Transcript
Page 1: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

South Carolina2017 MEMBERSHIP DIRECTORY & RESOURCE GUIDE

www.scasphalt.org

ASPHALT PAVEMENT ASSOCIATION

Page 2: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

OUR PASSION IS PROTECTING

PEOPLE ON THE ROADthe

With over 30 years of success, Ergon Asphalt & Emulsions

is committed to developing solutions to defend your

driving surfaces against harsh elements, game day and

every day.Learn more atErgonAsphalt.com

Page 3: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 3

Proudly Serving The Upstate For Over 40 Years

Safety. Quality. Success.

EZ Street® and the EZ Street Logo are registered trademarks of Asphalt Research Technology, Inc. © Copyright 2016

www.kingasphaltinc.com

1187 Old Stage Road Simpsonville, SC 29681

2127 Greenville Hwy Liberty, SC 29657

1020 W Main Street Pacolet, SC 29372

Phone: 864-855-0338 Fax: 864-843-2147

Works In WaterGuaranteed PermanentBulk And Bags Available In SC

794836_King.indd 1 12/02/16 9:00 PM

SSSSSSSSSSooooooooouuuuuuuutttttttttthhhhhhhhh CCCCCCCCaaaaaaaaarrrrrrrrrrrooooooooooollllllliiiiiiiinnnnnnnnnaaaaaaaaa’’’’’’’’sssssss BBBBBBBBeeeeeeeeessssssssttttttttt SSSSSSSSSoooooooooouuuuuuuuuurrrrrrrcccccccccceeeeeeeeeFFFFFFFFFooooooooorrrrrrrrr QQQQQQQQQuuuuuuuuuaaaaaaaalllllllliiiiiiiiittttttttyyyyyyyyy CCCCCCCCCooooooooonnnnnnnnssssssssstttttttttrrrrrrrrruuuuuuuuuccccccccctttttttttiiiiiiiiiooooooooonnnnnnnnn AAAAAAAAAgggggggggggggggggggrrrrrrrreeeeeeeeeggggggggaaaaaaaaattttttttteeeeeeeeesssssssss

wwwwwwwwwwwwwwwww.....mmmmmmaaaaaarrrrttttiiiiinnnnnnnmmmmmaaaaaarrrrrriiiieeeeeeettaaaaaa.cccccccoooooommmmmNNNNNNNYYYYYYYSSSSSSSSEEEEEEEE:::::: MMMMMMLLLLLLMMMMMMMMMYYYYYYYY

wwwwwwwwwwwwwwww mmmmmmaaaaarrrrtttttttiiiinnnnnnmmmmmmaaaaaaarrrrrriieeeeeeettttaaaaaaa cccccccoooooommmmmmm

739177_Martin.indd 1 12/03/15 3:11 PM

Page 4: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

4 www.scasphalt.org

Charleston Plant (843) 747-4848

Summerville Plant (843) 725-1194

Paving the way since 1948Banks Construction Company

P.O. Box 71505, N. Charleston, SC 29415 | 843.744.8261 | www.banksconstruction.com

695195_banks.indd 1 7/7/14 11:25 PM

847650_Blanchard.indd 1 08/12/16 4:11 AM

Page 5: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 5

Message from the Executive Director ................................................7

General Information About SCAPA ......................................................................................9 2015–2017 SCAPA Executive Committee....................................11 2017 SCAPA Board of Directors ....................................................11 SCAPA Directors Emeriti............................................................... 13 SCAPA Staff and Legal Counsel ................................................... 13 2017 SCAPA Committees and Task Groups .............................. 15 2016 SCAPA Quality Pavement Award Winners .......................16 The Economic Impact of the SC Asphalt Industry ....................19 SCAPA Event Photos 2016 ............................................................. 20 SCAPA Pavement Design Guide................................................... 23 Upcoming Events ............................................................................. 24

SCAPA Directory Contractor Members ....................................................................... 25 Major Associate Members ...............................................................31 Associate Members .......................................................................... 36

SCDOT Directory South Carolina Department of Transportation ........................ 43

Federal Directory Federal Highway Administration .................................................52 Federal Aviation Administration, Southern Region .................53 Naval Facilities Engineering Command, Southern Division ........................................................................ 54 Congressional Delegation .............................................................. 55

Education Directory Civil Engineering Faculties ............................................................ 57 Technical College Engineering/Certification Programs ..........61

Resources Found an Error? Update? ............................................................... 63 Membership Application ................................................................ 64 Metric Conversion Cards ............................................................... 65 Calendar ............................................................................................. 66 Index to Advertisers ........................................................................ 67 Advertisers.com ................................................................................ 68

Published for South Carolina Asphalt Pavement Association

1331 Elmwood Avenue, Suite 160 Columbia, SC 29201

Phone: (803) 252-2522 Fax: (803) 403-9952

Web: www.scasphalt.org

Published by

5950 NW First Place Gainesville, FL 32607

Phone: (800) 369-6220 Fax: (352) 331-3525

Web: www.naylor.com

Publisher: Heather Greyling

Content Strategist: Margaret Kuon

Project Manager: Lori Glenn

Marketing: Matthew Arnold

Advertising Sales Director: Paul Walley

Account Representatives: Lori Glenn

Stephanie Musial Jamie Williams

Chris Zabel Jason Zawada

Layout & Design: Susan Redfern | FairyDustDesigns

© 2017 Naylor, LLC. All rights reserved. The contents of this publication may not be

reproduced, in whole or in part, without the prior written consent of the publisher.

PUBLISHED JANUARY 2017/SCP-R0017/3734

Cover images: Top Left: King Asphalt

Top Right: Satterfield Construction Company

Middle Left: Palmetto Corp. Middle Right: King Asphalt

Bottom Left: Banks Construction Company

Table of Contents

Page 6: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

6 www.scasphalt.org

South Carolina Territory Sales Offi ce107 Aaron Tippin Drive Greer, South Carolina 29650 (864) 968-1310

Sales & Production Offi ces

Producer of Quality Crushed Aggregates

Anderson QuarryAnderson, South Carolina 864-296-9242

Brewer SandJefferson, S.C. 843-658-3816

Clinton QuarryClinton, S.C. 864-833-7474

Columbia Sand(803) 794-4803

Jefferson QuarryJefferson, S.C. 843-672-6181

Lowrys QuarryMcConnells, S.C. 803-684-1047

Marlboro Sand & GravelBennettsville, S.C. 843-479-8909

Pelham QuarryGreer, S.C. 864-848-1165

Sandy Flat QuarryTaylors, S.C. 864-895-5050

“Laying the foundations for long-term growth”

845580_Hanson.indd 1 23/11/16 8:55 pm

Emulsions

1404 Jonesville Hwy, Union South Carolina29376

864-505-3028Alan Harrison

803-360-4808Rip Harrington

SOUTHEASTT

Conventional Tack Trackless Tack Emulsion Prime Surface Treatment

Emulsions Fog Seal Dust Control Green Alternatives

46388_ o as .indd 1 30/04/15 4:38

Page 7: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 7

Welcome to your 2017 South Carolina Asphalt Pavement Association Member Directory & Resource Guide! 

On behalf of the entire SCAPA Board, its members and affiliates, we are honored that you have invested your time and resources to make this organization one of the most innovative and influential in the Palmetto State.

SCAPA prides itself in being the industry resource for the asphalt paving industry. The 2017 Directory & Resource Guide represents the very best of South Carolina. It provides the latest contact information for SCAPA’s producer members, associate members, and its industry partners, as well as South Carolina Department of Transportation and Federal Highway Administration-SC Division officials and personnel. 

Also included in the 2017 Directory & Resource Guide are upcoming events and educational training opportunities, which are found on pages 23-24. Included in this section are the dates and locations of scheduled monthly seminars discussing Phase II of SCAPA’s Asphalt Pavement Design Guide for Low Volume Roads and Parking Lots.

Found in these pages are the very people who move South Carolina forward. From advocacy to innovation to partnership and camaraderie, these companies and their employees are the foundation of the asphalt pavement industry in South Carolina.

Also, please help me thank our advertisers who helped make this directory possible. We appreciate your support of SCAPA and the asphalt paving industry in South Carolina.

We hope this directory will serve as a great resource for you.

Ashley Batson Executive Director

Message from the Executive Director

* Please contact SCAPA if you notice any errors or omissions relating to the contacts listed in the Directory. The update form is on page 63 of this directory.

Page 8: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

8 www.scasphalt.org

INFRASTRUCTURE FOR FUTURE GENERATIONS

250 Plemmons Road, Duncan, SC 29334P: 864-416-0200

www.sloan-construction.com

746312_Sloan.indd 1 02/05/15 7:45 PM

• Charter members of SCAPA. • Asphalt paving for subdivisions, commercial,

industrial, and highway.• Serving the upstate with plant sales,

grading, curb & gutter, in-place recycling, milling, and material recycling.

• Excellent safety and quality.

ashmorebros.com

Contact Jason [email protected]

(864) 879-7311

A Division of Rogers Group, Inc.www.ashmorebros.com

783861_Ashmore.indd 1 02/02/16 11:24 am

Page 9: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 9

South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated to the promotion of asphalt concrete. Its membership is comprised of asphalt producers and companies affiliated with the asphalt pavement industry in South Carolina.

SCAPA participates in various research and educational programs to develop an even better product, new paving techniques and higher quality workmanship. Contractor member-firms of the Association take great pride in their work and continue to prove their ability to satisfy the rigid requirements set by the S.C. Department of Transportation, Corps of Engineers, Naval Facilities Engineering Command, the Federal Aviation Administration and the engineers and architects engaged in private practice.

HISTORY AND MOTTOOn November 2, 1966, ten forward thinking and responsible asphalt plant mix producers came together and petitioned O. Frank Thorton, then Secretary of State for South Carolina, for an eleemosynary corporation charter in the name of the South Carolina Asphalt Pavement Association. The charter was issued and the Association was born.

In 1966, Robert E. McNair was governor, S.N. Pearman was chief highway commissioner and W.N. Dulin was the district engineer for South Carolina for the U.S. Bureau of Public Roads (now Federal Highway Administration). The interstate highway program was still in its infancy. Only I-85 was completed with I-20, I-26 and I-95 miles from completion. Discussions to extend I-77 to Columbia had not yet begun.

Asphalt plants were either batch or continuous mix and were manually controlled. Drum plants were nonexistent. Automatic grade controls were new to pavers. No one had heard of a vibratory roller for compacting asphalt pavements. The nuclear density gauge for determining roadway density was yet to be invented. Today, all of that equipment with automatic controls is utilized in the daily production and construction operations.

During the late Sixties, commercial passenger jet planes were beginning to be introduced in South Carolina which triggered runway expansions at our states major airports. Asphalt was the pavement of choice for that work.

The past 40 years have brought many positive changes to the asphalt paving industry. Today, state of the art plants and paving equipment are used and the design and testing of asphalt is more sophisticated. An increased emphasis on continuing educational programs for asphalt production and construction personnel is preparing the industry for the future years.

“Together we know more,” the Association’s motto, best describes the reason for the existence of the South Carolina Asphalt Pavement Association. The Association is a statewide trade association of contractor member-firms engaged in the production of high quality asphalt pavement. These firms construct all types of environmentally friendly asphalt pavements ranging from tennis courts to airport runways, parking lots, streets and highways.

About SCAPAGENERAL INFORM

ATION

Page 10: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

10 www.scasphalt.org

About SCAPA

MISSION STATEMENTSouth Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated to:

(1) Protect, promote and advance the progress, interest and welfare of the producers of plant mixed asphalt paving materials;

(2) Encourage the highest standards of business ethics and workmanship;

(3) Encourage the discussion, coordination and pursuit of solutions to problems of common interest and concern to the producers of plant mixed asphalt paving materials; and

(4) Foster a cooperative spirit and understanding between the producers of plant mixed asphalt paving mixtures and industry partners.

Call for a quote today 1-800-343-7335www.peeksafety.com

Whether by land, sea or air, Peek marks the way. For nearly 50 years, Peek Pavement Marking has earned its place as one of the premier full-service providers in the pavement marking industry. From roads to airfields to seaports,

Peek is prepared for virtually any size or type of job. And with one of the largest fleets in the industry, we can work on your schedule. Highly-trained people, the best equipment and a commitment to service — that’s Peek performance.

PAVEMENT MARKING

Why choose Peek? Full-service – surface preparation, marking removal, thermoplastic application, and more

Largest in the Southeast Substantial policy limits and bonding capability Cleared for secure environments

Marking your way.

569880_Peek.indd 1 1/20/12 6:03:21 AM

Page 11: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 11

PRESIDENT Mike Crenshaw .......................... King Asphalt, Inc.VICE PRESIDENT Steve Cosper ............... Granite Contracting, LLC

TREASURER Greg Sanders ...............................Sanders Brothers ............................................. Construction Company

2015–2017 SCAPA Executive CommitteeGENERAL INFORM

ATION

2017 SCAPA Board of Directors

Ken Atkinson ......................................................................................................................... Palmetto CorporationLee Barrack ................................................................................................. The Lane Construction CorporationReid Banks ............................................................................................................Banks Construction CompanySteve Cosper .................................................................................................................. Granite Contracting, LLCMike Crenshaw .............................................................................................................................King Asphalt, Inc.Jason Edmonds .......................................................... Ashmore Brothers, a division of Rogers Group, Inc.Scott Fant ............................................................................................................... Sloan Construction CompanyRichard Jackson ................................................................................................................................ CR Jackson, Inc.Robert Royal ...................................................................................................................... Preferred Materials Inc.Greg Sanders .................................................................................Sanders Brothers Construction CompanyWarren Smith ................................................................................................................................. Southern AsphaltBen Whetstone ..........................................................................................Satterfield Construction Company

Page 12: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

12 www.scasphalt.org845274_Linder.indd 1 30/11/16 3:41 am

For over 40 years, C.R. Jackson, Inc. has served South Carolina as a leader in the heavy highway

and site development industries.

ColumbiaSouth Carolina

803.750.6070

DarlingtonSouth Carolina

843.393.2837

ConwaySouth Carolina

843.347.3555

www.crjackson.com

694760_CRJackson.indd 1 5/24/14 8:38 AM

Providing Highway and Site Development services in the

Rock Hill and Charlottearea Since 1999

www.granitecontracting.com

Charlotte Of ce:18606 Northline DriveCornelius, NC 28031(704) 892-0341

York Of ce:470 True RoadMcConnells, SC 29726(803) 684-5111

700806_Granite.indd 1 6/26/14 12:49 PM

Page 13: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 13

Russell C. Ashmore, Jr.

Ronnie S. Banks

*Thomas O. Glover

*Harry M. Mims

William S. Simpson, III

Harry M. Mims, Jr.

*Ralph B. Pond, Jr.

*A. Keith Roberts

Charles Randolph Snow

* Deceased

GENERAL INFORMATION

SCAPA Directors Emeriti

SCAPA Staff

Elmore Goldsmith, P.A. P.O. Box 1887 55 Beattie Place, Suite 1050 Greenville, SC 29601 Phone: (864) 255-9500 Fax: (864) 255-9505 www.elmoregoldsmith.com

Frank Elmore, Owner [email protected]

Andy Goldsmith, Jr., Owner [email protected]

Sharon Brown, Administrator [email protected]

SCAPA Legal Counsel

Ashley R. Batson, Esq. Executive Director SC Asphalt Pavement Association P.O. Box 11448 1331 Elmwood Ave., Suite 160 Columbia, SC 29211 Office: (803) 252-2522 Ext. 100 Cell: (803) 730-0571 Fax: (803) 403-9952 www.scasphalt.org [email protected]

Jayson R. Jordan, P.E. Technical Director Office: (803) 252-2522 Ext. 102 Cell: (803) 320-3813 [email protected]

Laura Voyles Executive Assistant Office: (803) 252-2522 Ext. 101 [email protected]

Page 14: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

14 www.scasphalt.org

CONNECT WITH THE INDUSTRYANY TIME, ANYWHERE

Access the digital edition ofSCAPA’s Membership Directory& Resource Guide year-round!

