![Page 1: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/1.jpg)
Inactivation of genes in bacteria
using PCR products
Requirements for the method
and adaptations to different models
Luis M. Ramírez Ch.
![Page 2: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/2.jpg)
Why do we inactivate genes?
Is not it just a hobby?
![Page 3: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/3.jpg)
Gene targeting: The classical approach
• Central to an understanding of the in vivo
function of genes is their analysis by mutation,
that is, inactivation or modification of a gene
by mutation and the study of the
consequences of the mutation in the mutant
organism.
Rajewsky et al. J. Clin. Invest. 1996.
![Page 4: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/4.jpg)
Inactivation of genes in bacteria
using PCR products:
step by step
![Page 5: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/5.jpg)
PCR amplify of a FRT-flanked resistance gene
Baba et al. Molecular Systems Biology. 2006.
![Page 6: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/6.jpg)
Transform strain expressing λ Red Recombinase
Select antibiotic resistant transformants
Baba et al. Molecular Systems Biology. 2006.
![Page 7: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/7.jpg)
Eliminate resistance cassette using a
FLP expression plasmid
Baba et al. Molecular Systems Biology. 2006.
![Page 8: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/8.jpg)
Structure of deletions
Baba et al. Molecular Systems Biology. 2006.
![Page 9: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/9.jpg)
Requirements
![Page 10: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/10.jpg)
PCR amplify of a FRT-flanked resistance gene
Baba et al. Molecular Systems Biology. 2006.
![Page 11: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/11.jpg)
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
Datsenko & Wanner. 2000. Liang & Liu. 2000.
![Page 12: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/12.jpg)
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
Gust et al. 2004. Chaveroche et al. 2000.
![Page 13: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/13.jpg)
Requirements for the step
• A Plasmid carrying a λ Red Recombinase system
• A template plasmid carrying an antibiotic resistance
gene flanked by FRT recombination sites
Datsenko & Wanner. PNAS. 2000.
![Page 14: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/14.jpg)
Some tips..
• Use pKD3 (Cm) or pKD4 (Kan) if you would like toknockout a gene with minimal polarity effects ondownstream genes.
• Use pKD13 (Kan), pKD32 (Cm), or pKD81 (Kan fromTn903) to knockout entire operons, single genes, or anyother situation in which polarity shouldn’t matter.
Kim. 2001
from: http://falkow.stanford.edu/whatwedo/general/wanner.pdf
![Page 15: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/15.jpg)
Requirements for the step
• Primer design
Datsenko & Wanner. PNAS. 2000. Baba et al. Molecular Systems Biology. 2006.
![Page 16: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/16.jpg)
Requirements for the step
• Primer design (using pKD4 as a template)
Datsenko & Wanner. PNAS. 2000.
Forward:
(47 bp upstream sequence)(ATG)(TGTAGGCTGGAGCTGCTTCG)
Reverse:
(Codons for the
6 C Terminal residues)(Stop codon)(29-nt downstream)(TATGAATATCCTCCTTAG)
Baba et al. Molecular Systems Biology. 2006.
![Page 17: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/17.jpg)
Transform strain expressing λ Red Recombinase
Select antibiotic resistant transformants
Baba et al. Molecular Systems Biology. 2006.
![Page 18: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/18.jpg)
Requirements for the step
• Prepare electrocompetent cells. The media
must contain the inductor (L-Arabinose)
• Electroporate as much as possible DNA you
can, even though the ammount depends on
the species. High, but not enough to cause
arcing. So, to avoid arcing, DNA must be as
clean as possible.
![Page 19: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/19.jpg)
Eliminate resistance cassette using a FLP
expression plasmid
Baba et al. Molecular Systems Biology. 2006.
![Page 20: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/20.jpg)
Structure of deletions
Baba et al. Molecular Systems Biology. 2006.
![Page 21: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/21.jpg)
Adaptation to different models
• Pseudomonas aeruginosa
(Lesic & Rahme. BMC Molecular Biology 2008, 9:20)
• Yersinia spp.
(Derbise, Lesic, Dacheux, Ghigo, Carniel. FEMS
Immunology and Medical Microbiology 2003 38:113-
116)
![Page 22: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/22.jpg)
Pseudomonas aeruginosa
Lesic & Rahme. 2008
![Page 23: Bacterial gene inactivation using pcr products](https://reader030.vdocuments.us/reader030/viewer/2022020208/55a9ff841a28abea578b476d/html5/thumbnails/23.jpg)
Thanks