![Page 1: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/1.jpg)
Tunisian Journal of Plant Protection 25 Vol. 11, No. 1, 2016
Development of TaqMan Real-Time PCR Markers Targeting
Erwinia amylovora Chromosomal DNA
Dorsaf Yahiaoui, Centre Technique des Agrumes, Km 6, Route Grombalia Beni-
Khalled, Nabeul, Tunisia, Mohamed Chérif, Laboratoire de Phytopathologie,
Institut National Agronomique de Tunis, Université de Carthage, 43- Rue Charles
Nicolle, 1082 Tunis-Mahrajene, Le Belvédère, Tunisia, and Jong Hyun Ham, LSU
Life Sciences Building, Department of Plant Pathology and Crop Physiology, 110
LSU Union Square, Baton Rouge, LA70803-0106, Louisiana State University, USA __________________________________________________________________________
ABSTRACT
Yahiaoui, D., Chérif, M., and Ham, J.H. 2016. Development of TaqMan real-time PCR
markers targeting Erwinia amylovora chromosomal DNA. Tunisian Journal of Plant
Protection 11: 25-35.
From the earliest, Erwinia amylovora, the causal agent of the fire blight disease was considered an
invasive pest that threatened several pome fruit varieties elsewhere and disrupted their
commercialization. In this work, highly specific sets of real-time PCR fluorogenic primers and probes
flanking the 16S-23S rRNA intergenic transcribed spacer regions have been designed based on
TaqMan chemistry. Throughout a serial of validation trials, crucial reaction parameters have been
optimized. Therefore, the primer set ITSEA2 highlighted the most reliable signals in terms of gene
expression. With respect to conventional PCR tools, the newly developed molecular markers provided
more accurate specificity, a higher sensitivity up to 105 cfu/ml and a quantitative amplification of the
targets.
Keywords: Erwinia amylovora, ITS, molecular diagnosis, TaqMan real-time PCR
__________________________________________________________________________
Erwinia amylovora pathogen is
native from North America. Then, it has
been slowly spread into the European
Union region and reached the Eastern
Mediterranean area since the early 1980’s
(6). Currently, fire blight disease’s causal
agent is one of the most important
quarantine organisms among the A2
EPPO list (5), whereby introduction is
Corresponding author: Dorsaf Yahiaoui
Email: [email protected]
Accepted for publication 9 March 2016
prohibited by almost all countries. It is
either considered as the most destructive
disease of many pome fruit crops
(Rosaceae: Maloideae) including apple
(Malus domestica), pear (Pyrus
communis), quince (Cydonia oblonga),
medlar (Eriobotrya japonica), Crataegus
spp., etc… (17), but natural infections can
occur also in other plants such as
Japanese plum (Prunus salicina) (11) and
Rubus spp. (6).
As indicated by its name, fire
blight infection induces dark
discoloration of twigs and leaves as
though burned by fire. Depending on the
affected explants, the disease produces
blossom blight, shepherd’s crook twig
![Page 2: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/2.jpg)
Tunisian Journal of Plant Protection 26 Vol. 11, No. 1, 2016
deformation and exudation of sticky-
milky ooze (17).
Within the Euro-Mediterranean
region, outbreaks of E. amylovora have
been depicted from most of the pome fruit
producing countries. So far, in the North
African area, E. amylovora foci have
been reported from Algeria and also from
Egypt. In spring 2012, the fire blight
disease has been reported from Tunisian
orchards for the first time (16); whereby
heavy losses have been occurred on pear
yields (cvs. Alexandrine and Williams)
that reached 75% value in some instances.
In order to maintain vigilance in pome
fruit orchards and to limit the spread of E.
amylovora ravages into uninfected areas,
governmental regulations dealt with
strengthening the international quarantine
measures in the borders, prohibiting the
introduction of any plant propagating
material (suckers, plantlets, etc.) from
risky countries and the establishment of a
large scale surveillance program. Up to
date, it still quiets hard to cure the fire
blight infestation once established.
