![Page 1: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/1.jpg)
Arterial Remodelling andInflammation in Peripheral Arterial
Disease
Dr. Rasheeda Mohd. Zamin
(MBBS, MSc. Anatomy)
This thesis is presented for the degree of Doctor of Philosophyat The University of Western Australia
School of Anatomy,Physiology & Human Biology
2013
![Page 2: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/2.jpg)
0
This thesis is dedicated to my loving and wonderful family:
Muhammad ‘IzzuddinUmaira Yusraa
Muhammad UwaisMohd. Zamin Jumaat
Robiah BaniNoor Hayati Hashim
Mohamad Adi
![Page 3: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/3.jpg)
1
Abstract
Peripheral arterial disease (PAD) can lead to impaired perfusion to the lower limbs and
remains an important cause for non-traumatic lower limb amputations. PAD is
becoming known as an inflammatory disease with established biomarkers such as C-
reactive protein and osteoprotegerin (OPG). PAD is commonly associated with diabetes
mellitus, which is thought to be a product of low-grade but chronic inflammation.
Common pathological causes of PAD, which include atherosclerosis, are now linked to
the presence of several inflammatory factors such as fractalkine receptor (CX3CR1) and
monocyte chemotactic protein-1 receptor (now known as CCR2). Another common
characteristic of PAD is arterial calcification, which previously received less attention
but is now being investigated for the receptor activator of nuclear factor kappa-B
(RANK), RANK ligand and OPG involvement as part of an active cellular regulation of
the calcification process. Not only does atherosclerosis have a close association with
inflammatory and immune-based regulation, but also there is strong evidence to suggest
that arterial calcification is regulated by inflammatory factors. It is important to identify
the specific inflammatory factors, which may play a role in the development and
progression of PAD.
Peripheral arterial disease, as a form of pathological arterial wall remodelling and
known as arteriosclerosis, may present with two distinct types of calcification in which,
one may involve the intima and another, the media. Intimal calcification, which is a
feature of advanced atherosclerosis, initially involves infiltration of monocytes and
macrophages, which turn into foam cells and are deposited in the sub-endothelial layer.
In medial calcification, inflammatory mediators such as chemokines and cytokines, may
be released and drive arterial wall changes by modulating the phenotypic expression
and function of the arterial smooth muscle cells (ASMC). The pathological remodelling
of the arterial wall may involve cells, which have been activated or influenced to behave
like osteoblast cells, which can secrete mineralization matrix and may activate
infiltrating monocytes into mature osteoclasts. A persistent source of inflammation
could be from an intracellular infection of the ASMC with organisms such as
Chlamydia pneumoniae (CP).
![Page 4: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/4.jpg)
ii
Thus, the thesis first aimed to assess the severity of calcification and lipid deposition in
the arterial walls of arteries obtained from limbs amputated for PAD, comparing these
to cadaveric controls. Secondly, the expression of the inflammatory markers: CCR2,
CX3CR1and RANK were investigated in both diabetic and non-diabetic PAD arterial
samples. Thirdly, the ASMC cultured from PAD samples and fetal aortic derived
ASMC were characterized and investigated for expression of lineage markers for
smooth muscle cells, fibroblasts, osteoblasts and precursor cells. The relevant
inflammatory surface markers such as RANK, CX3CR1 and their membrane bound
ligands were also investigated. Finally, possible source of infection such as CP were
also investigated as the possible cause of inflammation in the arterial wall.
Following the recruitment of 17 patients undergoing non-traumatic lower limb
amputation, 53 arteries were harvested for histopathological study and inflammatory
marker detection using immunofluorescence-based techniques. Out of 17 patients, 10
were diabetic. This thesis further investigated the relevant phenotypic and inflammatory
surface markers of successfully cultured ASMC (70% growth from the patient samples),
which have been postulated to play a role in pathological arterial remodelling. Flow
cytometry was also used to quantify the phenotypic and inflammatory markers exhibited
by PAD samples (diabetic and non-diabetic), and control samples that are derived from
human fetal aortic smooth muscle cells. Tissue immunofluorescence microscopy and
PCR were used to detect the intracellular pathogen in diabetic and non-diabetic PAD
samples, to determine the possible role of intracellular infection CP as a cause for
inflammation.
Generally, the arteries from both diabetic and non-diabetic amputated PAD cases
exhibited severe calcification when compared to the controls. Immunohistopathological
findings showed that RANK and CX3CR1 were expressed in these calcified arterial
walls but no expression of CCR2 was seen. In vitro evidence for phenotypic changes in
PAD derived ASMC suggested an osteoblast-like phenotype where there was positive
expression of vimentin, Stro-1, Runx2, Osterix along with the inflammatory markers
RANK and CX3CR1. The rate of detection of CP in the tissue immunofluorescence
microscopy was more than 50%, while PCR detection revealed 14% and 32% positivity
in diabetic and non-diabetic PAD samples, respectively. In vitro, the ASMC derived
from PAD samples responded to some extent with evidence of up-regulation in TLR4
![Page 5: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/5.jpg)
iii
and CD14 following LPS activation. This supports the previous findings of CP
detection in diseased arteries and suggests a role of inflammation in pathological arterial
wall remodelling without diabetes.
Previous studies have proposed a role for CX3CR1 expression and positive CP infection
in atherosclerosis development. In the context of vascular diseases, RANK and OPG
activities have also been implicated separately from CX3CR1 studies. This thesis has
concluded that the activity or presence of these inflammatory markers, synergistically
lead to the progression of PAD towards more calcification in the media, as a severe
form of pathological arterial remodelling. Additional molecular experiments need to be
performed in order to provide detailed pathways and mechanism of actions (for e.g. the
influence of LPS on CX3CR1 and RANK expression at the cellular level), before these
inflammatory receptors can be considered as therapeutic targets in clinical studies.
![Page 6: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/6.jpg)
iv
TABLE OF CONTENTS
Abstract ...................................................................................................................................... i
TABLE OF CONTENTS...........................................................................................................iv
Acknowledgements ............................................................................................................ vii
Statement of candidate contribution ..........................................................................viii
Academic Contribution .......................................................................................................ix
List of figures ........................................................................................................................... x
List of tables .......................................................................................................................... xii
Abbreviations ......................................................................................................................xiii
CHAPTER 1: INTRODUCTION .............................................................................................11.1 Clinical manifestations and diagnosis .............................................................................. 11.2 Epidemiology of PAD............................................................................................................... 31.3 Pathogenesis of PAD................................................................................................................ 41.4 Risk factors and common etiology of PAD ...................................................................... 5
CHAPTER 2: LITERATURE REVIEW ..................................................................................72.1 The arterial wall ....................................................................................................................... 72.2 Arterial remodelling ............................................................................................................... 9
2.2.1 Physiological arterial remodelling............................................................................................92.2.2 Pathological arterial remodelling .............................................................................................92.2.3 Cellular origin in arterial remodelling ....................................................................................9
2.3 Arterial inflammation...........................................................................................................112.3.2 Atherosclerosis .............................................................................................................................. 112.3.3 Causes of arterial inflammation: role of infection........................................................... 12
2.4 Arterial calcification .............................................................................................................132.4.1 Arterial cells and bone biology................................................................................................ 14
CHAPTER 3: AIMS AND HYPOTHESES........................................................................... 17
CHAPTER 4: GENERAL METHODS .................................................................................. 194.1 Materials and methods.........................................................................................................194.2 Arterial samples .....................................................................................................................20
CHAPTER 5: HISTOPATHOLOGICAL EVALUATION OF 53 ARTERIES FROM 17PAD CASES.............................................................................................................................. 21
5.1 Introduction.............................................................................................................................215.2 Hypothesis and aim...............................................................................................................215.3 Materials and Methods.........................................................................................................22
5.3.1 Arterial samples ............................................................................................................................ 225.3.2 Histopathological analysis ........................................................................................................ 225.3.3 Inter scorer reliability................................................................................................................. 255.3.4 Statistical analysis ........................................................................................................................ 26
5.4 Results........................................................................................................................................265.4.1 Subject population........................................................................................................................ 265.4.2 Differences between arterial location.................................................................................. 26
![Page 7: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/7.jpg)
v
5.4.3 Calcification scores in PAD cases and controls................................................................. 275.4.4 Calcification scores in PAD cases with or without diabetes........................................ 275.4.5 Lipid scores in PAD cases and controls ............................................................................... 285.4.6 Lipid scores in PAD cases with or without diabetes ...................................................... 28
5.5 Discussion .................................................................................................................................29
CHAPTER 6: EXPRESSION OF RANK AND CX3CR1 IN ARTERIES DERIVEDFROM PERIPHERAL ARTERIAL DISEASE ..................................................................... 31
6.1 Introduction.............................................................................................................................316.2 Hypothesis and Aim...............................................................................................................326.3 Materials and Methods.........................................................................................................32
6.3.1 Patient demographics ................................................................................................................. 326.3.2 Tissue immunofluorescent study........................................................................................... 326.3.3 Detection of tartrate-resistant acid phosphatase (TRAP) ........................................... 336.3.4 Statistical analysis ........................................................................................................................ 33
6.4 Results........................................................................................................................................346.4.1 Immunohistological findings of pan leukocytic markers and SMA..................346.4.2 Immunohistological findings of inflammatory and bone markers ..................346.4.3 Tissue TRAP activity..........................................................................................................386.5 Discussion .................................................................................................................................40
CHAPTER 7: THE OSTEOBLAST-LIKE PHENOTYPE IN PAD SMOOTH MUSCLECELLS ....................................................................................................................................... 43
7.1 Introduction.............................................................................................................................437.2 Hypothesis and Aims.........................................................................................................447.3 Materials and Methods.........................................................................................................45
7.3.1 Cell culture....................................................................................................................................... 457.3.2 Flow cytometry and fluorescence microscopy................................................................. 457.3.3 Data and statistical analysis ..................................................................................................... 45
7.4 Results........................................................................................................................................477.4.1 Characterisation of ASMC according to lineage markers ............................................. 477.4.2 Characterisation of ASMC according to inflammatory markers................................ 50
7.5 Discussion .................................................................................................................................53
CHAPTER 8: INFECTIVE EVIDENCE IN PAD SAMPLES ............................................. 578.1 Introduction.............................................................................................................................578.2 Hypothesis and Aims.............................................................................................................588.3 Material & Methods ...............................................................................................................58
8.3.1 Antigen detection in tissue sections from PAD samples .............................................. 598.3.2 DNA extraction from cryosections ........................................................................................ 598.3.3 C. pneumoniae-species specific PCR screening................................................................. 598.3.4 Genotyping of C. pneumoniae PCR positive arterial samples...................................... 608.3.5 General PCR parameters............................................................................................................ 608.3.6 Statistical evaluation ................................................................................................................... 61
8.4 Results........................................................................................................................................618.4.1 Immunofluorescent detection of C. Pneumoniae in arterial tissues from PADsamples ........................................................................................................................................................ 618.4.2 PCR detection of C. Pneumoniae.............................................................................................. 628.4.3 Detection of C. Pneumoniae in ASMC derived from PAD samples ............................ 628.4.4 LPS activation induced TLR4 and CD14 expression....................................................... 65
8.5 Discussion .................................................................................................................................67
CHAPTER 9: DISCUSSION .................................................................................................. 699.1 Major histopathological findings......................................................................................699.2 Expression of CX3CR1 in the intima ................................................................................709.3 Expression of CX3CR1 and RANK in the media............................................................709.4 In vitro assessment ................................................................................................................719.5 CX3CR1 expression and relation to vascular calcification......................................72
![Page 8: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/8.jpg)
vi
9.6 Possible infective cause as a source of inflammation ...............................................739.7 Limitations of the study .......................................................................................................74
9.7.1 Sample size ...................................................................................................................................... 749.7.2 Variability in biological samples............................................................................................. 759.7.3 Methodological aspects .............................................................................................................. 75
9.8 Future direction......................................................................................................................759.9 Conclusions ..............................................................................................................................75
REFERENCES.......................................................................................................................... 77
Appendix I.............................................................................................................................. 88A. SPECIFICITY OF RESEARCH ...............................................................................................89B. STORAGE OF SAMPLES........................................................................................................89C. ACCESS TO SAMPLES AND RESEARCH RESULTS.........................................................90
CONSENT..................................................................................................................................................... 90
Appendix II ............................................................................................................................ 97
Appendix III........................................................................................................................... 98
![Page 9: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/9.jpg)
vii
Acknowledgements
I wish to thank all the following people who have helped me throughout my PhD
journey. My supervisors: Luis Filgueira, Paul Norman and Silvana Gaudieri. Without
them, I may not have reach out to my dream of seeing this work completed. To the
School of Anatomy, Physiology & Human Biology, I would like to thank all the staff
and fellow PhD students who made me feel welcome and exist as a family. Special
thanks to the school’s lab manager Greg Cozens; and Mary Lee, Leonie Khoo and Guy
Ben Ary from CELLCentral histology and biological image Lab. A big thank you to
John Murphy, Paul Rigby, Tamara Abel and Kathy Heel from CMCA for providing me
help, support and assistance to use all the high end equipment for my slides scanning,
microscopy and flow cytometry. To the manager of Crawley Village, Carolyn de Graw
and her assistant, Anna Karhunen, thank you for providing an excellent post-graduate
accommodation and allowing me to continue my lease year after year, and to be able to
live close by the university and walk over to my labs or the library in the day or at night.
Last but not least, I would like to express my gratitude to family members and close
friends who have supported me in all ways that they can.
![Page 10: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/10.jpg)
viii
Statement of candidate contribution
The experimental work in this thesis was carried out at the University of Western
Australia under the supervision of Prof. Luis Filgueira (previously at the School of
Anatomy, Physiology and Human Biology), now the Chair of Anatomy at the
University of Fribourg, Switzerland. Internal supervisors include Winthrop Professor
Paul Norman (School of Surgery/Fremantle Hospital) and Associate Professor Silvana
Gaudieri (School of Anatomy, Physiology and Human Biology).
The PCR work in Chapter 7 was a contribution from Dr. Adam Polkinghorne’s group
from the Institute of Health and Biomedical Innovation, Queensland University of
Technology, Brisbane.
Otherwise, the work described in this thesis is original and entirely my own, except
where the contributions of others are acknowledged.
I also received financial assistance from the Malaysian Ministry of Higher Education
Scholarships and the University of Western Australia PhD Completion Scholarships.
Rasheeda Mohd. Zamin10th July 2013
![Page 11: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/11.jpg)
ix
Academic Contribution
1. Poster Title: The role of inflammatory cytokines with effects of hyperglycemia on
arterial wall changes leading to chronic wound healing
Author(s): Zamin R.; Filgueira L.
Source: WOUND REPAIR AND REGENERATION Volume:18 Issue: 4 Pages:
A68-A68 Meeting Abstract: 38 Published: JUL-AUG 2010
2. Poster Title: The influence of hyperglycemia and inflammatory cytokine on human
arterial smooth muscle cell phenotype: implications for diabetic arterial disease
Author(s): Zamin R.; Filgueira L.; Norman P.
Conference: 20th Annual Combined Biological Sciences Meeting, AUG 27, 2010
Location: The University Club, University of Western Australia
3. Oral Presentation: The influence of hyperglycemia and inflammatory cytokine on
human arterial smooth muscle cell phenotype: implications for diabetic arterial
disease
Author(s): Zamin R.; Filgueira L.; Norman P.
The Asian-Pacific Society of Atherosclerosis and Vascular Disease (APSAVD)
Congress OCT 25-29, 2010.
Location: Cairns, Queensland.
4. Abstract Title: The association of peripheral arterial disease (PAD) with infective
and inflammatory factors: assessing the presence of chemokine receptors (CCR2,
CX3CR1 and RANK)
Author(s): Zamin R.; Filgueira L.; Norman P.
Conference: Annual Congress of the British-Society-for-Immunology
Location: Liverpool, United Kingdom. Date: DEC 05-08, 2011 Sponsor(s): British
Soc Immunol Source: IMMUNOLOGY Volume: 135 Special Issue:
SI Supplement: 1 Pages: 116-116 Published: DEC 2011
5. Oral Presentation: The role of inflammatory factors in diabetic and non-diabetic
peripheral arterial disease
Author(s): Zamin R.; Filgueira L.; Norman P.
Anatomy and Human Biology Postgraduate Student Expo (21st July 2011)
Location: The University of Western Australia
6. Poster Title: Bacterial LPS Influences Receptor Activator NF Kappa B and
Fractalkine Receptors Expression In Arterial Smooth Muscle Cells Derived From
Limbs Amputated For Peripheral Arterial Disease Author(s): Zamin, Rasheeda;
Norman, Paul; Filgueira, Luis. Conference: Experimental Biology Meeting
Location: San Diego, CA Date: APR 21-25, 2012.Source: FASEB
JOURNAL Volume: 26 Published: APR 2012
7. Journal Article: A novel in vitro human microglia model: Characterization of human
monocyte-derived microglia. Author(s): Etemad, Samar; Zamin, Rasheeda Mohd;
Ruitenberg, Marc J.; et al. Source: JOURNAL OF NEUROSCIENCE
METHODS Volume: 209 Issue: 1 Pages: 79-89 DOI:
![Page 12: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/12.jpg)
x
10.1016/j.jneumeth.2012.05.025 Published: JUL 30 2012
List of figures
Figure 1.1 An example of digital subtraction angiogram showing atherosclerotic
plaque in the femoral artery, medial artery calcification shown in a plain x-ray and
tibial artery disease in a diabetic patient ____________________________________ 3
Figure 2.1 The structural representation of arterial wall layers __________________ 8
Figure 2.2 Proposed remodelling in arterial calcification with the involvement of two
key cells: monocyte derived osteoclasts and osteoblast-like smooth muscle cells ____ 15
Figure 4.1 Flow chart of the general research design for the thesis project. _______ 19
Figure 5.1 Scores of ‘0’ given for arterial section which are free from calcification
when stained with H&E and free from lipid deposition when stained with Oil red O _ 23
Figure 5.2 Calcification scoring was made using H&E staining indicated by the dark
purplish area in each segmental quadrant __________________________________ 24
Figure 5.3 Lipid scoring by quadrant involvement represented by the number of arrows
shown in each sample stained with oil red O ________________________________ 25
Figure 5.4 The mean scores from 6 different observers were plotted against the
author’s score ________________________________________________________ 26
Figure 5.5 Median scores of calcification and lipid deposition are shown in the box
plots for different arterial locations _______________________________________ 27
Figure 5.6 Median of calcification scorings is shown for control and PAD cases in box
plots________________________________________________________________ 28
Figure 5.7 Median of lipid scorings is shown for control and PAD cases in box plots 29
Figure 6.1 Presence of alpha SMA (stained green) in both the media and intima and
RANK expression in tissue samples _______________________________________ 35
Figure 6.2 CX3CR1 expression in PAD samples with either atherosclerosis or calcified
features _____________________________________________________________ 37
Figure 6.3 Non-DM and DM PAD arterial samples did not differ significantly in
calcification severity ___________________________________________________ 38
Figure 6.4 Medial calcification seen in the control groups (A) without TRAP staining
and (B) with TRAP staining indicates positive TRAP activity ___________________ 39
Figure 6.5 Samples with minimal calcification but having clear lipid deposition (in A)
stained positive with TRAP (in B) _________________________________________ 40
Figure 6.6 External stimuli (hyperglycemia, inflammation resulting from trauma,infection, or other injury) activate certain cells to release RANKL________________41
![Page 13: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/13.jpg)
xi
Figure 7.1 Cells in the first row were stained with alpha smooth muscle actin with
Alexa Fluor 488 (in green). Cells in the second row were stained red with vimentin,
which is strongly positive for the skin fibroblast cells (as positive control)_________ 48
Figure 7.2 Phenotypic markers expression was compared between control cells and
ASMC derived from non-diabetic and diabetic PAD.__________________________ 49
Figure 7.3 Intracellular phenotypic markers assessed by flow cytometry representing
the control (fetal aortic smooth muscle cells) and PAD arterial smooth muscle cell
lineage______________________________________________________________ 50
Figure 7.4 Cover slips grown ASMC (derived from PAD samples) expressing CX3CR1,
CCR4 and RANK in (green fluorescent) with their respective negative controls in the
lower row. Blue fluorescent were the nuclear staining with DAPI _______________ 51
Figure 7.5 Expression of surface markers in cultured fetal aortic SMC (controls) and
arterial SMC derived from non-diabetic and diabetic PAD _____________________ 53
Figure 8.1 There was no difference between positive CP detection using (A)
immunofluorescent microscopy or (B) using PCR methods _____________________ 62
Figure 8.2 ASMC derived from PAD sample (A) stained with primary antibody against
Chlamydia Pneumoniae and (C) without the primary antibody stained with Alexa fluor
488_________________________________________________________________ 63
Figure 8.3 Arrows showing positively stained anti-Chlamydial antibodies in the intima
and media of calcified PAD samples. Non-calcified PAD samples were also positive
with anti-Chlamydial antibodies in both intima and media but negative in control
samples _____________________________________________________________ 64
Figure 8.4 TLR4 immunofluorsecent staining pre (A) and post (B) 24 hours incubation
with LPS 10ng/ml on glass cover slips _____________________________________ 65
Figure 8.5 TLR4 expression from flow cytometry, non-DM (N =5), DM (N =9),
unpaired T-test p=0.30.All samples were not activated with LPS in order to evaluate the
baseline expression of TLR4 _____________________________________________ 66
Figure 8.6 Histograms representing CD14 expression in non-activated ASMC in (A),
activated ASMC with LPS (B) and positive control from human peripheral blood
monocytes (C) ________________________________________________________ 66
![Page 14: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/14.jpg)
xii
List of tables
Table 4.1 Demographic data representing groups of peripheral arterial disease (PAD)
cases and subgroups of the amputees or PAD cases with and without diabetes (DM) and
controls._____________________________________________________________ 20
Table 7.1 List of primary and secondary antibodies used in flow cytometry ________ 46
Table 8.1 Primer sequences for C. pneumoniae detection and genotyping _________ 61
Table 1 (Appendix III) Non-diabetic PAD arterial samples assessed for CP detection
using IF (immunofluorescence) and PCR (polymerase chain reaction)____________ 98
Table 2 (Appendix III) Diabetic PAD arterial samples assessed for CP detection using
IF and PCR __________________________________________________________ 98
![Page 15: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/15.jpg)
xiii
Abbreviations
ABI - Ankle Brachial IndexALP - Alkaline PhosphataseANOVA - Analysis Of VarianceApo E – Apolipoprotein EASMC - Arterial Smooth Muscle CellsATA - Anterior Tibial Arteryc-FMS - CFS-1 Receptor (GM-CSF)CCR2 - Monocyte Chemotactic Factor-1 (MCP-1) ReceptorCCR4 - Chemokine (C-C Motif) Receptor 4CD14 - Cluster Designation-14/Myeloid Cell AntigenCP - Chlamydia PneumoniaeCVD - Cardiovascular DiseaseCX3CL1- Fractalkine (Ligand)CX3CR1-Fractalkine ReceptorDAPI - 4’, 6-Diamidine-2’-Phenylindole DihydrochlorideDM – Diabetes mellitusDPA - Dorsalis Pedis ArteryFIB - Fibular/Peroneal ArteryFITC - Fluorescein IsothiocyanateFKN – Fractalkine/CX3CL1FKNrc – Fractalkine receptor/CX3CR1IF - ImmunofluorescenceIQR - Inter-Quartile RangeLDL - Low Density LipoproteinLLA - Lower Limb AmputationsLPS - LipopolysaccharideLSD - Least Significant DifferenceM-CSF - Macrophage-Colony Stimulating FactorMDC - Macrophage-Derived Chemokine Of CCL22MGP - Matrix Gla ProteinMHC - Myosin Heavy ChainNF-κB - Nuclear Factor Kappa-B OPG – Osteoprotegerin/Osteoclastogenesis Inhibitory Factor (OCIF)PAD - Peripheral Arterial DiseasePBS - Phosphate Buffered SalinePCR -Polymerase Chain ReactionPFA - ParaformaldehydePOP - Popliteal ArteryPTA -Posterior Tibial ArteryRANK -Receptor Activator Of Nuclear Factor Kappa-BRANKL-Receptor Activator Of Nuclear Factor Kappa-B LigandRT- Room TemperatureRunx2 – Runt-Related Transcription Factor-2SMA - Smooth Muscle ActinSMD - Standardized Mean DifferenceTARC -Thymus-and Activation-Regulated Chemokine/CCL17TLR4 -Toll-Like Receptor-4TNFα -Tumour Necrosis Factor-Alpha TRAP -Tartrate Resistant Acid Phosphatase
![Page 16: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/16.jpg)
1
CHAPTER 1: INTRODUCTION
Peripheral arterial disease (PAD) is amongst the commonest clinical manifestations of
atherosclerosis, which also includes acute coronary syndrome, transient ischaemic
attack and ischaemic stroke. These clinical manifestations suggest impaired oxygenated
blood supply to specific organs such as the heart, brain or lower limbs. However, PAD
alone is associated with a similar mortality risk as other manifestations of
cardiovascular disease (Chi & Jaff, 2008).
