1
N-METHYL-D-ASPARTATE (NMDA) RECEPTORS IN THE ENTERIC NERVOUS SYSTEM (ENS)
By
ARSEIMA YESENIA DEL VALLE-PINERO
A DISSERTATION PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT
OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY
UNIVERSITY OF FLORIDA
2009
2
© 2009 Arseima Yesenia Del Valle-Pinero
3
Para Mami Fernanda, Abuela Regina y las demás “amazonas” en mi familia, quienes me enseñaron que la mujer que busca ser igual al hombre carece de ambición.
4
ACKNOWLEDGMENTS
This dissertation would not have been possible without the support of many people.
Immense gratitude goes to my advisor, Dr. Robert M. Caudle, who gave me the chance to work
on this project and provided me with guidance and numerous indispensable comments for my
manuscripts. I highly value his advice and opinion in anything from astrocytes’ biophysics to
pop-culture.
I would like to thank my committee members for their assistance and constructive
comments: Dr. Donald Price, Dr. John Neubert, and Dr. Brian Harfe. I would also like to express
my appreciation to Dr. Sue Semple-Rowland, who generously sat through my qualifying exam
when asked in the nick of time. Thanks to Dr. Lee Kaplan, who recommend I look into Dr.
Caudle’s lab, the best advice I had in the last 6 years. I am also grateful to many persons who
shared their technical assistance, experience and friendship, especially; Federico Perez and the
members of the Caudle lab, both past and present, with whom I have been fortunate enough to
work: Shelby Suckow, Ethan Anderson, Ingrid Paredes and Matthew Martin.
Thanks go to the National Institute of Diabetes and Digestive and Kidney Disease (NIH-
NIDDK) for awarding me with a Ruth L. Kirschstein’s National Research Service Award Pre-
doctoral Fellowship, providing me with the financial means to complete this dissertation. Also
thanks to Harriet Scott, our grant specialist, for all her help and great disposition.
I would like to thank my family, Mamita Irma, Titi Ileana, but especially my Dad, Edgard
Resto who pointed me in the right direction, teaches me by example, and never stops believing in
me. Finally, thanks go to my dear friends, Francisco and my Gainesville’s friends, “my family
away from home.” My life is better because I met them. I could have not done it with out them.
5
TABLE OF CONTENTS page
ACKNOWLEDGMENTS ........................................................................................................... 4
LIST OF TABLES ...................................................................................................................... 7
LIST OF FIGURES .................................................................................................................... 8
LIST OF ABBREVIATIONS.................................................................................................... 10
LIST OF ABBREVIATIONS.................................................................................................... 10
ABSTRACT ............................................................................................................................. 11
CHAPTER
1 INTRODUCTION ............................................................................................................. 13
N-Methyl-D-Aspartate (NMDA) Receptors ........................................................................ 13 Overview .................................................................................................................... 13 Pathology .................................................................................................................... 14
Enteric Nervous System ..................................................................................................... 15 Overview .................................................................................................................... 15 Peristalsis .................................................................................................................... 16 Pathology: Bowel Disorders ........................................................................................ 17
Inflammatory Bowel Disease (IBD) ..................................................................... 17 Irritable Bowel Syndrome (IBS) ........................................................................... 18
NMDA Receptors in the Enteric Nervous System .............................................................. 19 Significance ....................................................................................................................... 19
2 GENERAL METHODS ..................................................................................................... 25
Animals.............................................................................................................................. 25 Tissue Collection................................................................................................................ 25 Reverse Transcription-PCR (RT-PCR) ............................................................................... 25 Western Blots ..................................................................................................................... 26 TNBS-Induced Colitis ........................................................................................................ 27 Colo-Rectal Distension....................................................................................................... 27 Mechanical Threshold Testing on Hind Paws: von Frey ..................................................... 28 Myeloperoxidase Activity Assay ........................................................................................ 28 Immunohistochemistry ....................................................................................................... 29
Whole Mount .............................................................................................................. 29 Cryostat Sections ......................................................................................................... 30
VIP Peptide Enzyme Immunoassay (EIA) Protocol ............................................................ 31 Ex Vivo Circular Muscle Colonic Contractility Assay ........................................................ 32 Colo-Rectal Manometry: In Vivo Motility .......................................................................... 32
6
Statistical Analyses ............................................................................................................ 33
3 EXPRESSION OF THE N-METHYL-D-ASPARTATE RECEPTOR NR1 SPLICE VARIANTS AND NR2 SUBUNIT SUBTYPES IN THE RAT COLON ........................... 38
Introduction........................................................................................................................ 38 Results ............................................................................................................................... 39
Expression of NR1 Protein in the Rat Colon. ............................................................... 39 Expression of Ssplice Variants of the NR1 Protein. ..................................................... 40 Expression of the N1 Cassette (exon 5) in the Rat Colon. ............................................ 40 Expression of C-Terminal Cassettes in the Rat Colon. ................................................. 41 Expression of NR2 Protein Subtypes. .......................................................................... 41 Co-labeling of NR1 with NR2B and NR2D in the Rat Colon. ...................................... 42
Discussion .......................................................................................................................... 42
4 NMDA RECEPTOR MEDIATED CHANGES IN CONTRACTILITY AFTER TNBS INDUCED COLITIS.......................................................................................................... 51
Introduction........................................................................................................................ 51 Results ............................................................................................................................... 52
Inflammation after TNBS Treatment ........................................................................... 52 NMDA Receptors Co-localize with VIP and NOS in the Rat Colon after Colitis. ........ 53 Changes in VIP Concentration Following TNBS Treatment ........................................ 53 NMDA Receptor Mediated Changes in Motility after TNBS Colitis ............................ 53
Discussion .......................................................................................................................... 54
5 CONCLUSIONS AND FUTURE CONSIDERATIONS .................................................... 67
NMDA Receptors in the Enteric Nervous System in the Naïve Rat Colon .......................... 67 NMDA Receptors in the Enteric Nervous System after TNBS-Induced Colitis ................... 68 Clinical Implications .......................................................................................................... 70 Future Considerations ........................................................................................................ 71
LIST OF REFERENCES .......................................................................................................... 74
BIOGRAPHICAL SKETCH ..................................................................................................... 81
7
LIST OF TABLES
Table page 2-1 RT-PCR Primers Sequences.. ........................................................................................ 34
2-2 Antibodies used for Western Blots and Immunohistochemical Assays.. ......................... 35
8
LIST OF FIGURES
Figure page 1-1 Schematic representations of the proposed structure of the NMDA receptor channel
subunits and the NR1 subunit splice variant composition ............................................... 21
1-2 Central Sensitization ...................................................................................................... 22
1-3 The Enteric Nervous System (ENS) ............................................................................... 23
1-4 Transmission from motor neurons to gastrointestinal muscle ......................................... 24
2-1 Clear colon tissue for whole mount preparations ............................................................ 36
2-2 Immunohistochemistry negative controls ....................................................................... 37
3-1 Expression of NR1 in the rat colon ................................................................................ 45
3-2 Visualization of NR1 protein and neuronal markers; PGP and neurofilament in the rat colon ........................................................................................................................ 46
3-3 Expression of NR1 splice variants in the rat colon ......................................................... 47
3-4 Visualization of the C2 and C2’cassettes in the rat myenteric plexus ............................. 48
3-5 Expression of NR2 subtypes in the rat colon .................................................................. 49
3-6 Co-labeling of NR1 with NR2B and NR2D subunits in the rat colon ............................. 50
4-1 Weight loss following trinitrobenzene sulfonic acid (TNBS) administration .................. 57
4-2 Visceral hypersensitivity after TNBS treatment ............................................................. 58
4-3 Somatic hypersensitivity after TNBS treatment.............................................................. 59
4-4 Myeloperoxidase (MPO) activity following TNBS-induced colitis ................................ 60
4-5 NMDA receptors present in the VIP/NOS neurons of the rat myenteric plexus 14 days following TNBS treatment ..................................................................................... 61
4-6 VIP in plasma after TNBS treatment .............................................................................. 62
4-7 NMDA receptor effect in VIP release 2 hours after TNBS treatment ............................. 63
4-8 NMDA receptor effect in VIP release 14 days after TNBS treatment. ............................ 64
4-9 Ex Vivo contractility following TNBS induced colitis ................................................... 65
9
4-10 Colo-rectal Manometry: In Vivo motility after TNBS .................................................... 66
5-1 Mechanism Model ......................................................................................................... 73
10
LIST OF ABBREVIATIONS
ACh Acetylcholine
APV 2-Amino-5-phosphonovalerate
CAN Colospinal Afferent Neurons
ENS Enteric Nervous System
GAPDH Glyceraldehyde-3-phosphate dehydrogenase
GI Gastrointestinal
HTAB Hexadecyltrimethylammonium Bromide
HRP Horse radish peroxidase
IBD Inflammatory Bowel Disease
IBS Irritable Bowel Syndrome
ICC Interstitial cells of Cajal
IHC Immunohistochemistry
MPO Myeloperoxidase
NF Neurofilament
NGS Normal Goat Serum
NMDA N-methyl-D-aspartate
NOS Nitric Oxide Synthase
PBS Phosphate Buffered Saline
PGP 9.5 Protein gene product 9.5
PVG Prevertebral ganglia
RT- PCR Reverse transcriptase polymerase chain reaction
TNBS Trinitrobenzene sulfonic acid
VIP Vasoactive intestinal peptide
11
Abstract of Dissertation Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy
N-METHYL-D-ASPARTATE (NMDA) RECEPTORS IN THE ENTERIC NERVOUS
SYSTEM (ENS)
By
Arseima Yesenia Del Valle-Pinero
August 2009 Chair: Robert Caudle Major: Medical Sciences - Neuroscience
More than 1.4 million Americans suffer from Crohn’s disease or ulcerative colitis, the
disorders that make up Inflammatory Bowel Disease (IBD). Irritable Bowel Syndrome (IBS)
afflicts 12% of adults in the US. The economic consequences of bowel disorders like IBD and
IBS are substantial not just because of direct medical care costs, but also as a result of time lost
at work. The annual costs of IBS management is estimated to be over $30 billion. Moreover, the
economic reward for an effective therapeutic is estimated to be on the order of $15 billion per
year. The major complaints in IBS and IBD patients are changes in bowel movements and the
associated pain.
Previous studies have shown that the N-methyl-D-aspartate (NMDA) receptor NR1
subunit and vasoactive intestinal peptide (VIP) co-exist in enteric neurons of the rat. Moreover,
NMDA alters peristalsis in the guinea pig colon and this effect is reversed by NMDA receptor
antagonists. We found that in the naïve animals’ colon, NMDA receptors are heteromeric
complexes of NR1001 or NR1000 with NR2B and/or NR2D. Moreover, the expression of specific
NR1 splice variants increases after trinitrobenzene sulfonic acid (TNBS) induced colitis.
Immunohistochemistry showed that the NMDA receptors present after inflammation co-
localized with vasoactive intestinal peptide and nitric oxide synthase. VIP concentration in the
12
plasma was also elevated following TNBS treatment. Also, NMDA inhibited VIP release in vitro
from colon segments. While NMDA receptor antagonist, MK-801, promoted VIP release.
The effects of NMDA receptor agonists and antagonists in rat colon motility after colitis
were also studied. Using colo-rectal manometry on restrained, non-anesthetized rats it was found
that animals treated with TNBS had significantly increased contractility when NMDA was
administered locally. Moreover, this effect was reversed MK-801. These effects were not seen
when isolated colon segments were used.
The results taken together suggest that NMDA receptor mediated changes in colonic
motility after colitis requires modulation of VIP release. Thus, the study of NMDA receptors
could provide useful information for the development of therapies that selectively modulate
bowel function.
13
CHAPTER 1 INTRODUCTION
N-Methyl-D-Aspartate (NMDA) Receptors
Overview
N-Methyl-D-aspartate (NMDA) receptor s are the most clearly defined glutamate receptor
channel subtype. These receptors have two subunit families designated NR1 and NR2 [1]. In
mammals, the functional NMDA receptor is a heteromeric complex containing NR1 and NR2
subunits [2] (Fig 1-1A). However, the exact number of subunits in each heteromeric glutamate
receptor is still unknown.
The NR1 subunit gene has a total of 22 exons, three of which (exons 5, 21 and 22) undergo
alternative splicing to generate eight NR1 splice variants. The alternatively spliced cassettes of
the NR1 protein are named N1, C1 and C2 (Fig. 1-1B). The resultant eight splice variants of the
NR1 protein in the presence (+) or absence (-) of the spliceable exons have several
nomenclatures [3]. The nomenclature used here; NR1xyz, was proposed by Durand and
colleagues [4], where x, y and z, represent the cassettes N1, C1 and C2, respectively. The values
of x, y and z are either 0 or 1 indicating the absence or presence of the respective cassette (Fig. 1-
1C).
The N1 and C1 cassettes may be either present or absent without affecting the remaining
NR1 structure. When the C2 cassette (exon 22) is spliced out the first stop codon is removed,
resulting in the expression of the C2’ cassette. Therefore, either the C2 or C2’ cassette is present
in all NR1 protein, but the two cassettes are not co-expressed within the same NR1 protein [5].
The N1 cassette is located extracellularly and interacts with various pharmacological modulators
of the channel, including zinc, protons and polyamines [6]. The C-terminal cassettes of the
protein control cell-surface expression of NR1, whereas proteins with the shortest C-terminal
14
region (lacking the C1 cassette and containing C2’; NR1x00) show the highest cell surface
expression [7].
