cleavage led
md=Retrieve&
;db=PubMed&dopt=Citation&list_uids=14747468</URL></MDL></Cite></EndNote>(6,
1).
Overall, our results led us t′ propose a novel mechanistic model for Dna2p
cleavage. Dna2p, like FEN1, will recognize the 5(-end of a flap and track along the
single-stranded region prior to cleavage.
00</YEAR><VOLUME>275</VOLUME><NUMBER>14</NUMBER><PAGES>104
98-505</PAGES></MDL></Cite></EndNote>(14,19,32). The tracking properties of
both nucleases are similar except that Dna2p may employ a threading-like mechanism
whereas FEN1 does not. As suggested before, Dna2p prefers long
fmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</URL>
</MDL></Cite></EndNote>(6,10,21,23). Only FEN1 can cut at the base of a flap in one
cleavage reaction to create the substrate for DNA
01</YEAR><VOLUME>412</VOLUME><NUMBER>6845</NUMBER><PAGES>4
56-61.</PAGES></MDL></Cite></End. This property also supports the proposed order
of action for the two nucleases ADDIN EN.CITE
<EndNote><Cite><Author>Bae</Author><Year>2001</Year><RecNum>2264</RecNu
m><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000002264
</REFNUM><LABEL>21366151</LABEL><AUTHORS><AUTHOR>Bae, S.
H.</AUTHOR><AUTHOR>Bae, K. H.</AUTHOR><AUTHOR>Kim, J.
A.</AUTHOR><AUTHOR>Seo, Y. S.</AUTHOR></AUTHORS><TITLE>RPA
33Dna2p is a tracking enzymeKao et al.
![Page 34: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/34.jpg)
governs endonuclease switching during processing of Okazaki fragments in
eukaryotes</TITLE><KEYWORDS><KEYWORD>Adenosinetriphosphatase/metabolis
m</KEYWORD><KEYWORD>DNA/genetics/*metabolism</KEYWORD><KEYWO
RD>DNA Helicases/metabolism</KEYWORD><KEYWORD>DNA
Ligases/metabolism</KEYWORD><KEYWORD>DNA, Single-
Stranded/metabolism</KEYWORD><KEYWORD>DNA-Binding
Proteins/*physiology</KEYWORD><KEYWORD>Escherichia
coli/genetics/metabolism</KEYWORD><KEYWORD>Exodeoxyribonucleases/antagoni
sts & inhibitors/metabolism</KEYWORD><KEYWORD>RNA,
Messenger/metabolism</KEYWORD><KEYWORD>Saccharomyces
cerevisiae/genetics/metabolism</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD></KEYWORDS><SECONDARY_TITLE>Nature</SECON
DARY_TITLE><YEAR>2001</YEAR><VOLUME>412</VOLUME><NUMBER>68
45</NUMBER><PAGES>456-
61.</PAGES></MDL></Cite><Cite><Author>Kao</Author><Year>2004</Year><Rec
Num>4490</RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REF
NUM>0000004490</REFNUM><ACCESSION_NUMBER>14747468</ACCESSION_
NUMBER><VOLUME>279</VOLUME><NUMBER>15</NUMBER><YEAR>2004<
/YEAR><DATE>Apr 9</DATE><TITLE>On the roles of Saccharomyces cerevisiae
Dna2p and flap endonuclease 1 in Okazaki fragment
processing</TITLE><PAGES>15014-
24</PAGES><AUTHOR_ADDRESS>Department of Biochemistry and Biophysics,
University of Rochester School of Medicine, Rochester, New York 14642, USA.
[email protected]</AUTHOR_ADDRESS><AUTHORS><AUTHO
R>Kao, H. I.</AUTHOR><AUTHOR>Veeraraghavan,
J.</AUTHOR><AUTHOR>Polaczek, P.</AUTHOR><AUTHOR>Campbell, J.
34Dna2p is a tracking enzymeKao et al.
