Upload File

Download - certificate amends V2 › ...Co˜g˚a˛u˝a˛i˙nˆ!Co˜g˚a˛u˝a˛i˙nˆ! hˇs ˛a˘e˜ pˇr˛ i˜ t e C a˜g 4L f Su a˚ Swˇpˆ cˇm a g˜ a˜d ˝eˇr˜e a o t eˇl˛h e˚ c o

Transcript
Page 1: certificate amends V2 › ...Co˜g˚a˛u˝a˛i˙nˆ!Co˜g˚a˛u˝a˛i˙nˆ! hˇs ˛a˘e˜ pˇr˛ i˜ t e C a˜g 4L f Su a˚ Swˇpˆ cˇm a g˜ a˜d ˝eˇr˜e a o t eˇl˛h e˚ c o

Congratulations!Congratulations!

has taken part in the Change4Life Sugar Swaps campaign and learned

about healthier choices.

has taken part in the Change4Life Sugar Swaps campaign and learned

about healthier choices.

You did it!

You did it!

Yeehaw!Yeehaw!

Shanice the Sheriff Margo the Mayor

Finn the Farmer

Shanice MargoRocky Finn

Rocky the Ranger

lower-sugar

Write your school name

In support of

Top Related

L3 - Pitești · ae a a a a a a a a a a a a a a a a a a a a e e e t t t t t t t t t t t c c g g g g g g g g g g g g g g g g g g g g g g g g g g g g g nuc nuc nuc p p p p p p p p p
L3 - Pitești · ae a a a a a a a a a a a a a a a a a a a a e e e t t t t t t t t t t t c c g g g g g g g g g g g g g g g g g g g g g g g g g g g g g nuc nuc nuc p p p p p p p p p
Nˆ. • Can Tax Increment Financing Support Transportation … · 2017-05-16 · Municipal governments are searching for new revenue tools to maintain municipal services and invest
Nˆ. • Can Tax Increment Financing Support Transportation … · 2017-05-16 · Municipal governments are searching for new revenue tools to maintain municipal services and invest
D--˝- 3 018 Nˆ˛-˙ 58 Harm Reduction · 19/10/2018  · Policymakers can reduce overdose deaths and other ... heroin-assisted treatment, deregulation of naloxone, and the decriminalization
D--˝- 3 018 Nˆ˛-˙ 58 Harm Reduction · 19/10/2018  · Policymakers can reduce overdose deaths and other ... heroin-assisted treatment, deregulation of naloxone, and the decriminalization
HEALTH AND REHABILITATION FOUNDATION S˜o˚˛a˝es ˙nˆ Angels · Only donations totalling $50 or more are listed above. Names received after January 13, 2017 will not be published
HEALTH AND REHABILITATION FOUNDATION S˜o˚˛a˝es ˙nˆ Angels · Only donations totalling $50 or more are listed above. Names received after January 13, 2017 will not be published
allmyreadingsquotes.files.wordpress.com · 4 ˆ ˆ ˆ ˜o˛$$ˇ!= kb˝clm ˙ nˆ˜ ˙ 2ˇ ˇ ?d ˙ ˆ 5ˆ ˘ ˘6ˆ ˘p ?d ˙ ˆ 0ˆ ˚ ˝ ˘ o . ,˘ ?d ˆ @ˆ $ k˜ ,˘ l
allmyreadingsquotes.files.wordpress.com · 4 ˆ ˆ ˆ ˜o˛$$ˇ!= kb˝clm ˙ nˆ˜ ˙ 2ˇ ˇ ?d ˙ ˆ 5ˆ ˘ ˘6ˆ ˘p ?d ˙ ˆ 0ˆ ˚ ˝ ˘ o . ,˘ ?d ˆ @ˆ $ k˜ ,˘ l
Contents Introduction ˆ;N Nˆ - University of Chicagomath.uchicago.edu/~emerton/pdffiles/families.pdf · 3. Representation theory | the case of GL n 14 4. The local Langlands correspondence
Contents Introduction ˆ;N Nˆ - University of Chicagomath.uchicago.edu/~emerton/pdffiles/families.pdf · 3. Representation theory | the case of GL n 14 4. The local Langlands correspondence
University of Groningen Modular assembly of functional DNA ...chapter 5 102 a c c t t g c g a a t g a c c t g g g t g g a c t g g a g t a tt gc ga g g a a g c agacatgtcagcgttctcaccagtc
University of Groningen Modular assembly of functional DNA ...chapter 5 102 a c c t t g c g a a t g a c c t g g g t g g a c t g g a g t a tt gc ga g g a a g c agacatgtcagcgttctcaccagtc
Sources of Measurement Error, Misclassification Error, and ...simons/Euring.pdf · Sources of Measurement Error, Misclassification Error, and Bias 239 where: Nˆ = the population
Sources of Measurement Error, Misclassification Error, and ...simons/Euring.pdf · Sources of Measurement Error, Misclassification Error, and Bias 239 where: Nˆ = the population