The NR2 subunit family includes four members NR2A, 2B, 2C and 2D. Expression of
different NR2 subunits determines the deactivation kinetics, antagonist sensitivity and ligand
affinity of recombinant NR1/NR2 receptors [2]. While the NR1 is widely expressed throughout
the whole brain, the expression of the NR2 subunits is greatly regulated. The distributions of
NR2A and NR2C have temporal and spatial similarities to that of NR1, while the expression of
NR2B shows differences in the density and distribution. NR2D is very faint compared to other
NR2s, and mutant mice defective in NR2D expression appear to develop normally [8]. But in
general, the expression of the NR2A- and NR2B-containing receptors is more predominant
relative to the NR2C- and NR2D-receptor subtypes.
Activation of NMDA receptor channels requires binding of both L-glutamate and the co-
agonist glycine. Site-directed mutagenesis has identified determinants of glycine binding in
distinct regions of the NR1 subunit. While the glutamate binding site was shown to reside in the
homologous regions of the NR2 subunits (Fig 1-1A).
These distinctive properties of the NMDA receptors have implicated them in important
physiological functions such as synaptic plasticity, synapse formation, memory, learning and
formation of neural networks during development [3;9].
Pathology
NMDA receptors may have roles in several pathological states including ischemia,
epilepsy, Huntington's disease, AIDS dementia complex, amyotrophic lateral sclerosis and
Alzheimer's disease. Additionally, these receptors are suspected to be involved in psychiatric
disorders and neuropathic pain syndromes [3;9].
15
Also, activation of the NMDA receptors in the dorsal horn neurons of the spinal cord that
receive primary afferent input is a key step in the development of central sensitization
Stimulation of nociceptive afferents following injury/inflammation causes an increased release of
glutamate from the central terminals of nociceptive afferents in the dorsal horn. This results in
activation of AMPA receptors, which then depolarize the membrane relieving NMDA receptors
from their Mg2+ block. NMDA receptor activation ends up in the consequent amplification of
pain (Fig. 1-2). This NMDA-mediated central sensitization mechanism has been studied in both
human and animal models of hypersensitivity and is attenuated by NMDA receptor antagonists
[10;11]
The pivotal role of NMDA receptor channels in physiological and pathological functions
implies that specific and selective drugs may be developed for therapeutic intervention.
Enteric Nervous System
Overview
The enteric nervous system (ENS) is formed of interconnected plexuses of neurons, their
axons and glial cells within the walls of the gastrointestinal tract. The ENS is of particular
interest because it is the only extensive group of neurons outside the central nervous system that
can assemble circuits capable of autonomous reflex activity. Humans have 200 – 500 million
enteric neurons with up to 20 different functional classes. The enteric nervous system has been
called the second brain due to its complexity and size. The digestive tract has several layers (Fig.
1-3); the first layer (starting from the lumen) is the mucosa (MC) which is arranged into tightly
packed straight tubular glands of cells specialized for water absorption and mucus-secreting cells
to aid the passage of feces. The next layer is the submucosal plexus (SP); one of two
ganglionated neural networks in the enteric nervous system. The submucosal (Meissner's)
plexus’ neurons (#9) innervate the epithelium, blood vessels, endocrine cells and other
16
submucosal ganglia and play an important role in regulating ion and water transport. The other
ganglionated plexus is the myenteric (Auerbach's) plexus (MP). This is located between the
longitudinal (LM) and circular muscle (CM) layers of the gut. Its neurons project to both muscle
layers, to other myenteric ganglia, to submucosal ganglia, or directly to the epithelium, and play
an important role in regulating and patterning gut contraction. The enteric neurons found in these
two ganglionated plexuses can be classified in various categories. Sensory neurons (#2,#6)
monitor tension and chemical content, associative interneurons (#1,#11) serve as a linkage
between the sensory neurons and the motor neurons. The motor neurons can synapse either at the
circular muscle layer (#7,#8) or the longitudinal muscle layer (#4,#5). They can be separated
depending on their chemical coding, as excitatory or inhibitory motor neurons. Excitatory motor
neurons (#4,#8) are mostly cholinergic and control contraction. Inhibitory motor neurons (#5,#7)
control relaxation and have multiple transmitters like vasoactive intestinal peptide (VIP) and
nitric oxide (NO)[12]. There are two other subsets of intrinsic neurons that innervates outside the
ENS. The intestinofugal neurons (#3) have cell bodies in the myenteric plexus and processes that
innervate the prevertebral ganglia (PVG) [12]. The other group, a unique population of neurons,
colospinal afferent neurons (CANs, #10), provides direct projection from both the myenteric and
submucosal plexuses to the spinal cord[13].
Peristalsis
“The law of the intestine” states that; a stimulus within the intestine (e.g. the presence of
food) initiates a band of constriction on the proximal side and relaxation on the distal side.
Currently we know that peristalsis is the product of the co-activation of excitatory and inhibitory
reflexes in a distended segment of intestine [14]. There are two phases of peristalsis: the
preparatory and emptying phases. During the preparatory phase, enteric inhibitory motor neurons
maintain the circular muscle in a relaxed state. When the intestine is distended, there is a
17
simultaneous activation of ascending excitatory and descending inhibitory pathways along the
length of the intestine, with the inhibitory reflex prevailing [15]. The emptying phase occurs
when a particular intraluminal volume (the threshold volume) is reached and triggers a
contraction at the oral end. Contractions can be accomplished by local stimulation (e.g. due to a
bolus) or generalized distension (e.g. due to fluid distension). A contraction then indicates a shift
from net inhibition to net excitation. Contraction of the oral end, deactivates enteric neurons
sensitive to distension, consequently the descending inhibitory reflex is no longer activated from
the contracted region. In this way the inhibition immediately anal to the contraction is reduced
and the ascending excitatory reflex dominates, leading to the anal propagation of the contraction
[16].
Neural influence is superimposed on the rhythmic activity of the muscle, generated by
interstitial cells of Cajal (ICC) (Fig. 1-4). These pacemaker cells are non-neural cells of similar
mesenchymal origin to the muscle. Motor neurons, both excitatory and inhibitory, release
transmitter that acts on ICC. The ICC cells are then electrically coupled to muscle cells through
gap junctions [17].
Pathology: Bowel Disorders
Inflammatory Bowel Disease (IBD)
Inflammatory bowel disease (IBD) refers to two chronic diseases that cause inflammation
of the intestines: ulcerative colitis and Crohn's disease. Research has not determined yet what
causes inflammatory bowel disease but researchers believe that a number of factors may be
involved, such as the environment, diet, and possibly genetics. Development of either disease
can be the result of an exaggerated or insufficiently suppressed immune response to a previously
undefined antigen, probably derived from the microbial flora. This inflammatory process leads to
mucosal damage and a further disturbance of the epithelial barrier function. This results in an
18
increased influx of bacteria into the intestinal wall [18]. The most common symptoms of IBD are
diarrhea and abdominal pain but some may also experience constipation. Colazal and Entocort
are two drugs developed recently for use in treating IBD. Colazal (Balsalazide) is an anti-
inflammatory drug which acts on the lining of the colon to reduce inflammation. Entocort EC is
a nonsystemic corticosteroid that is released into the intestine and works to reduce inflammation.
Irritable Bowel Syndrome (IBS)
Irritable bowel syndrome (IBS) is a gastrointestinal (GI) disorder of unknown etiology
often described as a functional disorder. Literature suggests that bacterial infection and
inflammation may play a role in the etiology of this “functional” disorder [19]. The presence of
mast cells in mucosal biopsies of IBS patients supports an inflammatory component in this
pathology. There is also a strong correlation between acute episodes of Salmonella and other
bacterial infections and the development of post-infectious IBS (PI-IBS). About 29-31% of
patients with acute bacterial gastroenteritis develop PI-IBS, 3 to 12 months after the
inflammatory/infectious process [20-22]. IBS is characterized by abdominal pain and cramps;
changes in bowel movements (diarrhea, constipation, or alternation between diarrhea and
constipation), gassiness, bloating, nausea and other symptoms. The diagnosis of IBS rests
basically on the occurrence of a set of symptoms and the exclusion of other GI pathology, called
the Rome criteria [23]. Patients with IBS also present extraintestinal symptoms such as migraine,
backaches and muscle pain. Moreover, IBS patients showed not only visceral hypersensitivity to
rectal distension but also cutaneous hypersensitivity to heat stimuli applied to the hand and foot.
The cutaneous hyperalgesia was more prominent in the foot but was also present in hand to a
lesser extent. These results are likely related to the fact that nociceptive afferents from both the
rectum and foot converge on common lumbosacral spinal segments. Consequently, it is likely
that central sensitization is expressed to a greater degree at lumbosacral levels as compared to
19
cervical spinal levels. Even though, the presence of mild hyperalgesia at cervical spinal levels
suggests a widely distributed, yet topographically organized, central hyperexcitability [24-28]. It
is evident that IBS comprises a complex collection of symptoms, but the major complaints in
these patients are the changes in bowel movements and the associated pain. Frequently
prescribed drugs target intestinal motility. Zelnorm (tegaserod), a 5-HT4 receptor agonist, is used
to treat constipation and Lotronex (alosetron hydrochloride), 5-HT3 receptor antagonist, is used
for diarrhea. Clinical trials with both drugs showed that reinstating normal bowel motility
alleviates the pain [29]. Unfortunately, both of these drugs are no longer available, leaving
patients with no suitable alternatives.
NMDA Receptors in the Enteric Nervous System
The NMDA receptor NR1 subunit has been characterized by in situ hybridization and
PCR techniques in the rat [30], guinea pig [31] and human [32] enteric plexuses. NR1 was also
co-labeled with vasoactive intestinal peptide (VIP) in enteric neurons of the rat using double in
situ hybridization [33]. NMDA receptors are also expressed in postganglionic parasympathetic
neurons of the rat larynx and esophagus and their activation may be associated with VIP or NO
release [34].
Moreover, NMDA altered the colonic peristaltic reflex in an in vitro model that retained
sympathetic and parasympathetic innervation [35]. NMDA produced concentration-dependent
tonic contractions of the rat rectum [36]. Shafton et al. found that peripherally administered
NMDA receptor antagonist ketamine reduces visceromotor responses and motility reflexes in
vivo [37]. These findings suggest that NMDA receptors are likely to be involved in peristalsis.
Significance
The objective of this investigation was to identify the changes in NMDA receptor
expression that occur during inflammation using the TNBS-induced colitis rat model. The
20
functional response of these receptors present after inflammation and the effect of NMDA
ligands in colonic contractility were studied. The hypothesis was that alterations in expression
and function of NMDA receptors following TNBS-induced colitis results in an enhanced activity
of these receptors. The enhanced NMDA receptor activity could account for the changes in
contractility reported. Since disturbances in peristalsis are major factors influencing the quality
of life of patients with bowel disorders, it is critical that we increase our knowledge of NMDA
receptor structural/functional changes following inflammation. Subunit-specific NMDA receptor
drugs could be used to selectively modulate bowel function.
21
Figure 1-1. Schematic representations of the proposed structure of the NMDA receptor channel subunits and the NR1 subunit splice variant composition. (A) Schematic representation of the proposed structure of the NMDA receptor channel subunits NR1 and NR2. The NR1 three transmembrane segment topology model shows the transmembrane domains in red and the alternatively spliced cassettes; N1 (yellow triangle), C1 (dark blue cylinder) and C2 (orange cylinder). Adapted from Yamakura and Shimoji 1999 [3]. (B) Detailed scheme of splice variant composition of NR1 protein. Colored boxes indicate the four alternatively spliced cassettes of NR1 protein, along with their name and exon number. The N1 cassette (exon 5) is extracellular at the N-terminal (solid yellow box). The red bars indicate the four transmembrane (M1, 3 and 4) or intramembrane (M2) domains of the NR1 protein. The three C-terminal cassettes; C1 (blue diamonds filled box), C2 (orange grid filled box) and C2’ (vertical green lines filled box) are located intracellularly [38]. (C) Splice variants of the NR1 subunit. The eight splice variants of the NR1 protein in the presence (+) or absence (-) of three alternatively spliced exons (N1, C1 and C2);NR1xyz, where x, y and z represent the cassettes N1, C1 and C2, respectively. The values of x, y and z are either 0 or 1 indicating the absence or presence of the respective cassette. Adapted from [4].
22
Figure 1-2. Central Sensitization. Stimulation of nociceptive afferents following injury/inflammation causes an increased release of glutamate from the central terminals of nociceptive afferents in the dorsal horn. This results in activation of AMPA receptors, which then depolarize the membrane relieving NMDA receptors from their Mg2+ block. NMDA receptor activation ends up in the consequent amplification of pain.
Nociceptive
Afferent
Inflammation/Injury
GLU
Mg2+
NMDA
AMPA
Pain Amplification
Dorsal Horn Neuron
23
Figure 1-3. The Enteric Nervous System (ENS). View of the layers of the ENS in the colon; Longitudinal muscle (LM), Myenteric plexus (MP), Circular muscle (CM), Submucosal plexus (SP), Mucosa (MC). Neurons are numbered as follows; (1) Ascending interneurons, (2) Intrinsic Primary Afferents Neurons (IPANs) of the MP, (3) Intestinofugal neurons that innervates the prevertebral ganglia (PVG), (4) Excitatory motor neurons to the LM, (5) Inhibitory motor neurons to the LM, (6) IPANs of the submucosal plexus, (7) Inhibitory motor neurons to the CM, (8) Excitatory motor neurons to the CM, (9) Submucosal secretory and/or circulatory neurons, (10) Colo-spinal Afferent Neurons (CANs) that innervates the spinal cord (SC), (11) Descending interneurons. Adapted from [12].