To reserve your spot in the digital edition, contact Paul Walley, Online Media Director, today: 417-326-209 | [email protected]

www.naylornetwork.com/scp-nxt

SCP-R0017 HP_FillerAd_MKG.indd 1 16/11/16 1:38 pm

INSURANCE SOLUTIONS

FOR BUSINESSES & INDIVIDUALS

Property & Casualty | Personal Lines | Employee Benefits & Life

Risk Management & Loss Control

John Gardner [email protected]

Graham Gardner [email protected]

www.hubinternational.com

787939_HUB.indd 1 12/01/16 8:54 PM

YOUR LOCAL SUPPLIER FOR HYDRATED LIME

Mississippi Lime Company – Chester, South Carolina

YOUR LOCAL SUPPLIER FOR HYDRATED LIME

Mississippi Lime Company – Chester, South Carolina

Mississippi Lime is the leading provider of high purity calcium products in North America. The high calcium content and superior reactivity of Mississippi Lime’s Hydrated Lime makes an easy to use product with minimal residual materials. Our hydrated lime provides excellent anti-strip performance in asphalt mixes.

Our production facility in Chester offers a local supply for your asphalt projects, with quick response for orders and a short supply chain.

1.800.437.5463www.mississippilime.comFor more information contact Paul Pine Regional Sales Manager

695242_Mississippi.indd 1 24/06/14 3:23 AM

Page 15: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 15

EXECUTIVE COMMITTEE:Chair: President (Mike Crenshaw) Members: Steve Cosper (VP), Greg Sanders (Treasurer)

STRATEGIC PLANNING COMMITTEE:Chair: President (Mike Crenshaw) Members: Reid Banks, Ben Whetstone

FINANCE & BUDGET COMMITTEE:Chair: Treasurer (Greg Sanders) Members: Steve Cosper

MEETINGS & EVENTS COMMITTEE:Chair: VP (Steve Cosper) Members: Scott Fant, Robert Royal

GOVERNMENT AFFAIRS COMMITTEE:Chair: Richard Jackson Members: Scott Fant

ENVIRONMENTAL COMMITTEE:Members: Collin Douglas, Bob Eastman, Bobby Perritt, Shirani Fuller

EDUCATION AND TRAINING COMMITTEE FORMERLY MARKETING:Chair: Robert Royal Members: Steve Cosper, Mike Crenshaw, Jason Edmonds, Al Hill

2017 WINTER CONFERENCE PLANNING COMMITTEE:SCAPA Members: Dominic Barilla, Stuart Boone, Ron Corun, Dean Frailey, Alan Harrison, Mike Murdaugh, Sam Light, Tony Felix, Lauren Lomascolo, Brett Murray, Austin Page, Brad Putman, Daniel Sapp, Chauncey Tschiffely, Gordon Wright

Non-SCAPA Members: Lateef Assi, Mary Corley, Serji Amirkhanian, Clay Richter, Cliff Selkinghaus, Todd Steagall, Jay Thompson, Merrill Zwanka

SCAPA/SCDOT HMA QUALITY IMPROVEMENT COMMITTEE:SCAPA Members: Clarke DeHart (Co-Chair), Stuart Boone, Scott Cooper, Paul Edwards, Eric Faulk, Tony Felix, Randy Funderburg, Allen Gambill, Joseph Hires, Scott Reece and Gordon Wright

Non-SCAPA Members: SCDOT Representatives: Cliff Selkinghaus (SCDOT/Co-Chair), Merrill Zwanka, David Cook, Chad Hawkins, Claude Ipock, Karen Nicholson, Cliff Selkinghaus, Todd Steagall, Jay Thompson FHWA Representative: Carolyn Fisher

SCAPA/SCDOT JOINT ASPHALT COMMITTEE:SCAPA Members: Mike Crenshaw (Co-Chair), Steve Cosper, Mike Crenshaw and Greg Sanders

Non-SCAPA Members: SCDOT Representatives: Leland Colvin (Co-Chair), Andy Leaphart, Todd Steagall, Jay Thompson, Merrill Zwanka

2017 SCAPA Committees and Task GroupsGENERAL INFORM

ATION

Page 16: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

16 www.scasphalt.org

Green Construction Award

Banks Construction Company, Summers Corner Development & Roundabout. Owner: MWV - East Edisto Summers Corner, LLC.

Project Delivery Award

King Asphalt, Perimeter Road (SCDOT File 2388990). Owner: SCDOT District 3, Greenville Construction A.

Innovative Pavement Award

Palmetto Corp, Georgetown County Airport – Apron Expansion Phase III. Owner: Georgetown County.

2016 SCAPA Quality Pavement Award Winners

Page 17: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 17

Quality Pavement Awards

King Asphalt, SC Highway 133 (SCDOT File 3991950). SCDOT District 3, Pickens Construction.

Satterfield Construction Company, US Highway 25 (SCDOT File 5292150). SCDOT District 2, Saluda Construction.

2016 SCAPA Quality Pavement Award Winners

Page 18: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

NEW YEAR, NEW OPPORTUNITIES!

Contact Lori Glenn, Project Manager, today. (352) 333-6019 [email protected]

SCAPA eNewsletterPaving the Way

SCAPA Official Websitescasphalt.org

SCAPA now offers advertising opportunities on our website, scasphalt.org, and eNewsletter, Paving the Way. Don’t miss the chance to participate in this limited opportunity to reach SCAPA members and industry professionals.

Page 19: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

THE ECONOMIC IMPACT OF SOUTH CAROLINA’S ASPHALT PAVEMENT INDUSTRY

The asphalt pavement industry generates more than $1 billion

of economic activity in South Carolina.

• More than $765.4 million generated in direct output

• Direct and indirect impacts of the industry added another $200 million in economic activity in the state

• Total labor income impact of $199.6 million per year

• Over 2,164 jobs created and supported per year

• Total employment impact of 4,600 jobs in the state

• Indirect impacts also felt across a wide spectrum of other industries in the state’s economy

Page 20: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

Winter ConferenceFebruary 22–23, 2016

Columbia, SC

SCAPA Events in 2016

Spring Member Dinner

May 17, 2016 Columbia, SC

20 www.scasphalt.org

Page 21: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

SCAPA Events in 2016

2017 South Carolina Asphalt Pavement Association 21

Summer ConferenceJuly 21–24, 2016 The Greenbrier,

White Sulphur Springs, WV

Page 22: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

22 www.scasphalt.org

SCAPA Events in 2016

Fall Member Dinner

October 19, 2016 Columbia, SC

Legislative DayMay 18, 2016 Columbia, SC

Page 23: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated
Page 24: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

24 www.scasphalt.org

2017January 24–25 .................................................................................SCAPA Winter Conference, Columbia, SCJanuary 31 .........................................SCAPA Pavement Design Guide Seminar, Hilton Head Island, SCFebruary 7 .........................................................SCAPA Pavement Design Guide Seminar, Charleston, SCMarch 2 ................................................................ SCAPA Pavement Design Guide Seminar, Greenville, SCMarch 7–11 ................................................................................................CONEXPO/CON/AGG, Las Vegas, NVMarch 16 ................................. SCAPA/SCDOT HMA Quality Improvement Committee, Columbia, SCApril 12...........................................................SCAPA Pavement Design Guide Seminar, Myrtle Beach, SCApril 25....................................................................................................... SCAPA Board Meeting, Columbia, SCApril 25.......................................................................................SCAPA Spring Member Dinner, Columbia, SCApril 26....................................................................................................... SCAPA Legislative Day, Columbia, SCMay 4 .......................................................................SCAPA Pavement Design Guide Seminar, Augusta, GAJune 1 ....................................................................SCAPA Pavement Design Guide Seminar, Columbia, SCJune 23–25 ................................................................. SCAPA Summer Conference, Hilton Head Island, SCJuly 16–19 ....................................................................................................NAPA Midyear Meeting, Chicago, ILJuly 20 ..................................................................... SCAPA Pavement Design Guide Seminar, Rock Hill, SCAugust 6-8 .......................................................................................SAPA Summer Meeting, St. Augustine, FLAugust 12-15 .............................................................................................................................SASHTO, Norfolk, VAAugust 22 ..........................................SCAPA Pavement Design Guide Seminar, Hilton Head Island, SCSeptember 14 ..................................................SCAPA Pavement Design Guide Seminar, Charleston, SCOctober TBD .................................................................................. SCAPA Fall Member Dinner, Columbia, SCOctober TBD ............................................................................................ SCAPA Board Meeting, Columbia, SCOctober 12 ......................................................... SCAPA Pavement Design Guide Seminar, Greenville, SCNovember 13–16 ............................................................................................................ SEAUPG, Jacksonville, FL

Upcoming Events

Southern Commercial Development is a family owned company founded in 2008. We operate throughout the Southeast and we are certified in South Carolina as a WBE (Woman Owned Business). Southern Commercial Development takes pride in our work and strives daily to produce quality customer service in all areas of our operation. Our goal is to be the best traffic control company in South Carolina and the one point of contact for all of our customer’s needs.

Traffic Control Equipment Sales & Rentals❏ Signs, Stands, Cones, Barricades❏ Crash Trucks & Pilot Trucks❏ Solar Message Boards❏ Arrow Boards❏ Lite Plants

Traffic Control Services❏ Lane Closures ❏ Flagging❏ Road Closures & Detours❏ Traffic Control Plans❏ Asphalt Paving

Sherita Evans, Operations ManagerOffice: 803-808-0232 Cell: [email protected]

Chuck Mace, Division ManagerOffice: 803-808-0232 Cell: [email protected]

848334_Southern.indd 1 2017-01-03 10:33 PM

Page 25: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 25

AASHMORE BROS., A DIVISION OF ROGERS GROUP, INC.P.O. Box 529 Greer, SC 29652 Phone: (864) 879-7311 www.ashmorebros.comSpecialties: Site Work Grading Paving Recycling Materials Roadway Recycling Asphalt FOB Sale Asphalt MillingOffice/Plant Locations: Greer Anderson SpartanburgKey Contacts: Dave Rechter, Vice President Mark Ashmore, Vice President, SMA Manager Greg Ashmore, Construction Manager David Hughey, Controller Jason Edmonds, Manager of Estimating – [email protected] Stuart Boone, Manager of Quality Control – [email protected] Jeff Frani, Manager of Asphalt – [email protected]

BBANKS CONSTRUCTION COMPANY4902 Banco Road Charleston, SC 29418 Phone: (843) 744-8261 Fax: (843) 566-7066 www.banksconstruction.comOffice/Plant Locations: Charleston SummervilleKey Contacts: Reid Banks, President – [email protected] Ron Banks, VP Estimating – [email protected] Johnny Leviner, Paving Manager – [email protected]

CCR JACKSON INC.Columbia Office 100 Independence Boulevard Columbia, SC 29202 Phone: (803) 750-6070 Fax: (803) 750-1356 www.crjackson.comOffice/Plant Locations: Columbia Plant 100 Independence Boulevard Columbia, SC 29202 Phone: (803) 216-7030Coastal Office 620 Mineral Springs Road Darlington, SC 29540 Phone: (843) 393-2837 Fax: (843) 395-3000Florence Plant 1550 East Campground Road Florence, SC 29506 Phone: (843) 669-8381Conway Plant 154 Winyah Road Conway, SC 29526 Phone: (843) 347-4041Sumter Plant 1170 Eagle Road Sumter, SC 29150 Phone: (803) 494-8171Jefferson Plant State Road 39 - Ogburn Road Jefferson, SC 29718 Phone: (843) 672-3654Key Contacts – Corporate and Columbia Office: Richard Jackson, CEO – [email protected] Ben Whetstone, President – [email protected] Bill Tomlinson, Chief Operating Officer – [email protected] Sean Walker, Executive Vice President – [email protected] Benji Vinson, Columbia Division Manager – [email protected] Mike Hanley, Construction Operations Manager – [email protected] Mike Murdaugh, Asphalt Operations Manager – [email protected] Clarke DeHart, Production Manager – [email protected] Jeremy Godwin, Risk Manager – [email protected] Key Contact – Coastal Office: Ken Barber, Coastal Division Manager – [email protected] Chad Lutz, Operations Manager – [email protected]

Contractor MembersCONTRACTOR M

EMBERS

Page 26: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

26 www.scasphalt.org

Contractor Members

GGRANITE CONTRACTING, LLC18606 Northline Drive Cornelius, NC 28031 Phone: (704) 892-0341 Fax: (704) 892-4794 www.GraniteContracting.comSpecialties: Stone Base Asphalt Paving Curb & Gutter Grading Storm Drain UtilitiesOffice/Plant Locations: McConnellsKey Contacts: Steve Cosper, Owner – [email protected] Steve Primm, VP-Project Manager – [email protected] Dave Yungfleisch, Project Manager – [email protected] Brad Whaley, Project Manager – [email protected] Jame Poletti, Project Manager – [email protected] Dallas Owens, Project Manager – [email protected] Chris Harrell, Project Manager Assistant – [email protected] Spencer Thompson, Project Manager Assistant – [email protected] Fred Reese, Plant Manager – [email protected] Allen Gambill, Q/C Manager – [email protected] Ryan Haynes, Controller – [email protected] Torrie Thompson, HR/Office Manager – [email protected] Lauren Lomascolo, Business Development – [email protected]

LANE The Lane Construction CorporationP.O. Box 38463176 Charleston HWY.West Columbia, S.C. 29171Phone : (803)791-1295FAX : (803)791-1965

Branch Offi ce:Beaufort, S.C. Phone : (843)846-8116FAX : (843)846-9444

Key Contacts:Michael Cuilik, Sr. District [email protected] Barrack, Plant ManagerAl Hill, Assistant Plant ManagerGordon Wright, QC Manager

The Lane Construction Corporation8205 Wilkinson Blvd.Charlotte, N.C. 28214Phone : (803)394-8354FAX : (803)394-5354

Key Contact:Tim Gaddy, Plant Manager

Plant Locations:West Columbia, Rock Hill, Orangeburg, Ridgeland, Ulmer

845188_Lane.indd 1 11/23/16 3:49 PM

Page 27: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 27

CONTRACTOR MEM

BERSContractor Members

LLANE CONSTRUCTION CORP.P.O. Box 3846 3176 Charleston Highway West Columbia, SC 29171 Phone: (803) 791-1295 Fax: (803) 791-1965 www.laneconstruct.comSpecialties: Heavy Highway Asphalt Manufacturing Grading and Sitework Asphalt Milling Asphalt Paving – Commercial and HighwayOffice/Plant Locations: West Columbia Orangeburg Ridgeland UlmerKey Contacts: Michael Cuilick, Sr. District Manager – [email protected] Lee Barrack, Plant Manager – [email protected] Al Hill, Assistant Plant Manager – [email protected] Tim Gaddy, Plant Manager – [email protected] Darryl Davis, NC QAQC Manager – [email protected] Gordon Wright, SC QAQC Manager – [email protected]

KKING ASPHALT, INC.Corporate Office 2127 Greenville Highway P.O. Box 179 Liberty, SC 29657 Phone: (864) 855-0338 www.kingasphaltinc.comSpecialties: Asphalt Manufacturing Asphalt Paving CMRB Milling Recycled Material Sales EZ Street® Cold Asphalt Sealcoating and StripingOffice/Plant Locations: Liberty 2127 Greenville Highway P.O. Box 179 Liberty, SC 29657Simpsonville 1189 Old Stage Road Simpsonville, SC 29681Pacolet 1020 West Main Street Pacolet, SC 29681Key Contacts: Michael Crenshaw, President – [email protected]; Cell: (864) 855-0338 Michael Van Daele, CFO/Treasurer – [email protected] Greg Heyward, Vice President/Commercial Division – [email protected] Marty McKee, Vice President, SCDOT Division – [email protected] Russell Ellenburg, Vice President, Small Services Division – [email protected] Zachary Michael, Vice President, Human Resources and Environmental Compliance – [email protected] Douglas Limbaugh, Vice President Reclamation & Milling Services – [email protected] Scott Reece, Quality Control Manager – [email protected] Danny Michael, Paving Superintendent – [email protected] Paul Van Daele, Sales – [email protected] Chris Cook, Plant Superintendent – [email protected]

PreferredMaterials.com

Hardeeville Asphalt Plant843-784-2067 912-443-3400

Call us for help with your next construction project!

m

847097_Preferred.indd 1 20/12/16 2:34 pm

Page 28: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

28 www.scasphalt.org

Contractor Members

SSANDERS BROTHERS CONSTRUCTION COMPANY INC.1990 Harley Street P.O. Box 60969 North Charleston, SC 29406 Phone: (843) 744-4261 Fax: (843) 554-2095 www.sandersbrothers.comOffice/Plant Locations: North Charleston SummervilleKey Contacts: Greg Sanders, President – [email protected] Elliott Sanders, Jr., Executive V.P. – [email protected] Lori Wood, Executive V.P. – [email protected] Tom Stokes, VP/General Manager – [email protected] Chris Davis, VP/Asphalt Operations – [email protected] Carl Schultz, CFO/Treasurer – [email protected] Herb Mallard, CFO/Treasurer – [email protected]