Soor and colleagues (2008) have demonstrated that there is another significant arterial
wall change i.e. medial calcification, which could impair oxygenated blood perfusion to
the lower limbs. Medial calcification, which is sometimes referred to as medial
sclerosis, is characterized by the presence of calcification in the media distinct from the
intimal layer, where calcification may be seen in atherosclerosis. Soor’s study samples
comprised 58 patients, who underwent lower limb amputations for limb-threatening
ischaemia. All arterial segments obtained in the study had some degree of calcification
with increased stiffening of the arterial wall and loss of vasodilator response and this
may have contributed to distal ischaemia. Medial calcification is also known as a
marker of increased risk of amputation and mortality (Guzman et al., 2008). Other
dominant risk factors for PAD include diabetes mellitus, renal failure, smoking,
advanced age and ethnicity (Aponte, 2012; Levy, 2002; Wattanakit et al., 2005).
1.1 Clinical manifestations and diagnosis
Peripheral arterial disease may initially present as pain in the calf during walking
(claudication), although it may be asymptomatic in individuals who do little walking or
lead a sedentary life-style. A more severe form of the disease is characterized by
persistent rest pain, which becomes worse when the legs are elevated, for example in
bed at night. In this case, it is called critical limb ischemia. In even more severe cases,
patients can develop gangrene and ulceration. At this stage, where the quality of life
might be impaired by the symptoms, patients may be advised to undergo re-
vascularisation. If this fails, lower limb amputation may eventually be necessary. This
however, depends on the extent of tissue damage, persistence of pain and/or recurrent
wound infection.
Making a diagnosis of PAD, as one of the macrovascular complications, may not be
easy as the clinical presentation may coincide with microvascular complications,
![Page 17: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/17.jpg)
2
especially in diabetes mellitus. Calcification for example can affect large to small sized
arteries including the arterioles. When the small arteries are affected, they may cause
peripheral nerve ischaemia (Jeffcoate, Rasmussen, Hofbauer, & Game, 2009). This can
lead to loss of sensation to pain and pressure, which is known as neuropathy. Diabetic
patients are again commonly affected by distal symmetrical neuropathy. Once deprived
of pain sensation, they easily develop neuropathic ulceration or poor healing ulcer with
sepsis. Persistent local pressure can also lead to tissue necrosis and this may also be a
cause of non-traumatic lower limb amputations.
In the diagnosis of PAD, the widely used screening method is the measurement of the
ankle-brachial systolic pressure index (ABI). A resting ABI of < 0.90 is the standard
cut-off point (Norgren et al., 2007). However, this method may not be specific and
sensitive enough, in particular with patients with calcified arteries. When the arteries are
stiffened because of calcification, they cannot not be fully compressed and this leads to
an artificially higher reading of the ABI (Criqui & Ix, 2012). Therefore, the diagnosis of
PAD is best combined with imaging modalities such as angiograms (Figure 1.1A). The
common finding for PAD is usually blockage in one or more of the vessels and/or
calcified arteries (see Figure 1.1B and 1.1C).
A B
![Page 18: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/18.jpg)
3
C
Figure 1.1 An angiogram showing atherosclerotic plaque in the femoral artery (A),
medial artery calcification shown in a plain X-ray (B) and tibial artery disease in a
diabetic patient as shown in a digital subtraction angiogram (C). Arrow show sites of
arterial lesions.
1.2 Epidemiology of PAD
The mean age of patients hospitalized with PAD in Western Australia is 69.0 years for
men and 71.5 years for women (Nedkoff et al., 2012). The prevalence of PAD has been
increasing and in Western Australia it affects about 15% of men aged 65 and over
(Fowler, Jamrozik, Norman, & Allen, 2002). PAD is common in the aging population
and events of lower limb amputations were reported to be on the rise with the increasing
prevalence of diabetes mellitus. It has been reported in Australia that the incidence of
diabetes mellitus is steadily rising. The current estimates from the Australian Institute of
Health and Welfare (AIHW, 2011) showed nearly 900,000 or 4.1% of the Australian
population have been diagnosed with diabetes mellitus (between 2007-08). The rate of
diabetes has more than doubled from 1.5% cases over just two decades, when compared
to the rate diagnosed in 1989. Thus, PAD, as part of the cardiovascular disease burden
remains an important morbidity and mortality risk factor.
![Page 19: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/19.jpg)
4
The link of PAD to the incidence of acute cardiovascular events has been assessed in
nearly 3000 participants ranging from 61-65 years at follow-up (Abbott, Brand, &
Kannel, 1990). Twenty years follow-up data collected from the Framingham Study has
been evaluated to determine the relationship between diabetes mellitus and clinical
findings of occlusive peripheral arterial findings, which were at that time assessed by
carotid/femoral bruits and non-palpable pedal pulse. This study supported the findings
of high risk of occlusive PAD symptoms in diabetic patients. However, without severe
occlusive arterial disease, this group of patients may have severe medial calcification
instead (Soor et al. 2008). The combination of PAD with diabetes mellitus is known to
increase mortality and morbidity rate including lower limb amputations (Golomb, Dang,
& Criqui, 2006).
1.3 Pathogenesis of PAD
In a histological study of peripheral arteries, Jeziorska and colleagues (1998) proposed
an association between atherosclerosis and inflammatory cells such as macrophages and
mast cells. This is exclusively seen in the intimal region where there is prominent
infiltration with inflammatory cells. However, when the group described the media of
diseased arteries, they noted predominance of medial calcification with no macrophages
or other inflammatory cell accumulation. They described the calcification in the media
as a separate pathology, which could have different inflammatory mediators. They also
suggested that arterial calcification is an organized and regulated process rather than a
passive ageing phenomenon.
It has been agreed that atherosclerosis and medial calcification should be considered as
separate pathologies (Fishbein & Fishbein, 2009). Atherosclerotic lesions may involve a
varying degree of changes in the intimal layer from fatty streak to atheroma plaque
formation. Advanced atherosclerosis usually involves calcification of the arterial wall as
well (Stary et al. 1995). While atherosclerosis is confined to the intima, medial
calcification occurs exclusively in the media. Monkeberg gave rise to the term
Monkeberg’s sclerosis and described this specific histological change as early as 1903.
Monkeberg has also been reported as the first scientist to describe prevalent arterial
calcification in the distal arteries (Jeffcoate et al. 2009). Despite being a common
finding in the healthy aging population, both lesions (atherosclerosis and medial
sclerosis) are now becoming more common in a much younger group of patients with
chronic diseases such as diabetes mellitus or renal failure.
![Page 20: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/20.jpg)
5
1.4 Risk factors and common etiology of PAD
The main risk factors for PAD are advanced age, smoking, diabetes mellitus,
hypertension and dyslipidaemia. As mentioned by Norgen and colleagues (2007), the
relative risk for developing PAD is less for hypertension than diabetes mellitus or
smoking. However, once hypertension is complicated with renal failure, then the risk of
having PAD may rise.
Ageing, for example was initially proposed as a risk factor because of the high
incidence or prevalence of PAD in the aging population. As put forward by Norgren and
others (2007), the risk factors may come out of association alone with no definitive
causal factor to be linked to the event of PAD.
With the increasing information on inflammatory-based diseases (Moe & Chen, 2005),
more can be postulated for the probable underlying factors for PAD. Despite the
seemingly multifactorial reasons, they may be underpinned by unifying inflammatory
causes. This thesis will try to bring together the common clinical manifestations of
atherosclerosis and medial calcification, which is PAD, under the umbrella of
inflammation and arterial remodelling.
There seems to be a type of mechanism in place in the arterial wall that is similar to
bone-formation, which may be responsible for the calcification and, which in itself is
pathological in the context of the artery (Boström et al., 1993; Parfitt, 1984). A better
understanding of how this bone-like process works in general, and specifically in the
arterial calcification, may help to identify new therapeutic approaches.
In addition, there are a number of bone diseases such as osteoporosis and arthritis
associated with vascular calcification, suggesting that inflammatory immune response
may be influencing bone metabolism at the same time (Foo, Frey, Yang, Zellweger, &
Filgueira, 2007; Weitzmann & Pacifici, 2006). It is not a straightforward case of
calcium depletion in the bone becoming deposits on the arterial wall, but rather an
intricate network of the adaptive immune system with T lymphocyte activity
augmenting release of immune factors and cytokines that influence bone, and possibly
vascular biology, such as RANKL and TNF-α (Chan, Mhawi, Clode, Saunders, &
Filgueira, 2009).
In vivo evidence of inflammatory burden has been shown in Apo E deficient mice with
increased arterial and valvular calcification, which at the same time showed loss of bone
mineral density (Hjortnaes et al., 2010). Due to the inherent difficulties associated with
investigation in humans, much information has been gained from animal models.
![Page 21: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/21.jpg)
6
Consequently, many of the principles identified in animals need to await further
validation in humans. In this thesis, the main investigations were carried out in human
samples and this may still be hampered by certain limitations. The outcome may differ
from those that have been shown in animal models. The issue of limitations will be
further highlighted in the final discussion chapter. The next chapter will further review
the key players in pathological arterial wall remodelling and the underlying
inflammatory mediators relevant to PAD.
![Page 22: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/22.jpg)
7
CHAPTER 2: LITERATURE REVIEW
This chapter aims to review the relevant background of the inflammation theory behind
atherosclerosis and medial calcification relevant to PAD. It has been proposed that
inflammation may drive the arterial wall changes and the corresponding arterial wall
remodelling (Ward, Pasterkamp, Yeung, & Borst, 2000).
2.1 The arterial wall
The arterial wall has three layers called tunics. The tunica externa or adventitia is the
outermost layer. It consists of loose connective tissue that often merges with
neighboring structures such as other blood vessels, nerves or an organ. This outermost
layer provides an anchor and passage to smaller nerves, lymphatic vessels and smaller
vessels called the vasa vasorum. The vasa vasorum represent feeding arteries to the
outer half of the larger arterial wall (see Figure 2.1A).
The middle layer of an artery is called the tunica media and is usually the thickest in
size because it has to withstand the surges of blood pressure generated by the pumping
heart. The media also lends a more muscular structure to the artery and when compared
to the veins, the arteries will appear relatively round in tissue sections. The tunica media
is generally made of arterial smooth muscle cells (ASMC), collagen and elastic tissue.
The largest artery, which is the aorta usually, has the highest amount of elastic fibers in
its media. Whereas the muscular arteries such as the femoral and popliteal arteries have
less amount of this elastic sheets in their media. The tunica intima and media is usually
separated by the internal elastic lamina (see Figure 2.1B). However the internal elastic
lamina may not be visible in a large artery due to the high amount of elastic lamellae.
The innermost layer facing the lumen is the tunica intima, where the arterial wall is
exposed to the blood. This layer could differ in thickness, depending on the size of the
artery. The large artery have a thicker intimal layer due to the large subendothelial area
and the medium arteries may have several layers of endothelial cells in the intima,
although thinner than the intima of the large arteries. Finally, the arterioles usually
consist of simple squamous endothelium overlying a basement membrane. An intact
endothelial layer provides a smooth inner lining that normally repels blood cells and
platelets. Platelets may adhere to a damaged endothelium and during inflammation.
![Page 23: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/23.jpg)
8
A
B
Figure 2.1 Structural representation of the arterial wall layers principally found in a
medium sized artery (A), and histological cross section with arrow indicating the
internal elastic lamina (B). Images taken from www.graysanatomyonline.com.
![Page 24: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/24.jpg)
9
2.2 Arterial remodelling
2.2.1 Physiological arterial remodelling
Remodelling in a physiological sense is predominantly a maintenance cycle to ensure
normal functioning of a tissue. In the arteries, this could involve normal turnover of
cells such as the endothelial cells and ASMC. A well-regulated turnover and
replacement of dead and dying cells helps sustain the structure and function of a healthy
arterial wall (Ward et al., 2000).
2.2.2 Pathological arterial remodelling
In an overt case of pathological cell turnover such as intimal hyperplasia, proliferation
of ASMC, migration, phenotypic differentiation, as well as extracellular matrix
formation and degradation could determine the extent of intimal thickening (Newby &
Zaltsman, 1999). These are mostly features of atherosclerosis, and its more severe form
is presented with arterial stenosis.
There is also remodelling activity that causes the wall to become stiffened with bone-
like material embedded in the wall. For the scope of this thesis, only two types of
pathological arterial wall remodelling will be discussed in the context of PAD. First, is
arterial wall thickening and atherosclerosis; second, calcified arteries involving the
media, which is also known as medial sclerosis.
There is increasing evidence that abnormal ASMC turnover and differentiation can lead
to adipocyte-like foam cells and calcifying-like bone cells, resulting in atherosclerosis
or medial sclerosis (Vukovic, Arsenijevic, Lackovic, & Todorovic, 2006). Normal
ASMC express the specific markers desmin and smooth muscle actin, whereas
pathological cells are expected to express either adipocyte or bone cell markers
(Iyemere, Proudfoot, Weissberg, & Shanahan, 2006; Vukovic et al., 2006).
2.2.3 Cellular origin in arterial remodelling
Since phenotypic differentiation has been mentioned in pathological arterial
remodelling, the source of the cell origin is further discussed here. There are at least
three different, possible sources for the appearance of bone-like cells in the arterial wall,
which may originate from (1) the mesenchymal progenitors resident in the arterial wall,
(2) re-differentiation of the mature ASMC and (3) from circulating cells with calcifying
![Page 25: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/25.jpg)
10
potential, which could still originate from bone marrow stromal cells. In order to
determine the possible cell origin, a range of markers has been used to determine the
lineage. Generally, ASMC are derived from the mesenchymal cell lineage and express
the stromal cell marker (Stro-1) and smooth muscle actin (Bensidhoum et al., 2004;
Yoshiba, Yoshiba, & Ohkura, 2012). The osteogenic cells, derived from pluripotential,
mesenchymal stem cells, principally come from the bone marrow and may be seeded
from the circulation (Fadini, Rattazzi, Matsumoto, Asahara, & Khosla, 2012). The cells
in the arterial wall, which retained the capacity to differentiate and re-differentiate, may
well display the osteogenic features, given a specific stimulus.
Osteoblasts are also of mesenchymal origin and share the same lineage as the ASMC,
fibroblasts, myocytes and adipocytes (Ahdjoudj, Fromigué, & Marie, 2004). An early-
differentiated osteoblast will display core binding factor-1 (cbfa-1) or Runx2. The
osteoblasts will differentiate and progress through several precursor stages before
forming the mature osteoblast. Osterix is a mature osteoblast marker and suggests a
terminally differentiated stage (Billiard et al., 2003). Osteoblasts can produce RANKL
to help regulate osteoclast activity. This is important because osteoblasts are responsible
for the calcification of the bone matrix and in maintaining physiological bone growth
and remodelling.
Osteoclasts however, originate from the haematopoietic lineage and the precursor forms
are monocytes. Osteoclasts are the only bone resorbing cells and are coupled with
osteoblast to regulate bone mass and structure as a feature of bone remodelling. The
markers that are important in characterizing the phenotype of osteoclasts are RANK,
TRAP and CD14 (for the early precursor cells-monocytes) (Saitoh, Koizumi, Sakurai,
Minami, & Saiki, 2007).
It is hypothesized that vascular cells may trans-differentiate into cells which display
osteoblast and osteoclasts-like phenotype ((Massy, Mentaverri, Mozar, Brazier, &
Kamel, 2008).There have been several tracer studies to identify whether these cells are
derived from ASMC. Mice models were developed, where the progenitors of
mesenchymal stem cells were tagged and then traced up to the stage of vascular
development. A specific strain such as the matrix Gla protein deficient (MGP null) mice
from the study of Speer and colleagues (2009), was used to show that the ASMC could
trans-differentiate and contribute to the development of medial wall calcification. Speer
and others (2009) have genetically labeled the ASMC with the SM22-Cre recombinase
and the Cre reporter Rosa26-LacZ alleles in utero and trace this cells formation into
osteochondrogenic precursor- and chondrocyte-like cells in calcified arteries of the
![Page 26: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/26.jpg)
11
MGP null mice. Tang and others (2012) however, insist that proper lineage tracing
should include the myosin heavy chain (MHC), specific for a smooth muscle lineage
instead of using smooth muscle actin stain alone. Tang and others (2012) proposed that
the differentiated smooth muscle cells might instead be derived from multipotent
vascular stem cells.
In general, findings of bone-like cells in the arterial wall have led to the theory of
ectopic bone-like formation in the arterial wall. However, what induces the changes is
still not clear. It could also be that some cells are not fully differentiated and attempts to
resolve calcification by recruiting monocytes to sites of calcification have failed.
2.3 Arterial inflammation
In general, chronic inflammation is characterized by ongoing tissue damage from
reactive oxygen species and proteases, which are secreted by inflammatory cells such as
the monocytes and macrophages. When there is prolonged exposure to toxic agents or
other persistent inflammatory agents or inducers, chronic inflammation may occur.
Other products such as pro-inflammatory cytokines and chemokines may amplify and
propagate the damage. Inflammatory factors have been long proposed to play a major
role in the development of PAD (Epstein, Zhou, & Zhu, 1999; Tervaert, 2009). These
factors include infection or injury from a mechanical, chemical or biochemical sources.
Inflammation is recognized as a key process in the development of atherosclerosis given
the presence of infiltrating macrophages. However, in medial calcification, it is likely
that the vascular resident cells namely the ASMC, act to differentiate and protect
themselves, hence releasing a number of pro-inflammatory cytokines and chemokines
(Charo & Ransohoff, 2006; Moser, Wolf, Walz, & Loetscher, 2004). It has become
clear that the expression of functional chemokines and receptors are not restricted to
immune cells alone (Zulli et al., 2008). Many cell types are able to produce chemokines
or up-regulate inflammatory receptor expression under the influence of pro-
inflammatory cytokines such as IL-1β, TNF-α and IFN-γ. Both cytokines and
chemokines are important in the maintenance of such lesions.
2.3.2 Atherosclerosis
The initial event in atherosclerosis is the adhesion of monocytes to endothelial cells and
the extravasation of these cells into the sub-endothelial region (Plasschaert, Heeneman,
& Daemen, 2009; Ross, 1999). These monocytes are recruited in the event of injury or
imbalance of the chemokine gradient at sites of inflammation. The chronic recruitment
![Page 27: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/27.jpg)
12
of these cells leads to the growth of the lesions and occlusion of arteries. With the
theory of “response-to-retention”, these monocytes accumulate modified forms of LDL
via scavenger receptors and further become lipid-laden cells called foam-cells
(Williams & Tabas, 1995). The chemokines CCL2 and CX3CL1 are important
mediators facilitating monocyte adhesion and migration, preceding the process of
plaque formation (Butoi et al., 2011; Matsumoto, Kobayashi, & Kamata, 2010)
CCL2 has been described previously as monocyte chemoattractant protein-1 (MCP-1)
and has been shown to be an important chemoattractant for monocytes towards the
subendothelial space of the arterial wall mediating the formation of foam cells (Nelken
et al. 1991). However, the involvement of chemokines other than CCL2 is suggested
when irradiated apolipoprotein (apo) E3-Leiden mice were reconstituted with CCR2-
deficient bone marrow progenitor cells, which resulted in 86% reduction of the overall
atherosclerotic lesion development (Guo et al., 2005). This suggests that there might be
other pathways for the monocytes recruitment to the inflammation site. Furthermore,
CCL2/CCR2 expression may be limited to the early stage of atherosclerosis formation
and downregulated in an advanced lesion (Wong, Wong, & McManus, 2002).
Fractalkine (FKN) or CX3CL1 is a unique chemokine, which functions as a
chemoattractant, as well as an adhesion molecule. FKN was described as a
transmembrane-anchored molecule on the surface of endothelial cells which is up
regulated in inflamed tissues, such as the atherosclerotic walls (Umehara et al., 2004).
The FKN receptor (CX3CR1) is a critical factor for monocyte trafficking to the
vasculature and is mainly expressed on monocytes. According to a number of studies,
CX3CR1 is chiefly involved in atherosclerosis (Butoi et al., 2011; Liu et al., 2008).
Interestingly, as atherosclerosis can display pathological remodelling such as intimal
hyperplasia and plaque formation, CX3CR1 has been found to be responsible from the
very beginning. A study by Lucas et al., (2003) has shown that the expression of the
FKN receptor facilitated the migration of the ASMC into the intimal layer. Since
Koizumi and colleagues (2009) suggested a novel role for FKN to attract monocytes to
sites of mineralization, there is the need to investigate the role of FKN and its receptor
in medial calcification.
2.3.3 Causes of arterial inflammation: role of infection
Many lines of evidence, ranging from in vitro experiments, pathological examinations
to epidemiological studies, reveal that inflammation is cardinal to the pathogenesis of
![Page 28: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/28.jpg)
13
PAD (Libby, 2002). However, this relationship between inflammation and the
development or progression of PAD involves complex molecular networks of the
immune and the host defense system. There is an emerging role for the toll-like
receptors (TLRs) in recognizing exogenous and endogenous molecular signals
promoting inflammation in cardiovascular disease (Spirig, Tsui, & Shaw, 2012).The
possible role of infectious agents has been described in a number of studies, but has
mainly revolved around atherosclerosis (Leinonen & Saikku, 2002; Rosenfeld et al.,
2000).
Up until now, no definitive conclusion has been drawn on the association between PAD
and a number of proposed infective organisms such as Chlamydophila, Mycoplasma
and Cytomegalovirus (CMV). For instance, Chlamydia pneumoniae (CP) has been the
most frequently proposed pathogen in coronary artery disease, however, results are
conflicting and causality is difficult to prove in humans (Pasterkamp et al, 2004).
Gutierrez and others have compiled 43 published studies that evaluated the association
between PAD and CP and their observational case-control meta-analysis did not support
any strong association. Gutiérrez and others (2005) proposed that an association can
only be made with a case control study with adequate number of cases that uses
multiple techniques and samplings from the same subjects to detect the presence of the
bacterium and establish a relationship with the disease. For the purpose of this thesis,
two methods of detection of CP will be used; immunofluorescent detection in arterial
tissue samples and a pathogen-specific PCR assay using fine tissue scrapings.
2.4 Arterial calcification
Arterial calcification has been suggested to resemble the active process of bone
formation. Although initially it was believed to be a passive mechanism, accumulating
evidence has now led to a new understanding in the process of arterial calcification.
Moreover, bone-like markers such as alkaline phosphatase (ALP), bone sialoprotein or
bone matrix protein have been reported to be present in the diseased arterial wall
(Boström et al., 1993; Hunt, 2002; Wada, McKee, Steitz, & Giachelli, 1999). These
findings mainly showed an association of bone forming-like lesions in atherosclerosis
rather than in medial sclerosis. However, it is possible that this bone-like structure could
be present in the medial wall of the arteries, as well.
Other evidence includes in vitro findings on bone related nuclear transcriptional factors
such as Runx2 and Osterix (Panizo et al., 2009). However, Byon et al. (2011) in a recent
study suggested that Runx2 might be responsible for RANKL expression in the
![Page 29: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/29.jpg)
14
osteoblast-like ASMC resulting from atherosclerotic lesions. It is now clear that arterial
calcification may involve phenotypic changes in the arterial cells. Although these
studies were centered on atherosclerosis, it is possible to investigate a similar
mechanism for medial sclerosis.