Adapted from Furness 2006
9
24
Figure 1-4. Transmission from motor neurons to gastrointestinal muscle. Motor neurons, both excitatory and inhibitory, release transmitter that acts on interstitial cells of Cajal (ICC). The ICC cells are then electrically coupled to muscle cells through gap junctions. Adapted from [12].
25
CHAPTER 2 GENERAL METHODS
Animals
All methods were approved by the University of Florida Institutional Animal Care
and Use Committee. Male Sprague Dawley rats (300 – 350 g, N= 154) were maintained
on a 12 hour light/dark cycle and fed standard rodent chow and water ad libitum. Animals
were weighted before and every day after all treatments.
Tissue Collection
Animals were euthanized with CO2/decapitation method. The skull was exposed
using a surgical blade. The brain was then exposed by breaking into the skull using bone
shears and scooped out using a small spatula. Approximately 300 µg of Forebrain was
collected. Brain tissue was deep frozen in liquid nitrogen and used for RNA and protein
extractions. Intestinal tissues were collected from the descending colon and prepared
according to the different protocols.
Reverse Transcription-PCR (RT-PCR)
Total RNA was isolated from rat brain and colon tissues using RNeasy Mini Kit
from Qiagen (Valencia, CA.). Target transcripts were amplified with PCR primers from
GenoMechanix (Gainesville, Fl) listed on Table 2-1. RT-PCR reactions were carried out
using Access RT-PCR System from Promega (Madison, WI) and the following cycle
conditions: 1 cycle at 48°C for 45 minutes, 94°C for 2 minutes and 72°C for 1 minutes,
35 cycles of PCR (94°C for 30 sec, 60°C for 1 minutes, 72°C for 2 minutes) and a final
elongation period of 7 minutes at 72°C. PCR products were separated on 1.2% agarose
gel with 1X TBE buffer, viewed with ethidium bromide and analyzed with Bio-Rad Gel
Doc EQ Gel Documentation System, Bio-Rad Laboratories (Hercules, CA). All the RT-
26
PCR products were sequenced at the Genome Sequencing Services Laboratory (GSSL),
part of the Interdisciplinary Center for Biotechnology Research (ICBR) at the University
of Florida, Gainesville, FL.
Western Blots
Samples of tissue were taken from rat brain and descending colon. Tissue was
homogenized in cold Cell Lysate Buffer (1mM Sodium Ortho-Vanadate, 10 mM Tris and
1% SDS) using a Sonics Vibra-Cell Sonicator. Lysates were boiled for 5 minutes and
then centrifuged at 16,000 g for 5 minutes and the supernatant was collected. Protein
concentration was determined by standard spectrophotometer method. Proteins were
separated using 4-20% Tris-Glycine Gel from Invitrogen (Carlsbad, CA), each lane was
loaded with 15 µg of protein extract. Proteins in the gel were then transferred to a
Millipore (Bedford, MA) Immobilon-P polyvinylidene fluoride membrane using a semi-
dry transfer device (Bio-Rad Laboratories, Hercules, CA). The transfer buffer used
contains 20% methanol, 48 mM Tris pH 9.2, and 39 mM glycine. The membrane was
then placed in TTBS buffer (20 mM Tris pH 7.6, 0.9% NaCl, and 0.05% Tween-20, pH
7.4) containing 5% non-fat dry milk for 1 hour to block non-specific binding of
antibodies. NR1 splice variant specific primary antibodies were provided by Dr. Michael
Iadarola from The National Institute of Dental and Craniofacial Research (NIDCR),
Bethesda, MD (Antibodies’ selectivity was assessed in Caudle et al. 2005). Antibodies
against Actin, NR1, NR2B and NR2D were purchased from different vendors (Table 2-
2). After overnight incubation with primary antibody at 4°C, the membrane was washed
three times in TTBS (5 minutes each) and then placed in fresh TTBS containing 5% non-
fat dry milk and secondary antibody [dilution 1:4000] for rabbit or mouse IgG coupled to
27
horse radish peroxidase (HRP) for 1 hour. The membrane is then washed three times with
TTBS (5 minutes each) and placed in chemiluminescence substrate (LumiGLO®, Cell
Signaling Technology, Beverly, MA) and exposed to film at variable times points (15
seconds to 10 minutes) to ensure best resolution.
TNBS-Induced Colitis
Colitis was induced in rats anesthetized with 3% isoflurane in oxygen. Rats
received an enema of 1 mL of TNBS (15 mg/mL) in 50% ethanol using a polyethylene
catheter (18 gauge; Fisher Scientific, Pittsburgh, PA) that was inserted rectally 7 cm
proximal to the anus. Animals were sacrificed at 7, 14, 21 and 28 days after TNBS-
treatment.
Colo-Rectal Distension
Naïve and TNBS-treated rats underwent colo-rectal distension at 7, 14, 21 and 28
days. While anesthetized with 3% isoflurane in oxygen, a 4 cm balloon attached to a
plastic tube (14 gauge; Fisher Scientific, Pittsburgh, PA) was inserted rectally 2-3 cm
proximal to the anus. The balloon was secured in place by taping the tube to the base of
the tail and rats were contained in a plastic restraining device. The tube was then attached
to a pressure transducer (Harvard Apparatus, Holliston, MA) connected to a LAB-TRAX
Data Acquisition System with Transducer Amplifier (World Precision Instruments,
Sarasota, FL). Following recovery from anesthesia, the animals were allowed 10 minutes
to acclimatize before behavioral testing began. Rats received phasic colon distension (0–
80 mmHg) until the first contraction of the testicles, tail, or abdominal musculature
occurred. These responses are considered indicative of the first nociceptive response as
previously described [39;40]. The colonic distensions were repeated 3 times and the
28
mean pressures at the nociceptive threshold were recorded for each rat. Data was then
analyzed using the Data-Trax 2 software (World Precision Instruments, Sarasota, FL).
Mechanical Threshold Testing on Hind Paws: von Frey
Mechanical hypersensitivity was measured using an electronic von Frey device
(Dynamic Plantar Aesthesiometer, Ugo Basile, Italy). Rats were placed on a wire mesh
floor in a plastic enclosure. Rats were left to acclimate for 20 minutes. Then, a fine
filament was extended up through the mesh floor and exerted an increasing amount of
pressure (max. 50 g) onto the rat’s hind paw. The mechanical threshold was defined as
the force in grams required until the rat withdrew its hind-paw. The stimulus was
repeated three times following a 5-min rest interval and the mean was calculated for each
hind-paw.
Myeloperoxidase Activity Assay
Myeloperoxidase activity was assessed as described by Krauter et al [41]. The
descending colon was removed from naïve rats, vehicle (ethanol) treated at 2 days and
TNBS treated at 2, 7, 14 and 28 days. Colons were cut open along the mesenteric border
and frozen in liquid nitrogen. Tissue segments weighing 100–200 mg were homogenized
in potassium phosphate buffer (50 mg/mL, 50 mM potassium phosphate, pH 6.0) and
spun at 20,000 g for 20 minutes. The supernatant was removed and HTAB buffer
(Hexadecyltrimethylammonium Bromide: 5 g/L in 50 mM potassium phosphate buffer)
was added. The pellet was homogenized and spun at 10,000 g. The samples were
sonicated, frozen in liquid nitrogen, thawed and spun at 10,000 g for 10 minutes. This
step was repeated twice. The level of myeloperoxidase (MPO) activity was determined
from the total supernatant by adding 200 µL of O-dianisidine buffer (16.7 mg O-
dianisidine dihydrochloride in 5 mM phosphate buffer containing 0.005% H2O2). The
29
change in absorbance at 450 nm was determined every 30 seconds over a 3-minute period
right after adding the O-dianisidine buffer by a Synergy HT microplate reader (BioTek
Instruments, Winooski, VT). Values are expressed as units of MPO activity per gram of
tissue sample where one unit of MPO is defined as that which degrades 1 µmol of
hydrogen peroxide per minute.
Immunohistochemistry
Whole Mount
Adapted from Rosa-Molinar et al. 1999 [42]. Segments of tissue from the
descending colon (2-3cm) were removed and cut longitudinally. The segments were
spread and mounted onto slides containing a silicone base to enable pinning of the tissue
to the slides. To defat the tissue, the segments were washed through a series of ethanol
dilutions starting with 2 washes in 100% ethanol followed by single washes in 95%, 70%,
and 50% ethanol for 20 minutes each. Sections were incubated in distilled water
overnight at 4ºC. The mucosa, submucosal plexus and circular muscle layers were then
pealed from each tissue section and the remaining myenteric plexus layer placed in 4%
paraformaldehyde overnight followed by 3-5 washes (5 minutes each) in PBS. Tissue
sections were cleared (Fig. 2-1) by placing them in KOH (in PBS) and glycerin serial
incubations: 3:1 0.5% KOH: glycerin for 1 hour, 1:1 0.5% KOH: glycerin for 1 hour, 1:3
0.5% KOH: glycerin for 1 hour, and 100% glycerin overnight. A few drops of 30% H2O2
were added to both 1:1 and 1:3 KOH: glycerin incubations. After 3-5 washes (5 minutes
each) in PBS, the tissue was placed in blocking buffer containing 3% Normal Goat
Serum (NGS) with PBS for 30 minutes, then incubated in the primary antibody (1:500 –
1:100) in 3% NGS/PBS, 1% Triton X-100 overnight at 4ºC. After 5 washes (10 minutes
each) in PBS, the tissue was incubated for 60 minutes in secondary antibodies, either
30
Alexa Fluor 594 or Alexa Fluor 488 (1:2000, Molecular Probes, Boston, MA) with 1%
NGS/PBS, 0.3% Triton X-100. The tissue was then washed 6 times (5 minutes each) in
PBS and placed in distilled water. Tissues were then mounted into clean slides and
coversliped with ProLong Antifade Kit mounting media (Molecular Probes, Boston,
MA). Slides were visualized with filters for red and green excitation. Images were
photographed on an Olympus BX51 Fluorescence microscope (Olympus, Center Valley,
PA).
Cryostat Sections
Descending colons were removed from naïve and TNBS-treated rats at 14 days.
This time point was chosen since we previously found it to be the time at which NMDA
receptor expression changes were most prominent [43]. Tissues were then fixed in 4%
Formalin for 24 hours and then preserved in 30% sucrose at 4°C. Tissues were sectioned
at 10-20 µm on a cryostat, serially mounted on a glass slide and air-dried for 1 hour.
Slides were treated with Target Retrieval Solution, pH 6 (Dako, Carpinteria, CA) for 24
hours at 60°C. All preparations were washed 3 times (10 minutes each) in Phosphate
Buffered Saline (PBS, 10 mM sodium phosphate, pH 7.4, 0.9% NaCl). Slides were then
incubated with goat anti-VIP (Santa Cruz Biotechnology, Santa Cruz, CA) with either
rabbit anti-NOS (Chemicon, Temecula, CA), rabbit anti-NR1-N1 or anti-NR1-C1
(Provided by Dr. Iadarola, NIDCR, Bethesda, MD) in 0.3% tween-20 in PBS for 24
hours at 4°C. The sections were washed 3 times in PBS (10 minutes each) followed by 1
hour incubation in secondary antibodies. The secondary antibodies were anti-goat Alexa
Fluor 488 and anti-rabbit Alexa Fluor 594 (Molecular Probes, Boston, MA) in 0.3%
tween-20 in PBS. Negative controls were performed by incubating samples with only
31
secondary antibodies and omitting primary antibodies (Fig. 2-2). After incubation with
secondary antibodies tissue was washed 3 times (10 minutes each) and coversliped with
VECTASHIELD Mounting Medium with DAPI (Vector Laboratories, Burlingame,
CA). The sections were visualized with filters for red, green and blue excitation. Images
were photographed on a Leica DM LB2 Fluorescence microscope (Leica, Wetzlar,
Germany).
VIP Peptide Enzyme Immunoassay (EIA) Protocol
Blood and colon tissues were collected from naïve rats and TNBS treated rats, 2
hours and 14 days after enema. Blood was mixed with 6% EDTA to prevent coagulation.
Samples were centrifuged at 2,000 g for 10 minutes at 4ºC. Plasma was removed and
immediately placed on dry ice. Colon segments (2 cm) were incubated for 30 minutes
with either saline, NMDA 1X (200 µM), NMDA 10X (2 mM), MK-801 (10 µM),
NMDA 1X + MK-801 and NMDA 10X + MK-801. VIP levels were assessed by
following a Peptide Enzyme Immunoassay (EIA) Protocol (Bachem Group, San Carlos,
CA). Briefly, 50 µL of samples, 25 µL of VIP antiserum, and 25µL of biotinylated-tracer
were mix into each well of a 96 well plate pre-coated with anti-rabbit secondary antibody
and incubated at room temperature for two hours. The plate was then washed 5 times
with buffer, and 100 µL/well of streptavidin-conjugated horseradish peroxidase were
added, and the plate was incubated for one hour. The plate was then washed 5 times with
buffer, and 100 µL/well of TMB solution were added. The change in absorbance at 650
nm was determined every minute over 30 minutes using a Bio-Tek® Synergy HT
Microplate reader. The reaction was terminated by adding 100uL 2 N HCL per well, and
readings were taken again at 450nm. VIP concentration was calculated by comparing
32
samples’ absorbance to a standard curve generated using the standard peptide provided
with the kit.