![Page 35: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/35.jpg)
L.</AUTHOR><AUTHOR>Bambara, R.
A.</AUTHOR></AUTHORS><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><URL>http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?c
md=Retrieve&a
mp;db=PubMed&dopt=Citation&list_uids=14747468</URL></MDL></Cite></EndNote>
1).
The nuclease activity of FEN1 alone has
md=Retrieve&db=PubMed&dopt=Citation&list_uids=12424238</URL><
/MDL></Cite></EndNote>(6,10). RD><KEYWORD>*Saccharomyces cerevisiae/ge
[Genetics]</KEYWOR∆></KEYWORDS></MDL></Cite></EndNote>(37-40). The
null mutant of FEN1 in S. cerevisiae,
rad2001</YEAR><VOLUME>21</VOLUME><NUMBER>15</NUMBER><PAGES>4889-
99.</PAGES></MDL></Cite></EndNote>(29), whereas dna2-1 mutants only show
md=Retrieve&db=PubMed&dopt=Citation&list_uids=14560028</URL><
/MDL></Cite></EndNote>(41,42). This indire
ctly reveals that FEN1 has a broader role in processing flaps
thamd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468</UR
L></MDL>< ′Cite></EndNote>(10,20). An exception is a flap with a foldback, also with
an
unstructmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12004053<
/URL></MDL></Cite></EndNote>(10,25). This suggests that Dna2p may be designed
to process only a subset of structured
fl00</YEAR><VOLUME>275</VOLUME><NUMBER>48</NUMBER><PAGES>38
022-31.</PAGES></MDL></Cite></EndNote>(1. Possible candidates are Rrm3p,
Pif1p, and Sgs1p, the yeast counterpart of BLM and WRN ADDIN EN.CITE
<EndNote><Cite><Author>Weitao</Author><Year>2003</Year><RecNum>4454</Re
35Dna2p is a tracking enzymeKao et al.
![Page 36: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/36.jpg)
cNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>0000004
454</REFNUM><ACCESSION_NUMBER>14643435</ACCESSION_NUMBER><V
OLUME>532</VOLUME><NUMBER>1-
2</NUMBER><YEAR>2003</YEAR><DATE>Nov 27</DATE><TITLE>Evidence
that yeast SGS1, DNA2, SRS2, and FOB1 interact to maintain rDNA
stability</TITLE><PAGES>157-72</PAGES><AUTHOR_ADDRESS>Braun
Laboratories 147-75, California Institute of Technology, 91125, Pasadena, CA,
USA</AUTHOR_ADDRESS><AUTHORS><AUTHOR>Weitao,
T.</AUTHOR><AUTHOR>Budd, M.</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><SECONDARY_TITLE>Mutat
Res</SECONDARY_TITLE><URL>http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cm
d=Retrieve&db=PubMed&dopt=Citation&list_uids=14643435</URL></
MDL></Cite><Cite><Author>Weitao</Author><Year>2003</Year><RecNum>4430</
RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNUM>00000
04430</REFNUM><ACCESSION_NUMBER>12686542</ACCESSION_NUMBER><
VOLUME>278</VOLUME><NUMBER>25</NUMBER><YEAR>2003</YEAR><D
ATE>Jun 20</DATE><TITLE>Dna2 helicase/nuclease causes replicative fork stalling
and double-strand breaks in the ribosomal DNA of Saccharomyces
cerevisiae</TITLE><PAGES>22513-22</PAGES><AUTHOR_ADDRESS>Braun
Laboratories 147-75, California Institute of Technology, Pasadena, California 91125,
USA.</AUTHOR_ADDRESS><AUTHORS><AUTHOR>Weitao,
T.</AUTHOR><AUTHOR>Budd, M.</AUTHOR><AUTHOR>Hoopes, L.
L.</AUTHOR><AUTHOR>Campbell, J.