Up till now, several studies have investigated the role of OPG/RANKL in the
progression of atherosclerotic calcification. In hyperlipidemic ApoE deficient mice,
Bucay et al. (1998) showed that OPG deficient mice developed osteoporosis and
vascular calcification. Arterial calcification is now recognized as a marker of
atherosclerotic plaque burden and also a major contributor of arterial stiffness owing to
the loss of arterial elasticity (Soor, Vukin, Leong, Oreopoulos, & Butany, 2008).
2.4.1 Arterial cell and bone biology
The theory proposed for the regulation of arterial calcification is the interplay between
osteoblast and osteoclast-like cells (Massy et al., 2008). The bone remodelling theory
describes how bone forming cells (osteoblast) and bone resorbing cells (osteoclast) may
interact (Figure 2.2). Bone remodelling involves the spatial and temporal coupling of
these cells through four main stages: cell activation, bone resorption, reversal of cell
activation and bone formation (Parfitt, 1984). The remodelling is initiated by the
activation of the quiescent cells on the bone surface, which is covered by the bone
lining cells. Activation requires the recruitment of new osteoclasts from the
mononuclear phagocyte system or from haematopoietic precursors. Also, the close cell-
to-cell interaction is needed in order to activate the signaling cascade. The mechanism
of attraction and binding to the mineralized surface could be due to chemotactic signals
such as fractalkine (Koizumi et al., 2009). Further maturation of the osteoclast is then
induced by binding of RANKL expressed by the osteoblast. Resorption is then carried-
out by the osteoclast, which when activated becomes a giant multinucleated cell. There
is a proposed interaction between RANKL and fractalkine receptor, which further
fascilitate osteoclast functions (Saitoh et al., 2007).
![Page 30: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/30.jpg)
15
Figure 2.2 Proposed remodelling in arterial calcification with the involvement of two
key cells: monocyte derived osteoclasts and osteoblast-like smooth muscle cells.
Adapted from Weitzmann and Pacifici (2006).
There is link between bone and vascular immunology, which has been established by
many bone destructive disorders such as rheumatoid arthritis (Jones, Kong, &
Penninger, 2002), Charcot’s disease (Ndip et al. 2011) and osteoporosis (Wu et al.
2012). The term osteoimmunology has been coined in order to describe the accelerated
bone loss caused by inflammatory and autoimmune diseases such as rheumatoid
arthritis and diabetes. Jones, Kong and Penninger (2002) noticed the osteoclast-inducing
capacity of activated T-cells in adjuvant arthritis that is mediated through the
RANK/RANKL/OPG axis. Most of these agents or pro-inflammatory cytokines are
produced by the osteoblast or bone marrow derived stromal cells. However, these
cytokines have to compete for binding on their shared cognate receptor RANK.
Therefore, the cytokines, which are more abundant in the circulatory system easily bind
to RANK and exert their effects. This is clearly demonstrated in the treatment of
osteoporosis by denosumad (an antibody to RANKL), where the osteoporotic bone
resorption problem in the patients can be controlled. Another important highlight from
an early animal study is the OPG knockout mice. In this mouse model of OPG
deficiency developed by Bucay and colleagues (1998), severe bone loss and
calcification of the aorta and renal arteries were observed. This finding indicates the
important role of OPG as an osteoprotective factor and also as an inhibitor to arterial
wall calcification. By acting as a decoy receptor to RANKL, osteoclastic activity and
thus bone resorption in the area of arterial wall may be halted and the active
remodelling of arterial wall calcification may be reduced.
![Page 31: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/31.jpg)
16
Despite increasing evidence supporting the link between the immune system and
vascular calcification, the role of the proposed biomarkers remains obscure in the
pathogenesis of PAD. This study, thus aimed to investigate the presence and role of
inflammatory markers CCR2, CX3CR1 and RANK in PAD. It is hypothesized that
these markers will be up-regulated in the arterial wall in PAD and contributes to the
pathological arterial wall remodelling.
![Page 32: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/32.jpg)
17
CHAPTER 3: AIMS AND HYPOTHESES
This chapter generally outlines the hypotheses to be tested with aims to be addressed in
the following experimental chapters. The overall aim is to identify relevant
inflammatory markers in severe PAD as derived from the arterial tissues and ASMC
grown from viable samples and to identify possible intracellular infection as a source of
inflammation.
Hypotheses:
Hypothesis 1- Patients with clinically severe PAD (needing amputation) have greater
arterial wall changes than in control subjects.
Aim: To assess the degree of arterial wall changes in terms of calcification and
lipid deposition on the arterial walls of PAD and controls. Further comparison was
made between samples having PAD with or without diabetes.
Hypothesis 2 - The expression of inflammatory and bone-related markers is associated
with the severity of arterial calcification and/or lipid deposition in the arterial walls of
PAD and controls.
Aim: To investigate the expression of the inflammatory and bone-related
markers: CCR2, CX3CR1, TRAP and RANK in association to the severity of arterial
calcification and/or lipid deposition in the arterial walls of PAD and controls. Further
comparison was made between samples having PAD with or without diabetes.
Hypothesis 3 - The calcification phenotype (osteoblast-like cells) is up-regulated in
ASMC derived from the arterial wall of patients with PAD.
Aim: To characterize PAD-derived and human fetal aorta-derived ASMC for
expression of markers specific for smooth muscle cells (alpha-smooth muscle actin,
desmin), fibroblasts (vimentin), osteoblasts (Osterix, Runx2) and mesenchymal
precursor cells (Stro-1).
![Page 33: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/33.jpg)
18
Hypothesis 4 - The inflammatory and bone-related cell surface markers (CX3CR1/L1,
RANK/L TLR4, CD14, CCR2 and CCR4) are up regulated in ASMC derived from the
arterial wall of patients with PAD compared to fetal derived ASMC.
Aim: To investigate the expression of inflammatory and bone-related cell
surface markers in PAD-derived ASMC and human fetal aortic smooth muscle cells,
including CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4.
Hypothesis 5 - Intracellular infection such as Chlamydia Pneumoniae (CP) may be
associated with inflammation in PAD.
Aims:
(i) To determine the presence of CP in calcified diabetic samples and non-
calcified non-diabetic samples using immunofluorescence (IF) study and
polymerase chain reaction (PCR).
(ii) To determine the molecular detection of TLR4 and CD14 in mediating
differential response to LPS as an in vitro model to CP infection in ASMC.
![Page 34: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/34.jpg)
19
CHAPTER 4: GENERAL METHODS
4.1 Materials and methods
This section describes the samples and general methods used throughout the thesis.
There will be four experimental chapters describing separate studies, which first
investigate the main histopathological characteristic of the arterial samples (Chapter 5)
and identifying relevant inflammatory markers using immunofluorescence techniques
(Chapter 6).The next experimental chapter (chapter 7) uses fresh arterial samples to
culture smooth muscle cells for phenotypic characterization and identify proposed
inflammatory markers either intracellularly or on the surface membrane to help support
tissue findings in chapter 6. The final experimental chapter (chapter 8), combines both
tissue, ex-vivo and in vitro studies in order to identify the possible source of
inflammation by testing for the presence of an obligate intracellular pathogen,
Chlamydia pneumoniae. The general outline of the experiments was given below in
Figure 4.1.
Figure 4.1 Flow chart of the general research design for the thesis project.
![Page 35: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/35.jpg)
20
4.2 Arterial samples
Between March 2010 and August 2012, 17 patients consented to arterial tissue
harvesting after below or above knee amputation for tissue loss, ulceration or gangrene.
Ethics approval was obtained from local Human Ethics committees (RA/4/1/4078) with
the relevant documents provided in Appendix I. Amongst the cases, seven were not
diabetic and 10 had diabetes for 9 to 20 years duration. Control arteries were obtained
from eight embalmed cadavers (< 48 hours post –mortem) – all without diabetes and no
clinical history of PAD. The cadavers were obtained from the body donation program at
the University of Western Australia. All subjects were Caucasian and subject
characteristics are summarized in Table 4.1.
Cases of PAD contributed 53 different arterial samples (popliteal,peroneal, anterior and
posterior tibial arteries) and controls contributed a total of 33 different lower limb
arteries for histopathological evaluation. A segment of these arteries were each
immediately fixed in 1% paraformaldehyde (PFA) (to be used for histopathological
evaluation).The other halves of the arterial segments were transported in culture
medium for explantation in the cell culture lab (as described in chapter 5).
The risk factors for PAD are also summarized in Table 4.1.
Table 4.1 Demographic data representing groups of peripheral arterial disease (PAD)
cases and subgroups of the amputees or PAD cases with and without diabetes (DM) and
controls.
PAD cases Controls
No DM DM No DM
Number 7 10 8
Mean Age (years) ± SD 66 ± 13 64 ± 15 78 ± 8
Median Age (years) 68 66 75
Age Range 41-78 39-82 68-90
Gender (male) (5) 71% (8) 80% (5) 63%
Smokers (7) 100% (6) 60% unknown
Hypertension (4) 57% (2) 20% unknown
Hyperlipidaemia (5) 71% (2) 20% unknown
Renal failure (1) 14% (6) 60% unknown
![Page 36: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/36.jpg)
21
CHAPTER 5: HISTOPATHOLOGICALEVALUATION OF 53 ARTERIES FROM 17PAD CASES
5.1 Introduction
Histopathological studies have revealed that the changes in severe peripheral arterial
disease (PAD) not only involves atherosclerosis in the intima, but also significant
medial arterial wall calcification (Soor et al. 2008, Mozes et al. 1998). Imaging
modalities usually confirm the diagnosis of PAD by showing areas of stenosis or
blockage and calcified arteries at the problem site. Calcification in the posterior tibial
artery can be scored using multi-sliced computated tomography, and this technique has
been proposed by Guzman and colleagues (2008) to predict future amputation.
Increasing age and traditional risk factors for atherosclerosis are associated with an
increased tibial artery calcification (TAC) score, which is used as an independent
marker by Guzman and his colleagues.
Sangiorgi and colleagues (1998) have also proposed that quantification of calcified
arterial lesion should be used in histological studies rather than using lumen diameter
measurements because of arterial remodelling factors that might influence the predictive
value of atherosclerotic plaque burden. Overall, the significance of calcification in PAD
has been established but the mechanistic picture is still not clear.
Through histopathological study in this chapter, evaluation were made on; first, whether
lipid or calcium depositions are more predominant in arteries from lower limbs
amputated for non-traumatic causes and clinically diagnosed PAD, compared to the
controls. Secondly, PAD cases with and without diabetes were compared separately
with control samples from individuals without known PAD or diabetes.
5.2 Hypothesis and aim
Hypothesis - Patients with clinically severe PAD (needing amputation) have greater
arterial wall changes than in control subjects.
Aim: To assess the degree of arterial wall changes in terms of calcification and
lipid deposition on the arterial walls of PAD and controls. Further comparison was
made between samples having PAD with or without diabetes.
![Page 37: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/37.jpg)
22
5.3 Materials and Methods
5.3.1 Arterial samples
Segments 2-3 cm in length of the distal popliteal artery and its named branches
(peroneal, anterior and posterior tibial arteries) were harvested and immediately fixed in
1% paraformaldehyde and 0.6% sucrose for storage at 4⁰C. Prior to transverse
sectioning, 5 mm long arterial sections from three different intervals (of at least 15 mm
apart) were embedded in Tissue Tek® (Sakura Finetek U.S.A. Inc., Torrance, CA) and
frozen at -22⁰C. Serial cryosections of 8 µm thickness were prepared from each sample,
air-dried and fixed on positively charged, Super frost® glass slides. 81 tissue slides
were then subjected to routine Hematoxylin and Eosin (H&E) and Oil red O lipid
staining with at least two repeats.
5.3.2 Histopathological analysis
The severity of PAD was determined by counting the number of quadrants involved
with either calcification or lipid deposition. For each segment of a given arterial section,
one type of the lesion was scored with a specific staining i.e. H&E; dark blue staining
indicating calcification and Oil Red O; deep red droplet areas indicate lipid deposition.
Figure 5.1 below highlights a normal arterial sample with H&E staining (Figure 5.1A),
and a similar tissue from serial sectioning (Figure 5.1B), which indicates that the sample
is free from lipid deposition (no red staining). The following figure (5.1C) showed
minimal red staining in two different areas within the intima, were given a score of 2.
Arterial sample in Figure 5.1D were also given a score of 2 despite the larger area with
the red stain, because it extends over two quarter of the arterial cross section. The
scoring methods were adapted from Mozes et al. (1998) for the semi quantitative
assessment. The region where the lesion was found was taken into account i.e. lipid
deposition was counted as a lesion only if found in the intimal layer (see Figure 5.1D)
and calcified lesion was counted only if it appeared in the medial region (see arrows in
Figure 5.2).
Since the method chosen was a semi quantitative assessment, the scale is not linear and
may not represent the severity of other confounding lesions. The approach taken is to
identify each type of lesion, one at a time although in reality, both lesions may coincide
or influence each other. For example, a similar extent of calcification may be found in
Figure 5.2B and 5.2C but the lumen of the artery in Figure 5.2B is occluded (indicating
a more severe lesion) and given a score of 2 although the sample in Figure 5.2C is not
occluded, but given a score of 3 since it is a calcification scoring. If occlusion is taken
![Page 38: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/38.jpg)
23
into account, it will suggest a contribution from atherosclerotic lesion and not
calcification.
Figure 5.1 Scores of ‘0’ given for arterial section which are free from calcification
when stained with H&E (A) and free from lipid deposition when stained with Oil red O
(B). Scores of ‘2’ were given to both arterial sections in C and D. Scale bars at 200 µm.
C D
A B
![Page 39: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/39.jpg)
24
Figure 5.2 Calcification score was made using H&E staining as indicated by the dark
purplish area in each segmental quadrant. Examples of scores from 1-4 are shown. All
calcification was noted to be in the medial region. The arrows indicate areas of
calcification. Each box represents a quadrant of the arterial segment. Scale bars at 1mm
except for score 2 at 100 µm (shown by the black rectangle bar).
Stained slides were digitized using the ScanScope CS digital slide scanner (Aperio, San
Diego, CA) and analysed using the software programme Aperio Image Scope
v11.1.2.752 (www.aperio.com). The number of quadrants involved determined the
scores for each lesion, with a score of 0 indicating no lesions (Figure 5.1A) and Figure
5.2 showing a representative score for calcification, from a score of 1 for any lesion
found in a quadrant up to a score of 4; indicating the most severe lesion involving all
four quadrants in a given arterial section. Similar representative scoring were also
shown for lipid deposition but this time indicated by the arrows (Figure 5.3).
![Page 40: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/40.jpg)
25
Figure 5.3 Lipid scoring by quadrant involvement represented by the number of arrows
shown in each sample stained with oil red O. Lipid deposition indicating atherosclerosis
generally involved the intima. However, difficulty in scoring arises when the intimal
region became distorted with hyperplasia for example in B, C and D. Scale bars 200
µm.
5.3.3 Inter-scorer reliability
To assess inter-scorer reliability, a total of 133 slides were analyzed independently for
lesion scoring using standard light microscope. There were six scorers (blinded to
sample ID and grouping) and the mean scores were compared to the author’s (RZ score)
using Cohen’s kappa measurement of agreement. The kappa measure of agreement was
moderate (R=0.4) but the correlation between author’s scoring and the other observer’s
mean scoring was high (R=0.84) Figure 5.4. There is also good internal consistency,
with Cronbach’s alpha coefficient of 0.93.
C D
A B
![Page 41: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/41.jpg)
26
Figure 5.4 The mean scores from 6 different observers were plotted against the author’s
score. Positive correlation was seen with a correlation coefficient of 0.84.
5.3.4 Statistical analysis
Data were analyzed using SPSS (version 16.0; SPSS, Chicago, IL). Kruskal–Wallis for
more than two different groups and Mann Whitney non-parametric tests were used to
assess the comparison of the data. In all analyses, a p value < 0.05 was considered to be
statistically significant. Kappa inter-observer strength of reliability was measured and
plotted. Box plot diagrams indicate the median (± interquartile range; IQR) scores for
calcification and lipid deposition.
5.4 Results
5.4.1 Subject population
There was a significant difference between the age of PAD cases (mean age 65 ± 13.5
years SD) and control cases (78 ± 8 years SD), using an unpaired t test (p =0 .02).
5.4.2 Differences between arterial location of deposit
The scoring of both calcification and lipid deposition did not differ between location of
the arteries harvested from the amputated leg of PAD and controls. A Kruskal-Wallis
ANOVA indicated that there were no statistical differences between the scores given to
calcification assessment for anterior tibial artery (ATA) Mean Rank = 42.89, posterior
tibial artery (PTA) Mean Rank =38.76, and popliteal artery (POP) Mean Rank =41.29,
![Page 42: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/42.jpg)
27
H (corrected for ties) =0.455, df =2, N =81, p =0.796, Cohen’s f (effect size =0.005)
was small. Figure 5.5A shows the box plot representation with median scores.
There were also no statistical differences between the scores given to lipid deposition
(Figure 5.5B). Atherosclerosis assessment for ATA (Mean Rank = 43.14), PTA (Mean
Rank =36.06), and POP (Mean Rank =43.83), H (corrected for ties) =1.902, df= 2, N
=81, p=0.386; Cohen’s f (effect size =0 .024) was small.
A p=0.796 B p=0.386
ATA
PTAPO
P
0
1
2
3
4
Ca
lcif
ica
tio
nS
co
res
ATA
PTAPO
P
0
1
2
3
4
Lip
idS
co
res
Figure 5.5 Median scores of calcification and lipid deposition are shown in the box
plots (A and B respectively) indicating no significant difference between the different
arterial locations from the lower limb arteries. Interquartile range (IQR) for calcification
scoring was between 3 to 4, and IQR for lipid scoring was 2 for all types of arteries.
5.4.3 Calcification scores in PAD cases and controls
Generally, all calcifications in the samples were noted to be in the medial layer where
the main bulk of ASMC reside. The severity of calcification was scored from 0 to 4 and
data for medians are represented in the box plot diagrams in Figure 5.6A. The Mann
Whitney U test indicated that there is statistically significant higher scores given to
calcification assessment for PAD cases (Mean Rank =46.04) compared to controls
(Mean Rank =33.67), H (corrected for ties) =5.726, df =1, N =81, p =0.016; Cohen’s f =
0.072, which is a moderate effect size.
5.4.4 Calcification scores in PAD cases with or without diabetes
Cases of PAD with diabetes showed a higher trend for calcification score but the
difference was not statistically significant from non-diabetic PAD cases (Figure 5.6B).
Calcification scores for cases with diabetes (Mean Rank = 26.61) and PAD cases
![Page 43: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/43.jpg)
28
without diabetes (Mean Rank = 21.55) showed a median of 3 and 1 respectively with a
large IQR for both groups. Mann Whitney U test indicated p =0.198, H (corrected for
ties) =1.658, df =1, N =48. The effect size calculated using eta squared, was small at
0.035.
A * p=0.016B p=0.198
Contr
ol
PAD
0
1
2
3
4
Ca
lcific
atio
ns
co
res
Non
DM
PAD
DMPA
D
0
1
2
3
4
Ca
lcif
ica
tio
nS
co
res
Figure 5.6 Median of calcification scores are shown for control and PAD cases in (A)
and between non-diabetic PAD and diabetic PAD in (B). The IQR for control is 2 and
PAD cases IQR is 4.
5.4.5 Lipid scores in PAD cases and controls
Atherosclerosis was classically represented with lipid deposition in the intimal region
(Figure 5.3). Only the quadrant stained positively red with Oil red O were counted for
ranking the severity and data for medians of PAD cases and controls are represented in
box plot diagrams in Figure 5.7A.
Mann Whitney U tests indicated that there were no statistically significant differences
between the scores given to lipid deposition on quadrant involvement. Mean rank of
lipid scores for amputated PAD cases was 38.94 and controls was 44.00, H (corrected
for ties) = 0.957, df = 1, N =81, p=0.314, Cohen’s f =0 .012. Figure 5.7A indicated the
median (± IQR) of PAD cases without DM is 3 ± 2, and PAD cases with DM is 2 ± 3.
5.4.6 Lipid scores in PAD cases with or without diabetes
There was no significant difference when atherosclerotic scores were compared
between diabetic and non-diabetic PAD cases. Atherosclerosis scoring for diabetic
*
![Page 44: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/44.jpg)
29
presence (Mean Rank = 24.00) was not significantly higher compared to cases without
diabetes (Mean Rank = 25.20), H (corrected for ties) = 0.091, df = 1, N =48, p=0.763;
Cohen’s f =0.002. Figure 5.7B shows the median (± IQR) of PAD cases without DM is
3 ± 3 and PAD cases with DM is 2 ± 2.75.
A p= 0.314 B p=0.763
Contr
ol
PAD
0
1
2
3
4
Lip
idS
co
res
Figure 5.7 Median and IQR of lipid scores are shown for control and PAD cases (A)
and between non-diabetic PAD and diabetic PAD (B).
5.5 Discussion
The prevalence of PAD is known to increase with age (Norman, Eikelboom, & Hankey,
2004). However, aging is not the only risk factor for PAD progression. This study has
demonstrated that the control group, which represents the “healthy” aging population,
showed significantly lower calcification scores compared to the cases with PAD. These
findings further support the studies of Guzman and others (2008), that calcification
could be the targeted as a modifiable risk factor for intervention. The early works by
Blumenthal and others (1944) also confirmed that Hematoxylin and Eosin staining is
adequate for determining calcified lesions in arterial walls.
Given that arterial calcification may contribute to increased arterial wall stiffness,
enhanced stiffening could be due to pathological causes. Mitchell and others (2004)
![Page 45: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/45.jpg)
30
have observed a relationship between aging and increase arterial wall stiffness in the
central arterial trunk but not in the peripheral arteries. The mean age of their study
sample is 56 years old for men and 57 years old for women and these participants are
relatively free of cardiovascular disease risk factors. They used arterial tonometry to
assess central (carotid-femoral) and peripheral (carotid-brachial) pulse wave velocity
and concluded that there is an age-related increase in aortic stiffness.
In the study by Soor and others (2008), the severity of calcification in diabetic arteries
were found to be greater than in non-diabetic arteries, whereas in this study the
calcification score did not differ between cases with underlying diabetes or not. This
could be due to the larger coefficient of variation (measured by IQR) for calcification
scores in the dataset, limiting the ability to detect modest associations for diabetes and
arterial calcification. However, a trend similar to Mozes and others (1998) can be seen
where the diabetic cases showed slightly higher calcification than non-diabetic cases.
Interestingly, the lipid deposition score did not differ between cases and controls or in
cases with or without diabetes. Indeed, the control group showed a higher trend for lipid
scores but it was not statistically significant. The limitation in detecting significant
changes could be due to the sensitivity of the scoring system. The lipid scoring took into
account the number of quadrants involved, for example a score of ‘2’ was given for
both Figure 5.1C and 5.1D despite area or volume differences of the red stained lipid
droplets and clinical severity such as stenosis (e.g. Figure 5.1C) was not assessed by
this scoring of quadrants. Although stenosis is best determined by the diameter of the
lumen, Sangiorgi and others (1998) also demonstrated that stenosis graded by luminal
diameter did not correlate with plaque burden whereas calcium quantification did.
In summary, the main histopathological findings in this study include early
atherosclerotic lesion, which could be seen in both PAD cases and cadaveric controls,
whereas arterial calcification is particularly seen in PAD cases with or without diabetes.
![Page 46: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/46.jpg)
31
CHAPTER 6: EXPRESSION OF RANK ANDCX3CR1 IN ARTERIES DERIVED FROMPERIPHERAL ARTERIAL DISEASE
6.1 Introduction
Both atherosclerotic lesions and medial calcification play important role in PAD
progression. However, factors that propagate these arterial wall lesions remain to be
elucidated. Atherosclerosis, which is known to be a chronic inflammatory disease, have
been linked with events of infiltration of monocytes and other inflammatory cells to the
site of “injury” (Ross, 1999). Given the similar pathology that coronary disease and
PAD may share, several inflammatory factors were investigated for their significant role
in atherosclerosis (i.e. CCR2 and CX3CR1) and RANK, for its specific influence on
calcified arterial wall lesions (Butoi et al., 2011; Heymann et al., 2012).