Hence, early pathogen detection, removal
and eradication of inoculum’s sources are
of a paramount importance in order to
limit the spread of disease into pathogen-
free areas. Routine diagnosis of E.
amylovora, however, makes problematic
the detection of latent or symptomless
infections, which is critical since infected
budwood are the main means of the
disease dispersal within and between
countries and continents (2). From this
context, serological tests such as
immunofluorescence and ELISA are time
consuming and cause problems with
sensitivity and specificity. Polyclonal
antibodies may cross-react with other
plant-associated bacteria, resulting in
false positive results. Monoclonal
antibodies are often too specific to detect
all E. amylovora strains. Then, classical
PCR assays are mostly based on pEA29
plasmid sequence making them not
reliable enough to detect bacteria lacking
this plasmid (7).
Real-time PCR based assays have
been designed for detection of various
plant pathogens and have benefits such as
rapidity, automation, reduction in post-
PCR handling, high sensitivity, the
possibility of quantification, etc... (4). To
date, several quantitative PCR (qPCR)
protocols have been designed on the basis
of pEA29 plasmid (1, 3), meanwhile,
methods based on detection of
chromosomal DNA give the best choice
as screening tests. So far, the ribosomal
16S-23S intergenic transcribed spacer
regions (ITS) showed their convenience
in detecting many bacterial species (18).
The main goal undertaken by this
work is the design of reliable TaqMan
real-time PCR primer sets for molecular
fire blight diagnosis flunking the 16S-23S
rDNA ITS of most E. amylovora isolates.
MATERIALS AND METHODS Bacterial isolation and plant material.
E. amylovora suspicious bacteria
used in this work were obtained from
several locations in Louisiana State (LA,
USA), including asymptomatic pear and
apple field samples growing in the LSU
AgCenter Plant Diagnosis Center, in
addition to some other cultures kindly
provided by the LSU Plant Pathology
Laboratories (Table 1). Samples were
originally recovered from young shoots,
leaves and some blossoms. From the
collected field samples, maceration of
endophytic bacteria has been processed in
sterile 10 mM phosphate buffered saline
(PBS, pH 7.2) solution. Further surface
sterilization with 70% ethanol and 10%
sodium hypochlorite, the plant tissues at
the leading edge of shoot and leaf lesions
have been carefully cut into small pieces
and supplied with 500 μl of PBS buffer.
Then, samples were crashed with a sterile
![Page 3: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/3.jpg)
Tunisian Journal of Plant Protection 27 Vol. 11, No. 1, 2016
pestle. By decantation, serial of dilutions
(1:10 fold) were made from the
supernatant. Then, a volume of 100 μl
from each dilution was dispensed in
Nutrient Agar (NA) solid media supplied
with cycloheximide (50 mg/ml).
Table 1. Bacteria samples used for the detection of Erwinia amylovora and their isolation sources
Code Location Host species
FB-A Civic Center, Houma (LA) Pyrus communis cv. Bradford
FB-B Abbeville, LA Malus domestica
FB-C New Orleans Botanical Garden, LA P. communis
FB-D New Orleans Botanical Garden, LA Western Mayhaw trees (Crataegus opaca)
EA’01 LSU Campus, LA Bacterial culture form P. communis
EA’05 LSU Campus, LA Bacterial culture form P. communis
Ea Std Bagalusa, LA Bacterial culture form P. communis
*Ea Std: a standard/reference strain of E. amylovora provided by LSU Plant Pathology lab and
used as positive control for the detection trials.
Among the endophytic bacteria
obtained from the plant tissues,
representative colonies sharing similar
morphological characteristics with the
bacteria of interest have been streaked
individually in solid Luria Burtani (LB)
medium, and incubated for 48-72 h at
30°C. On LB medium, a number of 18 E.
amylovora-like colonies showed circular
growth and creamy white consistence,
while, they had whitish smooth and
mucoid form when plated onto Potato
Dextrose Agar (PDA) medium.