SATTERFIELD CONSTRUCTION COMPANY INC.Corporate Office 2111 Laurens Highway P.O. Box 279 Greenwood, SC 29648 Phone: (864) 223-8601 Fax: (864) 223-3008 www.satterfieldconstruction.orgOffice/Plant Locations: Greenwood Phone: (864) 229-2944Eureka Phone: (803) 648-8258Newberry Phone: (803) 276-2623Key Contacts: Richard Jackson, CEO – [email protected] Whetstone, President – [email protected] Gene Sartain, Exec. Vice President – [email protected] Stacey Black, Vice President, Operations – [email protected] Scott Bledsoe, QC Manager – [email protected] Larry Paysinger, Asphalt Manager – [email protected] Bill Britt, Asphalt Manager – [email protected]

PPALMETTO CORP.3873 Highway 701 North P.O. Box 346 Conway, SC 29526 Phone: (843) 365-2156 Fax: (843) 365-5436 www.palmettocorp.netSpecialties: General Contractor Asphalt Manufacturing Asphalt Paving Asphalt Milling Grading & Site Work Drainage Stone Base Concrete C&G Asphalt & Concrete CrushingOffice/Plant Locations: Conway Florence BishopvilleKey Contacts: Shawn Godwin, President – [email protected] Rusty Faulk, VP-Operations – [email protected] Ken Atkinson, VP-Estimating – [email protected] Eric Faulk, VP-QC – [email protected]

PREFERRED MATERIALS, INC.47 Telfair Place Savannah, GA 31402 Phone: (912) 443-3400 Fax: (912) 443-3401 www. Preferredmaterials.comSpecialties: Asphalt Paving – Highway and Commercial FOB HMA Sales Fine Grading ServicesOffice/Plant Locations: Savannah HardeevilleKey Contacts: Robert Royal, VP/Regional Manager – [email protected] Jeff Andrews, Operations Manager – [email protected] Grant Peterson, Estimating Manager – [email protected] Darrell Cannon, Project Manager – [email protected] Bryan Thompson, Asphalt Plant Manager – [email protected] Joe Hires, Quality Control Manager – [email protected]

Page 29: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 29

CONTRACTOR MEM

BERSContractor Members

Pacolet Plant 230 Highway 176 Pacolet, SC 29372 Phone: (864) 474-2244Blacksburg Quarry 486 Shaman Rd. Blacksburg, SC 29702 Phone: (864) 839-6200Key Contacts – Corporate Office: Robert Ponton, President – [email protected] Scott Fant, VP of Business Development – [email protected]; Cell: (864) 420-3661 Fred Shelton, CFO – [email protected] Contacts – Duncan Office: Rob Loar, Region Manager – [email protected]; Cell: (706) 533-1472 Casey Schwager, Area Manager – [email protected]; Cell: (864) 303-8872 Richard Crochetiere, Jr., Senior Estimator – [email protected]; Cell: (864) 202-3456Key Contacts – Columbia Office: Paul Edwards, Area Manager – [email protected]; Cell: (803) 260-4040 Wendy Thompson, Estimator – [email protected]; Cell: (803) 960-8231 Wendell Powell, Operations Manager – [email protected]; Cell: (803) 960-8177Key Contacts – Blacksburg Plant: Scott Edwards, Plant Foreman – [email protected]; Cell: (864) 505-4002Key Contacts – Columbia Plant: Avery Mobley, Plant Foreman – [email protected]; Cell: (803) 260-4040 Chip Griner, Plant Foreman – [email protected]; Cell: (803) 606-5773Key Contact – Duncan Plant: Rusty Benton, Plant Foreman – [email protected]; Cell: (864) 505-4005Key Contact – Lakeside Plant: Paul Benton, Plant Foreman – [email protected]; Cell: (864) 303-4260Key Contact – Blacksburg Quarry: Irvin Wilson, Quarry Superintendent – [email protected]; Cell: (864) 303-7935

SLOAN CONSTRUCTION, A DIVISION OF REEVES CONSTRUCTION COMPANYCorporate Office 250 Plemmons Road Duncan, SC 29334 Phone: (864) 416-0200 Fax: (864) 416-0201 www.Sloan-Construction.comSpecialties: Heavy Highway Asphalt Paving Asphalt Manufacturing Grading & Site WorkOffice/Plant Locations: Duncan Office 248 Plemmons Road Duncan, SC 29334 Phone: (864) 968-2250 Fax: (864) 968-2255Columbia Office 645 Rosewood Drive P.O. Box 1957 Columbia, SC 29202 Phone: (803) 376-1240 Fax: (803) 376-1967Blacksburg Plant 493 Quarry Road Blacksburg, SC 29702 Phone: (864) 936-7212 Fax: (864) 936-7213Columbia Plant 630 Rosewood Drive Columbia, SC 29201 Phone: (803) 771-6541 Fax: (803) 376-1967Duncan Plant 235 Plemmons Road Duncan, SC 29334 Phone: (864) 801-3275 Fax: (864) 968-2255Lakeside Plant 4 Brown Road Piedmont, SC 29673 Phone: (864) 299-1333

Page 30: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

30 www.scasphalt.org

Contractor Members

Key Contacts: Donald Godwin, Owner/President – [email protected]; Cell: (843) 385-7283 Nick Godwin, Vice President – [email protected]; Cell: (843) 241-2356 Mark Thorne, VP/CFO – [email protected]; Cell: (843) 241-5152 Warren Smith, Operations Manager/Estimator – [email protected]; Cell: (843) 241-3834 Dean Floyd, Paving Operations Manager – [email protected]; Cell: (843) 241-3655 Bobby Johnson, QC Manager – [email protected]; Cell: (843) 455-5775 Brett Davis, QC Manager – [email protected]; Cell: (843) 995-1684 Dustin Thorne, Project Manager/Estimator – [email protected]; Cell: (843) 241-5700

SOUTHERN ASPHALT, INC.3370 Mt. Pisgah Cemetery Road Conway, SC 29526 Phone: (843) 369-7283 Fax: (843) 369-7284 www.southernasphalt.comSpecialties: Asphalt Paving – Highway and Commercial Grading and Sitework Asphalt Manufacturing Asphalt MillingOffice/Plant Locations: Conway Rains

864-223-8601

Satterfi eld Construction CompanyGreenwood, South Carolina

701552_Satterfield.indd 1 02/07/14 7:33 PM

“Work Zone Traffic ControlProducts and Services”

1240 Kirkland Rd., Raleigh, NC 27603Telephone (919) 828-5399

Fax (919) 828-5393

4024 Joe Street, Charlotte, NC 28206Telephone (704) 714-2166

Fax (704) 714-2169

272 Clayton Forest Rd., Kernersville, NC 27284Telephone (336) 993-2828

Fax (336) 993-6929

8256 Garners Ferry Rd., Columbia, SC 29209Telephone (803) 783-4250

Fax (803) 783-4284

www.stayalertsafety.comNCDOT/SCDOT/DBE/WBE Certifi ed

7 5213_Sta .indd 1 30/01/1 7:20 PM

Page 31: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 31

Aggregate SupplierHANSON AGGREGATES SOUTHEAST, LLCwww.lehighhanson.com Specialties: Crushed Stone Sand & Gravel

Greer Territory Office 107 Aaron Tippin Drive Greer, SC 29650 Phone: (864) 968-1310 Fax: (864) 968-1316 Key Contacts: Matt Jolliff, SC Sales Manager – [email protected]; Cell: (864) 968-1310 Doug Larson, SC Operations Manager – [email protected]; Cell: (864) 968-1310 Neal Barber, Quality Control Manager – [email protected]; Cell: (803) 417-5139 Angie Carr, SC Sales Rep/Upstate – [email protected]; Cell: (864) 982-2299 Bill Perry, SC Sales Rep – [email protected]; Cell: (843) 921-9629 Michael White, SC Sales Rep – [email protected]; Cell: (843) 921-7000

Anderson Quarry 1413 Hayes Road Anderson, SC 29624 Phone: (864) 296-9242 Fax: (864) 296-8245 Key Contact: Tom Markowski, Anderson Plant Manager – [email protected]; Cell: (864) 296-9242

Pelham Quarry 240 E. Howell Road Greer, SC 29651 Phone: (864) 848-1165 Fax: (864) 848-3630 Key Contact: Andy Ward, Pelham Plant Manager – [email protected]; Cell: (864) 848-1165

Sandy Flat Quarry 5566 Mountain View Road Taylors, SC 29687 Phone: (864) 895-5050 Fax: (864) 895-5053 Key Contact: Andy Ward, Sandy Flat Plant Manager – [email protected]; Cell: (864) 895-5050

Brewer Sand 3383 Kirkley Road Jefferson, SC 29718 Phone: (843) 658-3816 Fax: (843) 648-3059 Key Contact: Mike Cool, Brewer Sand Manager – [email protected]; Cell: (843) 658-3816

Lowrys Quarry 485 True Road McConnells, SC 29726 Phone: (803) 684-1047 Fax: (803) 684-2000

Marlboro Sand & Gravel 1798 Highway 15-401 West Bennettsville, SC 29512 Phone: (843) 479-8909 Fax: (843) 479-0499 Key Contact: Cary Gordon, Marlboro Plant Manager – [email protected]; Cell: (843) 479-8909

Jefferson Quarry 341 Becker Minerals Lane Jefferson, SC 29718 Phone: (843) 672-6181 Fax: (843) 672-5557 Key Contact: Allen Hartranft, Jefferson Plant Manager – [email protected]; Cell: (843) 672-6181

Major Associate MembersASSOCIATE M

EMBERS

Page 32: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

32 www.scasphalt.org

Major Associate Members

Georgetown Quarry 564 Quarry Road Jamestown, SC 29453 Phone: (843) 257-4545 Key Contact: Matt Miller, Sr. Sales Rep – [email protected]; Cell: (843) 296-9860

North Columbia Quarry 370 Monticello Trail Columbia, SC 29203 Phone: (803) 786-4510 Key Contact: Frank Manos, Sr. Sales Rep – [email protected]; Cell: (803) 917-9377

Cayce Quarry 2125 State Street Cayce, SC 29033 Phone: (803) 796-8320 Key Contact: Frank Manos, Sr. Sales Rep – [email protected]; Cell: (803) 917-9377

Berkeley Quarry 950 County Line Road Cross, SC 29436 Phone: (843) 753-2132 Key Contact: Matt Miller, Sr. Sales Rep – [email protected]; Cell: (843) 296-9860

Montague Ave Yard 2849 Three Lakes Road North Charleston, SC 29418 Phone: (843) 225-8210 Key Contact: Matt Miller, Sr. Sales Rep – [email protected]; Cell: (843) 296-9860

Loamy Sand & Gravel 4540 Timrod Road Bethune, SC 29009 Phone: (843) 334-7000 Key Contact: Scott Gibbes, Sales Rep II – [email protected]; Cell: (980) 721-9504

Rock Hill Quarry 991 Hawkfield Road Rock Hill, SC 29730 Phone: (803) 324-3181 Key Contact: Brandon Weimer, Sales Rep II – [email protected]; Cell: (980) 216-0804

MARTIN MARIETTA MATERIALSwww.martinmarietta.com Specialties: Aggregates

South Carolina District Office 8451 Monticello Road Columbia, SC 29203 Phone: (803) 779-6500 Fax: (803) 771-4200 Key Contacts: Jim Thompson, VP-Gen Mgr - SC and Charlotte – [email protected]; Cell: (980) 721-1220 Brandon Lindsey, District Sales Manager – [email protected]; Cell: (980) 721-1219 Frank Manos, Sales – Cell: (803) 978-6272 Matt Miller, Sales – Cell: (919) 794-1549

Charleston Yard 1801 Midford Street Charleston, SC 29418 Phone: (843) 225-2810 Key Contact: Matt Miller, Sr. Sales Rep – [email protected]; Cell: (843) 296-9860

Conway FlorenceBishopville

843-365-2156www.palmettocorp.net

791936_Palmetto.indd 1 2/13/16 9:25 AM

Page 33: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 33

ASSOCIATE MEM

BERSMajor Associate Members

Rains Yard P.O. Box 1239 - Grady Road Rains, SC 29589 Phone: (843) 275-0205 Key Contact: Kenton Richardson, Sales Representative – [email protected]; Cell: (704) 302-3608

Charlotte Regional Sales Office 11020 David Taylor Drive, Suite 105 Charlotte, NC 28262 Phone: (704) 549-1540 Fax: (704) 549-4137 Key Contact: Tim Garrett, Area Sales Manager – [email protected]; Cell: (704) 607-0790

Asphalt and Emulsion SuppliersASSOCIATED ASPHALT/SEACOwww.associatedasphalt.com Specialties: PG Asphalt Asphalt Emulsions Cold Mix

Inman, SC P.O. Box Inman, SC 29349 Phone: (864) 472-2816 Fax: (864) 472-3608 Key Contact: Scooter Kennedy, Sales & Technical Manager – [email protected]; Cell: (864) 420-1908

Columbia, SC 2700 William Tuller Drive Columbia, SC 29205 Phone: (803) 799-5335 Fax: (803) 256-8111 Key Contact: John Mims, Sales & Technical Manager – [email protected]; Cell: (803) 360-7334 306 Longview Terrace Greenville, SC 29605

Other Locations: Charlotte, NC Salisbury, NC Greenboro, NC Roanoke, VA Bristol, VA Martinsburg, WV Tampa, FL Gainesville, GA Coneley, GA

VULCAN MATERIALS COMPANYwww.vulcanmaterials.com Specialties: Crushed Stone

South Carolina Central Office 201 Brown Road Piedmont, SC 29673 Phone: (864) 277-2731 Fax: (864) 299-8872 Key Contacts: Elliott Botzis, VP / GM South Carolina – [email protected]; Cell: (864) 313-3375 Eric Seymore, SC Sales Manager – [email protected]; Cell: (803) 240-2955 Hal Stokes, Sales Representative – [email protected]; Cell: (864) 270-5832 Miles Willis, Sales Representative – [email protected]; Cell: (864) 316-9194 Neil Barnes, Sales Representative – [email protected]; Cell: (864) 299-4786 Eric Ponder, Sales Representative – [email protected]; Cell: (864) 245-5136

Columbia Office 545 Georgia Street Columbia, SC 29201 Phone: (803) 929-1348 Fax: (803) 256-3584 Key Contacts: David Dorroh, Sales Representative – [email protected]; Cell: (803) 413-5789 Heath Summer, Sales Representative – [email protected]; Cell: (803) 312-2515

Charleston Yard 2398 Aviation Boulevard North Charleston, SC 29406 Phone: (843) 572-6627 Fax: (843) 572-9897 Key Contact: Derek Weathers, Sales Representative – [email protected]; Cell: (843) 514-6861

Mt. Holly Yard 3100 Highway 52 Moncks Corner, SC 29461 Phone: (843) 761-8490 Key Contact: Derek Weathers, Sales Representative – [email protected]; Cell: (843) 514-6861

Page 34: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

34 www.scasphalt.org

Major Associate Members

Greer Plant 539 E. Poinsett Street Greer, SC 29651 Fax: (855) 890-2405 Key Contacts: Mike Jenkins, Director of Technical Marketing – [email protected]; Cell: (413) 230-7931 Jame Ross, Sales Manager – [email protected]; Cell: (252) 902-5706 Richard Lamprecht, Plant Manager – [email protected]; Cell: (864) 616-5453

ERGON ASPHALT & EMULSIONS, INC.www.ergon.com www.savemyroads.com Specialties: Manufacture of asphalt, polymer & emulsion products for road construction & maintenance

14 Foundation Drive Garden City, GA 31408 Phone: (912) 964-0811 Fax: (912) 964-0009 Key Contacts: Daniel Sapp, Area Sales Manager – [email protected]; Cell: (912) 318-3427 Cliff Horton, Plant Manager – [email protected]; Cell: (912) 401-5673 Bill Evans, Technical Marketing Manager – [email protected]; Cell: (706) 975-9339