Several biomarkers have been associated with the progression of PAD. Amongst
prominent biomarkers, the molecular triad of osteoprotegerin (OPG), receptor activator
of nuclear factor kappa B (RANK) and its ligand (RANKL) have been associated with
arterial calcification or pathophysiologic bone remodelling (Mabilleau, Petrova,
Edmonds, & Sabokbar, 2008; Ndip, Williams, Jude, & Serracino-inglott, 2011). The
OPG/RANK/RANKL triad plays a pivotal function in bone metabolism, vascular
biology and immunity. Bucay and others showed that OPG-deficient mice exhibited
medial calcification of the aorta and renal arteries with an early onset of osteoporosis
hence the introduction of the so-called “osteoprotective” factor OPG (Bucay et al.,
1998). In humans, a paradoxical picture was seen when increased OPG plasma
concentration was positively associated with severity of PAD (Ziegler et al. 2005,
Poulsen et al. 2011). High OPG levels were also associated with all-cause mortality in
type 2 diabetic patients (Reinhard et al., 2010).
RANKL, when present at high levels, may compete with OPG for the binding site on
RANK. It is still not clear how elevated RANKL concentration may promote arterial
wall calcification. Physiologically, RANKL is expressed by osteoblasts to activate and
promote activation of osteoclasts through binding with RANK. Thus, many studies have
postulated a role for osteoclasts in vascular calcification (Byon et al., 2011; Heymann et
al., 2012). If RANKL predominates, the osteoclast precursor monocytes will proliferate
![Page 47: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/47.jpg)
32
and commit to become osteoclasts and express the marker tartrate-resistant acid
phosphatase (TRAP). With the presence of osteoblast-like and osteoclast-like cells in
the vascular wall, there is a high chance that the remodelling process taking place will
deviate towards arterial wall calcification. Byon and others’ (2011) findings support the
accelerated calcification by increased osteoclast activity, which indirectly re-modeled
the calcified plaques. Bone-like plaque formation in the intima however, is distinctive
from medial wall calcification. In that the intima resembles an endochondral type of
bone formation while medial calcification resembles that of the non-endochondral type
(Vattikuti & Towler, 2004).
This study is proposing that RANK expression could be present on the ASMC instead
of the polymorphonuclear cells, and fit with the proposal of Panizo et al. (2009) on the
influence of RANKL on ASMC to directly promote phenotypic modulation. Ndip and
colleagues (2011) have also proposed that OPG and RANKL are important modulators
in bone homeostasis and are frequently associated with vascular calcification. It is
hypothesized that RANK would be up-regulated in pathological arteries.
6.2 Hypothesis and Aim
Hypothesis – The expression of inflammatory and bone-related markers is associated
with the severity of arterial calcification and/or lipid deposition in the arterial walls of
PAD and controls.
Aim: To investigate the expression of the inflammatory and bone-related
markers: CCR2, CX3CR1, TRAP and RANK in association with the severity of arterial
calcification and/or lipid deposition in the arterial walls of PAD and controls. Further
comparison was made between samples having PAD with or without diabetes.
6.3 Materials and Methods
6.3.1 Patient demographics
As presented earlier (Chapter 4).
6.3.2 Tissue immunofluorescence study
Arterial tissue sections from a series of sections were investigated for the presence of
antigens: CCR2, CX3CR1, RANK, alpha-smooth muscle actin (SMA) and leukocyte
common antigens: CD45 and CD68. Tissue slides were hydrated in PBS, separately
![Page 48: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/48.jpg)
33
incubated overnight in 3% bovine serum albumin with either mouse anti-human CKR-2
(1: 100; Santa Cruz Biotechnology), rabbit anti-human CX3CR1 (1:50; AbD, Serotec),
mouse anti-human RANK (1:100; Santa Cruz Biotechnology) mouse anti-human SMA
(1:200; Santa Cruz Biotechnology), FITC mouse anti-human CD45 (1:100; BD
Bioscience) or Alexa Fluor ® 647 mouse anti-human CD68 (1:100; BD Bioscience).
Samples for intra-cellular staining i.e. alpha SMA were initially permeabilized with
0.1% Triton-X for 5 minutes at room temperature (RT) to increase antibody penetration.
Following overnight incubation, tissue slides were washed three times and incubated
with Alexa Fluor® 488 (1:200; Invitrogen) conjugated anti-rabbit or anti-mouse (as
required) for a minimum of 60 minutes at RT. Nuclear staining was also introduced
during the secondary antibody incubation, using DAPI (4’, 6-diamidine-2’-phenylindole
dihydrochloride, 10ng/ml, Roche Diagnostics, Mannheim, Germany). For negative
controls, tissue slides were incubated without the primary antibodies. Slides were
washed another three times before mounting (Dako Cytomation, Carpinteria, CA,
USA). The samples were then analysed and documented using multiphoton confocal
laser scanning microscopy (Leica TCS SP2).
6.3.3 Detection of tartrate-resistant acid phosphatase (TRAP)
The phosphatase substrate ELF97 (Molecular Probes now Invitrogen) was used for the
detection of TRAP activity in osteoclasts as previously described (Filgueira, 2004).
Briefly, arterial sections on glass slides were hydrated in distilled water and
subsequently incubated with 200µM ELF97 in 110 nM acetate buffer staining solution
(pH5.2), 1.1 mM sodium nitrate and 7.4 mM tartrate (all from Sigma-Aldrich) and left
overnight in a humidified chamber at RT. After screening for a positive reaction, the
enzymatic reaction was halted by rinsing in distilled water. Other nuclear staining was
then introduced using DAPI (10ng/ml); Roche Diagnostics, Mannheim, Germany. After
mounting, the samples were analysed and documented using Nikon Inverted
Microscope Eclipse TE 300 with a Nikon CCD digital camera.
6.3.4 Statistical analysis
A Pearson’s chi-square test of contingencies (with α = 0.05) was used to evaluate
whether expression of the inflammatory and bone-related markers: CCR2, CX3CR1,
TRAP and RANK positivity is related to PAD with or without diabetes.. Chi square test
for independence with Yates Continuity Correction were also use to determine an
association between two different groups.
![Page 49: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/49.jpg)
34
6.4 Results
6.4.1 Immunohistological findings of pan leukocytic markers and SMA
Serial sections from PAD arteries were stained with pan-leukocytic marker and
monocyte-derived macrophage marker (CD45 and CD68 respectively) to determine the
presence of inflammatory cells in the regions prone for atherosclerosis. However, none
of the samples showed expression of the leukocytic or monocytic markers. Positive
control staining has been tested on fixed mononuclear cells on cytospins and in flow
cytometry, indicating that the antibody works on fixed cells. In addition, there was cells
found to be positively stained with the tested antibody, indicating immune cells were
found in the small blood vessels of the tissues.
Evidence for atherosclerosis was only found when expression of alpha-SMA was
present in the intima, apart from its usual location in the media (see Figure 6.1A). This
indicates intimal thickening, which most probably occur in arteries due to migration of
the ASMC into the intimal region. Other PAD samples, which showed severe
calcification, expressed fewer alpha-SMA in their medial region (Figure 6.1B).
6.4.2 Immunohistological findings of inflammatory and bone markers
To determine which inflammatory marker could be detected in association with
PAD, freshly isolated arteries from amputated lower limbs were carefully fixed
and examined by immunofluorescence microscopy. Separate arteries sampled from
ten PAD cases were serially sectioned and each stained with different test
antibodies against RANK, CX3CR1, CCR2, RANKL and fractalkine. Each slide
was evaluated with confocal microscopy for the expression of positive AF488
emission from positively tagged antibodies.
As shown in Figure 6.1C and 6.1E, RANK is mainly expressed in the medial
regions. Twenty-five percent of arteries derived from non-diabetic limbs and 75%
of samples derived from diabetic limbs stained positively for RANK (see Figure
6.3B). The chi square test was statistically significant, x² (1, N =24) = 6, p = 0.014.
The association between RANK and diabetic presence was quite strong with phi =
1.2.
There was positive CX3CR1 staining in 75% of arteries derived from non-diabetic
amputations and 83% of samples derived from diabetic amputations (Figure 6.3C).
A Chi-square test for independence (with Yates Continuity Correction) indicated
no significant association between CX3CR1 positivity and diabetes status, x² (1, N
=30) = 0.31, p = 0.576, phi = 0.06.
![Page 50: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/50.jpg)
35
CX3CR1 expression was found diffusely all over the media and intima of arterial
samples derived from amputated PAD cases. They were also expressed in both
calcified and non-calcified media e.g. Figure 6.2B and 6.2D. None of the
amputated arterial samples expressed CCR2, RANKL or fractalkine. Control
samples also did not show expression for all these markers (see Figure 6.2E and
6.2F).
Figure 6.1 Presence of alpha SMA (stained fluorescent green) in both the media
100um
![Page 51: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/51.jpg)
36
and intima (arrow indicating intimal layer). For calcified arterial wall section (B),
alpha SMA staining in the media was reduced. RANK expression (stained
fluorescent green) was positive in non-calcified amputated artery in (C) and
calcified artery in (E). D and F are the corresponding DAPI nuclear staining (blue)
for samples in C and E, respectively.
![Page 52: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/52.jpg)
37
Figure 6.2 Control sample without primary antibodies (A and C) correspond to samples
in B and D, which were incubated with CX3CR1 and showed positive expression
(stained green with AF488). Aand B represents the calcified arteries, whereas C and D
represents atherosclerotic samples (arrow indicating the intima). E and F are control
arterial sections showing no expression of RANK and CX3CR1 respectively. Scale bars
= 100um.
![Page 53: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/53.jpg)
38
A B C
Figure 6.3 Non-DM and DM PAD arterial samples (shown in A) did not differ
significantly in calcification severity (p= 0.126; N=53, x² =2.34). However, diabetic
arterial samples showed a significantly higher expression of RANK (B), suggesting a
moderate relationship between DM and RANK with phi and Cramer’s V at 0.5 (p=
0.014; N= 24, x² =6.0). CX3CR1 expression in non-DM and DM arterial samples (C)
were not significantly different.(p= 0.576; N=30, x² =0.312).
6.4.3 Tissue TRAP activity
To characterize the presence of osteoclast-like cells in the tissues, fluorescent tartrate
resistant acidic phosphatase (TRAP) and nuclear staining with DAPI was performed.
Positive fluorescence emission was detected in calcified regions (Figure 6.4B) and also
atherosclerotic regions in the intima (Figure 6.5A), with small regions starting to calcify
(Figure 6.5C, see arrow). These areas also coincide with the presence of multinucleated
cells (Figure 6.5D). Positive TRAP staining is indicative of osteoclastic activity in the
calcified region.
![Page 54: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/54.jpg)
39
A B
C D
Figure 6.4 Medial calcification seen in the control groups (A; without TRAP staining
and B; with TRAP staining) indicates positive TRAP activity surrounding the calcified
region (green fluorescent dots). Arterial sample from non-DM PAD (C) and DM PAD
(D) showed calcified region with some expression of TRAP. Scale bar 100µm.
![Page 55: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/55.jpg)
40
Figure 6.5 Samples with minimal calcification but having clear lipid deposition (A),
stained positive green with TRAP in B. The calcification area indicated by an arrow in
magnified image C. Negative control or control with secondary antibody only, shown in
D. Scale bar in A;400µm, B and D ;1000µm and C; 50µm.
6.5 Discussion
Complications of PAD may arise from progressive underlying arterial wall changes and
active vascular remodelling. Understanding the biologic basis of vascular remodelling
is, therefore, critical to prevent disease progression and clinical complications of PAD.
Recently, there has been a surge of interest in bone regulating factors such as OPG and
RANKL in PAD research (Poulsen et al., 2011). These key bone regulators have been
shown to be involved in vascular remodelling since 1997 (Bucay et al.1997). OPG was
positively related to the extent of aortic and valvular calcification in patients with
coronary arterial disease. Similarly, OPG is also linked to severity of PAD (Ziegler et
al. 2005; Poulsen et al. 2011). There is also an association between diabetes and
increased OPG serum level in this group of patients (Knudsen et al., 2003; Secchiero et
al., 2006).
This study has shown that the calcification in amputated PAD was generally found in
the media. Both the media and intima seem to be devoid of inflammatory cells such as
macrophages or monocytes. For medial calcification, it is accepted that no inflammatory
cells will be present and this is consistent with the findings of Jeziorska, McCollum and
Woolley (1998). Interestingly, TRAP positive staining suggested that osteoclastic
![Page 56: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/56.jpg)
41
activity is seen in the media, and osteoclasts are known to derive from the monocytic
precursors. The presence of osteoclastic activity also suggests that there is a bone-like
mechanism in place of the arterial wall. It could be that there is a direct type of bone-
like formation through trans-differentiation of ASMC which is responsible for the
arterial calcification (Panizo et al., 2009; Steitz et al., 2001). Due to the pathological
remodelling, osteoblast-like cells in the media promote monocytes differentiation
towards osteoclasts, instead of the activation into macrophages and dendritic cells
which is more common for an atherosclerotic lesion.
Positive staining for RANK on arterial SMC was seen in the media of both diabetic and
non-diabetic arteries. No positive expression of RANKL was found, in agreement with
the report by Schoppet et al. (2004). It could be that the ligands were cleaved into their
soluble forms and washed away during the staining steps. The soluble form of RANKL
may be counteracted by the actions of OPG and this may fit with the reports that up
regulation of OPG may act directly or indirectly act on the arterial SMC (Poulsen et al.,
2011; Ziegler et al., 2005). RANK expression on the arterial SMC could also suggest an
osteoblast-like phenotype for the SMC in diseased arteries. Medial calcification
certainly differs in mechanistic formation, and this may be implicated with the
molecular triad RANK/RANKL/OPG. Ndip and others (2011) have depicted a probable
pathway in which RANK expression on ASMC may interact with RANKL/OPG (see
Figure 6.6).
CX3CR1 expression on ASMC has been documented by Lucas and colleagues (2003).
Similarly, CX3CR1 were found to be positively expressed in ASMC derived from both
diabetic and non-diabetic PAD cases. Butoi and others (2011) proposed that there is an
interaction between ASMC and the inflammatory cells (monocytes) via the CX3CR1-
CX3CL1 axis, which promotes atherosclerosis formation. In the context of vascular
calcification, the same axis has also been found to promote calcification if soluble
fractalkine induced the migration of bone marrow derived osteoclast precursors and
bound to CX3CR1 expressed on the arterial SMC (Koizumi et al., 2009). This axis is
useful when both attraction of osteoclast precursors and subsequent cell-cell interactions
are required. The evidence may be seen in increased osteoclast-like activity marked by
positive TRAP staining.
Another inflammatory marker, which was not found, is the CCR2 or MCP-1 receptor.
However, this marker is important in the early stage of atheroma formation as it acts
mainly to recruit monocyte-macrophages (Roijers et al., 2011; Wong et al., 2002).
![Page 57: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/57.jpg)
42
CCR2 expression may not be present, as it may not have a specific role for vascular
calcification.
The immunohistological findings from this study emphasized the possible role of
certain inflammatory and bone inducing factors in calcification seen in severe PAD
cases recruited in this study. These findings could raise the possibility of anti-
inflammatory therapy in modulating the role of RANK and CX3CR1 in vascular
calcification. In the next chapter the phenotypic markers of the smooth muscle cells
grown from PAD samples will be determined and their osteoblast-like feature and
associated membrane surface markers will be evaluated.
Figure 6.6 External stimuli (hyperglycemia, inflammation resulting from trauma,
infection, or other injury) activate certain cells to release RANKL. When the
RANKL/OPG ratio is high as in PAD (A), RANKL binds to its receptors (RANK) on
ASMC to activate NF-κB and cause downstream cell signaling cascades, resulting in
osteoblastic differentiation and deposition of mineralized matrix leading to arterial
calcification. However, when the OPG levels are high or the RANKL/OPG ratio is not
elevated (B), OPG acts as a decoy receptor mopping excess RANKL and preventing
human ASMC from undergoing osteoblastic differentiation and mineralization. (Image
taken from Ndip et al. 2011).
![Page 58: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/58.jpg)
43
CHAPTER 7: THE OSTEOBLAST-LIKEPHENOTYPE IN PAD SMOOTH MUSCLECELLS
7.1 Introduction
Physiological remodelling of the arterial wall should involve a normal turnover of cells
that sustain normal structure and function of the arterial wall. There is evidence that the
adult vasculature contains stem cells with the ability to differentiate into mesenchymal
stem-like cells that can subsequently differentiate into smooth muscle cells. These stem
cells, known as multipotent vascular stem cells were recently described by Tang and
colleagues (2012). They showed that these stem cells express markers such as Sox17,
Sox 10, S100β and neural filament-medium polypeptide and can further differentiate
into a proliferative and “synthetic” smooth muscle phonotype, which may contribute to
the pathological remodelling of the arterial wall. Another group (Phinney & Prockop,
2007), listed a few markers that are commonly present on multipotent mesenchymal
stromal cell which have the propensity to differentiate into osteoblast, adipocytes or
chondrocytes. They described the cells as having positive Stro-1 and lack the definitive
hematopoietic lineage markers such as CD11b, CD14 or CD45. However, it is
suggested that these cells display “plasticity” in response to the microenvironment they
are placed in. For example, low level of endotoxemia may induce expression of
functional membrane-bound CD14 in human coronary ASMC (Stoll et al., 2004). Ndip
and others (2011) also proposed that external stimuli could induce changes that
promotes release of significant inflammatory factors such as RANKL which could
influence ASMC phenotype and function. Thus, investigating the relevant markers on
cells derived from PAD samples will shed some light on the function and activity of the
cells. In order to show that these cells could differentiate into osteoblast-like cells, the
important transcriptional factors such as Runx2 and Osterix, will be investigated. Runx2
which is a key regulator of osteoblastic differentiation, still require the activation of
Osterix (Ducy et al.,1997; Komori et al., 1997). In mesenchymal cells, Runx2 has been
shown to bind to the Osterix promoter gene to regulate transcription (Nishio et al.,
2006).
Data presented in Chapter 6 indirectly supports the theory of phenotypic plasticity of the
smooth muscle cells because alpha smooth muscle actin (alpha-SMA) expression
indicates the ASMC lineage were present in the neo-intima and calcified media.
Similarly, RANK and CX3CR1 were expressed in the area, which has been stained
![Page 59: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/59.jpg)
44
positive with alpha-SMA in respective serial sections. The ability of the ASMC to
undergo phenotypic change has give rise to the description of the “synthetic”
phenotype, which marks the arterial disease process of either atherosclerosis or
Monkeberg’ sclerosis (Iyemere et al., 2006). The de-differentiation of ASMC, from the
contractile to the proliferative or synthetic phenotype has underly the basis of arterial
remodelling in disease processes.
By growing arterial SMC from PAD amputated cases, this chapter studies the
phenotype of cells from diseased arteries to be compared against control fetal derived
cells. This chapter describes the use of an in vitro model to investigate the markers
relevant to calcification such as RANK and CX3CR1. It is proposed that the expression
of RANK and CX3CR1 on ASMC controls active remodelling in the arterial wall of
PAD.
This current study will first determine the characteristic features of cells grown from
PAD arteries and analyze the features of ASMC such as alpha smooth muscle actin,
desmin and vimentin (Gabbiani et al., 1981). These cells will be further compared with
the control cell lines derived from fetal aortic samples. The phenotype and function of
these cells will be further investigated for other inflammatory markers such as
CX3CR1, CCR2, CCR4, TLR4, CD14, CX3CL1 and RANKL.
7.2 Hypothesis and Aims
Hypothesis (a) - The calcification phenotype (osteoblast-like cells) is up-regulated in
ASMC derived from the arterial wall of patients with PAD.
Aim: To characterize PAD-derived and human fetal aorta-derived ASMC for
expression of markers, specific for smooth muscle cells (alpha-SMA, desmin),
fibroblast (vimentin), osteoblasts (Osterix, Runx2) and mesenchymal precursor
cells (Stro-1).
Hypothesis (b) - The inflammatory and bone-related cell surface markers
(CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4) are up regulated in ASMC
derived from the arterial wall of patients with PAD.
Aim: To investigate the expression of inflammatory and bone-related cell surface
markers in PAD-derived ASMC and human fetal aortic smooth muscle cells,
including CX3CR1/L1, RANK/L TLR4, CD14, CCR2 and CCR4.
![Page 60: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/60.jpg)
45
7.3 Materials and Methods
7.3.1 Cell culture
Primary cultures of human arterial smooth muscle cells were generated in vitro. Briefly,
arterial segments were kept in DMEM/F12 and antibiotics (10,000 U/mL penicillin G
sodium, 10,000 μm/mL streptomycin sulphate and 25μg/mL amphotericin B in 0.85%
saline; Gibco) for the transport from the theatre to the laboratory. Samples were
processed within 5 hours after amputation. Segments of the arteries were minced under
sterile conditions and transferred into 25cm2 culture flasks (Corning/Starsted)
supplemented with fresh DMEM/F12, 20% fetal calf serum and 1% antibiotics. Success
rate was evaluated after 3 weeks in culture. Human fetal ASMC (from the American
Type Culture Collection, Manassas,Virginia) were used as control cells and kept under
the same culture condition as the patient derived cells. The cells were incubated at 37°
C with 5% Co2 under humidified conditions and passaged when almost confluent. Cells
were used for experiments between passage 3 and 9, after reaching 80-90% confluency.
7.3.2 Flow cytometry and fluorescence microscopy
Cells for morphological study were grown separately onto glass cover slips placed in 24
well cell culture plate with flat-bottom wells (Sarstedt). The same antibodies were used
for flow cytometry and glass cover slips staining. Incubation with listed primary
antibodies (as given in Table 7.1) followed several washing steps before incubation with
respective secondary antibodies (Table 7.1). Corresponding labeled isotypes or
unstained controls were included in all experiments.
Morphologically, stained cells on cover slips were analysed with CoolSNAP ES digital
camera (Photometrics, Tucson, AZ) on a Nikon Eclipse 90i fluosrescent microscope.
For flow cytometry, live cells were scrapped and fixed before the standard staining
protocol was introduced. Fluorescent quantification was performed with FacsCallibur
(BD Biosciences). The recorded data were analyzed using Flowjo Software
(Treestar,Ashland,OR). Flow cytometry analysis included unstained controls and
isotype antibodies to account for autofluorescence or non-specific antibody binding.
7.3.3 Data and statistical analysis
The data obtained post-gating were corrected (minus auto fluorescence value) and
standardized against control to get the mean fluorescent score or standardized mean
difference (SMD). A one-way ANOVA with LSD post hoc tests were used to test mean
![Page 61: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/61.jpg)
46
differences in expression of the phenotypic and/or inflammatory markers. A p-value of
less than 0.05 was considered statistically significant. Data were statistically analysed
with SPSS software (version 17.0; Chicago, IL) and GraphPad Prism® version 6.0
(trial). Error bar indicates standard deviation.