Furthermore, aiming to screen E.
amylovora accessions among the isolated
colonies, bacterial suspensions have been
prepared from an enriched LB broth
medium and overnight incubated at 30°C
with shaking at 250 rpm. For accurate
identification, a recipient supplied with a
reference strain of E. amylovora culture
(hereafter designated as Ea Std) has been
included for comparison, in addition to
two negative controls containing only
sterile LB broth and Pseudomonas sp.
isolate, respectively.
Genomic DNA isolation and
conventional PCR amplifications.
Due to the low titer of culturable
population of E. amylovora in the
asymptomatic collected samples
(unfavorable weather conditions for fire
blight), the v/v enrichment of the
macerate have been prepared and
incubated overnight at 30°C. A standard
concentration of 108
cfu/ml has been set
up from each colony using a
spectrophotometer at OD600 nm. Then,
genomic DNA has been recovered from a
volume of 1.5 ml of Gram negative
bacterial suspensions using a commercial
silica-column-based DNeasy Plant Mini
Kit (Qiagen) following the
manufacturer’s instructions. Resulting
pellets were re-suspended in 50-100 μl of
TE buffer and stored at -20°C until use.
Quality of DNA has been checked by 1%
electrophoresis gel in 1X TBE buffer (89
mM Tris-Borate, 2 mM EDTA, pH 8)
prior to be stained with ethidium bromide
(200 ng/ml) and visualized under UV
light. Extracted DNA was subjected to
conventional PCR amplifications using a
standard pair of oligonucleotide primers
described by Weisburg et al. (1991);
specific to a broad spectrum of eubacteria
taxa flunking the 16S ribosomal DNA
(rDNA) (Table 2).
![Page 4: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/4.jpg)
Tunisian Journal of Plant Protection 28 Vol. 11, No. 1, 2016
Table 2. Primers used for the 16S rDNA amplification from bacteria (18)
Primer
name Sequence 5’ – 3’
Amplicon
length
fd1 CCGAATTCGTCGACAACAGAGTTTGATCCTGGCTCAG ca 1500 bp rd1 CCGAATTCGTCGACAACAGAGTTTGATCATGGCTCAG
*fd1: Forward primers; rd1: reverse primers.
PCR reactions were made at a
final volume of 25 μl vessel including: 2
μl of DNA template, 10X PCR buffer, 10
mM deoxy-nucleotidetriphosphate
(dNTPs), 10 μM from each primer and 5
U/ μl Paq5000 Taq polymerase (Agilent,
USA). Cycling program consisted of 1
min at 95°C, then 34 cycles of 2 min
denaturation at 95°C, 30 s annealing at
42°C and 4 min elongation at 72°C; with
a final extension step of 20 min at 72°C.
PCR products were analyzed with 0.7%
agarose gel electrophoresis in 1X TBE
buffer. Later on, PCR amplicons from
positive samples have been purified using
the Qiagen PCR purification kit following
the manufacturer’s instructions. A volume
of 15 μl has been sent for sequencing.
Real-time PCR primers assay: design
and setup.
During this study, the 16S-23S
rDNA ITS was selected as target genomic
fragment for the design of E. amylovora
specific primers probes from the TaqMan
chemistry. Consensus sequences of 662
length fragments have been retrieved
from the publicly available NCBI
Genbank and were subjected to sequence
alignment using the default options of
CLUSTALX 1.8 (13), a Windows
interface for the CLUSTALW multiple
sequence alignment program.
A number of three sets of qPCR
primers and probes labeled with a
reporter fluorophore at the 5’ end and a
quencher dye at the 3’ end (hereafter
referred to as the ITSEA1, ITSEA2 and
ITSEA3) designed for the sensitive
detection of E. amylovora using the
GenScript Real-time PCR (TaqMan)
Primer Design program
(https://www.genscript.com/ssl-
bin/app/primer) to select a highly specific
region for most E. amylovora accessions
(Table 3).