HAMMAKER EAST EMULSIONS, LTD.www.hammakereast.com Specialties: Fibermat

Greensboro Plant 1124 South Holden Road Greensboro, NC 27407 Phone: (336) 292-6875 Fax: (336) 292-6076 Black Mountain Plant 1561 Grovestone Road Black Mountain, NC 28711 Phone: (828) 686-3011 Fax: (828) 686-3014 Key Contacts: Brigetta Johnson, Regional Sales Representative – [email protected]; Cell: (336) 905-5162 Sid Witmer, Regional Sales Manager – [email protected]; Cell: (717) 387-2800

AXEON SPECIALTY PRODUCTSwww.axeonsp.com Specialties: Liquid Asphalt

750 Washington Boulevard, Suite 600 Stamford, CT 06901 Phone: (855) 378-4958 Key Contacts: Mike Gothard, Asphalt Marketing Director – [email protected]; Cell: (404) 747-7568 Horace Turbeville Sr., Area Sales Manager – [email protected]; Cell: (704) 906-6038 Kurt Korinek, Sr. Area Sales Manager – [email protected]; Cell: (941) 518-5639 Ron Corun, Technical Services Director – [email protected]; Cell: (410) 952-4020 Robbie Robinson, Sr. Technical Services Manager – [email protected]; Cell: (803) 729-7088 Christina Skala, Asphalt Quality Manager – [email protected]; Cell: (856) 217-3361

BITUMAR USA, INC.www.bitumar.com Specialties: Liquid Asphalt

Corporate Office 6000 Pennington Avenue Baltimore, MD 21226 Phone: (410) 354-9550 Fax: (410) 354-9552 Key Contact: Steve Eveker, Regional Sales Manager – [email protected]; Cell: (706) 631-9330

BLACKLIDGE EMULSIONS, INC.www.blacklidgeemulsions.com Specialties: UltraTack UltraFuse UltraArmor (Fog Seal) UltraPrime MC-70 Liquid Asphalt AC-20 CRS-2 Emulsions

Corporate Office 12251 Bernard Parkway, Suite 200 Gulfport, MS 39503 Phone: (228) 863-3878 Fax: (228) 864-0437

Page 35: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 35

ASSOCIATE MEM

BERSMajor Associate Members

SOUTHEAST EMULSIONS INC.www.southeastemulsions.com Specialties: Liquid Asphalt Asphalt Emulsions Micro-surfacing Surface Treatments

Corporate Office 250 Plemmons Road Duncan, SC 29334 Phone: (864) 416-0200 Fax: (864) 416-0201 Key Contacts: Michael Burdette, General Manager – Cell: (912) 257-6736 Alan Harrison, Regional Sales Manager – Cell: (864) 505-3028 Rip Harrington, Regional Sales Manager – Cell: (803) 360-4808

Locations: Union, SC Plant Perry, GA Plant Key Contacts: Gary Turner, Union Plant – Cell: (864) 327-7349 David Gales, Perry Plant – Cell: (478) 972-0616

J.T. RUSSELL & SONS, INCwww.jtrussellandsons.com Specialties: Liquid Asphalt

Corporate Office 221 Snuggs Street P.O. Box 670 Albemarle, NC 28002 Key Contacts: Jim Russell, CEO – [email protected]; Cell: (704) 982-2225 Anna-Yates Lipcsak, Marketing/Sales – [email protected]

Albemarle Terminal 221 Snuggs Street Albemarle, NC 28001

Denton Terminal 18846 NC Highway 8 Denton, NC 27239

Nation's largest producer of crushed stone

SC Central Office201 Brown RoadPiedmont, SC 29673864-277-2371

Division Office800 Mount Vernon HwySuite 200, Atlanta, GA 30328770-458-4481

Southeast Division

737325_Vulcan.indd 1 11/03/15 6:03 PM

Page 36: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

36 www.scasphalt.org

Additives, Truck Bed Release Agents and Biodegradable Extraction SolventsARIZONA CHEMICAL COMPANYwww.arizonachemical.com Specialties: Asphalt Rejuvenators4600 Touchton Road East, Suite 1200 Jacksonville, FL 32246 Phone: (904) 928-8993 Key Contact: Brian Fennell, Senior Account Manager – [email protected]; Cell: (904) 254-8126

CARMEUSE LIME & STONEwww.carmeusena.com Specialties: Lime Hydrated Lime Crushed Aggregate523 East Street Albemarle, NC 28001 Phone: (704) 305-1218 Key Contact: Rusty Story, Territory Sales Rep - North Carolina, South Carolina, Southern Virginia – [email protected]; Cell: (704) 305-1218Other Locations: Tennessee Georgia Virginia Alabama

LHOIST NORTH AMERICAwww.lhoist.com2093 Big Stony Creek Road Ripplemead, VA 24136 Phone: (540) 626-8702 Fax: (540) 626-7234 Key Contacts: Kevin Butler, Senior Account Manager – [email protected]; Cell: (843) 442-9181 Drema Stewart, Sales Coordinator – [email protected]; Cell: (540) 626-8702

INGEVITYwww.ingevity.com Specialties: Warm Mix Asphalt Additives Liquid Anti-stripsCorporate Office 5255 Virginia Avenue North Charleston, SC, SC 29406 Phone: (225) 362-1405 Fax: (843) 746-8488 Key Contacts: Lance Brooks, Technical Marketing Manager – [email protected]; Cell: (225) 362-1405 Dean Frailey, Business Development Manager, Asphalt Innovations, MWV Specialty Chemicals – [email protected]; Cell: (803) 487-9278

MISSISSIPPI LIME COMPANYwww.mississippilime.com Specialties: Lime Hydrated LimeCorporate Office 3870 S. Lindbergh Boulevard, Suite 200 St. Louis, MO 63127 Phone: (800) 437-5463 Key Contact: Paul Pine, Regional Sales Manager – [email protected]; Cell: (704) 657-2154Chester, SC 1544 Beltline Road Chester, SC 29706 Phone: (803) 581-3183

Certified Public Accounting FirmsDIXON HUGHES GOODMAN, LLPwww.dhgllp.com Specialties: Certified Public Accountants and Advisors320 E. Main Street, Suite 310 Spartanburg, SC 29304 Phone: (864) 583-5800 Fax: (864) 585-6389 Key Contacts: Michael Trammell, Managing Partner – [email protected]; Cell: (864) 326-8525 Chris Feehan, Manager – [email protected]; Cell: (864) 326-8503 Sarah Windham, Senior Manager – [email protected]; Cell: (843) 727-3708

Associate Members

Page 37: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 37

ASSOCIATE MEM

BERSAssociate Members

Equipment DealersASC CONSTRUCTION EQUIPMENT USA, INC.www.ascvolvo.com Specialties: Equipment Dealer for Volvo, LB Performance / Blaw-Knox, Champion, Doosan Portable Power, Sennebogen Products and Stewart-Amos SweepersCorporate Office 9115 Harris Corners Parkway, Suite 450 Charlotte, NC 28269 Phone: (704) 494-8100 Fax: (704) 494-8199 Key Contacts: Shawn Sweet, COO – [email protected] Mike Werner, General Manager, South Carolina Region – [email protected]; Cell: (803) 230-0937 John Van Patton – [email protected], SC Branch Office 407 Oak Road Piedmont, SC 29673 Phone: (864) 704-1060 Fax: (864) 704-1060Columbia, SC Branch Office 2303 Airport Boulevard Cayce, SC 29033 Phone: (803) 791-0740 Fax: (803) 791-9920Charleston, SC Branch Office 7235 Cross Couty Road North Charleston, SC 29418 Phone: (843) 414-1120 Fax: (843) 414-1129Charlotte, NC Branch Office 11425 Reames Road Charlotte, NC 28269 Phone: (704) 596-8283 Fax: (704) 596-1362Additionally ASC has 12 more branch offices in NC, TN, GA and AL.

Engineering & TestingCOASTAL LASERS INC.Specialties: Paving and Milling Automation1406-1 Castle Hayne Road Wilmington, NC 28401 Phone: (910) 763-4898 Fax: (910) 763-4858 Key Contacts: Marty Evans, President

MICHAEL BAKER INTERNATIONAL, INC.www.mbakerintl.com Specialties: Roadway and Bridge Design Aviation Construction Engineering & Inspection (CEI) Architecture Environmental NEPA Program Management Planning HydrologyColumbia, SC 700 Huger Street Columbia, SC 29201 Phone: (803) 254-2211 Fax: (803) 779-8749 Key Contacts: John V. Walsh, P.E., VP & Office Executive – [email protected]; Cell: (803) 254-2211 Timothy D. Sewell, P.E., Associate VP & Construction Services Manager – [email protected]; Cell: (803) 457-1112Other Locations: Greenville, SC North Charleston, SC

Page 38: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

38 www.scasphalt.org

Associate Members

Myrtle Beach 2334 Chestnut Road Longs, SC 29568 Phone: (843) 399-2074Rock Hill 3777 Lazy Hawk Road Rock Hill, SC 29730 Phone: (803) 324-9600Simpsonville 224 Neely Ferry Road Simpsonville, SC 29680 Phone: (864) 963-3645Spartanburg 1410 Asheville Highway Spartanburg, SC 29303 Phone: (864) 582-1245Summerville 151 Farmington Road Summerville, SC 29483 Phone: (843) 871-2000Walterboro 3984 Jefferies Highway Walterboro, SC 29488 Phone: (843) 538-2595

BOMAG AMERICASwww.gobomag.com Specialties: Road Building and Construction Equipment125 Blue Granite Parkway Ridgeway, SC 21930 Key Contacts: Greg Shockley, Director of Sales Jerry Fitch, Territory Manager – [email protected] Dave Dennison, Marketing Manager – [email protected]

GENCOR INDUSTRIES, INC.www.gencor.com Specialties: Asphalt Plant EquipmentFlorida 5201 N. Orange Blossom Trail Orlando, FL 32810 Phone: (407) 290-6000 Fax: (407) 578-0577 Key Contacts: Dennis Hunt, VP Sales / Marketing Charlie Bartell, Regional Manager – Cell: (407) 718-1661 Ron Clark, District Manager-Mid Atlantic – [email protected]; Cell: (757) 593-2993Virginia 98 Rowe Drive Poquoson, VA 23662 Fax: (757) 868-4596

ASTEC INC.www.astecinc.com Specialties: Asphalt Plant Equipment4101 Jerome Avenue Chattanooga, TN 37407 Phone: (423) 867-4210 Fax: (423) 867-4636 Key Contacts: Malcolm Swanson, President – Cell: (423) 867-4210 Chris Frost, Senior Vice President of Sales – [email protected]; Cell: (423) 867-4210 Tom Baugh, Vice President of Sales – Cell: (423) 867-4210 Adrian Williamson, Regional Sales Manager – [email protected]; Cell: (423) 260-7915

BLANCHARD CATwww.blanchardmachinery.com Specialties: Road Building and Construction EquipmentWest Columbia 3151 Charleston Highway West Columbia, SC 29172 Phone: (803) 791-7100 Fax: (803) 791-9874 Key Contacts: Jay McCormack, General Sales Manager – [email protected]; Cell: (843) 871-2000 Austin Page, Sales Representative – [email protected]; Cell: (843) 963-3645Columbia 851 Buckner Road Columbia, SC 29203 Phone: (803) 799-2286 Fax: (803) 678-8538Florence 3031 Caterpillar Lane Florence, SC 29506 Phone: (803) 678-8520 Fax: (843) 390-6145Georgetown 3233 Highmarket Street Georgetown, SC 29440 Phone: (803) 527-4446Greenville 6755 Frontage Road Greenville, SC 29605 Phone: (803) 235-1076Hilton Head 50500 Whyte Hardee Boulevard Hardeeville, SC 29927 Phone: (843) 784-6766

Page 39: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 39

ASSOCIATE MEM

BERSAssociate Members

RITCHIE BROS. AUCTIONEERSwww.rbauction.com Specialties: Heavy Equipment AuctioneersNewnan Office 4170 Highway 154 Newnan, GA 30265 Phone: (770) 304-3355 Fax: (770) 304-3366 Key Contact: Clint Blair, Regional Sales Manager – [email protected]; Cell: (678) 423-5737

ROADTECwww.roadtec.com Specialties: Pavers Material Transfer Vehicles Mills Soil Stabilizer/Reclaimers Broom and Conveyor BroomsChattanooga 800 Manufacturers Road Chattanooga, TN 37405 Phone: (423) 265-0600 Fax: (423) 265-7521 Key Contacts: Charles Hall, Equipment Sales – [email protected]; Cell: (770) 380-3976 Andy Guth, National Sales Manager – [email protected]; Cell: (423) 260-0169

VOLVO CONSTRUCTION EQUIPMENT N.A.www.volvoce.com Specialties: Pavers Rollers Mills109 Pebble Creek Road Chapin, SC 29036 Phone: (828) 280-6670 Key Contact: Gary Atkinson, District Manager – [email protected]; Cell: (828) 280-6670

LINDER INDUSTRIAL MACHINERYwww.linderco.com www.facebook.com/linderindustrialmachinery www.twitter.com/LinderMachinery Specialties: Equipment Dealer: Hamm Rollers, Vogele Pavers,Wirtgen Milling, Kleemann Crushing & Screening, Etnyre Distributors, Superior Brooms, Komatsu Earthmoving, Atlas Material Handlers, & Konecranes LiftTrucksColumbia 3109 Charleston Highway Columbia, SC 29172 Phone: (803) 794-6150 Fax: (803) 739-8889 Key Contacts: Samuel Light, VP South Carolina – Cell: (803) 794-6150Other Locations: Greer Phone: (864) 877-8962 Fax: (864) 877-8157Charleston Phone: (843) 552-0095 Fax: (843) 851-0074

MAXAM EQUIPMENT, INC.www.maxamequipment.com Specialties: Equipment Manufacturing Custom Design Plant Equipment6501 E. Commerce Avenue Kansas City, MO 64120 Phone: (800) 292-6070 Fax: (816) 241-6465 Key Contact: Eric Hutchison, Regional Sales Manager – [email protected]; Cell: (717) 599-9959

MAY HEAVYEQUIP RENTALS & SALESwww.mayequip.com Specialties: Excavators, Pavers, Rollers, Wheel Loaders, Soil Stabilizers, Milling Machines; Distributor for: Hyundai, Bomag, Kawasaki, Sakai, Bell Trucks, NorAm, Terex-Trucks, Link-Belt, Bomag-Cedar Rapids1330 Buckner Road Columbia, SC 29203 Phone: (803) 917-2223 Fax: (803) 865-1003 Key Contacts: Richie Ambrose, VP - New Equipment Sales – [email protected]; Cell: (803) 917-2223 Jacob May, President – Cell: (336) 225-6293

Page 40: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

40 www.scasphalt.org

Associate Members

HOLDER PADGETT LITTLEJOHN + PRICKETT, LLCwww.hplplaw.comGreenville 1204-A E. Washington Street Greenville, SC 29601 Phone: (864) 335-8808 Fax: (864) 248-4090 Key Contacts: Lee Prickett, Partner – [email protected]; Cell: (864) 385-4936Other Location: Charleston

Natural Gas SuppliersTEXICAN NATURAL GAS COMPANYwww.texican.com Specialties: Natural Gas SupplyCharlotte 7301 Carmel Executive Park, Suite 316 Charlotte, NC 28226 Phone: (704) 544-6347 Fax: (704) 544-6752 Key Contacts: Robert Gray, Sales – [email protected]; (704) 544-7123 Eric Sayman, Sales – [email protected]; (704) 544-7122 Jennifer Crouch, President – [email protected]; (704) 544-7127Other Location: Atlanta

Insurance BrokersWILLIS TOWERS WATSON www.willistowerswatson.comSpecialties: Insurance/Surety1441 Main Street, Suite 806 Columbia, SC 29201 Phone: (803) 540-3084 Fax: (803) 256-1686Key Contact: Brad Lorenzetti, VP – lorenzetti_br@ willistowerswatson.com; Cell: (803) 917-7118

LegalELMORE GOLDSMITH, P.A. www.elmoregoldsmith.comP.O. Box 1887 55 Beattie Place, Suite 1050 Greenville, SC 29601 Phone: (864) 255-9500 Fax: (864) 255-9505Key Contacts: Frank Elmore, Owner – [email protected] Andy Goldsmith, Jr., Owner – [email protected] Sharon Brown, Administrator – [email protected]

OGLETREE, DEAKINS, NASH, SMOAK & STEWART, P.C.www.ogletreedeakins.com300 N. Main Street, Suite 500 Greenville, SC 29601 Phone: (864) 240-8317 Fax: (864) 235-4754 Key Contact: Kyle Dillard, Shareholder – [email protected] Locations: Charleston, SC Columbia, SC Charlotte, NC