Ex Vivo Circular Muscle Colonic Contractility Assay
Descending colon segments (1.5 – 2 cm) were removed from naïve and TNBS-
treated rats at 14 days and mounted in individual tissue chambers. Circular muscle
contractions were recorded for 10 minutes while applying acetylcholine (200 µM) diluted
in Mg2+-free Tyrode solution (mM: NaCl, 140; KCl, 4; CaCl2, 4; Glucose, 10; HEPES,
10; pH 7.4) and acetylcholine combined with NMDA (200 µM) and MK-801 (10 µM).
Tissue was washed for 5 minutes with Mg2+-free Tyrode solution before and after each
trial and temperature was maintained at 35o for the duration of the experiments. Circular
muscle contractility was recorded using a MYOBATH-II multi-channel isolated tissue
bath system combined with the LAB-TRAX Data Acquisition System with a 4-channel
Transbridge™ amplifier and analyzed using the Data-Trax 2 software (World Precision
Instruments, Sarasota, FL). Data was then transferred to an Excel spreadsheet and the
area under the contraction peaks was integrated.
Colo-Rectal Manometry: In Vivo Motility
Naïve and TNBS-treated rats at 14 days were anesthetized with 3% isoflurane in
oxygen and a 4 cm balloon attached to a plastic tube (14 gauge; Fisher Scientific,
Pittsburgh, PA) was inserted rectally 2 – 3 cm proximal to the anus. This tube was then
attached to a pressure transducer (Harvard Apparatus, Holliston, MA) connected to a
LAB-TRAX Data Acquisition System with Transducer Amplifier (World Precision
Instruments, Sarasota, FL). Attached to the balloon was a small polyethylene tube (30
gauge; Fisher Scientific, Pittsburgh, PA) connected to a 1 mL syringe for drug delivery.
Both tubes were secured with tape to the base of the tail and rats were contained in a
33
plastic restraining device. The balloon was then maintained at a basal pressure of 10
mmHg. Contractions were recorded for 5 minutes before and after applying 0.2 mL of
NMDA (14.3 mg/mL) or MK-801 (1.7 mg/mL) diluted in sterile saline (0.9% NaCl).
Each trial was followed by a 3 minute 0.5 mL wash with saline. Data was analyzed using
the Data-Trax 2 software (World Precision Instruments, Sarasota, FL) and then
transferred to an Excel spreadsheet and the area under the contraction peaks was
integrated.
Statistical Analyses
Data was analyzed using ANOVAs. Post-hoc tests were either Dunnett’s or
Bonferroni’s tests. P-values < 0.05 were considered to be significant and n values
represent individual animals. GraphPad Prism software (version 4.0 for Windows,
GraphPad Software, San Diego, CA) was used for all analyses.
34
Table 2-1 RT-PCR Primers Sequences. All primers were purchased from GenoMechanix (Gainesville, Fl). RT-PCR reactions were carried out using Access RT-PCR System from Promega (Madison, WI) with the following cycle conditions: 1 cycle at 48°C for 45 min, 94°C for 2 min and 72°C for 1 min, 35 cycles of PCR (94°C for 30 sec, 60°C for 1 min, 72°C for 2 min) and a final elongation period of 7 min at 72°C.
Primer name Forward sequence Fwd Tm Reverse sequence Rev
Tm Product length
General NR1 general cagaaacccctcagacaagttc 59oC cttctgtgaagcctcaaactcc 59oC 213bp NR1 generic ccctcagacaagttcatctacgc 61oC aggttcttcctccacacgttcac 61oC 563bp GAPDH ccttcattgacctcaactacatggtcta 63oC tagcccaggatgcccttt 55oC 720bp Exon 5 or N1 NR1a Exon 5 (-) NR1b Exon 5 (+)
gcgagtctacaactggaaccac 61oC ctcgcttgcagaaaggatgatg 59oC 170bp 235bp
Exon 5+ inside ggaactatgaaaacctcgacc 58oC NR1b Exon 5 Reverse 59oC 158bp N1+ (ζ1 N1+) accacttcactcccacccctgtctcctac 72oC gtccgcgcttgttgtcata 61oC 330bp N1- (ζ1 N1-) agctcaacgccacttctgtc 61oC caccttctctgccttggactcac 65oC 407bp Exon 21 or C1 C1 Use NR1 general Fwd or
NR1 generic Fwd 59oC 61oC
gttttgcaaagcgccgcgtcca 63oC 717bp 710bp
C1+ (ζ1 C1+) tgtgtccctgtccatactcaag 60oC gtcgggctctgctctaccac 62oC 307bp Exon 22 or C2 NR1 Exon-22 catggcaggggtcttcatgctg 63oC gaacacagctgcagctggccct 65oC 318bp NR2 NR2A tatagagggtaaatgttgga 50oC agaaactgtgaggcatttct 52oC 322bp NR2B actgtgacaacccacccttc 58oC cggaactggtccaggtagaa 58oC 400bp NR2C tgtgtcaggccttagtgaca 56oC ccacactgtctccagcttct 58oC 402bp NR2D aagaagatcgatggcgtctg 56oC ggatttcccaatggtgaagg 56oC 353bp All primers from GenoMechanix, Gainesville, Fl.
35
Table 2-2 Antibodies used for Western Blots and Immunohistochemical Assays. Antibodies were purchased from different vendors and dilutions were prepared according to vendors’ specifications. Incubation time for primary antibodies was 24 hours and 1 hour for secondary antibodies.
Antibody Company Cat. No. Primary Antibodies Actin Mouse Chemicon, Temecula, CA. MAB1501 Neurofilament Mouse Sigma, Saint Louis, Missouri. N-5389 NR1 Mouse BD Biosciences Pharmigen, San Diego, CA. 556308 NR1 Rabbit Santa Cruz Biotechnology, Santa Cruz, CA. SC-9058 NR1 splice variants Rabbit Provided by Dr. Iadarola, NIDCR, Bethesda, MD. N/A NR2B Rabbit Santa Cruz Biotechnology, Santa Cruz, CA. SC-9057 NR2B Mouse BD Biosciences Pharmigen, San Diego, CA. 610417 NR2D Rabbit Santa Cruz Biotechnology, Santa Cruz, CA. SC-10727 Protein Gene Product 9.5 Rabbit Chemicon, Temecula, CA. AB1761 Fluorescent Secondary Antibodies Alexa Fluor 488 Mouse Molecular Probes, Eugene, OR. A21202 Alexa Flour 488 Rabbit Molecular Probes, Eugene, OR. A21206 Alexa Fluor 594 Mouse Molecular Probes, Eugene, OR. A21201 Alexa Flour 594 Rabbit Molecular Probes, Eugene, OR. A21442
36
Figure 2-1. Clear colon tissue for whole mount preparations. (A) Colon tissue was pinned
to silicon. (B) Using serial dilutions of potassium hydroxide (KOH) and glycerin, tissues were made almost completely transparent for whole mount immunohistochemistry.
37
Figure 2-2. Immunohistochemistry negative controls. Colon tissue sections (20 µm) were incubated with only secondary antibodies, either Alexa fluor 488 or Alexa fluor 594, and omitting primary antibodies. L= lumen, M = mucosa, SP = submucosal plexus, CM = circular muscle, MP = myenteric plexus, LM = longitudinal muscle.
38
CHAPTER 3 EXPRESSION OF THE N-METHYL-D-ASPARTATE RECEPTOR NR1 SPLICE
VARIANTS AND NR2 SUBUNIT SUBTYPES IN THE RAT COLON
Introduction
The most clearly described ionotropic glutamate receptor subtype is the N-methyl-
D-aspartate (NMDA) receptors. NMDA receptors have two subunit families designated
NR1 and NR2 [1]. Functional NMDA receptors in mammals are heteromeric complexes
containing NR1 and NR2 subunits [2].
The NR1 subunit (Fig. 1-1) has only one gene which has three regions of
alternative splicing, named the N1, C1 and C2 cassettes and results in eight possible
splice variants. The N1 (exon 5) and C1 (exon 21) cassettes may be either present or
absent without having an effect on the remaining NR1 structure. Once the C2 cassette
(exon 22) is spliced out the first stop codon is lost, resulting in the expression of the C2’
cassette.
The N1 cassette is located extracellularly and interacts with various
pharmacological modulators of the channel, including zinc, protons and polyamines [6].
The C-terminal cassettes of the protein are localized intracellularly and control cell-
surface expression of NR1. Proteins with the shortest C-terminal region (lacking the C1
cassette and containing C2’; NR1x00) show the highest cell surface expression [7].
There are four members in the NR2 subunit family; NR2A, 2B, 2C and 2D.
Expression of different NR2 subunits determines the ligand affinity, antagonist sensitivity
and deactivation kinetics of the NMDA receptors [2;9].
The presence of L-glutamate receptors, presumably of the NMDA type, was
documented in the myenteric plexus of the guinea pig [44-48]. Furthermore, the
expression of the NMDA receptor NR1 subunit was characterized by in situ hybridization
39
and PCR techniques in both the rat and guinea-pig enteric plexuses [30;31]. Also
glutamatergic receptors, including the NMDA type, were found in the enteric plexuses of
the human colon [32]. These findings together established the presence of NMDA
receptors in the enteric nervous system (ENS). However, the roles of these enteric
NMDA receptors are still not fully understood.
Here we studied the expression of the NMDA receptor NR1 protein splice variants
and the NR2 subunit subtypes in the rat colon by using reverse transcription-polymerase
chain reaction (RT-PCR), Western blot and immunohistochemistry.
Results
Expression of NR1 Protein in the Rat Colon.
The expression of NR1 was examined in the rat colon (Fig. 3-1). We used two
different sets of primers to amplify by RT-PCR (Fig. 3-1A) the RNA extracted from
intestine and brain tissues. These primers (arbitrarily named NR1 general and generic)
recognized areas in the NR1 outside the spliced exons. The expression of NR1 was
evident in the colon tissue (gastrointestinal, GI) and the rat brain. Rat brain was used as a
positive control. Sample integrity and reaction reliability were validated with the
expression of the housekeeping gene, Glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) in both the GI and the brain tissues. A negative control (-RT) that lacked
reverse transcriptase using GAPDH primers was included to control for genomic DNA
contamination.
Protein expression was confirmed by western blot analyses that showed the NR1
protein in GI and brain tissues using general mouse-NR1 antibody, which recognized a
site outside of the alternatively spliced cassettes (Fig. 3-1B, Top panel). To control for
sample loading purposes, an antibody against Actin was used.
40
Furthermore, we visualized the double label of the NR1 protein with the neuronal
markers; Protein Gene Product 9.5 (PGP 9.5) (Fig. 3-2A) and neurofilament (NF) (Fig. 3-
2B) in the rat myenteric and submucosal plexuses using immunohistochemistry. The co-
labeling of NR1 and the neuronal markers PGP and neurofilament verified that NR1 is
localized in enteric neurons.
Expression of Ssplice Variants of the NR1 Protein.
After verifying the general expression of NR1 protein in the rat intestine, we
examined the expression of the splice variants of NR1 using specific primers and
antibodies with RT-PCR and western blots. Rat brain contains all splice variant isoforms
[49;50], thus, this tissue was used as a control in all our assays.
Expression of the N1 Cassette (exon 5) in the Rat Colon.
NR1 protein containing and lacking the N1 cassette was known to be present in
both rat brain [49;50] and spinal cord [38;51]. To analyze the expression of the N1
cassette in rat colon we performed RT-PCR (Fig. 3-3A) using four different sets of
primers (Table 2-1); “NR1a(b)”, which produced two different sized products, a 274 bp
band in the presence of exon 5 or a 211 bp band in the absence of this cassette. Primers
“exon 5+” and “N1+”, that were designed inside the N1 cassette and only showed a band
if this cassette was present. Alternatively “N1-” primers only showed a band if exon 5
was not present. While brain samples expressed both the N1 splice variants, the rat colon
only expressed the variant that lacked N1 (NR10yz). To verify these findings at the protein
level, western blot assays were performed. The expected NR1 band around 118 kDa was
present in brain but it was lacking in GI tissues (Fig. 3-3B).
These results further suggested that only splice variants without the N1 cassette
(NR10yz) were present in the rat colon.
41
Expression of C-Terminal Cassettes in the Rat Colon.
We analyzed the expression of the rat colon C1 cassette by RT-PCR, using two sets
of primers; “C1” (with NR1 generic, see Table 2-1) and the “C1+” primers [52]. We
found with both sets of primers that the expected C1 band was present in brain, but was
absent from the rat colon (Fig. 3-3C). To confirm these findings, we blotted using an
antibody targeted towards the C1 cassette. We observed the expression of C1 containing
NR1 protein in brain but not in GI (Fig. 3-3D). Whereas bands corresponding to the C1
cassette in both RT-PCR and western blot analyses were present as expected in brain,
none were visible in GI, suggesting that only the NR1 splice variants that lacked the C1
cassette (NR1x0z) were present in the rat colon.