L.</AUTHOR></AUTHORS><SECONDARY_TITLE>J Biol
Chem</SECONDARY_TITLE><KEYWORDS><KEYWORD>Adenosinetriphosphatas
e/*metabolism</KEYWORD><KEYWORD>Bleomycin/pharmacology</KEYWORD>
36Dna2p is a tracking enzymeKao et al.
![Page 37: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/37.jpg)
<KEYWORD>*DNA Damage</KEYWORD><KEYWORD>DNA
Helicases/*metabolism</KEYWORD><KEYWORD>DNA
Replication/*genetics</KEYWORD><KEYWORD>DNA,
Fungal/chemistry/genetics/metabolism</KEYWORD><KEYWORD>DNA,
Ribosomal/chemistry/*genetics/metabolism</KEYWORD><KEYWORD>Models,
Molecular</KEYWORD><KEYWORD>Nucleic Acid
Conformation</KEYWORD><KEYWORD>Recombination,
Genetic</KEYWORD><KEYWORD>Restriction
Mapping</KEYWORD><KEYWORD>Saccharomyces cerevisiae/drug
effects/*enzymology/genetics</KEYWORD><KEYWORD>Sequence
Deletion</KEYWORD><KEYWORD>Support, Non-U.S.
Gov't</KEYWORD><KEYWORD>Support, U.S. Gov't, Non-
P.H.S.</KEYWORD><KEYWORD>Support, U.S. Gov't,
P.H.S.</KEYWORD></KEYWORDS><URL>http://www.ncbi.nlm.nih.gov/entrez/quer
y.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12686542<
/URL></MDL></Cite><Cite><Author>Imamura</Author><Year>2003</Year><RecNu
m>4387</RecNum><MDL><REFERENCE_TYPE>0</REFERENCE_TYPE><REFNU
M>0000004387</REFNUM><AUTHORS><AUTHOR>Imamura, O,
</AUTHOR><AUTHOR>Campbell,
JL.</AUTHOR></AUTHORS><YEAR>2003</YEAR><TITLE>The human Bloom
syndrome gene suppresses the DNA replication and repair defects of yeast dna2
mutants</TITLE><SECONDARY_TITLE>Proc Natl Acad Sci U S
A</SECONDARY_TITLE><VOLUME>100</VOLUME><NUMBER>14</NUMBER
><PAGES>8193-8198</PAGES></MDL></Cite></EndNote>(43-45).
The tracking mechanism of Dna2p may also have other roles in cellular DNA
metabolismd=Retrieve&db=PubMed&dopt=Citation&list_uids=14747468
37Dna2p is a tracking enzymeKao et al.
![Page 38: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/38.jpg)
</URL></MDL></Cite></EndNote>(6,10). The essential nature of Dna2p in DNA
metabolism is under intensive study. Many studies have revealed that it
mmd=Retrieve&db=PubMed&dopt=Citation&list_uids=14718559</URL
></MDL></Cite></EndNote>(44,46,47). Clearly, further study of the interaction of
Dna2p with other pr
oteins for cleavage of long flaps is necessary just to understand its role in DNA
replication.
Acknowledgments––We are grateful to members of the Bambara laboratory for
valuable discussions and suggestions, especially the members of the DNA replication and
repair gr
oup. We als of the Campbell laboratory for contributing to this project.
38Dna2p is a tracking enzymeKao et al.
![Page 39: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/39.jpg)
References ADDIN EN.REFLIST 1. Kornberg, A., and Baker, T. A. (1992) DNA Replication, 2nd.
Ed., pp. 140-144, W. H. Freeman and Co., New York
2. Anderson, S., and DePamphilis, M. L. (1979) J. Biol. Chem. 254, 11495-11504
3. Nethanel, T., Zlotkin, T., and Kaufmann, G. (1992) J. Virol. 66, 6634-6640
4. Arezi, B., and Kuchta, R. D. (2000) Trends Biochem. Sci. 25, 572-576.
5. Maga, G., Villani, G., Tillement, V., Stucki, M., Locatelli, G. A., Frouin, I., Spadari, S., and Hubscher, U. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14298-14303.