Real-time PCR reactions were
performed on an ABI PRISM_ 7900 real-
time apparatus (Applied Biosystems)
following the cycling conditions of 2 min
at 50°C, 10 min at 95°C, followed by 45
cycles of 15 s at 95°C and 1 min at
different annealing temperatures.
Reaction vessel of 20 μl volume
contained, in final concentrations: 1 μM
each of FAM and TAMRA primers
(Bioneer, Republic of Korea), 400 nM
probe, 1X TaqMan Universal PCR
Master MixR (Applied Biosystems, USA)
and 1 μl of DNA template/sample. SDS
2.2.2 software (Applied Biosystems) was
used for fluorescence acquisition and
calculation of threshold cycles (Ct). The
baseline was set automatically and the
fluorescence threshold was set manually
to intersect with the linear part of the
amplification curves of all real-time PCR
assays, resulting in the final Ct value for
each well. Then, the slope (K) of the
linear regression line between logarithmic
values of cell numbers and Ct values was
used to calculate the amplification
efficiency (E) where a value of one
corresponds to 100% amplification
efficiency.
![Page 5: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/5.jpg)
Tunisian Journal of Plant Protection 29 Vol. 11, No. 1, 2016
Table 3. TaqMan primers and probes designed for real-time PCR detection of Erwinia amylovora
Name Sequence 5’-3’ Posi-
tion
Tm
(°C)
Expected
amplicon
length
GC
(%)
TaqMan primer set 1: ITSEA1
ITSEAF1 CCTGTGGGTTGTGAGGTTAAG 543 62
95 bp
52.4
ITSEAR1 CCGTCGCTTTACGCAGATTA 618 62 50
ITSEAP1 FAM-CAGTCAGAGGCGATGAAGGACGTG-TAMRA 593 68 58
TaqMan primer set 2: ITSEA2
ITSEAF2 CGAGTCTCTCAAATGCTTGC 502 58.75
124 bp
45
ITSEAR2 GCAGATTAGCACGTCCTTCA 606 59.03 50
ITSEAP2 FAM-TGACTGCCTGGGCATCCACC-TAMRA 579 69.05 65
TaqMan primer set 3: ITSEA3
ITSEAF3 GCTTGGTGACAGGTGAAAGA 347 58.85
116 bp
50
ITSEAR3 ACGACACGTCGTTTCAATTT 443 58.13 40
ITSEAP3 FAM-TGCTCTTTAACAATCCGGAACAAGCTG-TAMRA 415 68.93 44.4
Performance characteristics of the
real-time PCR assays.
Firstly, the specificity of the
designed TaqMan primers and probes was
assessed throughout amplifications of
genomic DNA templates extracted from
some bacterial accessions belonging to
Pseudomonas spp. strains. Then, in order
to determine the limit of detection of each
real-time PCR assay, a serial of dilutions
(10 fold) of E. amylovora standard culture
(Ea Std) in sterile water ranging from
1.109 to 1.10
5 cfu/ml (3
replicates/dilution) has been performed.
The slope (K) of the linear regression line
between logarithmic values of cell
numbers (X-axis) and Ct values (Y-axis)
were used to calculate the amplification
efficiency, E = (10[-1/k]
) - 1, where a value
of one corresponds to 100% amplification
efficiency (14).
RESULTS Conventional PCR detection of E.
amylovora.
Using 16S universal primers, a
signal of 1500 bp length amplicons has
been yielded from almost all collected
samples (Fig. 1). Nevertheless, DNA
extracted from pear samples FB-A
relative to pear leaves that have been
collected from Houma (LA, USA) was
rarely amplified, while the FB-C, from
New Orleans botanical garden resulted
negative. Regarding the DNA targets
from Pseudomonas sp. and E. amylovora
reference strain, used primers often
yielded some unspecific amplifications.