RT-PCR and western blot were used to assess the expression of the C2 and
C2’cassettes. RT-PCR with primers for exon 22 showed a band for both GI and brain
(Fig. 3-3E). For the western blot analyses we employed two different antibodies; the C2+
antibody, which targeted the C2 cassette and the C2- antibody directed against the C2’
cassette. These antibodies showed expression of both the C2 and C2’ cassettes in the rat
brain and colon (Fig. 3-3F). These results suggested that both NR1 splice variants, the
one that has the C2 cassette and the one that contains the C2’ cassette (NR1xx0 and
NR1xx1) were present in the rat colon. These variants were visualized in the rat myenteric
plexus by immunohistochemistry with Alexa fluor-linked antibodies (Fig. 3-4).
Expression of NR2 Protein Subtypes.
We used RT-PCR with four different sets of primers to assess the expression the
NR2 subunits (Fig. 3-5A). Analyses of NR2A and NR2C demonstrated no bands for GI,
while both NR2B and NR2D were evident in GI and brain tissues. These results
suggested that only NR2B and NR2D were present in the rat colon. These subunits were
42
visualized in the rat myenteric plexus by immunohistochemistry with Alexa fluor-linked
antibodies (Fig. 3-5B). Moreover, we were able to visualize the double label of the NR2B
protein with the neuronal marker; Protein Gene Product 9.5 (PGP 9.5) (Fig. 3-5C) using
immunohistochemistry. The co-labeling of NR2B and the neuronal marker PGP further
verified that NR2B was localized in enteric neurons.
Co-labeling of NR1 with NR2B and NR2D in the Rat Colon.
In order to verify if NR2B and NR2D were co-localized with NR1 in the rat colon
we used specific antibodies targeted to NR1, NR2B and NR2D. We visualized the double
labeling of NR1 with both NR2B and NR2D with immunohistochemistry using Alexa
fluor-linked secondary antibodies (Fig. 3-6). The co-localization of NR1 with NR2B and
NR2D suggested there were heteromeric complexes of these NR2 subtypes with NR1 in
the rat colon.
Discussion
Our studies confirmed the expression of NR1 protein in the rat myenteric and
submucosal plexuses. We found that only the NR1 splice variants that contained the C2
or the C2’ cassette (NR1000 and NR1001) were present in the rat colon. Also, the NR2B
and NR2D subunits were the only NR2 subunit subtypes found in the rat colon. The
NMDA receptors in the rat colon were arranged in heteromeric complexes including the
NR1 with NR2B and NR2D subunits. Lastly, these NMDA receptors co-label with
neuronal makers, PGP and Neurofilament, confirming their presence in the enteric
neurons.
The presence of the N1 cassette is known to cause a decrease in the open time of
the NMDA receptor channel [53] and decrease the ability of spermine to potentiate
NMDA mediated currents [54]. Since these enteric receptors lacked the N1 cassette, they
43
would show an increased pH, Zn2+, and spermine sensitivity similar to receptors with
mutations at the N1 cassette [55].
NR1 proteins with the shortest C-terminal region (lacking the C1 cassette and
containing C2’; NR1x00) showed the highest cell surface expression [7]. The lack of the
C1 cassette also affected the PKC potentiation [4;56;57] and the calmodulin-dependent
inhibition [58] of these receptors’ currents. Receptor clustering may be affected also,
since the C1 cassette was shown to have specific interactions with multiple intracellular
proteins, including neurofilament-L [59] and the cytoskeletal protein yotiao [60].
Therefore, these enteric NMDA receptors which lacked both the N1 and C1 cassette may
have an increased cell-surface expression but poor clustering properties. Moreover, prior
studies found that NR1000 receptors were markedly less active than other splice forms like
NR1111 [4], indicating that the NMDA receptors in the naïve colon may not produce large
currents in the neurons when activated.
NR2A and NR2C are widely expressed throughout the whole brain, while the
expression of NR2B shows differences in the intensity and distribution [61]. The NR2D
expression is very faint and mutant mice defective in NR2D expression appear to develop
normally [8]. Not only the intensity and distribution of expression of the NR2 subunits is
unique, but their functional behavior differs. The offset decay time constant of the
NRl/NR2B channel is ~400 msec, while the NR1/NR2D channel shows a very long offset
decay time constant (~5000 msec) [9]. Therefore, these NMDA receptors found in the
naïve colon are going to show different expression and functional behavior depending if
they contain NR2B or NR2D.
44
To our knowledge this is the first comprehensive analysis of the expression of the
NMDA receptor NR1 protein splice variants and the NR2 subunit subtypes in the rat
colon. Therefore, more studies are needed to determine the specific properties of these
receptors both in normal and pathological conditions.
45
Figure 3-1. Expression of NR1 in the rat colon. (A) RT-PCR analyses of NR1 in rat colon (named GI, for gastrointestinal) and brain tissues using two different set of primers; NR1 general and NR1 generic, that recognize areas in the NR1 outside the spliced exons. Assessment of housekeeping gene, GAPDH (Glyceraldehyde-3-phosphate dehydrogenase) was included as a control for sample integrity and reaction fidelity. A negative control (-RT) was included which lacks Reverse transcriptase and uses GAPDH primers. (B) Top panel, western blot showing broad expression of NR1 protein in GI and brain tissues using general mouse-NR1 antibody that recognizes a site outside of the alternatively spliced cassettes. Bottom panel, an antibody against Actin was use as a control for loading purposes.
46
Figure 3-2. Visualization of NR1 protein and neuronal markers; PGP and neurofilament in the rat colon. Immunohistochemistry with Alexa fluor-linked antibodies on transverse colon sections showing NR1 protein and neuronal marker protein gene product 9.5 (PGP 9.5) co-expression (A) and NR1 protein and neuronal marker Neurofilament (NF) co-labeling (B). Scale bar = 50 µm. Section thickness = 10 µm. L = lumen, M = mucosa, SM = submucosal plexus, CM = circular muscle, MP = myenteric plexus, LM = longitudinal muscle, Arrow = ganglia, Arrow head = single cells.
47
Figure 3-3. Expression of NR1 splice variants in the rat colon. (A) Expression of N1 cassette (exon 5) in the rat colon. RT-PCR analyses of N1 cassette (exon 5) expression in rat colon and brain tissues using four different sets of primers; “NR1a(b)”, “exon 5+”, “N1+” and “N1-”. (B) Western Blot showing expression of N1 cassette containing NR1 protein in GI and brain tissues using antibody against N1. (C) Expression of C1 cassette (exon 21) in the rat colon. RT-PCR results of C1 cassette (exon 21) expression in rat colon and brain tissues using two different set of primers; C1 and C1+. (D) Western blot showing expression of C1 cassette containing NR1 protein using antibody targeted towards the C-terminal of the C1 cassette (exon 21). (E) Expression of C2 cassette (exon 22) in the rat colon. RT-PCR results of C2 cassette (exon 22) expression in rat colon and brain tissues using primers targeted to the C2 cassette. (F) Western blot showing probing of C2+ antibody which is targeted to the C2 cassette and C2- antibody directed against the C2’ cassette.
Exon 5+ and NR1a(b) Exon 5+ and NR1a(b)
48
Figure 3-4. Visualization of the C2 and C2’cassettes in the rat myenteric plexus. Whole mount immunohistochemistry showing the C2 cassette expression and the C2’ cassette expression in the rat myenteric plexus using an Alexa fluor antibody. Scale bar = 50 µm.
49
Figure 3-5. Expression of NR2 subtypes in the rat colon. (A) RT-PCR analyses of NR2A, NR2B, NR2C and NR2D expression in the rat colon and brain tissues using primers to detect the presence of each different NR2 subtype respectively. (B) Whole mount immunohistochemistry showing the presence of the NR2B and NR2D proteins in the rat myenteric plexus using Alexa fluor-linked antibodies. (C) Double-labeling ofNR2B and neuronal marker PGP 9.5. Scale bar = 50 µm.
Exon 5+ and NR1a(b)
50
Figure 3-6. Co-labeling of NR1 with NR2B and NR2D subunits in the rat colon. Transverse colon sections showing co-labeling of the NR1 and NR2B (A) and the NR1 and NR2D proteins (B) in the rat colon using Alexa fluor-linked antibodies. Scale bar = 50 µm. M = mucosal crypts, CM = circular muscle, MP = myenteric plexus, LM = longitudinal muscle, Arrow = ganglia, Arrow head = single cells.
Exon 5+ and NR1a(b)
51
CHAPTER 4 NMDA RECEPTOR MEDIATED CHANGES IN CONTRACTILITY AFTER TNBS
INDUCED COLITIS.
Introduction
Bowel disorders like inflammatory bowel disease (IBD) and irritable bowel
syndrome (IBS) are one of the main reasons for visiting a gastroenterologist in America.
IBS afflicts 12% of adults in the US. IBD, which refers to two chronic diseases that cause
intestinal inflammation: ulcerative colitis and Crohn's disease, affect up to 1.4 million
Americans. The most common symptoms of these disorders are alterations in bowel
movements and the associated pain.
The NMDA receptor NR1 subunit is of particular interest because it is critical for
the function of the NMDA receptor [62]. NR1 has been characterized by in situ
hybridization and PCR techniques in the rat [30], guinea pig [31] and human [32] enteric
plexuses. NR1 was also co-labeled with vasoactive intestinal peptide (VIP) in enteric
neurons of the rat using double in situ hybridization [33]. NMDA receptors are also
expressed in postganglionic parasympathetic neurons of the rat larynx and esophagus and
their activation may be associated with VIP or NO release [34]. Moreover, NMDA
altered the colonic peristaltic reflex in an in vitro model that retained sympathetic and
parasympathetic innervations [35]. NMDA produced concentration-dependent tonic
contractions of the rat rectum [36]. Shafton et al. found that peripherally administered
NMDA receptor antagonist ketamine reduces visceromotor responses and motility
reflexes in vivo [37]. These findings suggest that NMDA receptors are likely to be
involved in peristalsis.
We previously reported the expression of the NMDA receptor NR1 subunit splice
variants in the rat myenteric plexus before and during inflammation. It was found that in
52
untreated animals the NR1 splice variants are NR1001 and NR1000 [63]. After
trinitrobenzene sulfonic acid (TNBS) induced colitis the expression of NR1 protein and
splice variants NR1011 and NR1111 were notably increased [43]. The purpose of the
current study was to determine the role of NMDA receptors in motility in normal and
inflamed colons.
Results
Inflammation after TNBS Treatment
Inflammation in the TNBS-induced model of colitis has several indicators
including transient weight loss after treatment. Animals treated with TNBS lost weight
(13.7 ± 3.2 g) during the first 2 – 7 days after the enema compared to controls (Fig. 4-1).
Previous studies [41;64] found similar results indicating that colitis was effectively
induced by TNBS. Treated animals stopped losing weight after day 14 and showed
weights undistinguishable from controls by day 21 (Fig. 4-1).
Visceral hypersensitivity to colo-rectal distension was increased in TNBS treated
rats at 7, 14 and 21 days following TNBS administration when compared to controls and
resolved by day 28 (Fig. 4-2). Moreover, somatic hypersensitivity to mechanical
threshold testing on hind, Von Frey, was increased at 14 days after TNBS but not at 21 or
28 days (Fig. 4-3). These results are comparable to previous findings [43;65].
Another marker of inflammation is an increase in the activity of myeloperoxidase
(MPO). MPO is an enzyme found in the intracellular granules of neutrophils and it is
used as an indicator of neutrophil infiltration. The levels of MPO activity were
significantly elevated 2 days after vehicle (ethanol-saline, 1:1) administration and 2,7 and
14 days after TNBS treatment when compared to control (naïve) and 28 days (Fig. 4-4).
This is in agreement to previous results reported by Krauter et al [41].
53
NMDA Receptors Co-localize with VIP and NOS in the Rat Colon after Colitis.
Here we found using immunohistochemistry that VIP co-localizes with Nitric
Oxide Synthase (NOS, Fig. 4-5 A-C). VIP also co-localizes with the NMDA receptors;
NR1-C1 (NR1x1x, Fig. 4-5 D-F) and NR1-N1 (NR11xx, Fig. 4-5 G-I) in the inflamed
colon, 14 days after TNBS treatment. Similar to our previous findings, NR1-C1 (Fig. 4-5
J-L) and NR1-N1 (Fig. 4-5 M-O) expression is barely detectable in non-inflamed colons.
Therefore, the NMDA receptors present after inflammation are localized in VIP/NOS
containing neurons.
Changes in VIP Concentration Following TNBS Treatment
Plasma concentration of the vasoactive intestinal peptide (VIP) was assessed using
a peptide enzyme immunoassay (Bachem Group, San Carlos, CA) before, 2 hours and 14
days after TNBS treatment. VIP plasma concentration was significantly increased 2 hours
following TNBS enema when compared to naïve animals and animals 14 days after
TNBS treatment (Fig. 4-6).
We also looked at the effect of NMDA and MK-801 in the release of the VIP.
Colon segments (2 cm) were incubated with either saline, NMDA 1X (200 µM), NMDA
10X (2 mM), MK-801 (10 µM), NMDA 1X + MK-801 and NMDA 10X + MK-801.
Similar to plasma results, VIP release in colons incubated in saline was significantly
increased 2 hrs after TNBS when compared to naïve animals and 14 days after TNBS.
This enhanced VIP release was significantly inhibited by NMDA (Fig. 4.8). While, MK-
801 seems to promote VIP release 14 days after TNBS induced colitis (4.9).