6. Ayyagari, R., Gomes, X. V., Gordenin, D. A., and Burgers, P. M. (2003) J. Biol. Chem. 278, 1618-1625
7. Podust, V. N., Podust, L. M., Muller, F., and Hubscher, U. (1995) Biochemistry 34, 5003-5010
8. Bae, S. H., Kim, J. A., Choi, E., Lee, K. H., Kang, H. Y., Kim, H. D., Kim, J. H., Bae, K. H., Cho, Y., Park, C., and Seo, Y. S. (2001) Nucleic Acids Res. 29, 3069-3079.
9. Budd, M. E., and Campbell, J. L. (1997) Mol. Cell. Biol. 17, 2136-2142
10. Kao, H. I., Veeraraghavan, J., Polaczek, P., Campbell, J. L., and Bambara, R. A. (2004) J. Biol. Chem. 279, 15014-15024
11. Harrington, J. J., and Lieber, M. R. (1994) EMBO J. 13, 1235-1246
12. Harrington, J. J., and Lieber, M. R. (1995) J. Biol. Chem. 270, 4503-4508
13. Kao, H. I., Henricksen, L. A., Liu, Y., and Bambara, R. A. (2002) J. Biol. Chem. 277, 14379-14389.
14. Murante, R. S., Rust, L., and Bambara, R. A. (1995) J. Biol. Chem. 270, 30377-30383
39Dna2p is a tracking enzymeKao et al.
![Page 40: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/40.jpg)
15. Ceska, T. A., Sayers, J. R., Stier, G., and Suck, D. (1996) Nature 382, 90-93
16. Hwang, K. Y., Baek, K., Kim, H. Y., and Cho, Y. (1998) Nat. Struct. Biol. 5, 707-713
17. Hosfield, D. J., Mol, C. D., Shen, B., and Tainer, J. A. (1998) Cell 95, 135-146
18. Kim, Y., Eom, S. H., Wang, J., Lee, D. S., Suh, S. W., and Steitz, T. A. (1995) Nature 376, 612-616
19. Bornarth, C. J., Ranalli, T. A., Henricksen, L. A., Wahl, A. F., and Bambara, R. A. (1999) Biochemistry 38, 13347-13354
20. Henricksen, L. A., Tom, S., Liu, Y., and Bambara, R. A. (2000) J. Biol. Chem. 275, 16420-16427
21. Bae, S. H., Bae, K. H., Kim, J. A., and Seo, Y. S. (2001) Nature 412, 456-461.
22. Bae, S. H., and Seo, Y. S. (2000) J. Biol. Chem. 275, 38022-38031.
23. Budd, M. E., Choe, W., and Campbell, J. L. (2000) J. Biol. Chem. 275, 16518-16529.
24. Kang, H. Y., Choi, E., Bae, S. H., Lee, K. H., Gim, B. S., Kim, H. D., Park, C., MacNeill, S. A., and Seo, Y. S. (2000) Genetics 155, 1055-1067
25. Bae, S. H., Kim, D. W., Kim , J., Kim, J. H., Kim, D. H., Kim, H. D., Kang, H. Y., and Seo, Y. S. (2002) J. Biol. Chem. 277, 26632-26641
26. Bae, S. H., Choi, E., Lee, K. H., Park, J. S., Lee, S. H., and Seo, Y. S. (1998) J. Biol. Chem. 273, 26880-26890.
27. LeBowitz, J. H., and McMacken, R. (1986) J. Biol. Chem. 261, 4738-4748
28. Sibenaller, Z. A., Sorensen, B. R., and Wold, M. S. (1998) Biochemistry 37, 12496-12506
29. Xie, Y., Liu, Y., Argueso, J. L., Henricksen, L. A., Kao, H. I., Bambara, R. A., and Alani, E. (2001) Mol. Cell. Biol. 21, 4889-4899.