Table 7.1. List of primary and secondary antibodies used
Primary Antibody Company and
dilution
Secondary antibody
and dilution
(All from Invitrogen
unless stated
otherwise)
Mouse Anti-Smooth-
Muscle Actin antibody
(anti-α-SMA)
Isotype: Monoclonal IgG2b
with1 min permeabilization
time
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:200
Mouse Anti-Vimentin
antibody
Isotype: Monoclonal IgM
10 mins permeabilization
time
Sigma-Aldrich
(1:50)
Goat Anti-mouse IgM
(FITC) AbD Serotec
1:100
Mouse Anti-Desmin
Isotype: Monoclonal IgG1
No permeabilization
Sigma, USA
(1:50)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:100
Rabbit Anti- Osterix
Isotype: Polyclonal IgG
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-rabbit IgG
(Alexa Fluor 488)
1:200
Mouse anti-human Runx2
Isotype: Monoclonal IgG2b
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:200
Stro-1 IgM
Hybridoma cell line
Culture supernatant
(1:1)
(from Development
Studies Hybridoma
Bank)
Goat Anti-mouse IgM
(FITC) AbD Serotec
1:200
Mouse Anti-human CKR-2
Isotype:Monoclonal IgG
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:200
![Page 62: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/62.jpg)
47
Pe-Cy7 ™ Mouse Anti-
Human CD194 or CCR4
Isotype: Monoclonal IgG1
BD Pharmingen
(1:100)
Pe-Cy7 ™ labeled
mouse IgG1 isotype
1:100
Mouse Anti-RANK
Isotype: Monoclonal
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:200
Mouse Anti-RANKL
Isotype: Monoclonal
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:200
Rabbit anti-human
CX3CR1
Isotype: Polyclonal IgG
No permeabilization
AbD Serotec
(1:100)
Donkey Anti-rabbit IgG
(AlexaFluor 488)
1:200
Rabbit anti-rat with 20%
cross-reactivity to Human
fractalkine
(CX3CL1)
Isotype: Polyclonal IgG
No permeabilization
Torrey Pines
(1:100)
Donkey Anti-rabbit IgG
(AlexaFluor 488)
1:200
PE ™ Mouse Anti-Human
CD14
Isotype: Monoclonal IgG
Becton Dickinson &
company
(1:100)
PE ™ labeled mouse
IgG isotype
(Becton Dickinson &
company)
1:200
Mouse Anti-Human TLR4
Isotype: Monoclonal IgG1
Santa Cruz
Biotechnology,Inc.
(1:100)
Donkey Anti-mouse
IgG (Alexa Fluor 488)
1:100
7.4 Results
7.4.1 Characterisation of ASMC according to lineage markers
Cells grown from PAD and control samples were tested for expression of lineage
markers using fluorescence microscopy. Both adherent cell lineages displayed slightly
elongated cells with hills and valleys characteristic of the arterial smooth muscle cells
(Figure 7.1A). The fetal aortic smooth muscle cells were positive for alpha smooth
muscle cell actin (SMA), slightly positive for vimentin and negative for desmin
expression. PAD derived cells generally exhibited positive SMA, vimentin and desmin
indicative of a myofibroblastic nature, as well as Stro-1, indicating a precursor stage
with stem cell properties. Flow cytometry was used to quantify marker expression and
the pooling of several cell lines results, after standardization using their negative
![Page 63: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/63.jpg)
48
controls. Flow cytometry allows an indicative measurement of marker expression and in
this study, showed a relatively higher expression of vimentin, desmin, Stro-1, Osterix
and Runx2 in PAD samples when compared to the controls (representative bar charts
given in Figure 7.2). PAD derived cells also displayed detectable level of bone
transcription factors Runx2 and Osterix, although not significantly higher than control
cells (Figure 7.2E and 7.2F). In a representative histogram (shown in Figure 7.3), Stro-1
was expressed more in PAD derived ASMC compared to the fetal aortic smooth muscle
cells.
A Fetal Aortic SMC B DM PAD ASMC
C Fetal Aortic SMC D Skin Fibroblast Cells
Figure 7.1. Cells in the first row (A and B) were stained with alpha smooth muscle
actin (green). Cells in the second row (C and D) were stained with vimentin (red) which
is strongly positive for the skin fibroblast cells (used as positive control).
![Page 64: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/64.jpg)
49
A p=0.764 B p=0.176
alpha-SMA
SM
D
Contr
ol
Non
DMPA
D
DM
PAD
0
1000
2000
3000
Vimentin
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
1000
2000
3000
4000
5000
C p=0.384 D p=0.272
Desmin
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
200
400
600
800
Stro-1
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
500
1000
1500
2000
E p=0.395 F p=0.488
Osterix
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
200
400
600
Runx-2
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
200
400
600
Figure 7.2 Phenotypic marker expression compared between control cells and ASMC
derived from non-diabetic and diabetic PAD. The assessments were made from pooled
flow cytometry data but standardized against unstained controls and respective
secondary or isotype antibodies. (SMD: standardized mean differences from median
fluorescent intensity). SMD ± SD.
![Page 65: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/65.jpg)
50
Fetal Aortic SMC PAD ASMC
Figure 7.3 Intracellular phenotypic markers assessed by flow cytometry representing
the control (fetal aortic smooth muscle cells) and PAD arterial smooth muscle cell
lineage. The cells were gated based on cell size and granularity (forward scatter and side
scatter) after labeling with respective markers. Median fluorescent intensity from blue
histograms (as test markers) was corrected against the controls (in red histogram).
7.4.2 Characterisation of ASMC according to inflammatory markers
ASMC explanted and grown from PAD arterial samples expressed RANK and
CX3CR1. Interestingly, their respective ligands, which are membrane-bound RANKL
and CX3CL1, were not visible in arterial tissues (as examined in chapter 6) but seen
positive on PAD explanted ASMC when examined through flow cytometry. The
cellular surface markers for CX3CR1, CCR4 and RANK were shown in cells cultured
on glass cover slips (Figure 7.4).
![Page 66: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/66.jpg)
51
Figure 7.4 Cover slips grown ASMC (derived from PAD samples) expressing
CX3CR1, CCR4 and RANK in (green fluorescent) with their respective negative
controls in the lower row. Blue fluorescent were the nuclear staining with DAPI.
Magnification at x20.
Since PAD is related to chronic inflammatory processes, an array of surface
inflammatory markers such as CX3CR1, RANK, CX3CL1, RANKL, CCR2, CCR4,
TLR4 and CD14 were investigated through flow cytometry. Figure 7.5 lists the one-way
ANOVA comparisons of the mean SMD between controls (fetal aortic SMC) and PAD
derived ASMC (which were further divided into non-diabetic and diabetic derived
samples). There were no significant differences between the groups but RANK showed
a trend to have increased expression in diabetic PAD derived samples as compared to
the rest of other cell groups (Figure 7.5A).
![Page 67: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/67.jpg)
52
A p =0.052 B p =0.592
RANK
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
1000
2000
3000
m-RANKL
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
1000
2000
3000
4000
C p =0.575 D p =0.725
FKNrc
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
500
1000
1500
CX3CL1
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
1000
2000
3000
4000
E p =0.209 F p =0.653
CCR2
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
100
200
300
400
500
CCR4
SM
D
Contr
ol
Non
DMPA
D
DMPA
D
0
500
1000
1500
2000
G p =0.527 H p =0.073
![Page 68: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/68.jpg)
53
TLR4
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
50
100
150
200
250
CD14
SM
D
Contr
ol
Non
DM
PAD
DM
PAD
0
20
40
60
80
100
Figure 7.5 Expression of surface markers on cultured fetal aortic SMC (controls) and
arterial SMC derived from non-diabetic and diabetic PAD. The assessments were made
from pooled flow cytometry data but standardized against unstained controls and
respective secondary or isotype antibodies. (SMD: standardized mean differences from
median fluorescent intensity). SMD ± SD.
7.5 Discussion
An in vitro model was used in this study to assess the phenotype and function of PAD
arterial smooth muscle cells, in which ASMC were able to be cultured from PAD
samples and subjected to phenotypic characterization and function. The results mainly
suggested an osteoblast-like phenotype with positive expression of Stro-1,vimentin and
an increased expression of RANK in diabetic PAD derived cells. These cells mainly
expressed positive alpha SMA staining, which suggests that these cells retained their
features as ASMC but with some “plasticity” in the presence of other markers. The
current study approach was mainly for observation of bone-like markers and other
inflammatory markers.
In vitro conditions in this study might be limiting to test the functional markers of
osteoblast-like cells as it is an artificial environment. Furthermore, by not using culture
conditions for bone forming cells, but getting an osteoblast-like phenotype indicates that
the approach may well be suitable. Media which is commonly used to generate
osteoblasts in culture (which include β-glycerophosphate and ascorbic acid) has been
shown to help transdifferentiation of the ASMC (Steitz et al., 2001; Wada et al., 1999).
It is not the intention of this study to try and generate osteoblast, but rather to examine
their basic phenotype potential.
![Page 69: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/69.jpg)
54
Not many studies used human derived cells to determined the ability of these cells to
differentiate into osteoblast-like cells. Several studies have shown that primary culture
from bovine ASMC or mice derived ASMC are able to differentiate into ostoblast-like
cells, but with supplement of osteogenic β-glycerophosphate and ascorbic acid (Shioi et
al;1995,Steitz et al;2001). With higher Stro-1 expression (as represented in Figure 7.3),
there is a possibility that these PAD derived cells may differentiate into bone-like cells
given the right microenvironment. Spontaneous calcification has also been
demonstrated in human ASMC, but they may need longer culturing period for up to a
month (Proudfoot et al;1998).
Earlier study by Shanahan et al. (1999) has also looked into several markers to indicate
potential osteogenic cells from ASMC derived from amputated samples exhibiting
medial sclerosis. They showed expression of bone sialoprotein, alkaline phosphatase
and matrix Gla protein. In this study, transcription factors such as Runx2 and Osterix
were detected around 300 SMD and may be seen as low expressed in PAD derived
cells. However, higher expression of vimentin (nearly 3000 SMD), indicates that these
PAD derived cells were exhibiting a premature feature of an osteoblast-like cells (Lian,
Wang, Li, Elefteriou, & Yang, 2009). Having low expression of these transcriptional
factors, could still indicates that these cells have the potential to up-regulate the genes
related to bone formation. These cells may only need additional support by
inflammatory or other signals to do so. As a consequence of an inflammatory condition,
they could fully differentiate towards osteoblast-like cells and start to deposit a calcified
matrix (Ndip et al., 2011).
Inflammatory markers such as fractalkine receptors and CX3CL1 expression were
found to be higher than CCR2 expression. TLR4 and CD14 were 10 fold lower than
RANK fluorescent SMD, which is just above 1000. Whereas TLR4 SMD is about 100
and CD14 just 20. Markers having SMD below 500, were not detectable through cover
slip staining. Thus, markers which were positive in both tissue studies (in chapter 6) and
stained positive on cover slips were considered to be significant players in the
mechanistic pathway towards arterial remodelling.
Panizo and colleagues (2009) showed in their model, that ASMC lacking RANK, will
not show increase in calcification in the presence of RANKL. Given that the ASMC
expressed RANK (as shown in this study), they would probably respond to RANKL.
With higher Stro-1 expression (as represented in Figure 7.3), there is a possibility that
these PAD derived cells may differentiate into bone-like cells, given the right
![Page 70: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/70.jpg)
55
microenvironment. Many studies have put forward the evidence that similar diseased
arterial SMCs can differentiate into bone-like cells (Ziyad and Abedin., 2004, Al-Aly,
2007; Panizo et al., 2009).
Chemokines and cytokines are important mediators of macrophage and T-cell
recruitment in a number of inflammatory pathologies, including PAD. Chemokines such
as CCR2 and CX3CR1 expressed in atherosclerotic lesions may play an important role
in mononuclear cell recruitment and macrophage differentiation. Lucas and others
(2003) has reported that fractalkine is expressed at a high level by a subset of
inflammatory cells, but rarely expressed in normal endothelial and ASMC. Instead,
ASMC derived from diseased patients’ arteries showed high expression of fractalkine
cognate receptor, CX3CR1. Relevant to atherosclerotic features, Lucas and colleagues
(2003) proposed that fractalkine-driven ASMC proliferation could result in intimal
hyperplasia. On the other hand, the current study tried to extend this finding to other
forms of arterial remodelling such as arteriosclerosis or specifically the calcification in
the medial wall. Medial calcification is an important risk factor for cardiovascular
disease and also an independent risk factor of future amputations in PAD (Guzman et al.
2008). Furthermore, another novel function of fractalkine involved not only cell
trafficking but also osteoclast maturation and activation (Koizumi et al 2009).
Saitoh and colleagues (2007) reported that the common osteoclast activator (RANKL)
could interact with CX3CR1. This study proposed that with continuous CX3CR1
expression, may interfere with osteoclast “release” from osteoblast after their interaction
to activate mature osteoclast. As Koizumi and others (2009) showed that osteoclasts
precursors may expressed CX3CR1, which became a potent chemotactic factor and
adhesive factor to bind to osteoblast. The close cell-to-cell interaction between an
osteoblast and an osteoclastic precursor is needed as part of the precursor cell’s crucial
steps to be activated by RANKL. Once the precursor is activated and become mature
osteoclast, the cell will need to reverse the adhesion from osteoblast in order to proceed
with bone-resorption activities. This is where RANKL role is proposed to suppress
CX3CR1 expression (Saitoh et al., 2007) and may explain the higher CX3CR1
expression in PAD derived ASMC.
The RANKL competitive inhibitor, osteoprotegerin (OPG) were positively expressed in
the vicinity of arterial calcification (Schoppet et al; 2004). OPG have been shown to
counteract RANKL effect by competitively binding to RANK. A study on OPG knock-
out mice display severe osteoporosis and vascular calcifications, which is also common
![Page 71: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/71.jpg)
56
in humans (Bucay et al; 1998). When OPG action was blocked by RANKL infusion in a
mice model, skeletal deterioration but not vascular calcification was seen (Yuan et al.,
2008). It could be that in this case, a higher OPG to RANKL ratio indicates a late
marker for the disease process which involves vascular calcification.
The current study is adding more evidence to human studies by showing reduced
expression of RANKL but high expression of RANK for OPG binding and proposes an
increase in CX3CR1 expression as an effect which have been described by Saitoh and
colleagues study (2007). Therefore, detection of expression of RANK and CX3CR1 in
ASMC derived from PAD samples, point to certain mechanisms of how the
calcification phenotype may develop.
![Page 72: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/72.jpg)
57
CHAPTER 8: INFECTIVE EVIDENCE INPAD SAMPLES
8.1 Introduction
This chapter is focused on investigating a specific risk factor, which is the intracellular
pathogen, known to be associated with atherosclerosis but equivocal for medial
sclerosis or medial calcification (MAC). Chlamydia Pneumoniae (CP) was selected as
the commonest reported obligate intracellular pathogen. CP has been the candidate link
between respiratory infection and atherosclerosis due to its ability to infect monocytes
or macrophages as a means of systemic dissemination (Campbell et al. 1995). This
chronic and commonly insidious infection may contribute to the inflammatory process
of atherosclerosis (Lehto et al., 2002; Rödel et al., 2000) and medial sclerosis
(Bobryshev, Lord, & Tran, 2006). Pathological studies have identified CP in
atherosclerotic plaques using numerous methods from polymerase chain reaction,
electron microscopy and antibody staining. Though the causal mechanism is not clear,
current evidence is that normal or non-atherosclerotic segments of the arterial wall were
comparatively free of Chlamydial antigens (Ngeh, Anand, & Gupta, 2002).
It has been shown earlier (in chapter 5) that severe vascular disease could be a
contributor to the calcified changes of the media. However, the link between calcified
arterial walls and CP infection is still not clear. Previously, evidence has been collated
from clinical study with a focus on ischemic heart disease or ischemic injury to the
brain (reviewed by Singanayagam et al. 2011). An interesting finding from a clinical
study (Syrjanen et al. 1988) suggests that prior infection is an important risk factor for
ischaemic stroke. The group identified that positive serological evidence for bacterial
infection in patients developing ischemic stroke was five times more likely than patients
with no serological evidence of infection prior to a stroke. These infections include the
common pathogens causing community-acquired pneumonia such as Staphylococcus
aureus, Streptococcus pneumoniae, Mycoplasma pneumoniae and CP. Another study by
Lin and others (2003) investigated the presence of CP in comparison to
Cytomegalovirus but found lower frequency of CP in their 200 samples of amputated
lower limbs in diabetic PAD cases.
![Page 73: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/73.jpg)
58
Lipopolysaccharides (LPS) are part of the outer wall component of the intracellular
bacterium CP and other gram-negative bacteria. LPS are well-known endotoxins, and
their presence may be representative of these pathogenic organisms. Host defense
mechanisms will usually initiate a protective response or a chain of defense mechanisms
to combat the invasion of pathogenic organisms by detecting the molecular pattern of
the invading pathogen. Usually, the presence of these invaders will be sensed by the
surveillance cells like monocytes and macrophages with the help of a group of
transmembrane receptors called Toll-like receptors (TLR4) and CD14. However, CP
and certain intracellular microbes may be able to slip through these circulating sentinel
cells and hide intracellularly in residence cells such as ASMC. It has been reported that
low level of endotoxemia can pose as a significant risk factor for atherosclerosis and be
sufficient to produce an inflammatory response by human ASMC (Stoll et al., 2004;
Stöllberger & Finsterer, 2002). This study also investigated if the ASMC could
somehow respond to this invasion directly by mounting similar defense mechanisms to
the sentinel cells by evaluating the expression of TLR4 and CD14 on ASMC.
8.2 Hypothesis and Aims
Hypothesis - Intracellular infection such as Chlamydia Pneumoniae (CP) may be
associated with inflammation in PAD.
Aims:
(i)To determine the presence of CP in calcified diabetic samples and non-calcified
non-diabetic samples using immunofluorescence (IF) and polymerase chain
reaction (PCR).
(ii)To evaluate differential response to LPS via the molecular detection of TLR4
and CD14.
8.3 Material & Methods
Patient samples were grouped according to diabetic presence and calcification score.
The first group is non-diabetic PAD cases with mild or no calcification (N=3, 9 arterial
segments) and the second group is diabetic PAD cases with severe calcification (N=3, 6
arterial segments). Arterial segments were about 1-2 cm in length and contributed to an
average of 3 different sections tested for either PCR or immunofluorescent staining.
Successfully grown and confluent cells on glass cover slips were incubated with LPS
10ng/ml (AbD, Serotec) in 24 well plates over 24 hours. These cells were then fixed
with 0.5% PFA and stained with primary antibodies against TLR4 and CD14. Control
![Page 74: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/74.jpg)
59
cells without LPS incubation were also included and a comparison was made with
negative control cover slips.
8.3.1 Antigen detection in tissue sections from PAD samples
CP specific immunofluorescence was performed on slides using purified mouse
monoclonal primary antibodies (IgG2a) against CP (TWAR; AbD, Serotec) and rabbit
IgG against Chlamydia (all strains; Fitzgerald). All tissue sections (8 µm) were
rehydrated and incubated in PBS with 3% FCS overnight after brief permeabilization
with 0.1% Triton-x. Test slides were incubated with respective primary antibodies
(1:100) and control slides were incubated without the primary antibodies in a humidity
chamber at 4°C overnight. Slides were washed in PBS prior to incubation with
respective secondary anti-rabbit and anti-mouse IgG (Alexa Fluor 488) from Invitrogen
(1:200). Nuclei were stained with DAPI (4’, 6-diamidine-2’-phenylindole
dihydrochloride) at 10ng/ml (Roche Diagnostics, Mannheim, Germany) along with
secondary antibody incubation for 30 minutes at RT. Slides were covered and allowed
to dry on the bench. Positive detection using confocal microscopy (Leica SP5) was
compared with the negative staining control of the same sample (matched sections
devoid of the primary antibody).
The following PCR work was undertaken by Adam Polkinghorne’s group from the
Institute of Health and Biomedical Innovation, Queensland University of Technology,
Brisbane, Queensland, Australia.
8.3.2 DNA extraction from cryosections
A variable number of 50 µm PFA-fixed cryosections were cut from the arteries of each
patient and placed in sterile cryotubes. Sections were transferred to sterile eppendorf
tubes and weighed. Tissue was washed twice in phosphate buffered saline to remove
cryogel and fixative. DNA extraction was performed using a QIAamp DNA mini kit
(Qiagen, Doncaster, Victoria) as per the manufacturer’s instructions.
8.3.3 C. pneumoniae-species specific PCR screening
Detection of CP from DNA extracted from tissue sections was performed using a
previously described conventional CP species-specific PCR assay (Campbell et
al.1992). Using primers (HM-1/HR-1; Table 8.1), this PCR assay targets a 229 base pair
(bp) CP-specific region of the RNA polymerase beta (rpoB) gene. PCR positivity was
![Page 75: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/75.jpg)
60
evaluated on a subjective five-point scale (Appendix II, Figure 1) from strongly positive
(+++), moderately positive (++), weak positive (+), very weak positive (+/-) and PCR
negative (-) For the purpose of this thesis; the scale was converted to positive or
negative findings as represented in Table 1 and 2 (Appendix III).
The identity of CP positive bands was confirmed for selected samples by cloning of
PCR products into a pGEM-T Easy vector system (Promega, Alexander, NSW) and
transformation of Escherichia coli JM109 competent cells, as per the manufacturer’s
instructions. Positive plasmid constructs, identified by blue-white colour selection from
transformed colonies, were grown overnight in LB/ampicillin (100 µg/ml) media at
37°C. DNA extraction from selected colonies was performed using the Purelink™
Quick Plasmid Miniprep kit (Invitrogen, Mulgrave, Australia) and submitted for
sequencing at the Australian Genome Research Facility (AGRF).
8.3.4 Genotyping of C. pneumoniae PCR positive arterial samples
Genotyping of CP positive samples was based on the ability of the selected gene to
discriminate between indigenous Australian, non-indigenous and animal strain,
amplicon sizes (for amplification from fixed tissues). This gene, CPK_ORF00679,is a
hypothetical gene encoding a laminin 2-like protein which, distinguishes indigenous
Australian from non-indigenous strains by a 251 bp upstream segment, and additionally
distinguishes human from animal strains by any of five single nucleotide
polymorphisms (SNPs).
8.3.5 General PCR parameters
A set of general parameters was used for both CP detection and genotyping PCR assays.
Primer sequences and the appropriate annealing temperatures used are listed in Table
8.1. Briefly, each 50 µL reaction volume was prepared by addition of 10 µL DNA
template to a reaction mastermix containing 1U FastStartTaq DNA polymerase (Roche,
Castle Hill, NSW), 0.2 mM dNTPs (Roche), 1 x FastStartTaq PCR buffer with MgCl2
(Roche), 4.5 mM MgCl2 (Roche) and 0.3 µM each of forward and reverse primers as
described (Sigma Aldrich, Australia). Cycling conditions consisted of an initial
denaturation of 94 °C for 10 minutes, followed by 45 repeated cycles of 94 °C for 60
seconds, primer annealing (Table 8.1) for 60 seconds and extension at 72 °C for 60
seconds. The reaction was concluded with a final extension at 72 °C for 7 minutes.
DNA extracted from cell-cultured CP was used as a positive control for these reactions
and dH2O was used in negative control reactions.
![Page 76: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/76.jpg)
61
All PCR products were visualised using Tris-Borate-EDTA agarose gel electrophoresis
with ethidium bromide to confirm presence and size of target products. PCR products
were purified and submitted for sequencing.
Table 8.1 Primer sequences for C. pneumoniae detection and genotyping.
8.3.6 Statistical evaluation
The groups of CP-positive vs.-negative samples were compared using non-parametric
Chi-square or Fisher’s exact test. The analysis was performed with SPSS version 16.0
(USA). Statistical significance was defined as p <0.05.
8.4 Results
8.4.1 Immunofluorescent detection of C. Pneumoniae in arterial tissues from PADsamples
Positive detection of CP antigen was found in nine out of fifteen PFA fixed arterial
sections when tested using species-specific CP antibodies. There were 3 positive
sections (50%) derived from diabetic PAD cases, which exhibited severe medial
calcification (score of 4). Whereas 6 positive sections (67%) were derived from non-
diabetic PAD cases and has minimal arterial calcification (score of 0 or 1). There was
no significant difference between the rates of CP detection in diabetic and non-diabetic
Primer
namePrimer sequence (5’ to 3’)
Annealing
temperature
(°C)
Predicted
size of
product
(bp)
Ref
Detection:
HM-1 GTGTCATTCGCCAAGGTTAA 48
229
Campbell
et al.
(1992)
HR-1 TGCATAACCTACGGTGTGTT48
Genotyping:
K_00679 HF TCGAAAAGGCGATTGTATATTG 60
539
Mitchell
et al.