NMDA Receptor Mediated Changes in Motility after TNBS Colitis
Ex vivo circular muscle contractility was studied using isolated colon segments
from naïve and TNBS treated rats at 7, 14, 21 and 28 days, using a MYOBATH-II multi-
54
channel bath system (World Precision Instruments, Sarasota, FL). No significant (P-
values > 0.05) differences were found between the circular muscle contractility of
inflamed and control colons when activated with acetylcholine (ACh, 200 µM).
Moreover, when circular muscle contractions were recorded in the presence of NMDA
(200 µM) and the NMDA receptor antagonist MK-801 (10 µM) no differences were
noticed (Fig. 4-9).
Employing a basic colo-rectal manometry device the contractions of naïve and 14
days TNBS-treated rat colons were studied in vivo. Contractions were recorded at a basal
pressure of 10 mmHg and in the presence of NMDA (14.3 mg/mL) or MK-801 (1.7
mg/mL). TNBS treated animals’ contractility was significantly increased when NMDA
was administered locally compared to controls. Moreover, this effect was reversed by
MK-801 (Fig. 4-10). Since these effects were not seen in the circular muscle contractility
of isolated colon segments it suggests that NMDA receptor mediated changes in colonic
motility after colitis requires extrinsic neuronal input.
Discussion
The purpose of this investigation was to determine the effects of NMDA and the
NMDA receptor antagonist MK-801 in rat colonic contractility following inflammation.
For this, we used the trinitrobenzene sulfonic acid (TNBS) induced colitis model.
Following TNBS treatment rats showed transient weight loss, indicating that
inflammation was effectively induced. We found as well that visceral hypersensitivity
and somatic hypersensitivity were increased in the inflamed animals, which is in
agreement with our previous work [43]. Also, the levels of myeloperoxidase (MPO)
activity were augmented after TNBS administration. These results were similar to
Krauter et al. findings [41], even though our MPO maximum values were slightly higher.
55
This is most likely due to differences in the severity of the inflammatory insult (7.5 mg
TNBS in 30% ethanol VS. 15 mg TNBS in 50% ethanol).
We found that after TNBS treatment NR1-C1 and NR1-N1 co-localize in the
VIP/NOS containing neurons. The expression of both VIP and NOS was previously
found in the enteric inhibitory motor neurons [66]. They are also present in the
intestinofugal neurons that project to the celiac and the inferior mesenteric ganglia [67-
69]. VIP and NOS have also been characterized in a unique population of neurons,
colospinal afferent neurons (CANs), with a direct projection from the enteric nervous
system to the central nervous system [13]. Other studies have shown that VIP and NOS
are present on parasympathetic nerves that innervate the uterus, the larynx and the
esophagus [70;71]. Moreover, activation of NMDA receptors expressed in post-
ganglionic parasympathetic neurons may be associated with VIP or NO release [34].
We also reported that VIP plasma concentration was significantly increased 2 hours
following TNBS enema when compared to naïve animals and animals 14 days after
TNBS treatment. This is consistent with clinical studies in which the levels of VIP in
fasting plasma were higher in IBS patients than in control group [72]. Also, NMDA
inhibits VIP release in vitro 2 hours after inflammation, while MK-801 promotes VIP
release 14 days after TNBS treatment. Therefore, alterations of VIP may play a role in
the pathogenesis of inflammation and bowel disorders like IBS.
We found using restrained, non-anesthetized animals that inflamed colon
contractility was significantly increased when NMDA was delivered in the lumen. This
altered contractility was reversed by MK-801. These effects were not observed when
circular muscle contractility was assessed in isolated colon segments. Cosentino et al.
56
found that NMDA altered peristalsis in their in vitro model, which was dependent on the
integrity of parasympathetic and sympathetic pathways [35]. While, in an in vivo model
Shafton et al. found that the NMDA receptor antagonist ketamine had an inhibitory effect
in motility reflexes [37].
In conclusion, NMDA receptors were found to have role in contractility following
colitis. This NMDA receptor mediated effect in colonic motility requires modulation of
VIP release.
57
Figure 4-1. Weight loss following trinitrobenzene sulfonic acid (TNBS) administration. Graph shows the weight change in grams after TNBS treatment. Animals lost more weight at 2 days and 7 days after TNBS compared to 14 days, 21 days and control animals (n = 20 for control, n = 20 for Day 0, n = 20 for Day 2, n = 20 for Day 7, n = 12 for Day 14, n = 5 for Day 21; **P < 0.001, when compared to controls; ANOVA with Bonferroni’s posttests).
58
Figure 4-2. Visceral hypersensitivity after TNBS treatment. Graph representing colo-rectal distension scores in mmHg before and after TNBS. Animals show visceral hypersensitivity at 7, 14 and 21 days after TNBS which seems to resolve by 28 days after TNBS, compared to controls (n = 10 for 7 days, n = 15 for 14 days, n = 5 for 21 days, n = 8 for 28 days; *p < 0.05, **P < 0.001, when compared to controls; ANOVA with Bonferroni's posttests).
59
Figure 4-3. Somatic hypersensitivity after TNBS treatment. Graph representing the mechanical threshold testing on hind, Von Frey, scores in grams of force. Animals show somatic hypersensitivity at 14 days after TNBS but not at 21and 28 days after TNBS (n = 18 for 14 days, n = 12 for 21 days, n = 42 for 28 days; *p < 0.05, when compared to controls; ANOVA with Bonferroni's posttests).
Mechanical threshold testing on hind paws following TNBS treatment
Con
trol
14
days
TNB
S 14
day
s
Con
trol
21
days
TNB
S 21
day
s
Con
trol
28
days
TNB
S 28
day
s
0
10
20
30
40
50ControlTNBS
Forc
e / g *
60
Figure 4-4. Myeloperoxidase (MPO) activity following TNBS-induced colitis. Graph shows the average myeloperoxidase (MPO) activity, indicating that the activity is elevated at 2 days after vehicle (ethanol) and at 2, 7 and 14 days after TNBS. MPO activity also remains slightly elevated 28 days after TNBS (for all conditions, n = 3, each with 8 replicates; *p < 0.05, **p < 0.01, when compared to controls; ANOVA with Dunnett’s posttests).
61
Figure 4-5. NMDA receptors present in the VIP/NOS neurons of the rat myenteric plexus 14 days following TNBS treatment (A) Shows labeling for vasoactive intestinal peptide (VIP) in rat colon after TNBS (B) Labels for nitric oxide synthase (NOS) in rat colon after TNBS. (C) Shows VIP and NOS co-labeled cells in yellow and DAPI nuclear stain in blue. (D) Labels for VIP in rat colon after TNBS. (E) Labels for NMDA receptor NR1-C1 in rat colon after TNBS. (F) Shows VIP and NR1-C1 co-labeled cells in yellow and DAPI nuclear stain in blue. (G) Labels for VIP in rat colon after TNBS. (H) Labels for NMDA receptor NR1-N1 in rat colon after TNBS. (I) Shows VIP and NR1-N1 co-labeled cells in yellow and DAPI nuclear stain in blue. (J) Labels for VIP in naïve rat colon. (K) Labels for NMDA receptor NR1-C1 in naïve rat colon. (L) Shows VIP and NR1-C1 co-labeled cells in yellow and DAPI nuclear stain in blue. (M) Labels for VIP in naïve rat colon. (N) Labels for NMDA receptor NR1-N1 in naïve rat colon. (O) Shows VIP and NR1-N1 co-labeled cells in yellow and DAPI nuclear stain in blue. Scale bar 50 µm.
62
Figure 4-6. VIP in plasma after TNBS treatment. Plasma concentration of VIP was assessed in naïve animals and after TNBS treatment at the 2 hours and 14 days time-points using a peptide enzyme immunoassay (n = 4 for all conditions, *p < 0.05, when compared to controls; ANOVA with Dunnett’s posttests).
63
Figure 4-7. NMDA receptor effect in VIP release 2 hours after TNBS treatment. VIP
released from colon segments was assessed in naïve animals and 2 hours after TNBS treatment in the presence of NMDA (200 µM) and MK-801 (10 µM) using a peptide enzyme immunoassay (n = 4 for all conditions, *p < 0.05, when compared to controls; ANOVA with Dunnett’s posttests).
*
64
Figure 4-8. NMDA receptor effect in VIP release 14 days after TNBS treatment. VIP released from colon segments was assessed in naïve animals and 14 days after TNBS treatment in the presence of NMDA (200 µM) and MK-801 (10 µM) using a peptide enzyme immunoassay (n = 4 for all conditions, *p < 0.001, when compared to controls; ANOVA with Dunnett’s posttests).
*
65
Figure 4-9. Ex Vivo contractility following TNBS induced colitis. (A) Shows an example of the contraction recordings of colon segments in control animals or 14 days after TNBS treatment. Contractions were recorded in the presence of 200 µmol L-1 acetylcholine (ACh) alone or combined with 200 µmol L-1 NMDA and 10 µmol L-1 MK-801. (B) Graphical representations of recordings of colon segments contractility at 7 days (n=23 for naïve, n=24 for TNBS), 14 days (n=16 for naïve, n=17 for TNBS), 21 days (n=44 for naïve, n=41 for TNBS), and 28 days (n=30 for naïve, n=29 for TNBS) after treatment. Data is shown as the integrated area under the contraction peaks (No significant differences found if P < 0.05, when compared to controls; ANOVA with Bonferroni’s posttests).
66
Figure 4-10. Colo-rectal Manometry: In Vivo motility after TNBS. (A) Shows an example of the contraction recordings at 10 mmHg and in the presence of NMDA or MK-801 in control and 14 days TNBS-treated rats. (B) Graph demonstrates the combined contractility of five rats. Animals were restrained and non-anesthetized during colo-rectal manometry. Data is shown as the integrated area under the contraction peaks (n = 5, *p < 0.05, when compared to controls; ANOVA with Bonferroni’s posttests).
67
CHAPTER 5 CONCLUSIONS AND FUTURE CONSIDERATIONS
NMDA Receptors in the Enteric Nervous System in the Naïve Rat Colon
We confirmed the expression of NR1 protein in the naïve rat myenteric and
submucosal plexuses. Our studies reported that only the NR1 splice variants that
contained the C2 or the C2’ cassette (NR1000 and NR1001) were present in the naïve rat
colon. Also, the only NR2 subunit subtypes found in the naïve rat colon were the NR2B
and NR2D subunits. Moreover, these NMDA receptors were arranged in heteromeric
complexes including the NR1 with NR2B and NR2D subunits.
The N1 cassette is known to cause a decrease in the open time of the NMDA
receptor channel [53] and decreases the ability of spermine to potentiate NMDA
mediated currents [54]. Since these enteric receptors lacked the N1 cassette, they would
show an increased pH, Zn2+, and spermine sensitivity similar to receptors with mutations
at the N1 cassette [55].
NR1 proteins with the shortest C-terminal region (lacking the C1 cassette and
containing C2’; NR1x00) have the highest cell surface expression [7]. The absence of the
C1 cassette also affects the PKC potentiation [4;56;57], receptor clustering and the
calmodulin-dependent inhibition [58] of these receptors’ currents. In addition, the C1
cassette affects receptor clustering. [59;60]. Consequently, these enteric NMDA
receptors lacking the N1 and C1 cassette may have an increased cell-surface expression
but poor clustering properties. Furthermore, previous studies found that NR1000 receptors
were markedly less active than other splice forms like NR1111 [4], indicating that enteric
NMDA receptors in the naïve colon may not produce large currents when activated.
68
Functional NMDA receptor channels in mammals are considered to be produced
only when the NR1 subunit is expressed together with one or more of the four NR2
subunits [2]. While the NR1 is widely expressed throughout the whole brain, the
expression of the NR2 subunits is highly regulated. The distributions of NR2A and NR2C
have temporal and spatial similarities to that of NR1, while the expression of NR2B
shows differences in the intensity and distribution [61]. NR2D expression in the brain is
very faint compared to other NR2s, and mutant mice defective in NR2D expression
appear to develop normally [8]. Not only the intensity and distribution of expression of
the NR2 subunits is unique, but their functional behavior differs. The offset decay time
constant of the NRl/NR2B channel is ~400 msec, while the NR1/NR2D channel shows a
very long offset decay time constant (~5000 msec) [9]. Therefore, these NMDA receptors
found in the naïve colon are going to show different expression and functional behavior
depending if they contain NR2B or NR2D.
NMDA Receptors in the Enteric Nervous System after TNBS-Induced Colitis
Based on our previous findings [43;63], the hypothesis for this portion of our work
was that NMDA receptors expression in the rat colon changes after trinitrobenzene
sulfonic acid (TNBS) induced colitis. These changes in NMDA receptor expression
would then mediate changes in colonic motility. Regulation of colonic contractility
through NMDA receptors could then modulate bowel function and relieve pain
To determine the effects of NMDA and the NMDA receptor antagonist MK-801 in
rat colonic contractility following inflammation we used the TNBS-induced colitis
model. After TNBS enema, rats showed weight loss, which is an indication that
inflammation was effectively induced. We reported an increase in visceral
hypersensitivity in response to colo-rectal distension in the animals with colitis, which is
69
in agreement with our previous work [43]. Moreover, the levels of myeloperoxidase
(MPO) activity were higher after TNBS administration, similar to prior reports [41].