40Dna2p is a tracking enzymeKao et al.
![Page 41: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/41.jpg)
30. Budd, M. E., and Campbell, J. L. (1995) Proc. Natl. Acad. Sci. U. S. A. 92, 7642-7646
31. Bae, K. H., Kim, H. S., Bae, S. H., Kang, H. Y., Brill, S., and Seo, Y. S. (2003) Nucleic Acids Res. 31, 3006-3015
32. Tom, S., Henricksen, L. A., and Bambara, R. A. (2000) J. Biol. Chem. 275, 10498-10505
33. Formosa, T., and Nittis, T. (1999) Genetics 151, 1459-1470.
34. Zhou, B. B., and Elledge, S. J. (2000) Nature 408, 433-439
35. Yong, Y., and Romano, L. J. (1996) Chem. Res. Toxicol. 9, 179-187
36. Driscoll, H. C., Matson, S. W., Sayer, J. M., Kroth, H., Jerina, D. M., and Brosh, R. M., Jr. (2003) J. Biol. Chem. 278, 41126-41135
37. Bambara, R. A., Murante, R. S., and Henricksen, L. A. (1997) J. Biol. Chem. 272, 4647-4650
38. Kao, H. I., and Bambara, R. A. (2003) Crit. Rev. Biochem. Mol. Biol. 38, 433-452
39. Gordenin, D. A., Kunkel, T. A., and Resnick, M. A. (1997) Nat. Genet. 16, 116-118
40. Kunkel, T. A., Resnick, M. A., and Gordenin, D. A. (1997) Cell 88, 155-158
41. Budd, M. E., and Campbell, J. L. (2000) Mutat. Res. 459, 173-186.
42. Callahan, J. L., Andrews, K. J., Zakian, V. A., and Freudenreich, C. H. (2003) Mol. Cell. Biol. 23, 7849-7860
43. Weitao, T., Budd, M., and Campbell, J. L. (2003) Mutat. Res. 532, 157-172
44. Weitao, T., Budd, M., Hoopes, L. L., and Campbell, J. L. (2003) J. Biol. Chem. 278, 22513-22522
45. Imamura, O., and Campbell, J. (2003) Proc. Natl. Acad. Sci. U. S. A. 100, 8193-
41Dna2p is a tracking enzymeKao et al.
![Page 42: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/42.jpg)
8198
46. Choe, W., Budd, M., Imamura, O., Hoopes, L., and Campbell, J. L. (2002) Mol. Cell. B
iol. 22, 4202-4217
47. Lesur, I., and Campbell, J. L. (2004) Mol. Biol. Cell. 15, 1297-1312
42Dna2p is a tracking enzymeKao et al.
![Page 43: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/43.jpg)
Footnotes1 The abbreviations used are: FEN1, flap endonuclease 1; PC
NA, proliferatin
g cell nuclear antigen; RPA, replication protein A; RFC, replication factor C.
43Dna2p is a tracking enzymeKao et al.
![Page 44: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/44.jpg)
Figure Legends
FIG. 1: Dna2p makes multiple cuts on a flap. A Dna2p titration assay (0, 10, 50, and 100
fmol, as indicated by the triangles) under either maximum-nuclease or maximum-
helicase conditions was employed. The experimental conditions and the labeling
prot′cols were the same as described under “Experimental Procedures.” An extra nucleotide at
the 3(-end of the temp′ate is purposely designed in all substrates, creating a one-
nucleotide overhang, that allows 3(-nucleotide addition by Klenow fragment. Both
substrates tested are in 38-nucleotide nicked double-flap configuration an′ contain exact
sequences (D1:T1:U1).′ The only difference in these substrates is that one is 5(-32P-
radiolabeled and the other is 3(-32P-radiolabeled, in lanes 1-7 and lanes 8-14,
respectively. The numbers o′ nucleotides on the flap and numbers of base pairs on the
duplex regions are indicated. The 3(-labeled substrate contains one more nucleotide in
the downstream annealed duplex, creating a blunt end (23 nucle′tides annealed on the
downstream duplex), due to the addition of the radioactive dC. In the 5(-labeled
substrate, the one-nucleotide overhang is represented as a staggered end in the schematic
diagram. Lanes 1 and 8 are the substrate-only controls. Lanes 2-4 and 9-11 are under
maximum-nuclease conditions whereas lanes 5-7 and 12-14 are under maximum-
helicase conditions. Schematic representations of the substrate structures are depicted on the
top of the gel, and a nucleotide length marker series is indicated on the left side of the gel.