(2010)
K_00679R TTGAGCTAAGGTCGAGGGAAG60
![Page 77: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/77.jpg)
62
PAD cases, p=0.619 (see Figure 8.1A). CP antigens were not only found in diabetic
PAD cases or calcified arterial segments alone, but frequently found in non-diabetic
PAD cases as well. Similar arterial samples were also tested for PCR and the results
were given in Appendix II. The list for CP detection results by both techniques was
comparable in the tables provided in Appendix III.
A p =0.619 B p =0.128
Figure 8.1 There was no difference between positive CP detection using (A)
immunofluorescent microscopy or (B) using PCR methods.
8.4.2 PCR detection of C. Pneumoniae
Subsequent sections from similar arterial segments tested with IF, were run through
PCR analysis where more cryosections (N=50) were obtained from a total of 6 different
patients; three with diabetes and three without diabetes. Samples were investigated
using CP genotyping primers. Grading of the PCR products was done using quantitative
PCR. Figure 8.1B showed the distribution of positive PCR samples for non-diabetic and
diabetic arterial samples, which were 32% and 14% respectively. There was no
significant difference for the distribution (p=0.128).
8.4.3 Detection of C. Pneumoniae in ASMC derived from PAD samples
In order to confirm the presence of CP in ASMC, explant technique was used to obtain
cultured smooth muscle cells from PAD samples. Tissue immunofluorescence
microscopy has indicated that the CP distribution was found in the region positive with
smooth muscle cells (positive with alpha smooth muscle actin as shown in chapter 6).
![Page 78: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/78.jpg)
63
Thus, cover slip samples were prepared to determine CP presence and distribution in
this cell culture. Figure 8.2A showed cytoplasmic distribution of CP antibodies in
ASMC. In tissue samples, positive staining was shown in the intima and media of
calcified arterial samples (Figure 8.3A and G), and also in the intima and media of non-
calcified sample (Figure 8.3 C). Evaluation through epifluorescent microscope (Nikon
90i upright) was further confirmed by confocal fluorescence microscopy evaluation (see
Figure 8.3).
Figure 8.2 ASMC derived from PAD sample (A) stained with primary antibody against
Chlamydia pneumoniae and (C) without the primary antibody stained with Alexa fluor
488.Figure B and D were corresponding nuclei staining with DAPI.
C D
A B
![Page 79: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/79.jpg)
64
Figure 8.3 Arrows show positively stained anti-Chlamydial antibodies in the intima (A)
and media (G) of calcified PAD samples. Non-calcified PAD samples were also
positive with anti-Chlamydial antibodies in both intima and media (C) but negative in
C Media D Media
E Control sample F
G Test sample H
Intima Intima
A Lumen B Lumen
![Page 80: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/80.jpg)
65
control samples (D). E and F were controls for calcified PAD samples. Blue staining
were respective nuclear staining DAPI. Scale bars in C and D 300 μm.
8.4.4 LPS activation induced TLR4 and CD14 expression
There is a possibility that ASMC could somehow respond to CP invasion by mounting a
similar defense mechanism to the sentinel cells (monocytes and macrophages) by
expressing TLR4 and CD14. Cover slips with grown cells activated by LPS and non-
activated cells were evaluated through immunofluorescence staining and positive
expression of TLR4 was seen only with LPS activated cells (Figure 8.4B). However,
upon quantification of pooled samples with flow cytometry, there was no significant
difference in TLR4 expression between diabetic or non-diabetic PAD grown cells
(Figure 8.5).
CD14 expression was invisible through immunofluorescence microscopy due to the
nature of the PE™ conjugated antibodies, which is sensitive to photo-induced
degradation. Therefore, it is best investigated through flow cytometry along with the
introduction of a positive control, using donor’s peripheral blood mononuclear cells
(PBMCs). Figure 8.6 showed the histogram of CD 14 expression for ASMC not
activated with LPS (Figure 8.6 A) and ASMC activated by LPS (Figure 8.6B).
Although there is a shift in the test histogram (Figure 8.6B) with LPS activation, the
overall expression of CD14 is still lower than the positive control (Figure 8.6C).
(A) TLR4 before LPS activation (B) TLR4 after LPS activation
Figure 8.4 TLR4 immunofluorescent staining pre (A) and post (B) 24 hours incubation
with LPS 10ng/ml on glass cover slips. Scale bar 50 μm.
![Page 81: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/81.jpg)
66
Figure 8.5 TLR4 expression from flow cytometry, non-DM (N =5), DM (N =9),
unpaired T-test p=0.3.All samples were not activated with LPS in order to evaluate the
baseline expression of TLR4.
A B C
Figure 8.6 Histograms representing CD14 expression in non-activated ASMC in (A),
activated ASMC with LPS (B) and positive control from human peripheral blood
monocytes (C). Slight increase in CD14 expression can be seen in (B) which could be
due to the activation effect with LPS. The red lines showed cells with secondary
antibodies stained alone as controls and the blue line as the cells profile with tested
antibodies.
![Page 82: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/82.jpg)
67
8.5 Discussion
The main finding of this study is that CP can be frequently demonstrated in both
diabetic and non-diabetic PAD arterial samples obtained from lower limb amputations.
The first aim in this study was to determine the presence of CP in calcified diabetic
samples, which represents severe PAD cases, and non-calcified non-diabetic samples,
which represents the less severe PAD cases. Thomas and colleagues (1999) also found
no correlation between CP detection and the severity of atherosclerosis grading using
Stary’s classification and showed that mild atherosclerotic lesions were as likely as the
severe lesions to be positive for CP.
Peripheral arterial disease, which is commonly comprised of both atherosclerosis and
medial sclerosis, has been associated with diabetes mellitus (Soor et al., 2008).
However, non-diabetic specimens with less severe histopathopathology (showing no
calcified lesions), collected in this study, showed positive detection of CP at a higher
percentage (between 6 and 20%) more by immunostaining detection and PCR
respectively. This could be due the presence of atherosclerosis in the non-calcified
samples. Earlier studies had found a relationship between atherosclerotic lesions and CP
presence through serological antigens, and previous study has shown that CP is not
normally found in non-diseased arteries (Grayston, 2000).
However, there is also a study showing low detection (3.5% positive) of CP in diseased
lower limb arteries from 200 cases of non-traumatic, diabetic amputated cases (Lin et
al., 2003). The control patients recruited in Lin and colleagues’ study (2003) were non-
diabetic patients who had undergone surgical amputation due to traumatic injury.
Therefore, this study reported similarly lower incidence of CP infection in diabetic
amputees with severe calcification, but higher incidence of CP infection in a well-
described control cases different to Lin’s study samples. The control cases recruited in
the current study were non-traumatic cases undergoing lower limb amputations
involving non-diabetic patients. Since this study has demonstrated that both diabetic and
non-diabetic cases have significantly higher calcification scores compared to non-
amputated cases in controls (as presented in chapter 5), CP infection may contribute to
the calcified lesions formation to some degree. The detection of CP could also be lower
because severe calcified samples may have less viable ASMC. As proposed by
Bobryshev and others (2006), the detection of CP in the medial ASMC may be
associated with the pathophysiological presentation of the calcified media as 10 out of
17 carotid artery specimens detected positive CP in their study. They also detected the
![Page 83: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/83.jpg)
68
presence of CP with both PCR and immunohistochemistry staining. Gutiérrez and
others (2005) also found a relationship between PAD and CP infection through
immunohistochemical analysis and nested PCR studies. However, they made a guarded
conclusion from their meta-analyses of forty-three published studies, suggesting that
proper case-control study and adequate number of cases need to be used. Although the
majority of published studies used coronary arteries, one has to consider that coronary
disease and PAD share common risk factors including CP infection.
The finding in this study further enhanced the possibility that CP influences PAD
progression and contributes to vascular inflammation by expression of TLR4 and CD14.
Membrane-bound TLR4 and CD14 have been shown to be expressed in human
coronary ASMC, which suggests a role for these cells in leading the innate
inflammatory response by expressing the pattern recognition molecules (Shi et al.,
2010; Stoll et al., 2004). This response was shown in the context of low endotoxin such
as LPS and the level of CD14 can be a useful determinant of endotoxin–induced cellular
activation. Although there was no difference between non-diabetic and diabetic samples
in this study, expression of both TLR4 and CD14 could be clearly demonstrated using
the techniques proposed by Qiang Shi and colleagues (2010), which used flow
cytometry and similar conjugated-antibodies. Despite a low base-line expression in
these cells, higher expression of TLR4 and CD14 is seen in human ASMC compared to
endothelial cells or baboon ASMC (Shi et al., 2010).
The current study suggests that there might be various sources of inflammation
including CP, and interestingly the group without diabetes has higher infection rates. It
could be that other than diabetes mellitus, intracellular infection could influence PAD
progression and lead toward calcification of the arterial wall. TLR4 as part of the innate
immune system can be triggered not only by external pathogens, but also by
endogenous molecules released in response to tissue injury or damage cells (Gan et al.,
2013; Manolakis et al., 2011; Pasterkamp et al., 2004).
![Page 84: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/84.jpg)
69
CHAPTER 9: DISCUSSION
The purpose of this general discussion is to summarize the major findings of this thesis
and attempt to discuss the implications of how the data contributes to an increased
understanding of vascular calcification related to inflammation and immunobiology.
The experiments described in this thesis were performed to examine the
immunopathology in PAD, specifically in the context of arterial calcification.
9.1 Major histopathological findings
The first issue addressed was to determine the major histopathological findings in
severe PAD cases obtained in this study. Previously, PAD was thought to be a sole
consequence of atherosclerosis because of the obvious stenotic lesion. Soor and others
(2008), however, showed that apart from atherosclerosis, medial calcification is an
important condition that can cause stiffening of the arterial wall, which can further
compromise the circulation to the lower limb. Medial calcification is also related to the
complication of diabetes mellitus, especially in patients having chronic kidney diseases.
In the study of Soor and colleagues (2008), out of 58 patients undergoing lower limb
amputation, 70% comprised patients with diabetes mellitus (mainly type 2). This study
recruited 17 patients undergoing lower limb amputation for non-traumatic causes in
which 59% were diabetic cases. The main histopathological lesion presented in the
current study was severe medial calcification, which did not show discrimination
between diabetic and non-diabetic cases.
The histopathological study (chapter 5) has found no fibrotic calcification displayed in
the intimal layer of the arterial cross sections derived from amputated PAD cases and
the controls. Instead, very few stages in the formation of atherosclerosis could be found,
which were fatty streak (evidenced by positive Oil red O staining) and intimal
thickening (showed by positive alpha smooth muscle actin staining). Although the
arterial samples appeared devoid of inflammatory cells (negative for CD45 and CD68),
it has been documented that in response to inflammatory damage, the normally residing
smooth muscle cells in the media can migrate and proliferate to effect repair.
![Page 85: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/85.jpg)
70
9.2 Expression of CX3CR1 in the intima
Lucas and others (2003), have implicated the role of a chemokine receptor (CX3CR1)
expressed by the ASMC, to facilitate the migration and proliferation of the smooth
muscle cells. The findings in Chapter 6 have demonstrated the presence of CX3CR1 in
similar cells of the arterial intima and media of both diabetic and non-diabetic PAD.
However, another common receptor in atherosclerosis (CCR2) or the monocyte
chemotactic protein-1 (MCP-1) was not found in the samples of this study. It could be
that these PAD samples have bypassed the early stage of atherosclerosis formation and
may not progress to form plaques in the intima. This finding may support the notion that
CCR2 is mainly important at the early stage. However, no other human study has
demonstrated CCR2 expression on ASMC. Evidence of CCR2 involvement in
atherogenesis were mainly based on animal studies using the Apo E deficient mice
model (Guo et al., 2005; Zhang et al., 2011). A study using freshly isolated human
monocytes, suggested that stimulation with CCL2 induced a rapid increase of CX3CR1
protein on the cell surface (Green et al., 2006). Guo and colleagues (2005) studied the
role of CCR2 in established atherosclerotic lesions by transplanting bone marrow
progenitor cells from CCR2-deficient mice into irradiated 16 week-old Apo E knockout
mice with established atherosclerosis. The CCR2 deficient bone marrow progenitor
cells did not seem to reduce the plaque progression in the irradiated mice after 9 weeks
of transplantation and there is still evidence of macrophage or monocyte influx at lesion
site. This suggests that there may be additional mechanisms for recruitment of
monocytes at later stages of an advanced vascular disease with expression of CX3CR1
and not CCR2.
9.3 Expression of CX3CR1 and RANK in the media
The findings of medial calcification in severe PAD cases examined in this thesis were
further associated with expression of RANK and CX3CR1. These markers may
represent inflammatory functions related to osteoblast and osteoclast-like activity. On
one hand, osteoclast precursors, which are the monocytes, may be recruited by diseased
ASMC expressing CX3CR1. On the other hand, there is less RANKL expression to
induce the down-regulation of the fractalkine receptor and release the binding of
monocytes from ASMC. In a physiological context, Saitoh and others (2007) proposed
that mature osteoclast (upon activation by the osteoblast on cell-cell interaction) need to
reverse the adhesion to osteoblast and rustle in the bone-like matrix in order to proceed
with bone resorption activities. ASMC in the context of PAD do not only express
![Page 86: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/86.jpg)
71
CX3CR1 but also RANK. RANK expression is important in the event of arterial
calcification, which closely resembles bone formation. RANK as part of the molecular
triad (RANK, RANKL and OPG) is an important participant in bone forming activity.
With the reportedly higher OPG expression in PAD (Poulsen et al., 2011; Ziegler et al.,
2005), RANKL activity may be reduced and allow higher expression of CX3CR1
instead.
OPG and RANKL as inflammatory markers, have been investigated by Schoppet and
colleagues (2004), who investigated atherosclerosis and Monkeberg’s sclerosis in the
coronary arteries; but they have not yet been described for the popliteal and tibial
branches. One recent study by Heymann and others (2012) did compare the expression
of the bone regulatory triad OPG/RANK/RANKL between carotid and femoral arteries
and highlighted some differences between the two. The study of Heymann and
colleagues (2012) also demonstrated less infiltration of macrophages in the femoral bed
and lesser expression of OPG, which may contribute to the overall higher calcification
seen in the lower limb arteries. Interestingly, serum OPG level is higher for the femoral
subjects but lower for the carotid subjects.
9.4 In vitro assessment
In chapter 7, it has been shown that the highly calcified arteries were able to grow
“synthetic” ASMC phenotype with explant techniques. The term “synthetic” is used
here to denote the plasticity or the ability of the ASMC to trans-differentiate into other
stromal cell lineages as suggested by Vukovic and others (2006). Compared to human
fetal ASMC, PAD derived ASMC displayed positive smooth muscle actin and
vimentin. Vimentin is a well-known marker for a synthetic smooth muscle cell (Salabei
et al., 2013; Vukovic et al., 2006). Na Lian and colleagues (2009, 2012) had also found
an interaction of vimentin with an osteoblast transcription factor ATF4. They concluded
that vimentin will be predominantly expressed in immature osteoblast and might
interfere with the terminal differentiation of this cells, which are of stromal origin (Lian
et al., 2012, 2009).
The expression of other bone-regulatory markers in association with inflammation such
as RANK and CX3CR1 were demonstrated at both tissue and cellular levels in this
thesis. In support of these findings, Schoppet et al. (2004) have demonstrated OPG
localization, but not RANKL in Mönckeberg’s sclerosis and atherosclerotic samples. In
contrast, Ndip et al. (2011) showed positive RANKL staining within the vicinity of
calcified medial arterial layer. Both studies utilized immunohistochemistry techniques,
![Page 87: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/87.jpg)
72
but used different primary antibodies which are mouse anti human RANKL monoclonal
antibodies (R&D systems) and rabbit anti-human RANKL (AbCAM,UK). RANKL
mRNA expression were also negative in Schoppet’s investigation. Ndip and colleagues
however, did not find any different serum level of RANK or RANKL between control
and diabetic patients without Charcot’s lesion, but a higher soluble form of RANKL in
the serum of Charcot’s patient. Thus, the higher serum RANKL in patients with Charcot
lesion may explain the increased osteolysis activity of the ankle joint. Ndip and
colleagues (2011) further suggest increased expression of RANK on the smooth muscle
cells, drives the osteoblastic differentiation pathway to facilitate arterial calcification.
This could be relevant to the expression of RANK in ASMC as shown at both tissue and
cellular levels (chapter 6 and 7). Furthermore, Heymann and others (2012) found
positive expression of both RANK and RANKL in diseased carotid and femoral
specimens but highlighted that the expression is found in macrophages, lipid core and
calcified plaques rather than ASMC.
9.5 CX3CR1 expression and relation to vascular calcification
In earlier literature, the fractalkine receptor (CX3CR1) has been mainly discussed in
association with atherosclerosis (Kumar et al., 2010; Liu et al., 2008). Although, the
expression of CX3CR1 has been frequently associated with atherosclerosis, the main
function of this receptor is to facilitate monocyte and macrophage recruitment to the
intimal layer or other inflammatory sites (reviewed by Liu and Jiang, 2011). Lucas and
colleagues (2003) proposed that this chemokine may play an important role in vascular
remodelling, since many of these receptors are found in the neo-intima of human
coronary artery plaques and expressed by the smooth muscle cells recruited into the
atherosclerotic plaque.
However, there is now emerging evidence for the role of CX3CR1 and its ligand in
vascular calcification (Hoshino et al., 2013). CX3CR1 expression in the context of
PAD in this study may be relevant to arterial wall remodelling which involved
osteoblast and osteoclasts-like activity. Evidence of osteoclast-like activity was detected
through positive TRAP expression along calcified areas of PAD arteries.
In a model of CX3CR1-deficient mice, osteoclast formation was reduced alongside the
increase in osteoid formation. Thus, in a diseased state where CX3CR1 is up-regulated,
there may be an up-rise in osteoclast formation and more bone resorption that leads to
osteopenia. This phenomenon was considered to be a therapeutic method in
counteracting vascular calcification in a review by Demer, Linda and Tintut (2011).
![Page 88: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/88.jpg)
73
They proposed that the osteoclastic activity could be part of the host defense mechanism
to counteract vascular calcification. Chapter 6 of this thesis has demonstrated positive
TRAP staining in PAD arterial samples, suggesting that there is osteoclast-like activity
in the area of the calcified lesions.
In bone biology, presence of CX3CR1 alongside the TRAP activity may be explained
by Hoshino and others (2012) findings, where they coupled the role of the CX3CR1-
CX3CL1 axis to the early stage of osteoblast formation and maintenance of osteoclastic
precursors. Chapter 7 demonstrated detectable levels of bone transcriptional factors;
Cbfa1/Runx2 and Osterix through flow cytometry on PAD derived arterial SMC.
RANK expression is higher in PAD derived SMC and this supports the expression of
RANK on the stromal lineage cells such as ASMC.
9.6 Possible infective cause as a source of inflammation
As mentioned earlier, intracellular infection is highlighted as a possible source of
inflammation, which may induce vascular calcification seen in severe PAD cases. It has
been well documented that Chlamydia Pneumoniae may be implicated with
atherosclerosis, but the association of this particular pathogen with arterial calcification
is still not clear. Bobryshev and colleaugues (2006) have demonstrated a significant
relationship between Chlamydia and medial calcification from 60 endarterectomy
carotid samples. They investigated the presence of the organism using PCR and
immunohistochemistry and showed 17 samples (28%) positive with both methods.
Another group (Lin et al., 2003), however, detected higher presence of cytomegalovirus
and not Chlamydia pneumoniae in 200 samples of atherosclerotic lesions from diabetic
cases undergoing lower limb amputations. Lin and others (2003) demarcated only
atherosclerotic lesions and not medial calcification. The samples included in chapter 6
however selectively differentiates diabetic and non-diabetic amputated samples and
representative of medial calcification (for the diabetic cases). Although the distribution
of Chlamydia pneumoniae was similar in both groups, the detection for diabetic and
non-diabetic patients was still high (50% and 67% respectively) with
immunofluorescent staining and (14% and 32% respectively) with PCR study.
Chapter 6 further explores the expression of TLR4 and CD14 on the ASMC using flow
cytometry, to identify whether the probable related pathways are involved. This was
assessed by incubating the ASMC with low level of LPS and comparing the expression
of the markers (TLR4 and CD14) without LPS incubation, using flow cytometry..
![Page 89: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/89.jpg)
74
However, there is no significant difference between activated and non-activated ASMC
with LPS introduction. LPS, the outer glycolipid content in the outer leaflet of the outer
wall of Gram- negative bacteria can bind to TLR4 and is thought to induce the
expression of other endotoxin receptor such as LPS- binding protein, CD14 and MD-2
(Antal-Szalmás, 2000; Pasterkamp et al., 2004). These surface markers or receptors are
quite specific for circulating inflammatory cells, and there is evidence that human
smooth muscle cells can express similar endotoxin receptors. Although the TLR4
baseline expression is low in ASMC, LPS is shown to increase TLR4 expression in
Qiang Shi and others study (2010). Qiang Shi uses both flow cytometry for detection of
protein expression and reverse transcription-polymerase chain reaction for mRNA
quantification of the TLR4 protein expression in human and baboon ASMC. Results
from flow cytometry, presented in chapter 7 also showed similar expression with an up
regulated trend of TLR4 and CD14, although their expression were not as high as
CX3CR1 and RANK expression in PAD ASMC samples.
Interestingly, Zulli (2008) demonstrated leukocytic markers such as CD14 and
embryonic stem cell markers (i.e. Octomer 4 and SSEA 1, 3 and 4) in ASMC derived
from diseased arteries. This further supports the phenotypic plasticity of the ASMC,
where aberrant phenotypic and functional changes of ASMC changes into bone-like
cells or foam-like cells may contribute to the pathogenesis of vascular diseases such as
atherosclerosis and Monckeberg’s sclerosis.
9.7 Limitations of the study
9.7.1 Sample size
The first limitation encountered in this study was sample size since recruited diabetic
and non-diabetic cases in this study is only 17 compared to 58 patients in the study of
Soor and others (2008). However, this study sample managed to show highly significant
calcified lesions in amputated diabetic samples when compared to non-diabetic samples,
as presented by Soor’s group. This could probably be due to the higher percentage of
diabetic participants in both Soor’s (70%) and this study (59%). Interestingly, a study
by Mozes et al. (1998) did not show significant differences between calcified lesions
amongst their equally distributed diabetic amputees (N=14) and non-diabetic amputees
(N=14).
![Page 90: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/90.jpg)
75
9.7.2 Variability in biological samples
Another limitations could be due to the variability of biological samples as
suggested by age distribution alone. For example, a given age for any case selected
from the cadaveric controls and PAD group, could be anywhere between 39 to 90 years
old. This may contribute to an experimental challenge to obtain minimal variation in the
extent of histological or molecular abnormalities within a small sample size. The arterial
wall changes observed could be a wide spectrum from a healthy young artery to a
senescent and diseased artery.
9.7.3 Methodological aspects
With viable cell lineage of the adherent cell type, the cells grown from human PAD
samples obtained in this study did not detach easily with EDTA-Trypsin methods at
0.05% diluted concentration. Enzymatic digestion with this detachment method may
also render the loss of surface markers under investigation. Scrapping method was used
instead and this is done before the cell lineage reach maximum confluence. However,
this may contribute to the difficulty in obtaining a single cell suspension when the
scrapped cells easily become clumped together, due to increased “stickiness” when
detached manually. This could lead to an unspecific binding when using
immunofluorescence-based techniques leading to a higher background staining in the
controls. Another issue is in handling a large number of cells to be run together for
several long experiments using flow cytometry.
9.8 Future direction
In the future, more attention can be given to the selected few inflammatory markers
chosen since this thesis mainly tested a list of probable inflammatory mediators under a
wide range of targets. With narrowed list of candidates, better experimental targets can
be designed using precious human samples. Further evaluation of the selected markers
can also be made at the transcriptional or translational level using different stimuli in
activated cells.
9.9 Conclusions
In conclusion, the main findings from this thesis project are as follows:
1) ASMC derived from severe PAD with medial wall calcification express RANK
and CX3CR1.
2) Phenotypic plasticity is displayed by ASMC derived from PAD in response to
chronic inflammatory condition.