We also found that after TNBS treatment, NR1-C1 and NR1-N1 co-label with the
VIP/NOS containing neurons. VIP and NOS expression was previously characterized in
the enteric inhibitory motor neurons [66], intestinofugal neurons [67-69], colospinal
afferent neurons (CANs) [13], and parasympathetic nerves [70;71]. Furthermore,
activation of NMDA receptors expressed in post-ganglionic parasympathetic neurons
may be associated with VIP or NO release [34]. We reported that VIP plasma
concentration was significantly increased 2 hours following TNBS enema. Moreover,
similar to plasma results, VIP in vitro release in colon segments was significantly
increased 2 hrs after inflammation when compared to naïve animals and 14 days after
TNBS. This enhanced VIP release was significantly inhibited by NMDA. While, MK-
801 promotes VIP release 14 days after TNBS induced colitis. This is consistent with
clinical studies in which the levels of VIP in fasting plasma were higher in IBS patients
than in control group [72]. Therefore, alterations of VIP may play a role in the
pathogenesis of inflammation and bowel disorders like IBS.
Our in vivo manometry studies showed that inflamed colon contractility was
significantly increased in the presence of NMDA and this effect was reversed by MK-
801. However, when circular muscle contractility was assessed in isolated colon
segments, these effects were not observed. Literature shows that NMDA can alter
peristalsis in an in vitro model, which was dependent on the integrity of parasympathetic
and sympathetic pathways [35]. While, Shafton et al. found in their in vivo model that the
NMDA receptor antagonist ketamine had an inhibitory effect in motility reflexes [37].
70
These results taken together suggest that NMDA receptor mediated changes in intestinal
motility are mediated by extrinsic neuronal input. These NMDA receptors could be
localized in parasympathetic neurons or colospinal afferent neurons that activate
excitatory motor neurons via intrinsic interneurons. Excitatory motor neuron activation
then increases contractility. If conversely, these NMDA receptors were localized in the
inhibitory motor neurons or sympathetic neurons we would have expected to see a
decrease in contractility.
In conclusion, NMDA receptors in the naïve colon are heteromeric complexes of
either NR1000 or NR1001 with NR2B and/or NR2D. The enteric NMDA receptors were
also co-labeled with the vasoactive intestinal peptide (VIP). We know that an
inflammatory process like the TNBS enema induces an increase in contractility, diarrhea,
in order to prevent further damage. We propose that in order revert this exacerbated
motility, 2 hours after TNBS treatment, VIP release in the colon is increased to promote
relaxation. Then, 14 days after TNBS inflammation, NMDA receptor expression changes
and more active splice variants (NR1000 or NR1001) are present in the colon. Activation of
these NMDA receptors inhibits the now pathological VIP release and encourages
contractility (Fig. 5-1). Therefore, after colitis, NMDA receptor activation increases
contractility by inhibiting relaxation (VIP release). While, MK-801 decreases colon
motility by promoting VIP release.
Clinical Implications
Selective changes in the expression of the NR1 splice variants and possibly the
NR2 subunit subtypes of the NMDA receptors may be an element for the ongoing
visceral hypersensitivity in conditions such as inflammatory bowel disease (IBD) and
irritable bowel syndrome (IBS). Previous studies using NMDA receptor antagonists
71
showed promising inhibitory effects on models of visceral hypersensivity [32;76-78]. The
intravenous administration of NMDA receptor antagonist memantine inhibited pain
responses to noxious mechanical stimuli [77]. Intrathecal administration (10 nmol) of
MK-801 was sufficient to significantly attenuate the hyperalgesic visceromotor responses
to colonic distention after zymosan-induced inflammation [76]. In a similar inflammation
model, the administration of both intrathecal MK-801 (1.5 nmol) and intraperitoneal MK-
801 (0.15 mg/kg) completely abolished the colorectal distension-induced hypersensitivity
of both noxious and innocuous stimuli [78].
The drugs in these studies seemed to be working at the levels of the spinal cord and
primary afferent neurons.
Future Considerations
More studies are needed to determine the specific properties of the NMDA
receptors, both in normal and pathological conditions.
Zhou et al. 2008, found that 16 weeks after TNBS treatment, after inflammation
resolution, 24% of the treated rats still exhibit visceral and somatic hypersensitivity [79].
It would be interesting to see if this subset of animals also contains the NMDA receptor
splice variants present only after inflammation (NR1011 and NR1111). Moreover, we could
study if these also retain the NMDA-mediated changes in colonic contractility and VIP
release. Changes in NMDA receptor subtype expression can also be studied in colonic
biopsies of patients with irritable bowel syndrome (IBS).
Finally, bowel disorders like irritable bowel syndrome has an incidence among
women twice as high as men [19] in the US. It would be interesting to see if there are
biological sex differences in the colonic motility before and after TNBS treatment.
72
Therefore, a better understanding of the expression, physiology and
pharmacological properties of the NMDA receptors present in the enteric nervous system
could lead to the development of drugs that selectively modulate the bowel function and
inhibits visceral pain.
73
Figure 5-1. Mechanism Model. NMDA receptors in the naïve colon contain NR1000 or NR1001 with NR2B and/or NR2D. The enteric NMDA receptors were also co-labeled with the vasoactive intestinal peptide (VIP). We know that an inflammatory process like the TNBS enema induces an increase in contractility, diarrhea, in order to prevent further damage. We propose that in order revert this exacerbated motility, 2 hours after TNBS treatment, VIP release in the colon is increased to promote relaxation. Then, 14 days after TNBS inflammation, NMDA receptor expression changes and more active splice variants (NR1000 or NR1001) are present in the colon. Activation of these NMDA receptors inhibits the now pathological VIP release and encourages contractility (Fig. 5-1). Therefore, after colitis, NMDA receptor activation increases contractility by inhibiting relaxation (VIP release). While, MK-801 decreases colon motility by promoting VIP release.
Naïve 2 hours 14 days
TNBS enema induced colitis
Increased VIP release Increase relaxation
Normal state, low activity NMDARs: NR1000 + NR1001
Diseased state, high activity NMDARs: NR1011 + NR1111
Vasoactive intestinal peptide (VIP)
Diarrhea
Increased motility
Increased NMDARs expression Splice variant switch More active NMDARs
TIME
Decreased motility
VIP release inhibition
NMDA MK-801 VIP inhibition Increased contractility
VIP release
Decreased contractility
74
LIST OF REFERENCES
1. Michaelis,E.K., Two different families of NMDA receptors in mammalian brain: physiological function and role in neuronal development and degeneration, Adv. Exp. Med. Biol., 341 (1993) 119-128.
2. McBain,C.J., Mayer,M.L., N-methyl-D-aspartic acid receptor structure and function, Physiol Rev., 74 (1994) 723-760.
3. Yamakura,T., Shimoji,K., Subunit- and site-specific pharmacology of the NMDA receptor channel, Prog. Neurobiol., 59 (1999) 279-298.
4. Durand,G.M., Bennett,M.V., Zukin,R.S., Splice variants of the N-methyl-D-aspartate receptor NR1 identify domains involved in regulation by polyamines and protein kinase C, Proc. Natl. Acad. Sci. U. S. A, 90 (1993) 6731-6735.
5. Zukin,R.S., Bennett,M.V., Alternatively spliced isoforms of the NMDARI receptor subunit, Trends Neurosci., 18 (1995) 306-313.
6. Dingledine,R., Borges,K., Bowie,D., Traynelis,S.F., The glutamate receptor ion channels, Pharmacol. Rev., 51 (1999) 7-61.
7. Okabe,S., Miwa,A., Okado,H., Alternative splicing of the C-terminal domain regulates cell surface expression of the NMDA receptor NR1 subunit, J. Neurosci., 19 (1999) 7781-7792.
8. Ikeda,K., Araki,K., Takayama,C., Inoue,Y., Yagi,T., Aizawa,S., Mishina,M., Reduced spontaneous activity of mice defective in the epsilon 4 subunit of the NMDA receptor channel, Brain Res. Mol. Brain Res., 33 (1995) 61-71.
9. Mori,H., Mishina,M., Structure and function of the NMDA receptor channel, Neuropharmacology, 34 (1995) 1219-1237.
10. Woolf,C.J., Thompson,S.W., The induction and maintenance of central sensitization is dependent on N-methyl-D-aspartic acid receptor activation; implications for the treatment of post-injury pain hypersensitivity states, Pain, 44 (1991) 293-299.
11. Willert,R.P., Woolf,C.J., Hobson,A.R., Delaney,C., Thompson,D.G., Aziz,Q., The development and maintenance of human visceral pain hypersensitivity is dependent on the N-methyl-D-aspartate receptor, Gastroenterology, 126 (2004) 683-692.
12. Furness,J.B., The Enteric Nervous System, Blackwell Publishing, Inc., 2006.
13. Suckow,S.K., Caudle,R.M., Identification and immunohistochemical characterization of colospinal afferent neurons in the rat, Neuroscience, 153 (2008) 803-813.
75
14. Costa,M., Furness,J.B., Neuronal peptides in the intestine, Br. Med. Bull., 38 (1982) 247-252.
15. Waterman,S.A., Tonini,M., Costa,M., The role of ascending excitatory and descending inhibitory pathways in peristalsis in the isolated guinea-pig small intestine, J. Physiol, 481 ( Pt 1) (1994) 223-232.
16. Waterman,S.A., Costa,M., The role of enteric inhibitory motoneurons in peristalsis in the isolated guinea-pig small intestine, J. Physiol, 477 ( Pt 3) (1994) 459-468.
17. Sanders,K.M., Koh,S.D., Ward,S.M., Interstitial cells of cajal as pacemakers in the gastrointestinal tract, Annu. Rev. Physiol, 68 (2006) 307-343.
18. Schmidt,C., Stallmach,A., Etiology and pathogenesis of inflammatory bowel disease, Minerva Gastroenterol. Dietol., 51 (2005) 127-145.
19. Mertz,H.R., Irritable bowel syndrome, N. Engl. J. Med., 349 (2003) 2136-2146.
20. O'Sullivan,M.A., Mahmud,N., Kelleher,D.P., Lovett,E., O'Morain,C.A., Patient knowledge and educational needs in irritable bowel syndrome, Eur. J. Gastroenterol. Hepatol., 12 (2000) 39-43.
21. Spiller,R.C., Inflammation as a basis for functional GI disorders, Best. Pract. Res. Clin. Gastroenterol., 18 (2004) 641-661.
22. Parry,S., Forgacs,I., Intestinal infection and irritable bowel syndrome, Eur. J. Gastroenterol. Hepatol., 17 (2005) 5-9.
23. Thompson,W.G., Longstreth,G.F., Drossman,D.A., Heaton,K.W., Irvine,E.J., Muller-Lissner,S.A., Functional bowel disorders and functional abdominal pain, Gut, 45 Suppl 2 (1999) II43-II47.
24. Mayer,E.A., Raybould,H.E., Role of visceral afferent mechanisms in functional bowel disorders, Gastroenterology, 99 (1990) 1688-1704.
25. Mayer,E.A., Gebhart,G.F., Basic and clinical aspects of visceral hyperalgesia, Gastroenterology, 107 (1994) 271-293.
26. Verne,G.N., Robinson,M.E., Price,D.D., Hypersensitivity to visceral and cutaneous pain in the irritable bowel syndrome, Pain, 93 (2001) 7-14.
27. Verne,G.N., Price,D.D., Irritable bowel syndrome as a common precipitant of central sensitization, Curr. Rheumatol. Rep., 4 (2002) 322-328.
28. Verne,G.N., Himes,N.C., Robinson,M.E., Gopinath,K.S., Briggs,R.W., Crosson,B., Price,D.D., Central representation of visceral and cutaneous hypersensitivity in the irritable bowel syndrome, Pain, 103 (2003) 99-110.
76
29. Talley,N.J., Drug therapy options for patients with irritable bowel syndrome, Am. J. Manag. Care, 7 (2001) S261-S267.
30. Burns,G.A., Stephens,K.E., Benson,J.A., Expression of mRNA for the N-methyl-D-aspartate (NMDAR1) receptor by the enteric neurons of the rat, Neurosci. Lett., 170 (1994) 87-90.
31. Broussard,D.L., Li,X., Pritchett,D.B., Lynch,D., Bannermann,P.G., Pleasure,D., The expression of a NMDA receptor gene in guinea-pig myenteric plexus, Neuroreport, 5 (1994) 973-976.
32. Giaroni,C., Zanetti,E., Chiaravalli,A.M., Albarello,L., Dominioni,L., Capella,C., Lecchini,S., Frigo,G., Evidence for a glutamatergic modulation of the cholinergic function in the human enteric nervous system via NMDA receptors, Eur. J. Pharmacol., 476 (2003) 63-69.
33. Burns,G.A., Stephens,K.E., Expression of mRNA for the N-methyl-D-aspartate (NMDAR1) receptor and vasoactive intestinal polypeptide (VIP) co-exist in enteric neurons of the rat, J. Auton. Nerv. Syst., 55 (1995) 207-210.
34. Robertson,B.S., Satterfield,B.E., Said,S.I., Dey,R.D., N-methyl-D-aspartate receptors are expressed by intrinsic neurons of rat larynx and esophagus, Neurosci. Lett., 244 (1998) 77-80.
35. Cosentino,M., De Ponti,F., Marino,F., Giaroni,C., Leoni,O., Lecchini,S., Frigo,G., N-methyl-D-aspartate receptors modulate neurotransmitter release and peristalsis in the guinea pig isolated colon, Neurosci. Lett., 183 (1995) 139-142.