Percent product formation, defined as” (product/(product + starting substr
a
tes))*100,” is indicated on the bottom o′ the gel. N, maximum-nuclease; H, maximum-
helicase.
FIG. 2: Dna2p cleavage requires a free 5(-end of a DNA. A Dna2p titration assay (0, 10,
44Dna2p is a tracking enzymeKao et al.
![Page 45: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/45.jpg)
50, and 100 fmol, as indicated by the triangles) under either maximum-nuclease or
maximum-helicase conditions was employed in both A and B panels. The assay
conditions were the same as descri′ed under “Experimental Procedures.” A, Dna2p
cleav′ge is blocked by primers annealed to the 5(-terminus of a flap substrate. Lanes 1-7
contain 3(-radiolabeled 25-nucleotide double-flap substrates (D2:T2:U1) as the no-
blocking-primer controls. Lanes 8-14 contain blocking primers B1. Lanes 1 and 8 are
the substrate-only controls. Lanes 2-4 and 9-11 are under maximum-nuclease
conditions whereas lanes 5-7 and 12-14 are under maximum-helicase conditions.
Schematic representations of the substrate structures are depicted on the top of the gel.
The numbers of the nucleotides in the flap and the numbers of base pairs in the duplex
regions are labeled. Percent product formation is indicated on the bottom of the gel. A
10-nucleotide length marker series is indicated on the left side of the gel. B, bubble
substrates inhibit Dna2p cleavage. The experimental design is the same as in panel A,
but a 53-nucleotide double-flap (D4:T3:U1), 50-nucleotide bubble (D5:T4), nick-bubble
(D5:T4:U2), and double-flap-bubble (D5:T4:U1) substrates were utilized,
respectively in lanes 1-7, 8-14, 15-21, and 22-28. N, maximum-nuclease; H,
maximum-helicase.
FIG. 3: Cleavage by Dna2p requires a tracking mechanism. A, a Dna2p titration assay (0,
10, 50, and 100 fmol, as indicated by the triangles) under either maximum-nuclease or
maximum-helicase conditions was employed. The as′ay conditions were the same as
described under “Experimental Procedures.” Lanes 1-7 contain 3(-radiolabeled 73-
nucleotide double-flap substrates (D3:T3:U1) and a poly-dT16 primer, a non-
complementary primer, as the no-blocking-primer control. Lanes 8-14, 15-21, and 22-
28 contain blocking primers B1, B2, and B3, respectively, that are annealed at distances
45Dna2p is a tracking enzymeKao et al.
