dna structure, function, replication lesson
TRANSCRIPT
Advanced Biology Plans for the week of January 9th through January 13th, 2017 o Monday 1-9-17: DNA replication and function lesson + model o Tuesday 1-10-17: Gene Expression Lesson o Wednesday 1-11-17: DNA Extraction Pre-Lab o Thursday 1-12-17: DNA Extraction Lab o Friday 1-13-17: Science Skills Lesson - Working with data in a table; DNA structure and function quiz
DNA structure, replication & function
What do you already know about the structure of DNA?
DNA REPLICATION
“It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetics material.
Replication = copying
When DNA is copied, the 2 strands break apart at the hydrogen bonds between the nitrogen bases
The exposed bases are a template for the new strand.
What are the base pairing rules?
At the end of replication there are 2 new DNA molecules that are exactly the same
Draw a diagram in your notebook
DNA replication is called semi-conservative replication
Each new molecule is 1/2 original DNA and 1/2 new DNA
Practice
DNA strand:ATGGCTTCTAAGGCTATCTACCGAAGATTCCGATAG
Write the complimentary strand
TACCGAAGATTCCGATAG
DNA FUNCTION
DNA/chromosomes contain regions called genes
Genes code for proteins Proteins carry out life processes and give an
organism it’s physical appearance
Different versions of genes are called alleles
Only about 1% of the DNA in a human are genes that code for proteins
What is the other 99% for?
Some DNA regulates genes Turns them on or off as needed
Lots of DNA appears to have no purpose
DNA replication model Work with a partner to:
Create a model of DNA during replication Clearly label the deoxyribose, phosphate, A, T, C
and G on your model Clearly show how some of the DNA is a coding
region called a gene and some of the DNA is non-coding