Page 41: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 41

ASSOCIATE MEM

BERSAssociate Members

Traffic Control and Pavement Marking SuppliersPEEK PAVEMENT MARKING, LLCwww.peeksafety.com Specialties: Pavement Marking Airport Marking Marking EradicationSummerville 131 Jed Park Place Summerville, SC 29486 Phone: (843) 879-0529 Fax: (803) 753-0035 Key Contacts: Don Jackson, Division Manager – [email protected]; Cell: (803) 622-1576 Cary Mathis, Estimator – [email protected]; Cell: (706) 563-5867 Donnie Kick, VP of Operations – [email protected]; Cell: (706) 563-5867 Marc Hinson, President – [email protected]; Cell: (706) 563-5867Other Locations: Columbia Spartanburg Georgia Alabama

ROADSAFE TRAFFICwww.roadsafetraffic.com Specialties: Traffic Control Sales & Service Safety Equipment4841-A Edmund Highway West Columbia, SC 29170 Phone: (803) 755-6529 Fax: (803) 955-0209 Key Contacts: Brice Taylor, Branch Manager – [email protected] Roger Skoczek, Service Manager – [email protected]; Cell: (814) 494-8562

Surety Bond AgenciesBB&T/BOYLEVAUGHAN INSURANCE SERVICES, INC.www.bbandt.com Specialties: Insurance Bonds2000 Center Point Road P.O. Box 8628 Columbia, SC 29209 Phone: (803) 231-6181 Fax: (877) 467-7214 Key Contacts: Wes Dasher, President – [email protected] John Babson, Senior Vice President – [email protected]

HUB INTERNATIONAL SOUTHEASTwww.hubinternational.com Specialties: Insurance Bonds Employee BenefitsP.O. Box 21308 Columbia, SC 29221 Phone: (803) 739-0001 Fax: (803) 739-2200 Key Contacts: Graham Gardner, Producer – Cell: (803) 422-8987 John Gardner, Producer – [email protected]; Cell: (803) 739-0001 David Berno, C.S.O. – Cell: (843) 529-5472 Brian McGilvray, Producer – Cell: (843) 529-5672

SCOTT INSURANCE www.scottinsurance.comSpecialties: Risk Management Insurance Bonds521 East Morehead Street, Suite 300 Charlotte, NC 28202 Phone: (704) 556-1341 Fax: (704) 556-7681 Key Contact: Chauncey Tschiffely, Risk Advisor – [email protected]; Cell: (704) 644-7912

Page 42: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

42 www.scasphalt.org

Associate MembersSOUTHERN COMMERCIAL DEVELOPMENT, LLCwww.scdevelopmentllc.com Specialties: Traffic Control Services Sales and Rental of Traffic Control and Safety Equipment1326 South Lake Drive Lexington, SC 29073 Phone: (803) 808-0232 Fax: (803) 490-1511 Key Contacts: Sherita Evans, Operations Manager – [email protected]; Cell: (803) 509-3827 Chuck Mace, Division Manager – [email protected]; Cell: (803) 608-3827 Heather Evans, Office Manager – [email protected]

STAY ALERT SAFETY SERVICES, INC.www.stayalertsafety.com Specialties: Work Zone Traffic Control & SafetyColumbia, SC 8256 Garners Ferry Road Columbia, SC 29209 Phone: (803) 783-4250 Key Contacts: David Crowell, Offie Manager – [email protected] Jim Babcock, General Manager – [email protected] Wade Lackey, Operations Manager – [email protected] Chris Fulk, Account Manager – [email protected] Kernersville, NC P.O. Box 467 Kernersville, NC 27285 Phone: (336) 993-2828 Fax: (336) 993-6929Other Location: Charlotte, NC

TransportHILCO TRANSPORTwww.hilco.com Specialties: AC HaulingDuncan, SC P.O. Box 399 Reidville, SC 29375 Phone: (864) 848-4101 Key Contact: David Melton, Terminal Manager – [email protected]; Cell: (864) 848-4101

Corporate Headquarters221 Snuggs Street, Albemarle, NC 28001

(704) 982-2225Mailing Address

PO Box 670, Albemarle, NC 28002Asphalt Plants

Lexington202 Woodside Drive

336-237-9374Charlotte

14119 Brooks Mill Rd(704) 573-3567

Conover201 Herman Sipe Rd

(828) 464-0328New London

359 Coggins Rd(704) 463-1416

Liquid Asphalt Office18846 NC Hwy 8Denton, NC 27239

(336) 859-0902Asphalt Terminal Locations

221 Snuggs RdAlbermarle, NC 28001

32420 Moore LaneBoykins, VA 2382718846 NC Hwy 8Denton, NC 27239

Website: www.jtrussellandsons.com

846034_JTRussell.indd 1 29/11/16 10:43 PM

Page 43: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 43

SCDOT CommissionSCDOT COMMISSION DISTRICT 1Robby Robbins Commissioner 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 995-2875 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 2John Hardee Vice Chairman 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-0013 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 3Ben Davis Commissioner 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-0013 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 4Woodrow Willard Commissioner 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (864) 542-7949 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 5Gene Branham Commissioner 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 995-2874 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 6Samuel Glover Commissioner 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 596-4151 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION DISTRICT 7Mike Wooten Chairman 1298 Professional Drive Myrtle Beach, SC 29577 Phone: (843) 692-3200 Fax: (803) 737-5011 [email protected]

SCDOT COMMISSION Clifton Parker Commissioner - Governor’s At-Large 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 936-6015 Fax: (803) 737-5011 [email protected]

SCDOT HeadquartersOFFICE OF THE SECRETARY OF TRANSPORTATIONChristy Hall Secretary of Transportation 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-0874 Fax: (803) 737-2038 [email protected]

Wendy Nicholas Chief of Staff 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-0885 Fax: (803) 737-2038 [email protected]

ENGINEERINGLeland Colvin Deputy Secretary for Engineering 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-7900 Fax: (803) 737-5053 [email protected]

FINANCE AND ADMINISTRATIONBrian Keys Deputy Secretary for Finance & Procurement 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-1240 Fax: (803) 737-0096 [email protected]

PLANNING AND INTERMODAL PROGRAMSRon Patton Deputy Secretary for Intermodal Planning 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-1444 Fax: (803) 737-0145 [email protected]

OFFICE OF HUMAN RESOURCESMary Gail Monts-Chamblee Human Resources Director 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-1321 Fax: (803) 737-4846 [email protected]

LEGAL SERVICESLinda McDonald Chief Counsel 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-1347 Fax: (803) 737-2071 [email protected]

ENGINEERINGRandall Young Chief Engineer for Project Delivery 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-7900 Fax: (803) 737-5053 [email protected]

Andy Leaphart Chief Engineer for Operations 955 Park Street P.O. Box 191 Columbia, SC 29202-0191 Phone: (803) 737-7900 Fax: (803) 737-5053 [email protected]

South Carolina Department of Transportation

SCDOT DIRECTORY

Page 44: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

44 www.scasphalt.org

South Carolina Department of Transportation

Gary Lockman Geotechnical Materials Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6692 Fax: (803) 737-6649 [email protected]

Terry Swygert Research Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6691 Fax: (803) 737-6649 [email protected]

Clifford Selkinghaus Asphalt Materials Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6700 Fax: (803) 737-6649 SelkinghausCB@ scdot.org

Temple Short Operations Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6648 Fax: (803) 737-6649 [email protected]

Karen Nicholson HMA Verification Lab Manager 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-7744 Fax: (803) 737-6649 [email protected]

District 1DISTRICT OFFICERobert Dickinson Interim District Engineering Administrator 1400 Shop Road Columbia, SC 29201 Phone: 737-6661 Fax: (803) 737-0057 [email protected]

Doug McClure Assistant Bridge Construction Engineer 955 Park Street, Rm. 504 Columbia, SC 29201 Phone: (803) 737-1490 Fax: (803) 737-9945 [email protected]

Merritt Vann Quality Management Engineer 955 Park Street, Rm. 332 Columbia, SC 29201 Phone: (803) 737-6791 Fax: (803) 737-2313 [email protected]

OFFICE OF MATERIALS AND RESEARCHMerrill Zwanka Materials & Research Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6681 Fax: (803) 737-6649 [email protected]

Chad Hawkins State Materials Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6686 Fax: (803) 737-6649 [email protected]

Aly Hussein Structural Materials Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6687 Fax: (803) 737-6649 [email protected]

Jay Thompson State Pavement Design Engineer 1406 Shop Road Columbia, SC 29201 Phone: (803) 737-6683 Fax: (803) 737-6649 [email protected]

Jeff Elliott Contracts Engineer 955 Park Street, Rm. 334 Columbia, SC 29201 Phone: (803) 737-1249 Fax: (803) 737-2264 [email protected]

Tim Lindberg Data Support Engineer 955 Park Street, Rm. 332 Columbia, SC 29201 Phone: (803) 737-1656 Fax: (803) 737-2313 [email protected]

Brian Parnell Engineering Contracts Manager 955 Park Street, Rm. 333 Columbia, SC 29201 Phone: (803) 737-1147 Fax: (803) 737-2264 [email protected]

Patti Gambill Construction Scheduling Engineer 955 Park Street, Rm. 332 Columbia, SC 29201 Phone: (803) 737-2011 Fax: (803) 737-2313 [email protected]

Wei Johnson Construction Geomatics Engineer 955 Park Street, Rm. 332 Columbia, SC 29201 Phone: (803) 737-2031 Fax: (803) 737-2313 [email protected]

David Rister Bridge Construction Engineer 955 Park Street, Rm. 504 Columbia, SC 29201 Phone: (803) 737-1490 Fax: (803) 737-9945 [email protected]

Bill Mattison Assistant Bridge Construction Engineer 955 Park Street, Rm. 504 Columbia, SC 29201 Phone: (803) 737-1490 Fax: (803) 737-9945 [email protected]

SCDOT ConstructionCONSTRUCTIONTodd Steagall Director of Construction 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

Claude Ipock State Construction Engineer 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

David Rogers Assistant Construction Engineer 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

Kevin Harrington Assistant Construction Engineer 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

Nick Waites Assistant Construction Engineer 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

Clay Richter Assistant Construction Engineer 955 Park Street, Rm. 330 Columbia, SC 29201 Phone: (803) 737-1308 Fax: (803) 737-2389 [email protected]

Page 45: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 45

SCDOT DIRECTORYSouth Carolina Department of Transportation

District 2DISTRICT OFFICEKevin McLaughlin District Engineering Administrator 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8011 Fax: (864) 227-6567 [email protected]

Lee Neighbors District Construction Engineer 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8012 Fax: (864) 227-6567 [email protected]

Mark DeZurik District Maintenance Engineer 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8014 Fax: (864) 227-6567 [email protected]

Nick Rebovich District Traffic Engineer 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8016 Fax: (864) 227-6567 [email protected]

Drew McCaffrey Scheduler 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8004 Fax: (864) 227-6567 [email protected]

LEXINGTON B CONSTRUCTIONJoseph McIntyre Resident Construction Engineer 124 Park Road Lexington, SC 29072 Phone: 359-4672 Fax: (803) 356-3041 [email protected]

RICHLAND A CONSTRUCTIONPaul Miller Resident Construction Engineer 7201 Fairfield Road Columbia, SC 29203 Phone: 786-0717 Fax: (803) 333-8045 [email protected]

RICHLAND B CONSTRUCTIONChris Kelly Resident Construction Engineer 7201 Fairfield Road Columbia, SC 29203 Phone: 786-0706 Fax: (803) 333-8045 [email protected]

RICHLAND C CONSTRUCTIONAllen Thompson Resident Construction Engineer 1400 Shop Road Columbia, SC 29201 Phone: 254-1007 Fax: (803) 254-1009 [email protected]

SUMTER CONSTRUCTIONJeffrey Wilkes Resident Construction Engineer 129 South Harvin Street Suite 4 Sumter, SC 29150 Phone: 775-3501 Fax: (803) 773-8333 [email protected]

LEE MAINTENANCEWayne Keeys Resident Maintenance Engineer 703 E. Church Street Bishopville, SC 29010 Phone: 484-6236 Fax: (803) 484-4263 [email protected]

LEXINGTON MAINTENANCEMike Bagley Resident Maintenance Engineer 124 Park Road Lexington, SC 29072 Phone: 359-4103 Fax: (803) 359-9768 [email protected]

RICHLAND MAINTENANCETony Magwood Resident Maintenance Engineer 7201 Fairfield Road Columbia, SC 29203 Phone: 786-0128 Fax: (803) 786-9140 [email protected]

SUMTER MAINTENANCESandra Riley Resident Maintenance Engineer 301 E. Calhoun Street Sumter, SC 29150 Phone: 778-5466 Fax: (803) 778-0923 [email protected]

LEXINGTON A CONSTRUCTIONRobert Power Resident Construction Engineer 1033 Sox Street West Columbia, SC 29171 Phone: 796-9540 Fax: (803) 796-7603 [email protected]

Robbie Isgett District Construction Engineer 1400 Shop Road Columbia, SC 29201 Phone: 737-6797 Fax: (803) 737-0057 [email protected]

Ashleigh Sandel Assistant District Construction Engineer 1400 Shop Road Columbia, SC 29201 Phone: 737-6659 Fax: (803) 737-0057 [email protected]

Robert Dickinson District Maintenance Engineer 1400 Shop Road Columbia, SC 29201 Phone: 737-6658 Fax: (803) 737-0057 [email protected]

Bruce Wells Scheduler 1400 Shop Road Columbia, SC 29201 Phone: 737-6605 Fax: (803) 737-0057 [email protected]

Jason Wolfman Asphalt Manager 1400 Shop Road Columbia, SC 29201 Phone: 737-6708 Fax: (803) 737-0057 [email protected]

Vanetta Jackson Utilities 1400 Shop Road Columbia, SC 29201 Phone: 737-6707 Fax: (803) 737-0057 [email protected]

KERSHAW MAINTENANCETom Hammond Resident Maintenance Engineer 512 South Fair Street Camden, SC 29021 Phone: 432-4358 Fax: (803) 424-0028 [email protected]

Page 46: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

46 www.scasphalt.org

South Carolina Department of Transportation

EDGEFIELD/SALUDA CONSTRUCTIONTom Dorn Resident Construction Engineer 701 N. Wise Road P.O. Box 400 Saluda, SC 29138-1029 Phone: (864) 445-3411 Fax: (864) 445-3895 [email protected]

SALUDA MAINTENANCERebecca Campbell Resident Maintenance Engineer 701 N. Wise Road P.O. Box 400 Saluda, SC 29138-1029 Phone: (864) 445-2586 Fax: (864) 445-3895 [email protected]

District 3DISTRICT THREE Stephanie Jackson-Amell District Engineering Administrator 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Dennis Garber District Construction Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

David Hebert District Construction Engineer - DB 253 South Pleasantburg Drive Greenville, SC 29608 Phone: (864) 241-1011 Fax: (864) 241-1116 [email protected]

LAURENS MAINTENANCEAdam Hedden Assist. Resident Maintenance Engineer 201 Todd Avenue Extension P.O. Box 750 Laurens, SC 29360-2673 Phone: (864) 984-7632 Fax: (864) 984-0666 [email protected]

MCCORMICK MAINTENANCETommie Parker Resident Maintenance Engineer 488 Airport Road McCormick, SC 29835-7532 Phone: (864) 852-2216 Fax: (864) 852-2323 [email protected]

NEWBERRY CONSTRUCTIONMatthew Shealy Resident Construction Engineer 203 Mount Bethel Garmany Road P.O. Box 39 Newberry, SC 29108-9299 Phone: (803) 276-4460 Fax: (803) 276-5461 [email protected]

NEWBERRY MAINTENANCEAlan Kozusko Resident Maintenance Engineer 203 Mount Bethel Garmany Road P.O. Box 39 Newberry, SC 29108-9299 Phone: (803) 276-0554 Fax: (803) 276-5461 [email protected]

EDGEFIELD MAINTENANCEClifton White Resident Maintenance Engineer 851 Hwy. 25 N Edgefield, SC 29824-4429 Phone: (803) 637-6511 Fax: (803) 637-0325 [email protected]

GREENWOOD CONSTRUCTIONPat Koone Resident Construction Engineer 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8031 Fax: (864) 227-2509 [email protected]

GREENWOOD MAINTENANCEBilly Lybrand Resident Maintenance Engineer 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8043 Fax: (864) 227-2509 [email protected]