36. Jankovic,S.M., Milovanovic,D., Matovic,M., Iric-Cupic,V., The effects of excitatory amino acids on isolated gut segments of the rat, Pharmacol. Res., 39 (1999) 143-148.
37. Shafton,A.D., Bogeski,G., Kitchener,P.D., Sanger,G.J., Furness,J.B., Shimizu,Y., Effects of NMDA receptor antagonists on visceromotor reflexes and on intestinal motility, in vivo, Neurogastroenterol. Motil., 19 (2007) 617-624.
38. Prybylowski,K.L., Grossman,S.D., Wrathall,J.R., Wolfe,B.B., Expression of splice variants of the NR1 subunit of the N-methyl-D-aspartate receptor in the normal and injured rat spinal cord, J. Neurochem., 76 (2001) 797-805.
39. Ness,T.J., Gebhart,G.F., Colorectal distension as a noxious visceral stimulus: physiologic and pharmacologic characterization of pseudaffective reflexes in the rat, Brain Res., 450 (1988) 153-169.
40. Wesselmann,U., Czakanski,P.P., Affaitati,G., Giamberardino,M.A., Uterine inflammation as a noxious visceral stimulus: behavioral characterization in the rat, Neurosci. Lett., 246 (1998) 73-76.
77
41. Krauter,E.M., Strong,D.S., Brooks,E.M., Linden,D.R., Sharkey,K.A., Mawe,G.M., Changes in colonic motility and the electrophysiological properties of myenteric neurons persist following recovery from trinitrobenzene sulfonic acid colitis in the guinea pig, Neurogastroenterol. Motil., 19 (2007) 990-1000.
42. Rosa-Molinar,E., Proskocil,B.J., Ettel,M., Fritzsch,B., Whole-mount procedures for simultaneous visualization of nerves, neurons, cartilage and bone, Brain Res. Brain Res. Protoc., 4 (1999) 115-123.
43. Zhou,Q., Caudle,R.M., Price,D.D., Valle-Pinero,A.Y., Verne,G.N., Selective up-regulation of NMDA-NR1 receptor expression in myenteric plexus after TNBS induced colitis in rats, Mol. Pain, 2 (2006) 3.
44. Moroni,F., Luzzi,S., Franchi-Micheli,S., Zilletti,L., The presence of N-methyl-D-aspartate-type receptors for glutamic acid in the guinea pig myenteric plexus, Neurosci. Lett., 68 (1986) 57-62.
45. Luzzi,S., Zilletti,L., Franchi-Micheli,S., Gori,A.M., Moroni,F., Agonists, antagonists and modulators of excitatory amino acid receptors in the guinea-pig myenteric plexus, Br. J. Pharmacol., 95 (1988) 1271-1277.
46. Shannon,H.E., Sawyer,B.D., Glutamate receptors of the N-methyl-D-aspartate subtype in the myenteric plexus of the guinea pig ileum, J. Pharmacol. Exp. Ther., 251 (1989) 518-523.
47. Alesiani,M., Pellegrini Giampietro,D.E., Cherici,G., Galli,A., Moroni,F., The guinea pig myenteric plexus as a tool to characterize drugs active at the glycine recognition site of the NMDA receptors, Pharmacol. Res., 22 Suppl 1 (1990) 15-16.
48. Wiley,J.W., Lu,Y.X., Owyang,C., Evidence for a glutamatergic neural pathway in the myenteric plexus, Am. J. Physiol, 261 (1991) G693-G700.
49. Sugihara,H., Moriyoshi,K., Ishii,T., Masu,M., Nakanishi,S., Structures and properties of seven isoforms of the NMDA receptor generated by alternative splicing, Biochem. Biophys. Res. Commun., 185 (1992) 826-832.
50. Laurie,D.J., Putzke,J., Zieglgansberger,W., Seeburg,P.H., Tolle,T.R., The distribution of splice variants of the NMDAR1 subunit mRNA in adult rat brain, Brain Res. Mol. Brain Res., 32 (1995) 94-108.
51. Tolle,T.R., Berthele,A., Laurie,D.J., Seeburg,P.H., Zieglgansberger,W., Cellular and subcellular distribution of NMDAR1 splice variant mRNA in the rat lumbar spinal cord, Eur. J. Neurosci., 7 (1995) 1235-1244.
52. Liesi,P., Stewart,R.R., Akinshola,B.E., Wright,J.M., Weaver cerebellar granule neurons show altered expression of NMDA receptor subunits both in vivo and in vitro, J. Neurobiol., 38 (1999) 441-454.
78
53. Rumbaugh,G., Prybylowski,K., Wang,J.F., Vicini,S., Exon 5 and spermine regulate deactivation of NMDA receptor subtypes, J. Neurophysiol., 83 (2000) 1300-1306.
54. Mott,D.D., Doherty,J.J., Zhang,S., Washburn,M.S., Fendley,M.J., Lyuboslavsky,P., Traynelis,S.F., Dingledine,R., Phenylethanolamines inhibit NMDA receptors by enhancing proton inhibition, Nat. Neurosci., 1 (1998) 659-667.
55. Traynelis,S.F., Burgess,M.F., Zheng,F., Lyuboslavsky,P., Powers,J.L., Control of voltage-independent zinc inhibition of NMDA receptors by the NR1 subunit, J. Neurosci., 18 (1998) 6163-6175.
56. Logan,S.M., Rivera,F.E., Leonard,J.P., Protein kinase C modulation of recombinant NMDA receptor currents: roles for the C-terminal C1 exon and calcium ions, J. Neurosci., 19 (1999) 974-986.
57. Zheng,X., Zhang,L., Wang,A.P., Bennett,M.V., Zukin,R.S., Ca2+ influx amplifies protein kinase C potentiation of recombinant NMDA receptors, J. Neurosci., 17 (1997) 8676-8686.
58. Ehlers,M.D., Zhang,S., Bernhadt,J.P., Huganir,R.L., Inactivation of NMDA receptors by direct interaction of calmodulin with the NR1 subunit, Cell, 84 (1996) 745-755.
59. Ehlers,M.D., Fung,E.T., O'Brien,R.J., Huganir,R.L., Splice variant-specific interaction of the NMDA receptor subunit NR1 with neuronal intermediate filaments, J. Neurosci., 18 (1998) 720-730.
60. Lin,J.W., Wyszynski,M., Madhavan,R., Sealock,R., Kim,J.U., Sheng,M., Yotiao, a novel protein of neuromuscular junction and brain that interacts with specific splice variants of NMDA receptor subunit NR1, J. Neurosci., 18 (1998) 2017-2027
61. Takai,H., Katayama,K., Uetsuka,K., Nakayama,H., Doi,K., Distribution of N-methyl-D-aspartate receptors (NMDARs) in the developing rat brain, Exp. Mol. Pathol., 75 (2003) 89-94.
62. Ishii,T., Moriyoshi,K., Sugihara,H., Sakurada,K., Kadotani,H., Yokoi,M., Akazawa,C., Shigemoto,R., Mizuno,N., Masu,M., ., Molecular characterization of the family of the N-methyl-D-aspartate receptor subunits, J. Biol. Chem., 268 (1993) 2836-2843.
63. Del Valle-Pinero,A.Y., Suckow,S.K., Zhou,Q., Perez,F.M., Verne,G.N., Caudle,R.M., Iadarola,M.J., Expression of the N-methyl-D-aspartate receptor NR1 splice variants and NR2 subunit subtypes in the rat colon, Neuroscience, 147 (2007) 164-173.
79
64. Lomax,A.E., O'Hara,J.R., Hyland,N.P., Mawe,G.M., Sharkey,K.A., Persistent alterations to enteric neural signaling in the guinea pig colon following the resolution of colitis, Am. J. Physiol Gastrointest. Liver Physiol, 292 (2007) G482-G491.
65. Zhou,Q., Price,D.D., Caudle,R.M., Verne,G.N., Visceral and somatic hypersensitivity in TNBS-induced colitis in rats, Dig. Dis. Sci., 53 (2008) 429-435.
66. Costa,M., Furness,J.B., Pompolo,S., Brookes,S.J., Bornstein,J.C., Bredt,D.S., Snyder,S.H., Projections and chemical coding of neurons with immunoreactivity for nitric oxide synthase in the guinea-pig small intestine, Neurosci. Lett., 148 (1992) 121-125.
67. Dalsgaard,C.J., Hokfelt,T., Schultzberg,M., Lundberg,J.M., Terenius,L., Dockray,G.J., Goldstein,M., Origin of peptide-containing fibers in the inferior mesenteric ganglion of the guinea-pig: immunohistochemical studies with antisera to substance P, enkephalin, vasoactive intestinal polypeptide, cholecystokinin and bombesin, Neuroscience, 9 (1983) 191-211.
68. Costa,M., Furness,J.B., The origins, pathways and terminations of neurons with VIP-like immunoreactivity in the guinea-pig small intestine, Neuroscience, 8 (1983) 665-676.
69. Barbiers,M., Timmermans,J.P., Scheuermann,D.W., Adriaensen,D., Mayer,B., Groodt-Lasseel,M.H., Nitric oxide synthase-containing neurons in the pig large intestine: topography, morphology, and viscerofugal projections, Microsc. Res. Tech., 29 (1994) 72-78.
70. Papka,R.E., McCurdy,J.R., Williams,S.J., Mayer,B., Marson,L., Platt,K.B., Parasympathetic preganglionic neurons in the spinal cord involved in uterine innervation are cholinergic and nitric oxide-containing, Anat. Rec., 241 (1995) 554-562.
71. Papka,R.E., McNeill,D.L., Thompson,D., Schmidt,H.H., Nitric oxide nerves in the uterus are parasympathetic, sensory, and contain neuropeptides, Cell Tissue Res., 279 (1995) 339-349.
72. Zhang,H., Yan,Y., Shi,R., Lin,Z., Wang,M., Lin,L., Correlation of gut hormones with irritable bowel syndrome, Digestion, 78 (2008) 72-76.
73. Hulten,L., Extrinsic nervous control of colonic motility and blood flow. An experimental study in the cat, Acta Physiol Scand. Suppl, 335 (1969) 1-116.
74. Rostad,H., Extrinsic and central nervous control of colonic motility. A survey of previous and new concepts based on experimental results, J. Oslo. City Hosp., 23 (1973) 65-75.
80
75. De Groat,W.C., Krier,J., The sacral parasympathetic reflex pathway regulating colonic motility and defaecation in the cat, J. Physiol, 276 (1978) 481-500.
76. Coutinho,S.V., Meller,S.T., Gebhart,G.F., Intracolonic zymosan produces visceral hyperalgesia in the rat that is mediated by spinal NMDA and non-NMDA receptors, Brain Res., 736 (1996) 7-15.
77. McRoberts,J.A., Coutinho,S.V., Marvizon,J.C., Grady,E.F., Tognetto,M., Sengupta,J.N., Ennes,H.S., Chaban,V.V., Amadesi,S., Creminon,C., Lanthorn,T., Geppetti,P., Bunnett,N.W., Mayer,E.A., Role of peripheral N-methyl-D-aspartate (NMDA) receptors in visceral nociception in rats, Gastroenterology, 120 (2001) 1737-1748.
78. Gaudreau,G.A., Plourde,V., Involvement of N-methyl-d-aspartate (NMDA) receptors in a rat model of visceral hypersensitivity, Behav. Brain Res., 150 (2004) 185-189.
79. Zhou,Q., Price,D.D., Caudle,R.M., Verne,G.N., Visceral and somatic hypersensitivity in a subset of rats following TNBS-induced colitis, Pain, 134 (2008) 9-15.
81
BIOGRAPHICAL SKETCH
Arseima Del Valle-Pinero was born in 1977 in San Juan, Puerto Rico. In 1995, she
was accepted into the Department of Natural Sciences of the University of Puerto Rico.
In 1997, Dr. Del Valle joined the laboratory of Dr. Jose A. Lasalde, as a research
assistant. From 1997 to 2000, she was awarded with undergraduate research funding from
the NSF- EPSCoR (National Science Foundation’s Experimental Program to Stimulate
Competitive Research), PR-AMP (Puerto Rico Alliance for Minority Participation),
R.I.S.E (Research Initiative for Scientific Enhancement Program) and the Howard
Hughes Program. In 2000, Arseima was the winner of the PR-AMP Academic Excellence
Award for Low Income Students. In June 2000, Arseima graduated from the University
of Puerto Rico with a Bachelor of Science degree.
To expand her academic horizons, Arseima decided to purse graduate studies in the
United States. She was accepted in August 2003 into the Ph.D. program at
Interdisciplinary Biomedical Sciences Program (IDP) of the College of Medicine at the
University of Florida. In 2004, she joined the laboratory of Dr. Robert Caudle. Since then
she has published several manuscripts and abstracts. In 1997, her paper entitled:
Expression of the N-methyl-D-aspartate receptor NR1 splice variants and NR2 subunit
subtypes in the rat colon, published in Neuroscience was featured in the cover of that
issue (147:1). Arseima was awarded in 2008 with the 2nd Place at the 6th Annual UFCD
Research Day Poster Competition. Also in 2008, she became the recipient of a Ruth L.
Kirschstein National Research Service Awards for Individual Predoctoral Fellowships to
Promote Diversity in Health-Related Research from the National Institute of Diabetes
and Digestive and Kidney Disease. Arseima obtained a Ph.D. in Biomedical Sciences in
August 2009 and plans on pursuing a post doctoral degree in the near future.