![Page 46: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/46.jpg)
leaving a gap of 53, 32, and 0 nucleotides from the first annealed nucleotide on the
downstream duplex DNA. Lanes 1, 8, 15, and 22 are the substrate-only controls. Lanes 2-4,
9-11, 16-18, and 23-25 are under maximum-nuclease conditions whereas lanes 5-7,
12-14, 19-21, and 26-28 are under maximum-helicase conditions. Schematic
representations of the substrate structures are depicted on the top of the gel. For A and B,
the numbers of nucleotides in the flap and numbers of the base pairs in the duplex regions
are labeled. Percent product formation is indicated on the bottom of the gel. A 10-
nucleotide length marker series is indicated on the left side of the gel. B, a single amount
of Dna2p (50 fmol) was utilized in each reaction. Substr°tes (5 fmol) were preincubated
with and without 25 fold excess of streptavidin for 5 min at 37(C and followed by either
maximum-nuclease (lanes 2, 5, 8, 11, 14, and 17) or maximum-helicase (lanes 3, 6, 9,
12, 15, and 18) conditions as described under the “Experimental Procedures.” Lanes 1-6
contain the non-biotinylated substrate control (D4:T3:U1). Lanes 7-12 and 13-18
inc′ude substrates (D4:T3:U1) that are biotinylated at the first or the 25th nucleotide from the
5(-end of the flap, respectively. The experimental setup and the schematic representation
of the substrates are indicated on the top of the gel, and a 10-nucleotide length marker
series is indicated on the left side of the gel. N, maximum-nuclease; H, maximum-
helicase.
FIG. 4: Dna2p can track over modified sites, and a “threading-like” mechanism may be
involved. A Dna2p titration assay (0, 10, 50, and 100 fmol, as indicated by the triangles)
under either maximum-nuclease or maximum-helicase conditions was employed in both
A and B panels. The experimental conditions and the labeling protocols′were the same as
described under “Experimental Procedures.” A, the substrates utilized were 3(-32P-
radiolabeled 38-nucleotide double-flaps (D6:T5:U1) in lanes 1-7 and 3-amino-
46Dna2p is a tracking enzymeKao et al.
![Page 47: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/47.jpg)
thiocyano-1,2-propanediol modified flap substrates in lanes 8-14. Lanes 1 and 8 are the
substrate-only controls, and lanes 2 and 10 are the FEN1-only controls. Lanes 3-5 and
11-13 are under maximum-nuclease conditions whereas lanes 6-8 and 14-16 are under
maximum-helicase conditions. Schematic representations of the substrate structures are
depicted on the top of the gel, and a nucleotide length marker series is indicated on the
left side of the gel. The numbers of the nucleotides in the flap and numbers of the base
pairs in the duplex regions are labeled. Percent product formation is indicated on t′e
bottom of the gel. B, the experimental designs are the same as in A. Lanes 1-8 contain a
3(-radiolab′led 38-nucleotide double-flap substrate (D1:T1:′1), and lanes 9-16 are the
substrates with a 2(-branch point
a
t the 12th nucleotide from the 5(-end of the flap. N, maximum-nuclease; H, maximum-
helicase.
FIG. 5: The tracking mechanism prevents Dna2p from cleaving replication intermediates. A reaction with Dna2p (100 fmol) and RPA (100 fmol) was performed under maximum-nuclease (lanes 2-3, 7-8, 12-13, and 17-18) or maximum-helicase ′lanes 4-5, 9-10, 14-15, and 19-20) conditions,′as described in “Experimental
Procedures.” A 3(-radiolabeled 30-nucleotide (D7:T6:U3) and a 3(-radiolabeled 73-
nucleotid′ (D3:T3:U1) double-flap control reactions were′done in lanes 1-5 and
11-15, respectively. A 5(-radiolabeled 29-nucleotide (D8:T7:U4) and a 5(-
radiolabeled 70-nucleotide (D9:T8:U5) gap substrates mimicking replication intermediates were tested in lanes 6-10 and 16-20. Lanes 1, 6, 11, and 16 are the substrate-only controls. Schematic representations of the substrate structures are depicted on the top of the gel, and a nucleotide length marker series is indicated on the left side of the gel. The numbers of the nucleotides in the flap and numbers of the base pairs in the duplex regions are labeled. Percent product
47Dna2p is a tracking enzymeKao et al.