Consensus sequences from the
positive PCR products delivered from the
samples FB-B and D showed over than
98% of nucleotide identity with 16S
ribosomal RNA of E. amylovora bc206
strain deposited in the GenBank under the
accession number: AF140338.1.
Performance characteristics of the
fluorogenic TaqMan qPCR markers.
As illustrated in Table 5, using
55°C as a polymerization temperature
fairly to the three qPCR primer sets and
using DNA from known E. amylovora
(Ea Std) strain in addition to nucleic acid
from other bacteria species and water
control (WC), a better amplification
signals were highlighted from the primer
set ITSEA2 (E value was around 114%)
compared to both ITSEA1 and 3;
whereby obtained E values were around
132 and 124%, respectively (Fig. 2).
Therefore, too low amount of inocula up
to 5 cfu/ml have been detected by all of
the designed primers (Table 4).
![Page 6: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/6.jpg)
Tunisian Journal of Plant Protection 30 Vol. 11, No. 1, 2016
Fig. 1. DNA fragments amplified upon 16S rDNA region from blighted blossoms using universal primers in 0.7% agarose gel electrophoresis. M: 1Kb plus DNA
Ladder; Lanes 1 to 4: Bacterial DNA isolated from samples FB-A, B, C and D,
respectively; Lanes 5 and 6: Genomic DNA extracted from Ea’01 and Ea’05 cultures; WC: water control; Lane 7: genomic DNA from Pseudomonas spp.; Lane
+C: DNA extracted from reference E. amylovora culture.
Table 4. Average of Ct values of different samples during standardization of designed ITSEA TaqMan primers
Sample ITSEA1 ITSEA2 ITSEA3
Ct average Result Ct average Result Ct average Result
Ea Std 109 CFU/ml 22.62 + 18.04 + 22.57 +
Ea Std 108 CFU/ml 24.60 + 20.17 + 24.47 +
Ea Std 107 CFU/ml 27.58 + 23.72 + 27.52 +
Ea Std 106 CFU/ml 30.70 + 27.15 + 30.86 +
Ea Std 105 CFU/ml 33.21 + 29.61 + 33.58 +
Pseudomonas sp. No signal - No signal - No signal -
WC No signal - No signal - No signal -
Table 5. Average of Ct values of samples during standardization of designed ITSEA TaqMan primer
sets
Sample ITSEA1 ITSEA2 ITSEA3
Ct average Result Ct average Result Ct average Result
Ea Std 109 CFU/ml 22.13 + 21.27 + 26.00 +
Ea Std 108 CFU/ml 25.37 + 23.02 + 26.03 +
Ea Std 107 CFU/ml 27.70 + 26.73 + 28.91 +
Ea Std 106 CFU/ml 31.56 + 30.53 + 31.84 +
Ea Std 105 CFU/ml 34.73 + 33.95 + 35.99 +
Pseudomonas sp. No signal - No signal - No signal -
WC No signal - No signal - No signal -
In order to optimize the reaction
conditions for the different designed
qPCR primers, similar experiments have
been performed by increasing the
polymerization and cleavage temperature
up to 60°C and maintaining the same
reaction conditions previously proceeded.
As a result, all of the real-time
assays were found to be efficient for
detection of E. amylovora, and these
results were in accordance with the
characteristics of the target regions.
Meanwhile, higher sensitivity has
been shown by the ITSEA2 designed set
of primers (1.8 × 105 cfu/ml), and as
expected no non-specific amplifications
have been yielded from bacteria other
than E. amylovora DNA, such as
Pseudomonas sp. used as a biocontrol
agent. ITSEA2 primer set showed the best
amplification efficiency values and an
average square regression coefficient R2
of 98% (Fig. 3). Then, Ct values were
below 35 at the detection limit for all the
tested samples (Table 5), suggesting that
using this qPCR primer set pathogen
titres even less than 5 cfu/ml may be
efficiently detected.