LAURENS CONSTRUCTIONJeremy Hodges Resident Construction Engineer 201 Todd Avenue Extension P.O. Box 750 Laurens, SC 29360-2673 Phone: (864) 984-3214 Fax: (864) 984-0666 [email protected]

Jeffrey Lawson District Asphalt Manager 510 West Alexander Avenue Greenwood, SC 29646-4029 Phone: (864) 889-8018 Fax: (864) 227-6567 [email protected]

ABBEVILLE/MCCORMICK CONSTRUCTIONAdam Rich Int. Resident Construction Engineer 127 McGowan Avenue Abbeville, SC 29620-2035 Phone: (864) 366-4406 Fax: (864) 459-4975 [email protected]

ABBEVILLE MAINTENANCEMike Jones Resident Maintenance Engineer 127 McGowan Avenue Abbeville, SC 29620-2035 Phone: (864) 366-4206 Fax: (864) 366-4975 [email protected]

ANDERSON CONSTRUCTIONMike McKenzie Resident Construction Engineer 4740 Liberty Highway Anderson, SC 29621-3420 Phone: (864) 260-2211 Fax: (864) 260-2211 [email protected]

ANDERSON MAINTENANCEFritz Wewers Resident Maintenance Engineer 4740 Liberty Highway Anderson, SC 29621-3420 Phone: (864) 260-2215 Fax: (864) 260-2208 [email protected]

Page 47: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 47

SCDOT DIRECTORYSouth Carolina Department of Transportation

Jope Laws Resident Construction Engineer 8890 Fairforest Road Spartanburg, SC 29303 Phone: (864) 587-4720 Fax: (864) 587-4724 [email protected]

SPARTANBURG MAINTENANCEJames Woodward Resident Maintenance Engineer 8890 Fairforest Road Spartanburg, SC 29303 Phone: (864) 587-4725 Fax: (864) 587-4733 [email protected]

District 4DISTRICT OFFICEJohn McCarter District Engineering Administrator P.O. Box 130 Chester, SC 29706 Phone: (803) 377-4155 Fax: (803) 581-0156 [email protected]

Jason Johnston District Construction Engineer P.O. Box 130 Chester, SC 29706 Phone: (803) 377-4155 Fax: (803) 581-0156 [email protected]

Melanie Mobley Assistant District Construction Engineer P.O. Box 130 Chester, SC 29706 Phone: (803) 377-4155 Fax: (803) 581-0156 [email protected]

Wes Spencer Resident Construction Engineer 1868 Old Georgia Highway Gaffney, SC 29340 Phone: (803) 377-4155 Fax: (864) 489-9149 [email protected]

OCONEE CONSTRUCTIONJoshua Makison Resident Construction Engineer 150 Richland Road Westminister, SC 29693 Phone: (864) 647-0879 Fax: (864) 647-0885 [email protected]

OCONEE MAINTENANCEMichael Smith Resident Maintenance Engineer 150 Richland Road Westminister, SC 29693 Phone: (864) 647-0798 Fax: (864) 647-0875 [email protected]

PICKENS CONSTRUCTIONTim Callenback Resident Construction Engineer 975 Breazeale Road Post Office Box 877 Pickens SC Liberty, SC 29657 Phone: (864) 859-0034 Fax: (864) 859-6054 [email protected]

PICKENS MAINTENANCESteven Henderson Resident Maintenance Engineer 975 Breazeale Road Liberty, SC 29657 Phone: (864) 859-0039 Fax: (864) 859-6054 [email protected]

SPARTANBURG CONSTRUCTIONTodd Carroll Resident Construction Engineer 8890 Fairforest Road Spartanburg, SC 29303 Phone: (864) 587-4722 Fax: (864) 587-0649 [email protected]

Ryan Dannelly Contract Manager 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Dana Lowery District Traffic Operations Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

George Radler District Traffic Signal Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

GREENVILLE CONSTRUCTIONKimberly Bishop Resident Construction Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1120 Fax: (864) 241-1069 [email protected]

Ben Olson Resident Construction Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1030 Fax: (864) 241-1120 [email protected]

GREENVILLE MAINTENANCERandy Russell Interim Resident Maintenance Engineer 13 Saluda Dam Road Greenville, SC 29611 Phone: (864) 241-1224 Fax: (864) 295-8347 [email protected]

Patrick McKenzie Assistant District Construction Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Tony Thompson District Maintenance Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Eric Dillon District Traffic Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Jeff Jordan Scheduler 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Robert Ryggs Utility Coordinator 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Wofford Green District Mechanical Engineer 252 South Pleasantburg Drive Greenville, SC 29607 Phone: (864) 241-1010 Fax: (864) 241-1115 [email protected]

Page 48: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

48 www.scasphalt.org

South Carolina Department of Transportation

District 5DISTRICT OFFICEKyle Berry District Engineering Administrator P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4710 Fax: (843) 661-4704 [email protected]

Ray George District Maintenance Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4710 Fax: (843) 661-4704 [email protected]

David Johnson District Construction Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4710 Fax: (843) 661-4704 [email protected]

Jason Thompson District Construction Engineer P.O. Box 1912 Florence, SC 29504 Phone: (843) 661-4711 Fax: (843) 661-4705 [email protected]

DISTRICT OFFICEPhilip Smith District Mechanical Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4710 Fax: (843) 661-4704 [email protected]

Michael Bethea District Traffic Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4710 Fax: (843) 661-4704 [email protected]

LANCASTER CONSTRUCTIONKen Wilson Resident Construction Engineer 1730 Pageland Highway Lancaster, SC 29720 Phone: (803) 286-4607 Fax: (803) 285-1461 [email protected]

LANCASTER MAINTENANCEJohnny McKay Resident Maintenance Engineer 1730 Pageland Highway Lancaster, SC 29720 Phone: (803) 283-3397 Fax: (803) 285-6990 [email protected]

UNION MAINTENANCEPhillip Hinson Resident Maintenance Engineer 1450 Furman Fendley Highway Union, SC 29379 Phone: (864) 427-3575 Fax: (864) 429-9039 [email protected]

YORK CONSTRUCTIONJohn Huskins Resident Construction Engineer 338 Robertson Road W Rock Hill, SC 29730 Phone: (803) 324-3545 Fax: (803) 324-3549 [email protected]

YORK MAINTENANCEClint Beaver Resident Maintenance Engineer 338 Robertson Road W Rock Hill, SC 29730 Phone: (803) 327-6186 Fax: (803) 327-6184 [email protected]

CHESTER/FAIRFIELD CONSTRUCTIONJeremiah Bradley Resident Construction Engineer 1143 SCDOT Road Chester, SC 29706 Phone: (803) 581-8008 Fax: (803) 581-2344 [email protected]

CHESTER MAINTENANCEFreddie Jackson Resident Maintenance Engineer 1143 SCDOT Road Chester, SC 29706 Phone: (803) 377-8101 Fax: (803) 581-8067 [email protected]

CHESTERFIELD CONSTRUCTIONGreg Williams Resident Construction Engineer 301 Laney Street Chesterfield, SC 29709 Phone: (843) 623-8988 Fax: (843) 623-3939 [email protected]

CHESTERFIELD MAINTENANCEKent Wagner Resident Maintenance Engineer 404 East Boulevard Chesterfield, SC 29709 Phone: (843) 623-2543 Fax: (843) 623-3734 [email protected]

FAIRFIELD MAINTENANCEJamie Johnston Resident Maintenance Engineer 1213 Kincaid Bridge Road Winnsboro, SC 29180 Phone: (803) 635-4222 Fax: (803) 635-2485 Johnston [email protected]

Tom Gaines Pavement Manager P.O. Box 130 Chester, SC 29706 Phone: (803) 377-4155 Fax: (803) 581-0156 [email protected]

Jamie Fowler Utility Coordinator P.O. Box 130 Chester, SC 29706 Phone: (803) 377-4155 Fax: (803) 581-0156 [email protected]

Andy Gaskins District Asphalt Manager P.O. Box 130 Chester, SC 29706 Phone: (843) 623-6988 Fax: (843) 623-3939 [email protected]

Raymond Cheek Assistant District Asphalt Manager P.O. Box 130 Chester, SC 29706 Phone: (864) 489-5760 Fax: (864) 489-9149 [email protected]

CHEROKEE/UNION CONSTRUCTIONShane Parris Special Projects Engineer 1868 Old Georgia Highway Gaffney, SC 29340 Phone: (864) 489-5760 Fax: (864) 489-9149 [email protected]

CHEROKEE MAINTENANCEStephen Ellis Resident Maintenance Engineer 1868 Old Georgia Highway Gaffney, SC 29340 Phone: (864) 489-2844 Fax: (864) 487-5592 [email protected]

Page 49: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 49

SCDOT DIRECTORYSouth Carolina Department of Transportation

WILLIAMSBURG MAINTENANCERichard Livingston Resident Maintenance Engineer P.O. Box 180 Kingstree, SC 29556 Phone: (843) 354-7491 Fax: (843) 354-6927 [email protected]

District 6DISTRICT OFFICERobert Clark District Engineering Administrator 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6714 Fax: (843) 740-1663 [email protected]

Kevin Turner District Construction Engineer 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6726 Fax: (843) 740-1663 [email protected]

Timothy Henderson District Construction Engineer 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6727 Fax: (843) 740-1663 [email protected]

Mike Black District Maintenance Engineer 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6715 Fax: (843) 740-1663 [email protected]

HORRY CONSTRUCTIONSPECIAL PROJECTSTravis Patrick Resident Construction Engineer P.O. Box 1663 Conway, SC 29528 Phone: (843) 365-2106 Fax: (843) 661-4704 [email protected]

HORRY MAINTENANCEShannon Welch Resident Maintenance Engineer P.O. Box 1663 Horry, SC 29442 Phone: (843) 365-2130 Fax: (843) 365-0338 [email protected]

MARION CONSTRUCTIONKen Hayes Resident Construction Engineer P.O. Box 986 Marion, SC 29571 Phone: (843) 431-1135 Fax: (843) 431-1134 [email protected]

MARION MAINTENANCEHarold Coleman Resident Maintenance Engineer P.O. Box 986 Marion, SC 29571 Phone: (843) 431-1130 Fax: (843) 431-1134 [email protected]

MARLBORO MAINTENANCERobert Bean Resident Maintenance Engineer P.O. Box 180 Bennettsville, SC 29512 Phone: (843) 479-4161 Fax: (843) 479-4107 [email protected]

FLORENCE/WILLIAMSBURG CONSTRUCTIONWill Fulton Resident Construction Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 661-4730 Fax: (843) 661-4779 [email protected]

FLORENCE MAINTENANCEEric Minshew Resident Maintenance Engineer P.O. Box 1911 Florence, SC 29503 Phone: (843) 393-6171 Fax: (843) 661-4779 [email protected]

GEORGETOWN CONSTRUCTIONKitt Scott Resident Construction Engineer P.O. Box 593 Georgetown, SC 29440 Phone: (843) 527-6719 Fax: (843) 527-6819 [email protected]

GEORGETOWN MAINTENANCERichard Pope Resident Maintenance Engineer P.O. Box 1009 Georgetown, SC 29442 Phone: (843) 546-2405 Fax: (843) 546-2406 [email protected]

HORRY CONSTRUCTIONAnna Levy Resident Construction Engineer P.O. Box 1663 Horry, SC 29442 Phone: (843) 365-2106 Fax: (843) 365-0338 [email protected]

DARLINGTON CONSTRUCTIONPhilip Bethea Scheduler P.O. Box 1912 Florence, SC 29504 Phone: (843) 661-4711 Fax: (843) 661-4705 [email protected]

Trey Parnell Resident Construction Engineer P.O. Box 494 Darlington, SC 29531 Phone: (843) 393-6170 Fax: (843) 395-5957 [email protected]

DARLINGTON MAINTENANCERoy Parnell Resident Maintenance Engineer P.O. Box 495 Darlington, SC 29532 Phone: (843) 393-6171 Fax: (843) 395-5958 [email protected]

DILLON/MARLBORO CONSTRUCTIONScott Ward Resident Construction Engineer P.O. Box 1009 Dillon, SC 29536 Phone: (843) 774-7979 Fax: (843) 774-7377 [email protected]

DILLON MAINTENANCEMitchell Carter Resident Maintenance Engineer P.O. Box 1009 Dillon, SC 29535 Phone: (843) 774-7376 Fax: (843) 774-7377 [email protected]

Page 50: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

50 www.scasphalt.org

South Carolina Department of Transportation

SPECIALIZED BRIDGE MAINTENANCE DIVISIONJonathan Gilmore Resident Maintenance Engineer 2695 Rourk Street North Charleston, SC 29406 Phone: (843) 740-1695 Fax: (843) 740-1696 [email protected]

District 7DISTRICT OFFICEBryan Jones District Engineering Administrator 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

Efrem Dantzler District Maintenance Engineer 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

Ems Baskin District Traffic Engineer 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

Charles Jones District Mechanical Engineer 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

COLLETON BRIDGE CONSTRUCTIONKeith Green Resident Construction Engineer 6355 Fain Street, Bldg. E North Charleston, SC 29406 Phone: (843) 746-7902 Fax: (843) 746-7902 [email protected]

COLLETON MAINTENANCEAdam Bishop Resident Maintenance Engineer 593 Sniders Hwy. Walterboro, SC 29488 Phone: (843) 538-8031 Fax: (843) 538-3878 [email protected]

DORCHESTER CONSTRUCTIONBehling Guess Resident Construction Engineer 107 West 6th North Street Suite 206 Summerville, SC 29483 Phone: (843) 873-5763 Fax: (843) 851-5848 [email protected]

DORCHESTER MAINTENANCEDavid Pilch Resident Maintenance Engineer 5225 Jim Bilton Boulevard St. George, SC 29477 Phone: (843) 563-3451 Fax: (843) 563-5497 [email protected]

JASPER MAINTENANCEMalzone Russell Resident Maintenance Engineer 150 E. Woodlawn Street Ridgeland, SC 29936 Phone: (843) 726-3431 Fax: (843) 726-4069 [email protected]

BERKELEY MAINTENANCECraig Brown Resident Maintenance Engineer P.O. Box 698 Moncks Corner, SC 29461 Phone: (843) 761-8481 Fax: (843) 761-5100 [email protected]

CHARLESTON BRIDGE CONSTRUCTIONJeff Rajabi Resident Construction Engineer 6355 Fain Street, Bldg. E North Charleston, SC 29406 Phone: (843) 746-7900 Fax: (843) 746-7903 [email protected]

CHARLESTON CONSTRUCTION AJohn Paulus Resident Construction Engineer 3525 Pinehaven Drive Charleston Heights, SC 29415 Phone: (843) 740-1685 Fax: (843) 740-1689 [email protected]

CHARLESTON CONSTRUCTION BRickie Green Resident Construction Engineer 3525 Pinehaven Drive Charleston Heights, SC 29415 Phone: (843) 740-6143 Fax: (843) 740-1561 [email protected]

CHARLESTON MAINTENANCERoger Bowers Resident Maintenance Engineer 2401 Maintenance Way North Charleston, SC 29406 Phone: (843) 740-1655 Fax: (843) 740-1548 [email protected]

Brian Holt District Traffic Engineer 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6718 Fax: (843) 740-1663 [email protected]

DISTRICT ASPHALT MANAGEMENTAbolfazl Rajabi Asphalt Manager 6355 Fain Street, Bldg. A North Charleston, SC 29406 Phone: (843) 746-6744 Fax: (843) 740-1663 [email protected]

DISTRICT 6 SCHEDULINGMichele Reece Scheduler 107 West 6th North Street Suite 206 Summerville, SC 29483 Phone: (843) 873-5763 Fax: (843) 851-5848 [email protected]

BEAUFORT CONSTRUCTIONToby Wickenhoefer Resident Construction Engineer 13 Munch Drive Beaufort, SC 29906 Phone: (843) 524-7616 Fax: (843) 524-1757 [email protected]

BEAUFORT MAINTENANCEWendell Mulligan Resident Maintenance Engineer 13 Munch Drive Beaufort, SC 29906 Phone: (843) 524-7255 Fax: (843) 524-3478 [email protected]

Page 51: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 51

SCDOT DIRECTORYSouth Carolina Department of Transportation

David Cook State Maintenance Engineer 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

Mark Hunter Asst. State Maintenance Engineer 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

James (Jim) Johannemann Asst. State Maintenance Engineer 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

Walter Reed Asst. State Maintenance Engineer 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