![Page 91: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/91.jpg)
76
3) Intracellular infection in cases of severe PAD might trigger inflammation in the
arterial wall.
Although the study has a small sample size, the cohort of 17 amputated cases might
give some insight to vascular immunopathobiology. The results of this work represent
an important step toward understanding medial wall calcification and its interplay with
recent inflammatory molecules. In addition to recognizing an extended role of
CX3CR1, which most likely contribute to the monocytes recruitment and activation into
osteoclasts, CX3CR1 expression could also be regulated by RANK/RANKL/OPG
activities. These regulatory molecules of bone biology seem to be at the same time
inflammatory mediators that may link the immune system to the vascular system, where
vascular cells, such as the ASMC, play an important role in maintaining vascular health
and integrity and may respond with pathological remodelling to inflammatory signals.
![Page 92: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/92.jpg)
77
REFERENCES
AIHW (2011). Australian Institute of Health and Welfare. Diabetes prevalence inAustralia: detailed estimates for 2007-08. Diabetes series no. 17. Cat. no. CVD 56.Canberra: AIHW. http://www.aihw.gov.au/publication-detail/?id=10737419311.
Abbott, R. D., Brand, F. N., & Kannel, W. B. (1990). Epidemiology of some peripheralarterial findings in diabetic men and women: experiences from the FraminghamStudy. The American Journal of Medicine, 88(4), 376–81. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/2327425
Ahdjoudj, S., Fromigué, O., & Marie, P. J. (2004). Plasticity and regulation of humanbone marrow stromal osteoprogenitor cells : potential implication in the treatment of age-related bone loss. Histology & Histopathologyl, 19, 151–158.
Al-Aly, Z. (2007). Medial vascular calcification in diabetes mellitus and chronic kidneydisease: the role of inflammation. Cardiovascular & Haematological Disorders-Drug Targets, 7(1), 1–6. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/17346122
Antal-Szalmás, P. (2000). Evaluation of CD14 in host defence. European Journal ofClinical Investigation, 30(2), 167–79. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10651843
Aponte, J. (2012). The prevalence of peripheral arterial disease (PAD) and PAD riskfactors among different ethnic groups in the US Population. Journal of VascularNursing : official publication of the Society for Peripheral Vascular Nursing,30(2), 37–43. doi:10.1016/j.jvn.2011.11.004
Bensidhoum, M., Chapel, A., Francois, S., Demarquay, C., Mazurier, C., Fouillard, L.,… Lopez, M. (2004). Homing of in vitro expanded Stro-1- or Stro-1+ humanmesenchymal stem cells into the NOD/SCID mouse and their role in supportinghuman CD34 cell engraftment. Blood, 103(9), 3313–9. doi:10.1182/blood-2003-04-1121
Billiard, J., Moran, R. a, Whitley, M. Z., Chatterjee-Kishore, M., Gillis, K., Brown, E.L., … Bodine, P. V. N. (2003). Transcriptional profiling of human osteoblastdifferentiation. Journal of Cellular Biochemistry, 89(2), 389–400.doi:10.1002/jcb.10514
Blumenthal, H. T., Lansing, A. I., & Wheeler P.A. (1944). Calcification of the media ofthe human aorta and its relation to intimal arteriosclerosis, ageing and disease. TheAmerican Journal of Pathology, XX(4), 665.
Bobryshev, Y. V, Lord, R. S. a, & Tran, D. (2006). Chlamydia pneumoniae in foci of“early” calcification of the tunica media in arteriosclerotic arteries: an incidentalpresence? American Journal of Physiology - Heart and Circulatory Physiology,290(4), H1510–9. doi:10.1152/ajpheart.01055.2005
![Page 93: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/93.jpg)
78
Boström, K., Watson, K. E., Horn, S., Wortham, C., Herman, I. M., & Demer, L. L.(1993). Bone morphogenetic protein expression in human atherosclerotic lesions.The Journal of Clinical Investigation, 91(4), 1800–9. doi:10.1172/JCI116391
Bucay, N., Sarosi, I., Dunstan, C. R., Morony, S., Tarpley, J., Capparelli, C., …Simonet, W. S. (1998). Osteoprotegerin-Deficient Mice Develop Early OnsetOsteoporosis and Arterial Calcification. Genes & development, 12(9), 1260–8.Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=316769&tool=pmcentrez&rendertype=abstract
Butoi, E. D., Gan, A. M., Manduteanu, I., Stan, D., Calin, M., Pirvulescu, M., …Simionescu, M. (2011). Cross talk between smooth muscle cells andmonocytes/activated monocytes via CX3CL1/CX3CR1 axis augments expressionof pro-atherogenic molecules. Biochimica et Biophysica Acta, 1813(12), 2026–35.doi:10.1016/j.bbamcr.2011.08.009
Byon, C. H., Sun, Y., Chen, J., Yuan, K., Mao, X., Heath, J. M., … Chen, Y. (2011).Runx2-upregulated receptor activator of nuclear factor κB ligand in calcifying smooth muscle cells promotes migration and osteoclastic differentiation ofmacrophages. Arteriosclerosis, thrombosis, and vascular biology, 31(6), 1387–96.doi:10.1161/ATVBAHA.110.222547
Campbell, C. K. (n.d.). Detection of Chlamydia pneumoniae in Arterial Tissues. TheJournal of Infectious Diseases, 181. Retrieved fromhttp://www.jstor.org/stable/30110397
Chan, E. P., Mhawi, A., Clode, P., Saunders, M., & Filgueira, L. (2009). Effects oftitanium(iv) ions on human monocyte-derived dendritic cells. Metallomics : Integrated Biometal Science, 1(2), 166–74. doi:10.1039/b820871a
Charo, I. F., & Ransohoff, R. M. (2006). The many roles of chemokines and chemokinereceptors in inflammation. The New England Journal of Medicine, 354(6), 610–21.doi:10.1056/NEJMra052723
Chi, Y. W., & Jaff, M. R. (2008). Optimal risk factor modification and medicalmanagement of the patient with peripheral arterial disease. Catheterization andCardiovascular Interventions : Official Journal of the Society for Cardiac Angiography & Interventions, 71(4), 475–89. doi:10.1002/ccd.21401
Criqui, M.H, Langer, R. ., Fronek, A., Feigelson, H. ., & et al. (1992). Mortality over aperiod of 10 years in patients with peripheral arterial disease. The New EnglandJournal of Medicine, 326(6), 381.
Criqui, Michael H, & Ix, J. H. (2012). Highs and lows in the peripheral vasculature.Journal of the American College of Cardiology, 59(4), 408–9.doi:10.1016/j.jacc.2011.10.861
Demer, Linda and Tintut, Y. (2011). The roles of lipid oxidation products and receptoractivator of nuclear factor-kappa B signaling in atherosclerotic calcification.Circulation Research., 108(12), 1482–1493.doi:10.1161/CIRCRESAHA.110.234245.The
![Page 94: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/94.jpg)
79
Ducy, P., Zhang, R., Geoffroy, V., Ridall, a L., & Karsenty, G. (1997). Osf2/Cbfa1: atranscriptional activator of osteoblast differentiation. Cell, 89(5), 747–54.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9182762
Epstein, S. E., Zhou, Y. F., & Zhu, J. (1999). Infection and Atherosclerosis : Emerging Mechanistic Paradigms. Circulation, 100(4), e20–e28.doi:10.1161/01.CIR.100.4.e20
Fadini, G. P., Rattazzi, M., Matsumoto, T., Asahara, T., & Khosla, S. (2012). EmergingRole of Circulating Calcifying Cells in the Bone-Vascular Axis. Circulation,125(22), 2772–2781. doi:10.1161/CIRCULATIONAHA.112.090860
Filgueira, L. (2004). Fluorescence-based staining for Tartrate-resistant AcidicPhosphatase (TRAP) in osteoclasts combined with other fluorescent dyes andprotocols. Journal of Histochemistry & Cytochemistry, 52(3), 411–414.doi:10.1177/002215540405200312
Fishbein, G. A., & Fishbein, M. C. (2009). Rethinking the Current Classification.Archive of Pathology & Laboratory Medicine, 133, 1309–1316.
Foo, C., Frey, S., Yang, H. H., Zellweger, R., & Filgueira, L. (2007). Downregulationof beta-catenin and transdifferentiation of human osteoblasts to adipocytes underestrogen deficiency. Gynecological endocrinology : the official journal of the International Society of Gynecological Endocrinology, 23(9), 535–40.doi:10.1080/09513590701556483
Fowler, B., Jamrozik, K., Norman, P., & Allen, Y. (2002). Prevalence of peripheralarterial disease: persistence of excess risk in former smokers. Australian and NewZealand Journal of Public Health, 26(3), 219–24. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12141616
Gabbiani, G., Schmid, E., Winter, S., Chaponnier, C., Chastonay, D., Vandekerckhove,J., & Franke, W. W. (1981). Vascular smooth muscle cells differ from othersmooth muscle cells : Predominance of vimentin filaments and a specific a-type actin. Proceedings of the National Academy of Sciences of the United States ofAmerica, 78.
Gan, A.-M., Butoi, E. D., Manea, A., Simion, V., Stan, D., Parvulescu, M.-M., …Simionescu, M. (2013). Inflammatory effects of resistin on human smooth musclecells: up-regulation of fractalkine and its receptor, CX3CR1 expression by TLR4and Gi-protein pathways. Cell and Tissue Research, 351(1), 161–74.doi:10.1007/s00441-012-1510-9
Golomb, B. a, Dang, T. T., & Criqui, M. H. (2006). Peripheral arterial disease:morbidity and mortality implications. Circulation, 114(7), 688–99.doi:10.1161/CIRCULATIONAHA.105.593442
Grayston, J. T. (2000). Background and current knowledge of Chlamydia pneumoniaeand atherosclerosis. The Journal of Infectious Diseases, 181(Suppl 3), S402–10.doi:10.1086/315596
![Page 95: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/95.jpg)
80
Green, S. R., Han, K. H., Chen, Y., Almazan, F., Charo, I. F., Miller, Y. I., &Quehenberger, O. (2006). The CC chemokine MCP-1 stimulates surfaceexpression of CX3CR1 and enhances the adhesion of monocytes tofractalkine/CX3CL1 via p38 MAPK. The Journal of Immunology, 176(12), 7412–20. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/16751386
Guo, J., de Waard, V., Van Eck, M., Hildebrand, R. B., van Wanrooij, E. J. a, Kuiper,J., … Van Berkel, T. J. C. (2005). Repopulation of apolipoprotein E knockout micewith CCR2-deficient bone marrow progenitor cells does not inhibit ongoingatherosclerotic lesion development. Arteriosclerosis Thrombosis and VascularBiology, 25(5), 1014–9. doi:10.1161/01.ATV.0000163181.40896.42
Gutiérrez, J., Luna, J. D. D., Linares, J., Montes, R., Quesada, E., Rojas, A., …Sorlozano, A. (2005). Relationship between peripheral arterial occlusive disease(PAOD) and chronic Chlamydophila (Chlamydia) pneumoniae infection. ThrombHaemost, 93, 1153–1160. doi:10.1160/TH04
Heymann, M.-F., Herisson, F., Davaine, J.-M., Charrier, C., Battaglia, S., Passuti, N.,… Heymann, D. (2012). Role of the OPG/RANK/RANKL triad in calcifications ofthe atheromatous plaques: comparison between carotid and femoral beds. Cytokine,58(2), 300–6. doi:10.1016/j.cyto.2012.02.004
Hjortnaes, J., Butcher, J., Figueiredo, J.-L., Riccio, M., Kohler, R. H., Kozloff, K. M.,… Aikawa, E. (2010). Arterial and aortic valve calcification inversely correlateswith osteoporotic bone remodelling: a role for inflammation. European HeartJournal, 31(16), 1975–84. doi:10.1093/eurheartj/ehq237
Hoshino, A., Ueha, S., Hanada, S., Imai, T., & Ito, M. (2012). Roles of chemokinereceptor CX3CR1 in maintaining murine bone homeostasis through the regulationof both osteoblsats and osteoclasts. Journal of Cell Science, 126(December).
Hoshino, A., Ueha, S., Hanada, S., Imai, T., Ito, M., Yamamoto, K., … Iimura, T.(2013). Roles of chemokine receptor CX3CR1 in maintaining murine bonehomeostasis through the regulation of both osteoblasts and osteoclasts. Journal ofCell Science, 126(Pt 4), 1032–45. doi:10.1242/jcs.113910
Hunt, J. L. (2002). Bone Formation in Carotid Plaques: A Clinicopathological Study.Stroke, 33(5), 1214–1219. doi:10.1161/01.STR.0000013741.41309.67
Iyemere, V. P., Proudfoot, D., Weissberg, P. L., & Shanahan, C. M. (2006). Vascularsmooth muscle cell phenotypic plasticity and the regulation of vascularcalcification. Journal of Internal Medicine, 260(3), 192–210. doi:10.1111/j.1365-2796.2006.01692.x
Jeffcoate, W. J., Rasmussen, L. M., Hofbauer, L. C., & Game, F. L. (2009). Medialarterial calcification in diabetes and its relationship to neuropathy. Diabetologia,52(12), 2478–88. doi:10.1007/s00125-009-1521-6
Jeziorska, M., McCollum, C., & Woolley, D. (1998). Calcification in atheroscleroticplaque of human carotid arteries: associations with mast cells and macrophages.Journal Of Pathology, 185, 10–17.
![Page 96: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/96.jpg)
81
Jones, D. H., Kong, Y.-Y., & Penninger, J. M. (2002). Role of RANKL and RANK inbone loss and arthritis. Annals of the Rheumatic Diseases, 61 Suppl 2, ii32–9.Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1766717&tool=pmcentrez&rendertype=abstract
Knudsen, S. T., Foss, C. H., Poulsen, P. L., Andersen, N. H., Mogensen, C. E., &Rasmussen, L. M. (2003). Increased plasma concentrations of osteoprotegerin intype 2 diabetic patients with microvascular complications. European Journal ofEndocrinology / European Federation of Endocrine Societies, 149(1), 39–42.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/12824864
Koizumi, K., Saitoh, Y., Minami, T., Takeno, N., Tsuneyama, K., Miyahara, T., …Saiki, I. (2009). Role of CX3CL1/fractalkine in osteoclast differentiation and boneresorption. Journal of immunology (Baltimore, Md. : 1950), 183(12), 7825–31.doi:10.4049/jimmunol.0803627
Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., …Kishimoto, T. (1997). Targeted disruption of Cbfa1 results in a complete lack ofbone formation owing to maturational arrest of osteoblasts. Cell, 89(5), 755–64.Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/9182763
Kumar, A. H. S., Metharom, P., Schmeckpeper, J., Weiss, S., Martin, K., & Caplice, N.M. (2010). Bone marrow-derived CX3CR1 progenitors contribute to neointimalsmooth muscle cells via fractalkine CX3CR1 interaction. The FASEB Journal : Official Publication of the Federation of American Societies for ExperimentalBiology, 24(1), 81–92. doi:10.1096/fj.09-132225
Lehto, S., Niskanen, L., Suhonen, M., Rönnemaa, T., Saikku, P., & Laakso, M. (2002).Association between Chlamydia pneumoniae antibodies and intimal calcificationin femoral arteries of nondiabetic patients. Archives of Internal Medicine, 162(5),594–9. Retrieved from http://www.ncbi.nlm.nih.gov/pubmed/11871929
Leinonen, M., & Saikku, P. (2002). Evidence for infectious agents in cardiovasculardisease and atherosclerosis. Lancet Infectious Diseases, 2, 11–17.
Levy, P. J. (2002). Epidemiology and pathophysiology of peripheral arterial disease.Clinical Cornerstone, 4(5), 1–15. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/16472007
Lian, N., Lin, T., Liu, W., Wang, W., Li, L., Sun, S., … Yang, X. (2012). Transforminggrowth factor β suppresses osteoblast differentiation via the vimentin activating transcription factor 4 (ATF4) axis. The Journal of biological chemistry, 287(43),35975–84. doi:10.1074/jbc.M112.372458
Lian, N., Wang, W., Li, L., Elefteriou, F., & Yang, X. (2009). Vimentin inhibits ATF4-mediated osteocalcin transcription and osteoblast differentiation. The Journal ofBiological Chemistry, 284(44), 30518–25. doi:10.1074/jbc.M109.052373
Libby, P. (2002). Inflammation and Atherosclerosis. Circulation, 105(9), 1135–1143.doi:10.1161/hc0902.104353
![Page 97: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/97.jpg)
82
Lin, T. M., Chen, W. J., Chen, H. Y., Wang, P. W., & Eng, H. L. (2003). Increasedincidence of cytomegalovirus but not CP in athelosclerotic lesions of arteries oflower extremities from patients with diabetes mellitus undergoing amputation.Journal of Clinical Pathology, 56, 429–433.
Liu, P., Yu, Y.-R. a, Spencer, J. a, Johnson, A. E., Vallanat, C. T., Fong, A. M., …Patel, D. D. (2008). CX3CR1 deficiency impairs dendritic cell accumulation inarterial intima and reduces atherosclerotic burden. Arteriosclerosis Thrombosisand Vascular Biology, 28(2), 243–50. doi:10.1161/ATVBAHA.107.158675
Lucas, A. D., Bursill, C., Guzik, T. J., Sadowski, J., Channon, K. M., & Greaves, D. R.(2003). Smooth muscle cells in human atherosclerotic plaques express thefractalkine receptor CX3CR1 and undergo chemotaxis to the CX3C chemokinefractalkine (CX3CL1). Circulation, 108(20), 2498–504.doi:10.1161/01.CIR.0000097119.57756.EF
Mabilleau, G., Petrova, N. L., Edmonds, M. E., & Sabokbar, a. (2008). Increasedosteoclastic activity in acute Charcot’s osteoarthopathy: the role of receptoractivator of nuclear factor-kappaB ligand. Diabetologia, 51(6), 1035–1040.doi:10.1007/s00125-008-0992-1
Manolakis, A. ., Kapsoritakis, A. ., Tiaka, E. ., Sidiropoulos, A., Gerovassili, A., Satra,M., … Vamvakopoulos, N. (2011). TLR4 gene polymorphisms: evidence forprotection against type 2 diabetes but not for diabetes-associated ischaemic heartdisease. European Journal of Endocrinology / European Federation of EndocrineSocieties, 165(2), 261–7. doi:10.1530/EJE-11-0280
Massy, Z. a, Mentaverri, R., Mozar, A., Brazier, M., & Kamel, S. (2008). Thepathophysiology of vascular calcification: are osteoclast-like cells the missinglink? Diabetes & Metabolism, 34 Suppl 1, S16–20. doi:10.1016/S1262-3636(08)70098-3
Matsumoto, T., Kobayashi, T., & Kamata, K. (2010). Diabetic conditions act asmatchmaker for monocytes and vascular smooth muscle cells. American Journal ofPhysiology. Heart Circ Physiol, 298(3), H731–3. doi:10.1152/ajpheart.01157.2009
Mitchell, G. F., Parise, H., Benjamin, E. J., Larson, M. G., Keyes, M. J., Vita, J. a, …Levy, D. (2004). Changes in arterial stiffness and wave reflection with advancingage in healthy men and women: the Framingham Heart Study. Hypertension,43(6), 1239–45. doi:10.1161/01.HYP.0000128420.01881.aa
Moe, S. M., & Chen, N. X. (2005). Inflammation and vascular calcification. BloodPurification, 23(1), 64–71. doi:10.1159/000082013
Moser, B., Wolf, M., Walz, A., & Loetscher, P. (2004). Chemokines: multiple levels ofleukocyte migration control. Trends in immunology, 25(2), 75–84.doi:10.1016/j.it.2003.12.005
Mozes, G., Keresztury, G., Kadar, a, Magyar, J., Sipos, B., Dzsinich, S., & Gloviczki,P. (1998). Atherosclerosis in amputated legs of patients with and without diabetesmellitus. International angiology : a journal of the International Union of
![Page 98: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/98.jpg)
83
Angiology, 17(4), 282–6. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10204663
Ndip, A., Williams, A., Jude, E. B., & Serracino-inglott, F. (2011). TheRANKL/RANK/OPG Signaling Pathway Mediates Medial Arterial Calcificationin Diabetic Charcot Neuroarthropathy. Diabetes Journal, 60(8), 2187.
Nedkoff, L., Briffa, T. G., Knuiman, M., Hung, J., Norman, P. E., Hankey, G. J., …Hobbs, M. (2012). Temporal trends in the incidence and recurrence of hospitalisedatherothrombotic disease in an Australian population, 2000-07: data linkage study.Heart, 98(19), 1449–56. doi:10.1136/heartjnl-2012-302181
Newby, a C., & Zaltsman, a B. (1999). Fibrous cap formation or destruction--the criticalimportance of vascular smooth muscle cell proliferation, migration and matrixformation. Cardiovascular research, 41(2), 345–60. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/10341834
Ngeh, J., Anand, V., & Gupta, S. (2002). Chlamydia pneumoniae and atherosclerosis --what we know and what we don’t. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and InfectiousDiseases, 8(1), 2–13. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/11906495
Nishio, Y., Dong, Y., Paris, M., O’Keefe, R. J., Schwarz, E. M., & Drissi, H. (2006).Runx2-mediated regulation of the zinc finger Osterix/Sp7 gene. Gene, 372, 62–70.doi:10.1016/j.gene.2005.12.022
Norgren, L., Hiatt, W. R., Dormandy, J. a, Nehler, M. R., Harris, K. a, & Fowkes, F. G.R. (2007). Inter-Society Consensus for the Management of Peripheral ArterialDisease (TASC II). Journal of Vascular Surgery, 45 Suppl S, S5–67.doi:10.1016/j.jvs.2006.12.037
Norman, P. E., Eikelboom, J. W., & Hankey, G. J. (2004). Peripheral arterial disease:prognostic significance and prevention of atherothrombotic complications. TheMedical Journal of Australia, 181(3), 150–4. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/15287833
Panizo, S., Cardus, A., Encinas, M., Parisi, E., Valcheva, P., López-Ongil, S., …Valdivielso, J. M. (2009). RANKL increases vascular smooth muscle cellcalcification through a RANK-BMP4-dependent pathway. Circulation Research,104(9), 1041–8. doi:10.1161/CIRCRESAHA.108.189001
Parfitt, a M. (1984). The cellular basis of bone remodeling: the quantum conceptreexamined in light of recent advances in the cell biology of bone. Calcified TissueInternational, 36 Suppl 1, S37–45. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/6430521
Pasterkamp, G., Van Keulen, J. K., & De Kleijn, D. P. V. (2004). Role of Toll-likereceptor 4 in the initiation and progression of atherosclerotic disease. Europeanjournal of clinical investigation, 34(5), 328–34. doi:10.1111/j.1365-2362.2004.01338.x
![Page 99: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/99.jpg)
84
Phinney, D. G., & Prockop, D. J. (2007). Concise review: mesenchymalstem/multipotent stromal cells: the state of transdifferentiation and modes of tissuerepair--current views. Stem cells (Dayton, Ohio), 25(11), 2896–902.doi:10.1634/stemcells.2007-0637
Plasschaert, H., Heeneman, S., & Daemen, M. J. (2009). Progression in atherosclerosis:histological features and pathophysiology of atherosclerotic lesions. Topics inmagnetic resonance imaging : TMRI, 20(4), 227–37.doi:10.1097/RMR.0b013e3181ea2869
Poulsen, M. K., Nybo, M., Dahl, J., Hosbond, S., Poulsen, T. S., Johansen, A., …Henriksen, J. E. (2011). Plasma osteoprotegerin is related to carotid and peripheralarterial disease, but not to myocardial ischemia in type 2 diabetes mellitus.Cardiovascular diabetology, 10(1), 76. doi:10.1186/1475-2840-10-76
Proudfoot, D., Skepper, J. N., Shanahan, C. M., & Weissberg, P. L. (1998).Calcification of Human Vascular Cells In Vitro Is Correlated With High Levels ofMatrix Gla Protein and Low Levels of Osteopontin Expression. Arteriosclerosis,Thrombosis, and Vascular Biology, 18(3), 379–388. doi:10.1161/01.ATV.18.3.379
Reinhard, H., Lajer, M., Gall, M.-A., & Tarnow, L. (2010). Osteoprotegerin andMortality in Type 2 Diabetic Patients. Diabetes Care, 33(12), 2561.doi:10.2337/dc10-0858.