M 1 2 3 4 5 6 wc 7 +c
![Page 7: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/7.jpg)
Tunisian Journal of Plant Protection 31 Vol. 11, No. 1, 2016
Fig. 2a. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 1 markers at polymerization
temperature of 55°C (FAM: 6-carboxyfluorescein).
Fig. 2b. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 2 markers at polymerization
temperature of 55°C (FAM: 6-carboxyfluorescein).
Fig. 2c. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 3 markers at polymerization
temperature of 55°C (FAM: 6-carboxyfluorescein).
![Page 8: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/8.jpg)
Tunisian Journal of Plant Protection 32 Vol. 11, No. 1, 2016
Fig. 3a. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 1 markers at polymerization
temperature of 60°C (FAM: 6-carboxyfluorescein).
Fig. 3b. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 2 markers at
polymerization temperature of 60°C (FAM: 6-carboxyfluorescein).
Fig. 3c. qPCR standard curves yielded from Erwinia amylovora DNA using ITSEA 3 markers at polymerization temperature of 60°C (FAM: 6-carboxyfluorescein).
![Page 9: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/9.jpg)
Tunisian Journal of Plant Protection 33 Vol. 11, No. 1, 2016
DISCUSSION E. amylovora is a plant pathogenic
bacterium whereby disease management
closely depends on rapid and specific
detection of the bacteria. Currently,
microbiological approaches developed for
fire blight detection such as culturing in
semi-selective media, ELISA,
immunofluorescence, etc..., are time
consuming and lucking either specificity
or sensitivity. Furthermore, almost
molecular diagnostic protocols were
targeting the pEA29: a 29 kb ubiquitous
plasmid that is able to increase the
bacteria fitness during colonization of
host species (1).
Nevertheless, the inartificial loss
of E. amylovora isolates to their plasmid
during host propagation or by successive
laboratory isolation assays, in addition to
the occurrence of plasmid-free bacteria in
nature (10) makes unreliable the
screening of all E. amylovora strains
using the classical PCR assays. From this
standpoint, application of real-time PCR
technology afforded several advantages
with respect to previously described
trials, relevant to inoculum quantization,
sensitivity and post PCR handling.
Therefore, the major output
afforded by this investigation is to give
better reliability of this bacterium
diagnosis even from symptomless
samples; through the development of
fluorogenic real-time molecular markers
flanking the chromosomal ITS fragments
and specific to E. amylovora isolates,
regardless to their plasmid profile.
Aiming to improve the robustness of the
assays, qPCR reaction mixtures and
cycling conditions have been accurately
standardized. Consequently, the ITSEA2
set of TaqMan DNA markers yielding
124 bp sized fragment was the most
reliable, since it showed the highest
specificity level with no cross-reactions
with other bacterial species tested. In
accordance with previous works dealing
with ITS-based markers, the 124 bp
sequence was amenable to greater
throughput sensitivity owing to its high
copy number within the studied region
(9).
Low bacterial titres up to 1.8 ×
105 cfu/ml have been detected showing
the consistent sensitivity of the described
qPCR markers making them suitable for
latent testing, when bacteria concentration
is below the detection limit of serological
methods (15), and/or it occurs in viable,
but not culturable state (VBNC) (12).
Moreover, this funding afforded
contribution to the trustworthy detection
of the fire blight causal agent with respect
to other routine diagnostic tools, such as
the conventional PCR method; by the use
of a third oligonucleotide in TaqMan
probe which potentially resulted in a
higher specificity. As any real-time PCR
assay, the present trial gave additional
advantages to routine detection tools
including quickness, quantization of the
inoculum amount and direct visualization
of the amplification signals.
ACKNOWLEDGMENTS
This research is dedicated with deepest thanks and
love in memory of Prof. Mohamed Chérif, the
former Director General of the Technical Center of
Citrus, for his enlightening knowledge and uncompromising passion; humble prayers to the
man and his life of devotion to all of us. As well,
thanks to all the collaborators from the United States Department of Agriculture Office (USDA), LSU
Department of Plant Pathology and Crop Physiology
which helped the authors to accomplish this project and allowed them to achieve this work.