![Page 48: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/48.jpg)
TABLE I. Oligonucleotide sequences (5’-3’)_________________________________________________________________________________________________________________________
Downstream Primers a,bD1 (60-mer) TCGCACGTTTCACGCCTGTTACTTAATTCACTGGCCGTCGTTTTACAACGACGTGACTGGD2 (43-mer) CGTACGGACGTAGAGCTGTTTCCAAGTAAAACGACGGCCAGTGD3 (96-mer) CGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCGCCCGTTTCACGCCTGTTAGTTAATTCACTGGCCGT
CGTTTTACAACGACGTGACTGGGD4 (76-mer) GTACCGAGCTCGAATTCGCCCGTTTCACGCCTGTTAGTTAATTCACTGGCCGTCGTTTTACAACGACGTGACTGGGD5 (100-mer) GACTCTCGACTCACGTAGAGCTGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCCAAGTA
AAACGACGGCCAGTGCTACGAGD6 (58-mer) TCGCXCGTTTCACGCCTGTTACTTAATTCACTGGCCGTCGTTTTACAACGTGACTGGGD7 (55-mer) AGGTCTCGACTAACTCTAGTCGTTGTTCCACCCGTCCACCCGACGCCACCTCCTGD8 (25-mer) CGACCGTGCCAGCCTAAATTTCAATD9 (20-mer) GACGAATTCCGGATACGACG
Upstream PrimersU1 (26-mer) CGCCAGGGTTTTCCCAGTCACGACCAU2 (25-mer) CGCCAGGGTTTTCCCAGTCACGACCU3 (26-mer) CGACCGTGCCAGCCTAAATTTCAATAU4 (18-mer) CCACCCGTCCACCCGACGU5 (20-mer) TGCTGGGATCCTACAACCAA
TemplatesT1 (48-mer) GCCAGTCACGTCGTTGTAAAACGGGTCGTGACTGGGAAAACCCTGGCGT2 (44-mer) GCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCGT3 (49-mer) GCCCAGTCACGTCGTTGTAAAACGGGTCGTGACTGGGAAAACCCTGGCGT4 (76-mer) GCTCGTAGCACTGGCCGTCGTTTTACGGTCGTGACTGGGAAAACCCTGGCGAACAGCTCTACGTGAGTCGA
GAGTCT5 (46-mer) GCCCAGTCACGTTGTAAAACGGGTCGTGACTGGGAAAACCCTGGCGT6 (51-mer) GCAGGAGGTGGCGTCGGGTGGACGGGATTGAAATTTAGGCTGGCACGGTCGT7 (72-mer) ATTGAAATTTAGGCTGGCACGGTCGGCACTGGCCGTCGTATCCGCAGGAGGTGGCGTCGGGTGGACGGGTGGT8 (110-mer) TTGGTTGTAGGATCCCAGCACATTGAAGGCAGGAGGTGGCGTCGGGTGGACGGGTGGATTGAAATTTAGGC
TGGCACGGTCGGCACTGGCCGTCGTATCCGGAATTCGTC
Blocking PrimersB1 (18-mer) CAGCTCTACGTCCGTACGB2 (20-mer) CCGGGGATCCTCTAGAGTCGB3 (21-mer) GGGCGAATTCGAGCTCGGTACB4 (23-mer) ACGGCCAGTGAATTAACTAACAG_________________________________________________________________________________________________________________________a The bolded nucleotides represent the location of modification. D6 contains either guanosine or 3-amino-thiocyano-1,2-propanediol at position X. D1 contain DNA side chains. b The underlined nucleotide indicates a biotin modification.
![Page 49: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/49.jpg)
![Page 50: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/50.jpg)
![Page 51: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/51.jpg)
![Page 52: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/52.jpg)
![Page 53: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/53.jpg)
![Page 54: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/54.jpg)
![Page 55: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/55.jpg)
![Page 56: Dna2p Helicase/Nuclease Is a Tracking Protein, Like FEN1 ...biophys.w3.kanazawa-u.ac.jp/References/DNA-RNA/Helicase-JBC-20… · segments called Okazaki fragments. Each contains an](https://reader034.vdocuments.us/reader034/viewer/2022042622/5f8290d4b1f1e4780e091fe3/html5/thumbnails/56.jpg)