Rödel, J., Woytas, M., Groh, a, Schmidt, K. H., Hartmann, M., Lehmann, M., &Straube, E. (2000). Production of basic fibroblast growth factor and interleukin 6by human smooth muscle cells following infection with Chlamydia pneumoniae.Infection and immunity, 68(6), 3635–41. Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=97653&tool=pmcentrez&rendertype=abstract
Roijers, R. B., Debernardi, N., Cleutjens, J. P. M., Schurgers, L. J., Mutsaers, P. H. a, &van der Vusse, G. J. (2011). Microcalcifications in early intimal lesions ofatherosclerotic human coronary arteries. The American journal of pathology,178(6), 2879–87. doi:10.1016/j.ajpath.2011.02.004
Rosenfeld, M. E., Blessing, E., Lin, T. M., Moazed, T. C., Campbell, L. a, & Kuo, C.(2000, June). Chlamydia, inflammation, and atherogenesis. The Journal ofinfectious diseases. doi:10.1086/315618
Ross, R. (1999). Atherosclerosis-An inflammatory disease. The New England Journalof Medicine, 340(2), 115–126.
Saitoh, Y., Koizumi, K., Sakurai, H., Minami, T., & Saiki, I. (2007). RANKL-induceddown-regulation of CX3CR1 via PI3K/Akt signaling pathway suppressesFractalkine/CX3CL1-induced cellular responses in RAW264.7 cells. Biochemicaland Biophysical Research Communications, 364(3), 417–22.doi:10.1016/j.bbrc.2007.09.137
Salabei, J. K., Cummins, T. D., Singh, M., Jones, S. P., Bhatnagar, A., & Hill, B. G.(2013). PDGF-mediated autophagy regulates vascular smooth muscle cell
![Page 100: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/100.jpg)
85
phenotype and resistance to oxidative stress. The Biochemical journal, 451(3),375–88. doi:10.1042/BJ20121344
Sangiorgi, G., Rumberger, J. a, Severson, a, Edwards, W. D., Gregoire, J., Fitzpatrick,L. a, & Schwartz, R. S. (1998). Arterial calcification and not lumen stenosis ishighly correlated with atherosclerotic plaque burden in humans: a histologic studyof 723 coronary artery segments using nondecalcifying methodology. Journal ofthe American College of Cardiology, 31(1), 126–33. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/9426030
Schoppet, M., Al-Fakhri, N., Franke, F. E., Katz, N., Barth, P. J., Maisch, B., …Hofbauer, L. C. (2004). Localization of osteoprotegerin, tumor necrosis factor-related apoptosis-inducing ligand, and receptor activator of nuclear factor-kappaBligand in Mönckeberg’s sclerosis and atherosclerosis. The Journal of clinicalendocrinology and metabolism, 89(8), 4104–12. doi:10.1210/jc.2003-031432
Secchiero, P., Corallini, F., Pandolfi, A., Consoli, A., Candido, R., Fabris, B., … Zauli,G. (2006). An increased osteoprotegerin serum release characterizes the early onsetof diabetes mellitus and may contribute to endothelial cell dysfunction. TheAmerican Journal of Pathology, 169(6), 2236–44. doi:10.2353/ajpath.2006.060398
Shanahan, C. M., Cary, N. R. B., Salisbury, J. R., Proudfoot, D., Weissberg, P. L., &Edmonds, M. E. (1999). Medial Localization of Mineralization-RegulatingProteins in Association With Monckeberg s Sclerosis : Evidence for Smooth Muscle Cell-Mediated Vascular Calcification. Circulation, 100(21), 2168–2176.doi:10.1161/01.CIR.100.21.2168
Shi, Q., Cox, L., Glenn, J., Tejero, M. E., Hodara, V., VandeBerg, J. L., & Wang, X. L.(2010). Molecular pathways mediating differential responses to lipopolysaccharidebetween human and baboon arterial endothelial cells. Clin Exp PharmacolPhysiol., 37(2), 178–184. doi:10.1111/j.1440-1681.2009.05260.x.MOLECULAR
Soor, G. S., Vukin, I., Leong, S. W., Oreopoulos, G., & Butany, J. (2008). Peripheralvascular disease: who gets it and why? A histomorphological analysis of 261arterial segments from 58 cases. Pathology, 40(4), 385–391.doi:10.1080/00313020802036764
Speer, M. Y., Yang, H.-Y., Brabb, T., Leaf, E., Look, A., Lin, W.-L., … Giachelli, C.M. (2009). Smooth muscle cells give rise to osteochondrogenic precursors andchondrocytes in calcifying arteries. Circulation research, 104(6), 733–41.doi:10.1161/CIRCRESAHA.108.183053
Spirig, R., Tsui, J., & Shaw, S. (2012). The Emerging Role of TLR and InnateImmunity in Cardiovascular Disease. Cardiology research and practice, 2012,181394. doi:10.1155/2012/181394
Steitz, S. a., Speer, M. Y., Curinga, G., Yang, H.-Y., Haynes, P., Aebersold, R., …Giachelli, C. M. (2001). Smooth muscle cell phenotypic transition associated withcalcification: ppregulation of Cbfa1 and downregulation of smooth muscle lineagemarkers. Circulation Research, 89(12), 1147–1154. doi:10.1161/hh2401.101070
![Page 101: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/101.jpg)
86
Stoll, L. L., Denning, G. M., Li, W., James, B., Harrelson, A. L., Romig, S. A., …Weintraub, N. L. (2004). Regulation of endotoxin-induced proinflammatoryactivation in human coronary artery cells: Expression of functional membrane-bound CD14 by Human Coronary Artery Smooth Muscle Cells. The Journal ofImmunology, 173, 1336–1343.
Stöllberger, C., & Finsterer, J. (2002). Role of infectious and immune factors incoronary and cerebrovascular arteriosclerosis. Clinical and Diagnostic LaboratoryImmunology, 9(2), 207–215. doi:10.1128/CDLI.9.2.207
Tang, Z., Wang, A., Yuan, F., Yan, Z., Liu, B., Chu, J. S., … Li, S. (2012).Differentiation of multipotent vascular stem cells contributes to vascular diseases.Nature communications, 3, 875. doi:10.1038/ncomms1867
Tervaert, J. W. C. (2009). Translational mini-review series on immunology of vasculardisease: accelerated atherosclerosis in vasculitis. Clinical and experimentalimmunology, 156(3), 377–85. doi:10.1111/j.1365-2249.2009.03885.x
Thomas, M., Wong, Y., Thomas, D., Ajaz, M., Tsang, V., Gallagher, P. J., & Ward, M.E. (1999). Relation Between Direct Detection of Chlamydia pneumoniae DNA inHuman Coronary Arteries at Postmortem Examination and Histological Severity(Stary Grading) of Associated Atherosclerotic Plaque. Circulation, 99(21), 2733–2736. doi:10.1161/01.CIR.99.21.2733
Umehara, H., Bloom, E. T., Okazaki, T., Nagano, Y., Yoshie, O., & Imai, T. (2004).Fractalkine in vascular biology: from basic research to clinical disease.Arteriosclerosis Thrombosis and Vascular Biology, 24(1), 34–40. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/12969992
Vattikuti, R., & Towler, D. a. (2004). Osteogenic regulation of vascular calcification: anearly perspective. American Journal of Physiology. Endocrinology andMetabolism, 286(5), E686–96. doi:10.1152/ajpendo.00552.2003
Vukovic, I., Arsenijevic, N., Lackovic, V., & Todorovic, V. (2006). The origin anddifferentiation potential of smooth muscle cells in coronary atherosclerosis.Experimental and Clinical Cardiology, 11(2), 123–8. Retrieved fromhttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2274860&tool=pmcentrez&rendertype=abstract
Wada, T., McKee, M. D., Steitz, S., & Giachelli, C. M. (1999). Calcification ofVascular Smooth Muscle Cell Cultures : Inhibition by Osteopontin. Circ. Res.,84(2), 166–178. doi:10.1161/01.RES.84.2.166
Ward, M. R., Pasterkamp, G., Yeung, a. C., & Borst, C. (2000). Arterial Remodeling : Mechanisms and Clinical Implications. Circulation, 102(10), 1186–1191.doi:10.1161/01.CIR.102.10.1186
Wattanakit, K., Folsom, A. R., Selvin, E., Weatherley, B. D., Pankow, J. S., Brancati, F.L., & Hirsch, A. T. (2005). Risk factors for peripheral arterial disease incidence inpersons with diabetes: the Atherosclerosis Risk in Communities (ARIC) Study.Atherosclerosis, 180(2), 389–97. doi:10.1016/j.atherosclerosis.2004.11.024
![Page 102: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/102.jpg)
87
Weitzmann, M. N., & Pacifici, R. (2006). Estrogen deficiency and bone loss : an inflammatory tale. The Journal of Cinical Investigation, 116(5), 1186.doi:10.1172/JCI28550.1186
Wong, B. W. C., Wong, D., & McManus, B. M. (2002). Characterization of fractalkine(CX3CL1) and CX3CR1 in human coronary arteries with native atherosclerosis,diabetes mellitus, and transplant vascular disease. Cardiovascular Pathology. TheOfficial Journal of the Society for Cardiovascular Pathology, 11(6), 332–338.Retrieved fromhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Citation&list_uids=12459434
Yoshiba, N., Yoshiba, K., & Ohkura, N. (2012). Immunohistochemical analysis of twostem cell markers of a-smooth muscle actin and STRO-1 during wound healing ofhuman dental pulp. Histochem Cell Biol, 138, 583–592. doi:10.1007/s00418-012-0978-4
Yuan, Y. Y., Kostenuik, P. J., Ominsky, M. S., Morony, S., Adamu, S., Simionescu, D.T., … Bateman, T. a. (2008). Skeletal deterioration induced by RANKL infusion: amodel for high-turnover bone disease. Osteoporosis International : A journal established as result of cooperation between the European Foundation forOsteoporosis and the National Osteoporosis Foundation of the USA, 19(5), 625–35. doi:10.1007/s00198-007-0509-7
Zhang, S., Wang, X., Zhang, L., Yang, X., Pan, J., & Ren, G. (2011). Characterizationof monocyte chemoattractant proteins and CC chemokine receptor 2 expressionduring atherogenesis in apolipoprotein E-null mice. Journal of Atherosclerosis andThrombosis, 18(10), 846–56. Retrieved fromhttp://www.ncbi.nlm.nih.gov/pubmed/21712615
Ziegler, S., Kudlacek, S., Luger, A., & Minar, E. (2005). Osteoprotegerin plasmaconcentrations correlate with severity of peripheral artery disease. Atherosclerosis,182(1), 175–80. doi:10.1016/j.atherosclerosis.2005.01.042
Zulli, A., Buxton, B. F., Merrilees, M., & Hare, D. L. (2008). Human diseased arteriescontain cells expressing leukocytic and embryonic stem cell markers. HumanPathology, 39(5), 657–65. doi:10.1016/j.humpath.2007.09.022
![Page 103: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/103.jpg)
88
Appendix I
![Page 104: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/104.jpg)
89
Information and Consent for Blood/Tissue/DNA (Genetic)Collection, Storage and Testing for Research
The role of inflammatory factors in peripheral arterial disease
REQUIREMENTS OF STUDY: (this form to be completed by Researcher)
In general, the South Metropolitan Area Health Service Human Research EthicsCommittee requires that the collection, use and storage of blood/tissue/DNAsamples be conducted in accordance with the NHMRC National Statement onEthical Conduct in Human Research (2007) and the Guidelines for Genetic Registersand Associated Genetic Material (2000).
Accordingly, in this study patients’ samples will be used in the following ways(these are to be explained to the patient by the study nurse or doctor):
A. SPECIFICITY OF RESEARCH
1. Samples will be used only for the purposes specified for thisstudy:
Yes
2. Samples will be used for other unspecified research purposes: No
B. STORAGE OF SAMPLES
1. Place of storage:The School of Anatomy and Human Biology, University of Western Australia
2. Body responsible for storage procedures:Professor Luis Figueria of the School of Anatomy and Human Biology, University ofWestern Australia
3. Contact details for patient use to arrange for retrieval or destruction of samples, orto obtain information about results:Professor Paul Norman, UWA School of Surgery, Fremantle Hospital. Tel:0894312500. Fax: 0894312623.
4. Duration of storage:
current storage for specific use: Yes
![Page 105: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/105.jpg)
90
long-term storage for specific use: Yes
long-term storage for unspecified use: No
5. Can stored samples and information be traced back (directly orindirectly) to the patient?
(If the answer to 5 is “No” then all answers to “C” must be “No”)
No
C. ACCESS TO SAMPLES AND RESEARCH RESULTS
1. Will the patient be able to receive results of their testing? No
2 . Will the patient be able to retrieve/destroy samples if theywithdraw from the study or wish to at a later date?
No
3. Could future testing of the sample reveal paternity/maternity? No
4. Will the test results be available to family members?
Upon the patient’s request No
Upon the family’s request No
Under any other circumstances (specify) No
CONSENT
I, ___________________________________of _____________________________________
______________________________________________________________________________
have read and understand the nature of this study as stated in the above details.The Information and any questions I have asked have been answered to mysatisfaction.
![Page 106: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/106.jpg)
91
............………………………………… ……………………..…………. ……...............Name of Patient Signature of Patient Date
……………………………………........ ..……………………………….. ...........………..
Name of Witness to Patient Signature Signature of WitnessDate
..………………………………………… .………………................…….. ...............………Name of Investigator Signature of Investigator Date
* The NHMRC advises the Australian community and Commonwealth and State Governments onstandards of individual and public health, and supports research to improve those standards.
The South Metropolitan Area Health Service Human Research Ethics Committee has given ethicsapproval for the conduct of this project. If you have any ethical concerns you can contact the Chairof the Human Research Ethics Committee on (08) 9431 2929. All study participants will beprovided with a copy of the Information Sheet and Consent Form for their personal records.
![Page 107: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/107.jpg)
92
SOUTH METROPOLITAN HEALTH SERVICE
FREMANTLE HOSPITAL
PATIENT INFORMATION SHEET
The role of inflammatory factors in peripheral arterial disease
Investigator: PROFESSOR PAUL NORMAN
INTRODUCTION
We invite you to participate in a research project which we believe is of potential
importance. However, before you decide whether or not you wish to participate, we
need to be sure that you understand why we are doing the research and what it would
involve if you agreed.
Please read this information carefully and be sure to ask any questions you have. The
doctor conducting the research will be happy to discuss it with you and to answer any
questions. You are free to discuss it with other people if you wish (i.e. family, friends
and/or your local doctor).
Your participation is purely voluntary and you are under no pressure to participate.
Should you agree to enter the study, you may change your mind and withdraw at any
stage.
This study has been approved by the South Metropolitan Area Health Service Human
Research Ethics Committee. This study is under the direction of Professor Paul
Norman, one of the Vascular Surgeons at Fremantle Hospital.
1. WHAT IS THE PURPOSE OF THIS STUDY?
Hardening of the arteries (atherosclerosis) may cause severe lower limb problems
including ulcers and gangrene. This is due to blockages of the main arteries that supply
blood to the legs. In some cases, particularly in patients with diabetes, the only leg
arteries that are diseased are those in the calf - these are called the tibial arteries. The
reason why these arteries are particularly prone to damage by diabetes, often in the
absence of blockages in other arteries, is unknown. Another feature of diabetes is
nerve damage (peripheral neuropathy) and abnormalities in the skin circulation. It is
unclear how important the neuropathy and the skin changes are in making the
circulation in the foot so bad that an amputation is needed. This research aims to
![Page 108: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/108.jpg)
93
compare the tibial arteries and nerves and the skin in patients with and without
diabetes in order to find out more about the changes that result in poor circulation.
2. WHAT DOES PARTICIPATION IN THIS RESEARCH PROJECT INVOLVE?
The vascular surgeon looking after you has recommended that you need an
amputation of your leg. This is because of severe arterial disease resulting in loss of
blood supply to the foot or leg. In your case this may or may not be due to diabetes.
The nature and level of amputation and the possible complications will be described
separately by the team looking after you. We are seeking your consent to the following:
(a) obtain some basic information from your hospital records about your health – this
includes information such as age, medical history, medication history and whether you
have been a smoker; some routine blood test results (eg blood sugar) and the reports
of scans (CT, MR or ultrasound) of your arteries (if available).
(b) after the amputation, remove a 10cm length of a tibial artery, a 5cm length of nerve,
a 2cm ellipse of skin from calf part of your leg and the tip of a toe. These samples will
be removed from the leg after it has been amputated. This does not affect your
operation in any way.
(c) take a 10ml (~one tablespoon) sample of blood from a vein in your arm. If at all
possible this will be done at the same time as routine blood tests, thereby avoiding an
extra needle.
3. WHAT WILL HAPPEN TO MY INFORMATION AND SAMPLES?
Only information necessary for the purposes of the study will be collected by the
researchers. This information includes your: age, medical history and diagnosis,
smoking history, current medications, results of X-rays and scans of your arteries,
routine blood test results any medical procedures that you undergo. All information
collected will be confidential and will be labelled with a code number and not your
name. Only Professor Norman will know your name. You can request to have access
to information collected and held about you during the study by contacting Professor
Norman (on 94312500). You may request that any incorrect personal data be
corrected.
The samples of artery, nerve, skin and blood will be taken to a laboratory in the School
of Anatomy and Human Biology at the University of Western Australia. The samples
will be identified by a number only and your name will not appear on them. The
samples will be studied by a PhD Student (Rasheeda Zamin) using a range of
laboratory techniques including examination under a microscope and the measurement
of various molecules relevant to arterial disease. The blood sample will be used to
![Page 109: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/109.jpg)
94
measure the concentration of certain proteins that may be relevant to arterial disease.
It will not be possible to make the results of any of these laboratory tests available to
you as your name will be removed from all samples.
4. WHAT ARE THE POSSIBLE BENEFITS?
There are no specific benefits for you personally. You will not receive any form of
payment for participation in this study. If successful, the research may help explain why
the calf arteries become so diseased in patients with diabetes. This has the potential to
help a future patient avoid an amputation.
5. WHAT ARE THE POSSIBLE DISCOMFORTS AND RISKS?
The removal of samples of artery, nerve and skin from the leg after amputation is of no
risk to you personally. Taking a blood sample from a vein in your arm may be
associated with a small risk of bruising.
6. CAN I HAVE OTHER TREATMENTS DURING THIS RESEARCH PROJECT?
The research will not alter your usual treatment in any way.
7. HOW WILL I BE INFORMED OF THE RESULTS OF THIS RESEARCH
PROJECT?
The results from individual patients are only analysed as part of the whole study and
your personal results will not be made available. Any published results of the study can
be obtained from the researchers (Professor Paul Norman) on request. Publication
may not occur for several years. When the results of the study are published,
participant data will be de-identified and all results supplied will be grouped. This
means that it will not be possible to identify individual participants from the results. As
part of West Australian law regarding research, all information about this study and its
participants will be kept for a minimum of 15 years.
8. WHAT IF I WITHDRAW FROM THIS RESEARCH PROJECT?
This study is entirely voluntary and you will be given time to decide whether you wish to
participate. If you do not wish to take part you don’t have to. If you decide to take part
and later change your mind, you are free to withdraw from the project at any stage
without having to give any reasons. However, once your name has been removed from
tissue (artery, skin, nerve and blood) samples it will no longer be possible to discard
your samples. Your decision whether to take part or not, or to take part and then
withdraw will not affect your current or future treatment. If you decide to withdraw,
![Page 110: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/110.jpg)
95
please notify your vascular surgeon or Professor Paul Norman via nursing or medical
staff looking after you on the ward.
9. WHAT ARE MY RIGHTS?
If you choose to participate and you become injured in this study and your injury is a
direct result of the effects of the study procedures, Fremantle Hospital will provide
reasonable medical treatment. By participating in this study, your normal legal rights
under common law will not be affected.
Your study doctor and colleagues are available to answer any questions you may have
regarding the treatment described or the study procedures. If you have any questions
regarding this research trial, you may contact:
PROFESSOR PAUL NORMAN on 9431 2500 or via nursing staff on the ward
The South Metropolitan Area Health Service (SMAHS) Human Research Ethics
Committee has approved this study. Should you wish to speak to a person not directly
involved in the study in relation to
matters concerning policies,
information about the conduct of the study,
your rights as participant, or
should you wish to make a confidential complaint, you may contact Chairman of this
Committee, on 9431 2929.
As a participant in this study you will be provided with a copy of the Information Sheet and
Consent Form for your personal records if requested.
![Page 111: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/111.jpg)
96
FREMANTLE HOSPITAL PATIENT CONSENT FORMThe role of inflammatory factors in peripheral arterial disease
Investigator: PROFESSOR PAUL NORMAN
I, the undersigned (print name)________________________________________
hereby consent to my involvement in the research project explained above.
I am over 18 years of age. I have read the information sheet entitled ‘The role of
inflammatory factors in peripheral arterial disease’, and I understand the
reasons for this study.
The details of the study have been explained to me by Professor Norman,
including:
The nature of the procedures being performed
Any risks or discomforts which I may experience
My questions have been answered to my satisfaction.
My consent is given voluntarily.
I understand I am free to withdraw from the study at any time without having to
give a reason, and without my medical care or legal rights being affected.
I understand that my tissue samples cannot be withdrawn once my name has
been removed from them.
I understand that the information in my medical records is essential to evaluate
the results of this study. I agree to the release of this information to the research
staff and on the understanding that it will be treated confidentially. I understand
that I will not be referred to by name in any report concerning this study. In turn,
I cannot restrict in any way the use of the results that arise from this study.
I understand that my normal legal rights to compensation under common law
will not be affected by participating in this study.
I understand that the purpose of this research project is to improve the quality of
medical care, but my involvement may not be of benefit to me.
I have been given the opportunity to have a member of family or a friend
present while the project was explained to me.
SIGNED DATE
WITNESSINVESTIGATOR
![Page 112: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/112.jpg)
97
Appendix II
Figure 1 Stacked bar graphs demonstrating the number of samples (and sections per artery) and
subjective evaluation of PCR positivity by the C. pneumoniae-species specific PCR assay by Adam
Polkinghornes’ group (unpublished data). PCR (polymerase chain reaction).
![Page 113: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/113.jpg)
98
Appendix IIITable 1. Non-diabetic PAD arterial samples assessed for CP detection using IF
(immunofluorescence) and PCR (polymerase chain reaction).
No. Sample ID Positive
sections tested
for IF
Positive sections
tested for PCR
Total sections
tested for PCR
1 P3 POP 0 3 4
2 P3 FIB 0 1 3
3 P3 ATA 0 0 2
4 P4 POP 1 1 5
5 P4 PTA 1 0 1
6 P10 ATA 1 1 4
7 P10 POP 1 0 3
8 P10 DPA 1 1 3
9 P10 PTA 1 2 3
Total positives 6 9 28
Positive (%) 67% 32%
Table 2. Diabetic PAD arterial samples assessed for CP detection using IF
(immunofluorescence) and PCR (polymerase chain reaction).
No. Sample ID Positive
sections tested
for IF
Positive sections
tested for PCR
Total sections
tested for PCR
1 P1 PTA 1 1 4
2 P1 POP 1 0 3
3 P2 ATA 1 2 4
4 P9 PTA 0 0 4
5 P9 POP 0 0 4
6 P9 ATA 0 0 3
Total positives 3 3 22
Positive (%) 50% 14%
![Page 114: Arterial Remodelling and Inflammation in Peripheral ... · Arterial Remodelling and Inflammation in Peripheral Arterial Disease Dr. Rasheeda Mohd. Zamin (MBBS, MSc. Anatomy) This](https://reader031.vdocuments.us/reader031/viewer/2022011816/5e6d63961a1ee960880d8e6a/html5/thumbnails/114.jpg)
99