![Page 10: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/10.jpg)
Tunisian Journal of Plant Protection 34 Vol. 11, No. 1, 2016
_________________________________________________________________________
RESUME
Yahiaoui D., Chérif M. et Ham J.H. 2016. Développement de marqueurs moléculaires
TaqMan de la PCR en temps réel ciblant l’ADN chromosomique d'Erwinia amylovora.
Tunisian Journal of Plant Protection 11: 25-35.
Depuis toujours, Erwinia amylovora, agent causal de la maladie du feu bactérien, a été considéré
comme un ravageur envahissant ayant anéanti certaines variétés locales de pomacées partout dans le
monde et perturbé l’économie internationale. Dans cette étude, des amorces et des sondes fluorescentes
du type TaqMan de la PCR en temps réel ont été conçues à partir de la région de l’espaceur
intergénique transcrit (ITS) de l’ADN ribosomal 16S-23S rARN. Des essais de validation ont permis
d’optimiser les paramètres cruciaux de la réaction. Comme résultat, la meilleure amplification du
pathogène en matière d’expression génomique a été envisagée par l’ensemble des amorces et sonde
ITSEA2. Par ailleurs, les marqueurs moléculaires développés au terme de ce travail ont apporté plus de
spécificité, une sensibilité plus élevée allant jusqu’à 105 cfu/ml et une quantification des cibles
amplifiées par comparaison à la PCR conventionnelle.
Mots clés: Diagnostic moléculaire, Erwinia amylovora, ITS, PCR en temps réel TaqMan
__________________________________________________________________________
ملخص التضخيم البوليمرازي جزيئية لتقنية . تصميم علامات2016هيان هام. غ اليحياوي، درصاف ومحمد الشريف وجون
Erwiniaعلى أساس الحمض النووي الكروموزومي للبكتيريا في الوقت الحقيقي TaqManالتسلسلي
amylovora.Tunisian Journal of Plant Protection 11: 25-35.
المسببة لمرض اللفحة النارية كآفة غازية لطالما تسببت في استئصال كثير من Erwinia amylovoraصُنفت البكتيريا
الأصناف المحلية من التفاحيات وإحداث خسائر اقتصادية هامة بعديد الدول. اهتم هذا العمل بتصميم علامات جزيئية
من الحمض النووي الكروموزومي للكشف الدقيق عن ITS -23S16Sعلى أساس المنطقة TaqManمشعّة من نوع
عديد من التجارب قصد ضبط مختلف معايير البكتيريا بتقنية التفاعل البوليمرازي المتسلسل في الوقت الحقيقي. تم إجراء ال
الاختبار من حيث التضخيم الجيني للبكتيريا. وبالمقارنة مع طرق ITSEA2علاماتالتفاعل. كما أثبتت النتائج نجاعة ال
حيث تم الكشف بنجاح عن تركيزات تعدّ ضئيلة جدّا الجزيئي التقليدي، أضفت هذه التقنية المطوّرة دقة وحساسية عاليتين
10من الخلايا البكتيرية إلى حدود 5 القياس الكمّي للأجسام.مع إمكانية لمستعمرة/مل وحدة مشكلة
ITS، Erwiniaفي الوقت الحقيقي، TaqManبوليمرازي متسلسل تفاعل تشخيص جزيئي، كلمات مفتاتحية:
amylovora
__________________________________________________________________________
LITERATURE CITED
1. Bereswill, S., Pahl, A., Bellemann, P., Zeller, W., and Geider, K. 1992. Sensitive and
species-specific detection of Erwinia
amylovora by PCR-analysis. Appl. Environ. Microbiol. 58: 3522-3526.
2. Bonn, W.G. and Van der Zwet, T. 2000.
Distribution and economic importance of fire blight. Pages 37-53. In: Vanneste JL, (Ed),
Fire Blight. The Disease and its Causative
Agent, Erwinia amylovora. CABI Publishing,
Wallingford, UK .