Richard (Lee) Floyd State Maintenance Bridge Engr. 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

Mark Kwayisi Asst. State Maint. Bridge Engineer 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

Tim Hunter Environmental Liasion 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

CALHOUN MAINTENANCELyle Davis Resident Maintenance Engineer 415 Chestnut Street Suite 1 P.O. Box 406 St. Matthews, SC 29135 Phone: (803) 874-3231 Fax: (803) 874-3232 [email protected]

CLARENDON CONSTRUCTIONScott McElveen Resident Construction Engineer 325 E. Boyce Street Manning, SC 29102 Phone: (803) 435-4431 Fax: (803) 435-0581 [email protected]

CLARENDON MAINTENANCEColey Holladay Resident Maintenance Engineer 325 E. Boyce Street Manning, SC 29102 Phone: (803) 435-4431 Fax: (803) 435-0581 [email protected]

HAMPTON MAINTENANCEJack Priester Resident Maintenance Engineer 65 Cemetery Road P.O. Box 278 Hampton, SC 29924 Phone: (803) 943-3721 Fax: (803) 943-5089 [email protected]

SCDOT MaintenanceMAINTENANCEJames (Jim) Feda Director Of Maintenance 955 Park Street, Rm. 324 Columbia, SC 29201 Phone: (803) 737-1290 Fax: (803) 737-2850 [email protected]

ALLENDALE MAINTENANCELoraine Williams Resident Maintenance Engineer 264 E. Gum Street Allendale, SC 29810 Phone: (803) 584-3465 Fax: (803) 584-3466 [email protected]

ALLENDALE/BAMBERG/BARNWELL/HAMPTON CONSTRUCTIONThomas Guest Resident Construction Engineer 462 S. Main Street P.O. Box 545 Bamberg, SC 29003 Phone: (803) 245-5181 Fax: (803) 245-5182 [email protected]

BAMBERG MAINTENANCEBobby Crider Resident Maintenance Engineer 462 S. Main Street P.O. Box 545 Bamberg, SC 29003 Phone: (803) 245-5181 Fax: (803) 245-5182 [email protected]

BARNWELL MAINTENANCEStanley Holladay Resident Maintenance Engineer 2000 Fuller Street P.O. Box 366 Barnwell, SC 29812 Phone: (803) 259-1141 Fax: (803) 259-1142 [email protected]

CALHOUN/ORANGEBURG CONSTRUCTIONDarryl Kennerly Resident Construction Engineer 1746 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6877 Fax: (803) 531-6865 [email protected]

Jim Porth District Construction Engineer 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

Jeff Terry Assistant District Construction Engineer 1725 Charleston Highway P.O. Box 1087 Orangeburg, SC 29117 Phone: (803) 531-6851 Fax: (803) 531-6855 [email protected]

Jeff Smith Scheduler 1724 Charleston Highway P.O. Box 1086 Orangeburg, SC 29116 Phone: (803) 531-6850 Fax: (803) 531-6854 [email protected]

AIKEN CONSTRUCTIONBobby Usry Resident Construction Engineer 1931 University Parkway P.O. Box 2010 Aiken, SC 29802 Phone: (803) 641-7660 Fax: (803) 641-7638 [email protected]

AIKEN MAINTENANCEJoe Winfield Resident Maintenance Engineer 1931 University Parkway P.O. Box 2010 Aiken, SC 29802 Phone: (803) 641-7665 Fax: (803) 641-7667 [email protected]

Page 52: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

52 www.scasphalt.org

Federal Highway Administration

Carolyn Fisher Operations Engineer 765-5464 [email protected]

Ken Johnson Structural Engineer 253-3880 [email protected]

Dan Hinton Safety and Traffic Operations Engineer 253-3887 [email protected]

Jim Garling Pavement, Materials, Research and Technology Engineer 253-3883 [email protected]

Rickele Gennie Operations Engineer 253-3295 [email protected]

Michelle Herrell Environmental Protection Specialist (803) 765-5460 [email protected]

Emily Lawton Division Administrator 253-3908

Bob Thomas Assistant Division Administrator 765-5282 [email protected]

Jeannie Moore Administrative Officer 253-3876 [email protected]

Thava Overstreet Administrative Assistant 765-5412 [email protected]

Lou Burch Management Analyst 253-3886 [email protected]

Bryan Smith Financial Manager 765-5331 [email protected]

Lindsay Sherbert Financial Specialist 253-3381 [email protected]

Pamela Foster Civil Rights Officer 253-3879 [email protected]

Jessica Hekter Community Planner/ Realty Manager 765-5458 [email protected]

Shane Belcher Environmental Coordinator 253-3187 [email protected]

Yolanda Morris Community Planner 253-3877 [email protected]

Steve Ikerd Director of Engineering and Operations 253-3885 [email protected]

Thaddeus Kitowicz Operations Team Leader 253-3882 [email protected]

Alice Travis Operation Engineer 253-3881 [email protected]

Federal Highway Administration (FHWA) South Carolina Division

Strom Thurmond Federal Building 1835 Assembly St., Suite. 1270

Columbia, SC 29201 Phone: (803) 765-5411

Fax: (803) 253-3989

Page 53: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 53

Federal Aviation Administration, Southern Region

FEDERAL DIRECTORY

Anthony Cochran Regional Paving Engineer (404) 305-5000

Dennis Roberts So. Region Regional Administrator (404) 305-5000

Pearlis Johnson So. Region Deputy Regional Administrator (404) 305-5000

Federal Aviation Administration Southern Region Regional Office 1701 Columbia Ave., Suite 2-260

College Park, GA 30337 Box 20636, Atlanta, GA 30320

Phone: (404) 305-6700 Fax: (404) 305-6730

www.faa.gov

Larry Clark Manager Atlanta Airport District Office (404) 305-7150

William Garrison ADO Assistant Manager (404) 305-7150

Federal Aviation Administration Southern Region Atlanta Airports District Office

1701 Columbia Ave., Suite 2-260 College Park, GA 30337 Phone: (404) 305-7150

Fax: (404) 305-7155 www.faa.gov

Page 54: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

54 www.scasphalt.org

Naval Facilities Engineering Command, Southern Division

Capt. Patrick Garin Commanding Officer/Regional Engineer

Capt. Drew Hascall Executive Officer/ Deputy Regional Engineer

Department of the Navy Naval Facilities Engineering Command Southeast

Building 903 Naval Air Station

Jacksonville, FL 32212-0030

Box 30 Naval Air Station

Jacksonville, FL 32212-0030

Phone: (904) 542-6633 Fax: (904) 542-6634

www.navfac.navy.mil

Page 55: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 55

U.S. SenateTHE HONORABLE TIM SCOTT UNITED STATES SENATORWashington, DC Office 520 Hart Senate Office Building Washington, DC 20510 Phone: (202) 224-6121 Fax: (202) 228-5143 www.scott.senate.gov

North Charleston Office 2500 City Hall Lane 3rd Floor Suite North Charleston, SC 29406 Phone: (843) 727-4525 Fax: (855) 802-9355

Columbia Office 1301 Gervais St., Suite 825 Columbia, SC 29201 Phone: (803) 771-6112 Fax: (855) 802-9355

Greenville Office 104 South Main St., Suite 803 Greenville, SC 29601 Phone: (864) 233-5366 Fax: (855) 802-9355

THE HONORABLE LINDSEY GRAHAM UNITED STATES SENATORWashington, DC Office 290 Russell Senate Office Building Washington, DC 20510 Phone: (202) 224-5972 Fax: (202) 224-3808 www.lgraham.senate.gov

Upstate Regional Office 130 South Main St., 7th Floor Greenville, SC 29601 Phone: (864) 250-1417 Fax: (864) 250-4322

Midlands Regional Office 508 Hampton St., Suite 202 Columbia, SC 29201 Phone: (803) 933-0112 Fax: (803) 933-0957

Pee Dee Regional Office McMillan Federal Building 401 West Evans St., Suite 111 Florence, SC 29501 Phone: (843) 669-1505 Fax: (843) 669-9015

Lowcountry Regional Office 530 Johnnie Dodds Blvd. Suite 202 Mt. Pleasant, SC 29464 Phone: (843) 849-3887 Fax: (843) 971-3669

Piedmont Regional Office 235 East Main St., Suite 100 Rock Hill, SC 29730 Phone: (803) 366-2828 Fax: (803) 366-5353

Golden Corner Regional Office 124 Exchange St., Suite A Pendleton, SC 29670 Phone: (864) 646-4090 Fax: (864) 646-8609

U.S. House of Representatives

DISTRICT ONE THE HONORABLE MARK SANFORD2201 Rayburn House Office Building Washington, DC 20515 Phone: (202) 225-3176 www.sanford.house.gov

530 Johnnie Dodds Blvd. Suite 201 Mount Pleasant, SC 29464 Phone: (843) 352-7572 Fax: (843) 352-7620

710 Boundary St., Suite 1D (P.O. Box 1538) Beaufort, SC 29902 Phone: (843) 521-2530 Fax: (843) 521-2535

DISTRICT TWO THE HONORABLE ADDISON G. “JOE” WILSON2229 Rayburn House Office Building Washington, DC 20515 Phone: (202) 225-2452 Fax: (202) 225-2455 www.joewilson.house.gov

1700 Sunset Blvd. (US 378) Suite 1 West Columbia, SC 29169 Phone: (803) 939-0041 Fax: (803) 939-0078

1930 University Pkwy. Aiken, SC 29801 Phone: (803) 642-6416 Fax: (803) 642-6418

Congressional DelegationFEDERAL DIRECTORY

Page 56: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

56 www.scasphalt.org

Congressional Delegation

1225 Lady St., Suite 200 Columbia, SC 29201 Phone: (803) 799-1100 Fax: (803) 799-9060

130 West Main St. Kingstree, SC 29556 Phone: (843) 355-1211 Fax: (843) 355-1232

176 Brooks Blvd. Santee, SC 29142 Phone: (803) 854-4700 Fax: (803) 854-4900

DISTRICT SEVEN THE HONORABLE TOM RICE, JR.223 Cannon House Office Building Washington, DC 20515 Phone: (202) 225-9895 Fax: (202) 225-9690 www.rice.house.gov

2411 North Oak St., Suite 405 Myrtle Beach, SC 29577 Phone: (843) 445-6459 Fax: (843) 445-6418

1831 West Evans St., Suite 300 Florence, SC 29501 Phone: (843) 679-9781 Fax: (843) 679-9783

DISTRICT FIVE THE HONORABLE JOHN MICHAEL “MICK” MULVANEY1201 Longworth House Office Building Washington, DC 20515 Phone: (202) 225-5501 Fax: (202) 225-0464

1456 Ebenezer Rd. Rock Hill, SC 29340 Phone: (803) 327-1114 Fax: (803) 327-4330 www.mulvaney.house.gov

110 Railroad Ave. Gaffney, SC 29732 Phone: (864) 206-6004 Fax: (864) 206-6005

531 A-Oxford Dr. Sumter, SC 29150 Phone: (803) 774-0186 Fax: (803) 774-0188

DISTRICT SIX THE HONORABLE JAMES E. “JIM” CLYBURN242 Cannon House Office Building Washington, DC 20515 Phone: (202) 225-3315 Fax: (202) 225-2313 www.clyburn.house.gov

DISTRICT THREE THE HONORABLE JEFFREY D. DUNCAN106 Cannon House Office Building Washington, DC 20515 Phone: (202) 225-5301 Fax: (202) 225-3216 www.jeffduncan.house.gov

303 West Beltine Blvd. Anderson, SC 29625 Phone: (864) 224-7401 Fax: (864) 225-7049

200 Courthouse Public Sq. (PO Box 471) Laurens, SC 29360 Phone: (864) 681-1028 Fax: (864) 681-1030

DISTRICT FOUR THE HONORABLE HAROLD WATSON “TREY” GOWDY III1404 Longworth House Office Building Washington, DC 20515 Phone: (202) 225-6030 Fax: (202) 226-1177 www.gowdy.house.gov

104 South Main St. Greenville, SC 29601 Phone: (864) 241-0175 Fax: (864) 241-0982

101 West St. John St. Spartanburg, SC 29306 Phone: (864) 583-3264 Fax: (864) 583-3296

Page 57: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 57

Civil Engineering Faculties EDUCATION DIRECTORY

Dr. John A. Murden Structures, Experimental Methods & System Modeling (843) 953-7684 [email protected]

Dr. Mary Katherine Watson Sustainable Engineering, Environmental Engineering [email protected]

Dr. Michael H. Woo Water Resources, Fluid Mechanics (843) 953-7679 [email protected]

Dr. Kevin C. Bower Department Head, Environmental, Water and Wastewater Treatment (843) 953-7683 [email protected]

Dr. W. Jeff Davis Transportation and Highways, Infrastructure Management (843) 953-7687 [email protected]

Dr. Dennis J. Fallon Structures, Engineering Management (843) 953-5454 [email protected]

Dr. Simon Ghanat Geotechnical Earthquake Engineering, Engineering Education [email protected]

Dr. J. Michael Grayson Resilient and Sustainable Infrastructure [email protected]

Dr. Timothy W. Mays Structures (843) 953-7678 [email protected]

Dr. Dimitra Michalaka Transportation Engineering Dimitra.Michalaka@ citadel.edu

The Citadel Civil and Environmental Engineering Department

LeTellier Hall Charleston, SC 29409

Phone: (843) 953-5083 Fax: (843) 953-6328

www.citadel.edu

Page 58: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

58 www.scasphalt.org

Civil Engineering Faculties

Dr. Ashok Mishra Applied Hydraulics (864) 656-1209 [email protected]

Dr. Bryant G. Nielson Structures (864) 656-3312 [email protected]

Dr. Jennifer Ogle Transportation Engineering (864) 656-0883 ogle.clemson.edu

Dr. Wei Chiang Pang Structures (864) 656-0114 [email protected]

Dr. Kalyan R. Piratla Construction Engineering and Management (864) 656-3324 [email protected]

Dr. Amir Poursaee Construction Materials (864) 656-3323 [email protected]

Dr. Bradley J. Putman Construction Materials (864) 656-0374 [email protected]

Dr. James R. Martin Chair and Professor, Geotechnical Engineering (864) 656-3002

Dr. Ronald D. Andrus Professor & Associate Chair, Geotechnical Engineering (864) 656-0488 [email protected]

Dr. Sez Atamturktur Structures (864) 656-3003 [email protected]

Dr. Nadim. M. Aziz Environmental Fluid Mechanics (864) 656-3661 [email protected]

Dr. James L. Burati, Jr. Construction Engineering and Management (864) 656-3315 [email protected]

Dr. Kapil Chalil Madathil Risk Engineering (864) 656-0856 [email protected]

Dr. Qiushi Chen Geotechnical Engineering (864) 656-3330 [email protected]

Dr. Mashur “Ronnie” Chowdhury Transportation Engineering (864) 656-3313 [email protected]

Dr. Thomas E. Cousins Structures (864) 656-2291 [email protected]

Prof. Stephen F. Csernak Structures (864) 656-3317 [email protected]

Dr. C. Hsein Juang Geotechnical Engineering (864) 656-3322 [email protected]

Dr. Nigel B. Kaye Applied Fluid Mechanics (864) 656-5941 [email protected]

Dr. Abdul A. Khan Applied Fluid Mechanics (864) 656-3327 [email protected]

Dr. Amy Landis Sustainable Engineering (864) 656-0484 [email protected]

Clemson University Glenn Department of Civil Engineering

Lowry Hall Clemson, SC 29634

Phone: (864) 656-3000 Fax: (864) 656-2670 www.clemson.edu

Page 59: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 59

EDUCATION DIRECTORYCivil Engineering Faculties

Dr. Ismail Farajpour Assistant Professor (803) 536-7081 [email protected]

Dr. Stanley Ihekweazu Chairperson (803) 536-7117 [email protected]

Dr. Di-Wen Chen Associate Professor (803) 536-4631 [email protected]

South Carolina State University Department of Civil and Mechanical Engineering Technology

300 College St. NE Orangeburg, SC 29117 Phone: (803) 536-8863

www.scsu.edu

Dr. Prasad Rao Rangaraju Construction Materials (864) 656-1241 [email protected]

Dr. N. “Ravi” Ravichandran Geotechnical Engineering (864) 656-2818 [email protected]

Dr. Brandon Ross Structures (864) 656-3401 [email protected]

Dr. Wayne Sarasua Transportation Engineering (864) 656-3318 [email protected]