3. De Bellis, P., Schena, L., and Cariddi, C. 2007.
Real-time Scorpion-PCR detection and quantification of Erwinia amylovora on pear
leaves and flowers. Eur. J. Plant Pathol. 118: 11-22.
4. Dreo, T., Gruden, K., Manceau, C., Janse, J.D.,
and Ravnikar, M. 2007. Development of a real-time PCR-based method for detection of
Xylophilus ampelinus. Plant Pathol. 56: 9-16.
5. EPPO, 2013. European and Mediterranean Plant Protection Organization. Diagnostic protocols
for regulated pests PM 7/20, Erwinia
amylovora. EPPO Bull. 34: 159-171.
6. EPPO, 1983. Data sheets on quarantine
organisms N°52, Erwinia amylovora. EPPO
Bull. 13(1): 6 pp.
![Page 11: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/11.jpg)
Tunisian Journal of Plant Protection 35 Vol. 11, No. 1, 2016
7. Evans, I.R. 1996. Fire blight of raspberries in Alberta. Acta Hortic. 411: 69-72.
8. Llops, P., Donat, V., and Rodriguez, M. 2006.
An indigenous virulent strain of Erwinia amylovora lacking the ubiquitous plasmid
pEA29. Phytopathology 96: 900-907.
9. McGhee, G.C., Schnabel, E.L., and Maxson-Stein, K. 2002. Relatedness of chromosomal
and plasmid DNAs of Erwinia pyrifoliae and
Erwinia amylovora. Appl. Environ. Microbiol. 68: 6782-6192.
10. Mohammadi, M., Moltmann, E., Zeller, W., and
Geider, K. 2009. Characterisation of naturally occurring Erwinia amylovora stains lacking
the common plasmid pEA29 and their
detection with real-time PCR. Eur. J. Plant
Pathol. 124: 293-302.
11. Mohan, S.K. and Thomson, S.V. 1996. An outbreak of fire blight in plums. Acta Hortic.
411: 73-76.
12. Ordax, M., Marco-Noales, E., Lopez, M.M., and Biosca, E.G. 2006. Survival strategy of
Erwinia amylovora against copper: induction
of the viable-but-nonculturable state. Applied and Environmental Microbiology: 72, 3482-
3488.
13. Pearson, W. and Lipman, D. 1988. Improved tools for biological sequence comparison.
Proc. Nat. Acad. Sci., USA 85: 2444-2448.
14. Pfaffl, M.W. 2001. A new mathematical model for relative quantification in real-time RT-
PCR. Nucl. Acids Res 29: 2002-2007.
15. Pirc, M., Ravnikar, M., Tomlinson, J., and Dreo, T. 2009. Improved fire blight
diagnostics using quantitative real-time PCR
detection of Erwinia amylovora chromosomal DNA. Plant Pathol. 58: 872-881.
16. Rhouma, A., Helali, F., Chattaoui, M.,
Hajjouji, M., and Hajlaoui, M.R. 2014. First report of fire blight caused by Erwinia
amylovora on pear in Tunisia. Plant Dis. 98:
158. http://dx.doi.org/10.1094/PDIS-05-13-
0542-PDN.
17. Van der Zwet, T. and Beer, S. 1995. Fire blight: its nature, prevention and control. A practical
guide to integrated disease management,
USDA. Agricultural Information Bulletin N° 631, Washington DC, USA.
18. Weisburg, W.G., Barns S.M., Pelletier, D.A.,
and Lane, D.J. 1991. 16S Ribosomal DNA amplification for phylogenetic study. J.
Bacteriol. 173: 697-703.
---------------------
![Page 12: Development of TaqMan Real-Time PCR Markers Targeting](https://reader031.vdocuments.us/reader031/viewer/2022022121/621297a6436cf635196e584e/html5/thumbnails/12.jpg)
Tunisian Journal of Plant Protection 36 Vol. 11, No. 1, 2016