Prof. Melissa Sternhagen Structures (864) 656-6428 [email protected]

Page 60: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

60 www.scasphalt.org

Civil Engineering Faculties

Dr. Michael E. Meadows Water Resources Engineer (803) 777-3614 [email protected]

Dr. Charles E. Pierce Geotechnical Engineer (803) 777-3855 [email protected]

Dr. Dimitris C. Rizos Structures (803) 777-6166 [email protected]

Dr. Inthuorn Sasanakul Geotechnical Engineer (803) 777-7160 [email protected]

Dr. Enrica Viparelli Water Resources Engineer (803) 777-7086 [email protected]

Dr. Yeomin Yoon Environmental Engineer (803) 777-8952 [email protected]

Dr. Paul Ziehl Structures (803) 777-4030 [email protected]

Dr. Robert Mullen Department Chair (803) 777-3614 [email protected]

Dr. Ronald L. Baus Geotechnical Engineer (803) 777-7160 [email protected]

Dr. Nicole D. Berge Environmental Engineer (803) 777-7521 [email protected]

Dr. J. Hugh Bradburn Professor Emeritus (803) 777-3700 [email protected]

Dr. Juan M. Caicedo Structural Engineer (803) 777-1925 [email protected]

Dr. M. Hanif Chaudhry Water Resources Engineer (803) 777-8318 [email protected]

Dr. John R. Dickerson Professor Emeritus (803) 467-2335 [email protected]

Dr. Joseph R.V. Flora Environmental Engineer (803) 777-8954 [email protected]

Dr. Sarah L. Gassman Geotechnical Engineer (803) 777-8160 [email protected]

Dr. Shamia Hoque Environmental and Fluids (803) 777-2288 [email protected]

Dean Wilfred Kenneth Humphries Dean Emeritus, Professor Emeritus

Dr. Nathan Huynh Transportation Engineer (803) 777-8947 [email protected]

Dr. Jasim Imran Water Resources Engineer (803) 777-1210 [email protected]

Dr. Fabio Matta Structures (803) 777-1917 [email protected]

Dr. A. Steve McAnally Environmental Engineer (803) 777-7400 [email protected]

University of South Carolina Department of Civil and Environmental Engineering

Swearingen Engineering Annex Center 300 Main Street

Columbia, SC 29208 Phone: (803) 777-3614

Fax: (803) 777-0670 www.sc.edu

Page 61: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 61

Technical College Engineering/ Certification Programs

Mr. Mohsen Lari Faculty (803) 691-3839 [email protected]. Eyma Yara Marrero-Alfonso Faculty (803) 691-3898 [email protected]. Ivelisse Ortiz-Hernandez CET Academic Program Coordinator (803) 691-3901 ortizhernandez@ midlandstech.eduMr. Keith Quigley Faculty (803) 691-3838 [email protected]

Dr. Clint Chandler Department Chair (803) 691-3877 chandlerc@ midlandstech.eduMr. Floyd Bowles Program Coordinator (803) 691-3839 [email protected]. Christy Buchanan Faculty (803) 691-3835 buchananc@ midlandstech.eduMr. Benjamin Gaston Faculty (803) 691-3837 [email protected]

Mr. Wiley Graf Faculty (803) 691-3833 [email protected]. Sean Higgins Faculty (803) 691-3836 [email protected]. Barbara Hurley Faculty (803) 691-3884 [email protected]. Richard Hurst Program Coordinator (803) 691-3897 [email protected]

Midlands Technical College Engineering Technology and Science

151 Powell Road Columbia, SC 29203

Phone: (803) 691-3832 Fax: (803) 691-3895

www.midlandstech.edu

EDUCATION DIRECTORY

Page 62: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

62 www.scasphalt.org

Technical College Engineering/Certification Programs

Myrtle Mraovich Training Coordinator (864) 646-2045 [email protected]

Richard Cothran Dean (864) 646-1701 [email protected]

Mary Corley Program Director (864) 646-2047 [email protected]

Tri-County Technical College Corporate & Community Education Division

P.O. Box 587 7900 Highway 76

Pendleton, SC 29670 Phone: (864) 646-1894

www.tctc.edu/scdot

Page 63: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 63

Found An Error? Update?We have made every effort to ensure the information in this directory is correct. Errors do happen though and we would appreciate your bringing it to our attention by returning this form with the correct information.

Company Name: _______________________________________________________________

Mailing Address: _______________________________________________________________

Physical Address: ______________________________________________________________

Phone Number: _______________________________________________________________

Fax Number: __________________________________________________________________

Tell us what we need to add, delete or correct and provide a contact name.

Please return to: South Carolina Pavement Association

P.O. Box 11448 Columbia, SC 29211

Or fax to: (803) 403-9952

Or email: [email protected]

RESOURCES

Page 64: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

64 www.scasphalt.org

Yes, I want to join the South Carolina Asphalt Pavement Association (SCAPA) and have a role in the collective effort to promote our industry.

NAME _______________________________________________________________

FIRM ________________________________________________________________

MAIL ________________________________________________________________

CITY ______________________________ ZIP ______________________________

PHONE ___________________________ FAX ______________________________

MEMBERSHIP CATEGORY:

_____ CONTRACTOR _____ ASSOCIATE

PLEASE RETURN MEMBERSHIP APPLICATION TO:

SC Asphalt Pavement Association P.O. Box 11448

Columbia, SC 29211

To learn more about SCAPA, please telephone the association’s office at (803) 252-2522.

A portion of your dues are tax-deductible.

Membership Application

Page 65: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 65

Metric Conversion Cards

Inch

es

1 2

3 Ce

ntim

eter

s 1

23

45

67

8

in

inch

es

ft fe

et

yd

yard

s m

i m

iles

2.5

cent

imet

ers

cm

ce

ntim

eter

s cm

0.

9 m

eter

s m

1.

6 kil

omet

ers

km

LENG

TH

in2

squa

re in

ches

ft2

squa

re fe

et

yd2

squa

re ya

rds

mi2

squa

re m

iles

acre

s

6.5

squa

re ce

ntim

eter

s cm

2 0.

09

squa

re m

eter

s m

2 0.

8 sq

uare

met

ers

m2

2.6

kilom

eter

s km

2 0.

4 he

ctar

es

ha

AREA

oz

ounc

es

Ib

poun

ds

shor

t ton

s

gr

ams

g 0.

45

kilog

ram

s kg

0.

9 m

etric

ton

t

MAS

S we

ight

)

(200

0 Ib)

°F

degr

ees

Fahr

enhe

it

degr

ees

°C

Ce

lsius

TEM

PERA

TURE

exa

ct)

(- 32)

x 5/

9

tsp

teas

poon

s Tb

sp t

ables

poon

s in

3 cu

bic i

nche

s fl

oz

fluid

ounc

es

c

cups

pt

pi

nts

qt

quar

ts ga

l ga

llons

ft3

cu

bic f

eet

yd3

cubi

c yar

ds

5 m

illili

ters

mL

m

illili

ters

mL

m

illili

ters

mL

m

illili

ters

mL

0.24

lit

ers

L 0.

47

liter

s L

0.95

lit

ers

L 3.

8 lit

ers

L 0.

03

cubi

c met

ers

m3

0.76

cu

bic m

eter

s m

3

VOLU

ME

SYM

BOL

MEA

SURE

MUL

TIPL

Y BY

TO FI

ND

SYM

BOL

C°C°

-40

8012

016

020

040

0

-40

-20

020

4060

8010

0

°F32

98.6

°F

37

212

30 28 15

16

30

Appr

oxim

ate C

onve

rsion

s to M

etric

Mea

sure

s

mm

m

illim

eter

s cm

ce

ntim

eter

s m

m

eter

s m

m

eter

s km

kil

omet

ers

0.04

in

ches

in

0.

4 in

ches

in

3.

3 fe

et

ft 1.

1 ya

rds

yd

0.6

mile

s m

i

cm2

squa

re ce

ntim

eter

s m

2 sq

uare

met

ers

km2

squa

re ki

lom

eter

s ha

he

ctar

es

0.16

sq

uare

inch

es

in2

1.2

squa

re ya

rds

yd2

0.4

squa

re m

iles

mi2

2.5

acre

s

(10 0

00 m

2 )

g

gram

s kg

kil

ogra

ms

t

met

ric to

n

0.035

oun

ces

oz

2.2

poun

ds

Ib

1.1

shor

t ton

s(1

000 k

g)

°C

degr

ees

Celsi

us

degr

ees

°F

Fa

hren

heit

mL

mill

ilite

rs m

L m

illili

ters

L

liter

s L

lit

ers

L

liter

s m

3 cu

bic m

eter

s m

3 cu

bic m

eter

s

0.03

fluid

ounc

es

fl oz

0.

06

cubi

c inc

hes

in3

2.1

pint

s pt

1.

06

quar

ts qt

0.

26

gallo

ns

gal

cu

bic f

eet

ft3

1.3

cubi

c yar

ds

yd3

Appr

oxim

ate C

onve

rsion

s fro

m M

etric

Mea

sure

s

LENG

TH

AREA

MAS

S we

ight

)

TEM

PERA

TURE

exa

ct)

VOLU

ME

35

(× 9/

5) +

32

SYM

BOL

MEA

SURE

MUL

TIPL

Y BY

TO FI

ND

SYM

BOL

Page 66: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

66 www.scasphalt.org

2017 - 2018 Calendar2017/2018 Calendar

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

JANUARY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

FEBRUARY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

MARCH S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23/30 24 25 26 27 28 29

APRIL

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

MAY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

JUNE S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23/30 24/31 25 26 27 28 29

JULY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

AUGUST

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

SEPTEMBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

OCTOBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

NOVEMBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24/31 25 26 27 28 29 30

DECEMBER

2017

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

JANUARY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28

FEBRUARY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 19 30 31

MARCH S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

APRIL

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

MAY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

JUNE S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

JULY S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

AUGUST

S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23/30 24 25 26 27 28 29

SEPTEMBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31

OCTOBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30

NOVEMBER S M T W T F S 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23/30 24/31 25 26 27 28 29

DECEMBER

2018

Page 67: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 67

AGGREGATES, STONE, SANDHanson Aggregates Southeast ...................................... 6Martin Marietta Materials, South Carolina District Office ...................................... 3Vulcan Materials Co ...........................................................35

ASPHALT & ASPHALT PRODUCTSSoutheast Emulsions .......................................................... 6

ASPHALT CONTRACTORSBanks Construction ............................................................. 4C. R. Jackson Inc. .................................................................12King Asphalt, Inc. .................................................................. 3The Lane Construction Corporation ..........................26

ASPHALT EMULSIONS OR EMULSIFYING AGENTSAssociated Asphalt .........................Outside Back CoverErgon Asphalt & Emulsions, Inc.................................. Inside Front Cover

ASPHALT PROCESSING EQUIPMENTPreferred Materials,Inc. ...................................................27

ASSOCIATIONNaylor Association Solutions .........................................18

CERTIFIED PUBLIC ACCOUNTANTSDixon Hughes Goodman LLP.........Inside Back Cover

CONTRACTORBanks Construction ............................................................. 4Palmetto Corp. .....................................................................32Satterfield Construction Company .............................30Sloan Construction Company, Inc. ................................ 8

GENERAL CONTRACTORSGranite Contracting ..........................................................12Sanders Brothers Construction ......................................Inside Back Cover

HEAVY EQUIPMENTBlanchard Machinery Company .................................... 4

INSURANCE & SURETY BOND SERVICESBB&T-Boyle-Vaughan Insurance ..................................68HUB International ..............................................................14

LIME MANUFACTURERMississippi Lime Company .............................................14

LIQUID ASPHALT SUPPLIESJ.T. Russell Asphalt Terminals .........................................42

PAVEMENT CONTRACTORSAshmore Bros./Roger's Group, Inc. ............................... 8

PAVEMENT MARKINGS & TRAFFIC CONTROLPeek Pavement Marking, Inc. ........................................10

PAVING & CONSTRUCTION EQUIPMENTLinder Industrial Machinery Co. ...................................12

TRAFFIC CONTROLSouthern Commercial Development ........................24

WORK ZONE TRAFFIC CONTROL & SAFETYStay Alert Safety Services, Inc........................................30

Index to Advertisers

FOR THEIR SUPPORT IN THIS PUBLICATION.TO OUR ADVERTISERS

Page 68: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

68 www.scasphalt.org

Linder Industrial Machinery Co. ......................... 12 www.Linderco.com

Martin Marietta Materials, South Carolina District Office ..............................3 www.martinmarietta.com

Mississippi Lime Company .................................... 14 www.mississippilime.com

Naylor Association Solutions ............................... 18 www.scasphalt.org

Palmetto Corp. ............................................................. 32 www.palmettocorp.net

Peek Pavement Marking, Inc. ............................... 10 www.peeksafety.com

Preferred Materials,Inc. ......................................... 27 www.preferredmaterials.com

Sanders Brothers Construction ............................... Inside Back Cover www.sandersbrothers.com

Satterfield Construction Company ................... 30 www.crjackson.com

Sloan Construction Company, Inc. ........................8 www.sloan-construction.com

Southeast Emulsions ...................................................6 www.southeastemulsions.com

Southern Commercial Development ................ 24 www.scdevelopmentllc.com

Stay Alert Safety Services, Inc. ............................ 30 www.stayalertsafety.com

Vulcan Materials Co .................................................. 35 www.vulcanmaterials.com

Ashmore Bros./Roger's Group, Inc. .......................8 www.ashmorebros.com

Associated Asphalt ...................Outside Back Cover www.associatedasphalt.com

Banks Construction ......................................................4 www.banksconstruction.com

BB&T-Boyle-Vaughan Insurance ......................... 68 www.bbandt.com

Blanchard Machinery Company.............................4 www.blanchardmachinery.com

C. R. Jackson Inc. ......................................................... 12 www.crjackson.com

Dixon Hughes Goodman LLP ............................. Inside Back Cover www.dhgllp.com

Ergon Asphalt & Emulsions, Inc. .......................... Inside Front Cover www.ergonasphalt.com

Granite Contracting .................................................. 12 www.granitecontracting.com

Hanson Aggregates Southeast...............................6 www.hansonplc.com

HUB International ...................................................... 14 www.hubinternational.com

J.T. Russell Asphalt Terminals .............................. 42 www.jtrussellandsons.com

King Asphalt, Inc. ..........................................................3 www.kingasphaltinc.com

The Lane Construction Corporation ................. 26 www.laneconstruct.com

Advertisers.com

[ [BB&T Boyle Vaughan Insurance - 2000 Center Point Road, Suite 2400, Columbia, South Carolina 29210803-231-6183 (office), 877-467-7214 (fax)

Your main focus is to manage your business. Let us manage your risk.

Insurance Services

At BB&T - Boyle - Vaughan Insurance, you can count on us to be your trusted insurance partner. From risk assessment to plan design, we take the time to get to know you and your business. We offer a wide range of carriers, programs and competitively priced coverage tailored to meet your insurance needs – all through a single source.

Insurance services are provided by BB&T Insurance Services, a wholly owned subsidiary of Branch Banking and Trust Company. Insurance products may not be available in all states. Insurance products are not a deposit; not FDIC insured; not guaranteed by the bank; not insured by any government agency. BBT.com © 2008 BB&T.

638535_BBT.indd 1 28/04/13 3:10 AM

Page 69: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

2017 South Carolina Asphalt Pavement Association 69

Notes

Page 70: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

70 www.scasphalt.org

Notes

Page 71: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

Charleston Plant1981 Harley Street, North Charleston

South Carolina 29406

Berkeley Plant2142 Asphalt Drive, Summerville

South Carolina 29483

www.sandersbrothers.com

Asphalt PlacementAsphalt Sales and ProductionConcrete | Crushing/Recycling

Grading | SiteworkSoil Stabilization

Road Reclamation | UtilitiesVacuum/Camera truck services

Page 72: ASPHALT PAVEMENT ASSOCIATION · 2017 South Carolina Asphalt Pavement Association 9 South Carolina Asphalt Pavement Association (SCAPA) is a non-profit trade association dedicated

PG Asphalt, Polymer Modified Asphalt and Emulsion

YOUR PROVEN SOURCE OF QUALITY ASPHALT, PMA, ASPHALT EMULSION AND CUTBACK ASPHALT.

Emulsion Terminals

SE COASPHALT EMULSIONS

an Associated Asphalt Company

Scooter Kennedy, SC Sales Manager

Asphp alt Terminals


Top Related