dna rafts

DR. MARYA LIEBERMANDR. KOSHALA SARVESWARAN

RENULA MITRA

DNA Rafts

Introduction

What is a DNA raft? Ds DNA composed of 4 tiles: A, B, C, D, each made of

16 oligonucleotides B’ and C’ have sticky ends, which connect to neighboring

rafts Each tile is made of 4 oligonucleotides: Red, Yellow,

Green, and Blue (hence, the 16 oligonucleotides) Known measurements:

Length: 37 nm Width: 8 nm Height: 2 nm

Diagram of DNA Raft

A

AGGTCGAGACAAGTCGTCCAGCTCTGTTCAGC

GATGCGGTCCCTTATCCATCGCCAGGGAATAG

AGGTGAAAGACCTCTGTCTTGTCCACTTTCTGGAGAC

TAGAGTGACCACCTTCCAAATACTGGTGGAAGCTTTA

AAGCACCCTTGCTTCGTTCGTGGGAACGAAGCATCTC

TATCGAGTCGGACAGGAGTGAATAGCTCAGCCAGTCC

GTTGTGTGGAGCACTTCAGCTGTAGGCGTGAAGTCGACATCC

GACCGAGGAAGCCACGCTGGCTCCTTCGGTGC

GATGGCGTCCGTTTACTCACTCTACCGCAGGCAAATG

AGTCGAGGACGGATCGTCAGCTCCTGCCTAGCCATAC

AGATAGCAGGCTACTGTCTATCGTCCGATGAC

GTAAGACCTGCGGTATCATTCTGGACGCCATA

GCTCTACAGGATCTGGAGAACCGAGATGTCCTAGACC

ATTCAACCTGTTGGCGCAACACACCTTAAGTTGGACAACCGC

GTATGGCGAACGGACAAGCCGCGCTTGCCTGTTCGGC

TGCAATGTCCTAACGGACGTTACAGGATTGCC

B’ C’

D

A









AAGCACCCTTGCTTCGTTCGTGGGAACGAAGCATCTC

TATCGAGTCGGACAGGAGTGAATAGCTCAGCCAGTCC
























B’ C’

D

Sticky end Sticky end

Introduction

Goal: to utilize DNA rafts in the creation of smaller circuit boards.

Why DNA? DNA self-assembly can be done with high specificity,

due to the order of base pairs and sticky ends. Rigidity- the double crossover molecule we use is very

strong. Availability of arbitrary sequences.

Hypothesis

If the specific AB’C’D DNA rafts are being imaged on mica, then they should show a pattern based on the chain length v. the time since the sample was prepared.

Procedure

Prepare DNA stock solution- 200 ul (adjusted from 100 ul) 5 ul of each of the 16 oligonucleotides 20 ul of Mg 2+/TAE 10x buffer (adjusted from 10 ul in

first stock solution) 100 ul of 18 mega ohm H20 (adjusted from 10 ul in first

solution)Anneal solution (heat solution to 90 degrees

Celsius, then cool to 20 degrees Celsius overnight)Pipette 2 ul of DNA solution and 8 ul

Mg 2+/TAE 1x buffer into Eppendorff tube and mix

Procedure, 2

Clean mica Peel off 2 layers with tape “Vigorously rinse” with 18 mega ohm water Dry with nitrogen gas

Deposit the 10 ul from Eppendorff tube onto surface Deposition time: 3 minutes

“Vigorously rinse” with 18 mega ohm waterDry with nitrogen gasPlace on puck with double-sided tape and view

under AFM

Results

First stock solution Image results very variable, no consistency Formation of networks

See following slides for images

June 24, 2008

20 ul of 0.1mM solution on mica

Deposition time: 5 minutes

10 ul of 0.1 mM solution on mica


June 27, 2008** Didn’t make homogenous solution before depositing on mica surface

0.1 mM solution diluted further- used 5 ul of solution + 5 ul of Mg 2+/TAE 1x buffer


June 30, 2008** was made with a homogenous solution before deposition

0.1 mM solution diluted further- used 5 ul of solution + 5 ul of Mg 2+/TAE 1x buffer


June 30, 2008

The dreaded networks…

July 1, 2008** didn’t rinse mica with water before DNA deposition (as with all the other previous samples)

10 ul 0.05 mM solution (made with new stock solution) on mica


July 1, 2008

Same preparation as the last image.

How the problem was fixed….

By rinsing the mica (in its cleaning process) with 18 mega ohm water and drying with nitrogen gas before depositing the DNA, the networks were eliminated.

From this time onward, every mica sample was washed with 18 mega ohm water and dried with nitrogen gas before DNA deposition.

Additionally, different volumes of DNA solution were mixed with the 1x buffer.

July 10, 2008** Started seeing chains, so thought of diluting a bit more next time to spread molecules farther apart.

0.05 solution further diluted- this is 3 ul of DNA solution + 7 ul of Mg 2+/TAE 1x buffer


Further Adjustments

As I was making samples, diluting DNA further with 1x buffer seemed to produce better images, so I decided to take it to 2 ul of DNA solution + 8 ul of buffer

Rinsing the mica with 18 mega ohm water before deposition was still executed

Made a new stock solution, 0.05 mM 80 ul of DNA (5 ul of each oligonucleotide) 20 ul of Mg 2+/TAE 10x buffer 100 ul of 18 mega ohm water

The following images were made from the new stock solution, composed of 2 ul of that solution + 8 ul of 1x buffer, and were rinsed with 18 mega ohm water before the DNA was deposited.

Section Analysis

Took horizontal measurements of 102 particles Total distance: 3779.814 nm Average 3779.814 nm/102 particles = 37.057

nm/particle Matches very closely with the known measurement of a

DNA raft, which is 37 nm

Vertical distance measurements Total distance: 132.429 nm Average 132.429nm/102 particles = ~1.298 nm

Conclusion

During the course of my time at Notre Dame, I learned a great deal. First, I realized that 2 hours after school is hardly enough time to accomplish anything in research, and that 5-6 hours (at least) must be devoted to it each day. But, more importantly, I understand that it can take many weeks, and even months and years, to accomplish a goal in research. One must have patience, and be meticulous in journal entries, because every detail may be a clue to the answer. Additionally, I was very relieved, I must confess, that my particle measurements were consistent with published results. It was also extremely exciting, because now I feel that I can move on to the next part of the project, or at least I feel that I am ready to. I have only finished the foundation work and have a long way to go. Next, we will have to identify patterns of the DNA raft length v. the time since the sample has been prepared. This has been a great experience for me, and I am grateful for the opportunity to continue the research at Notre Dame.

I am also sorry that I cannot present this PowerPoint today, but this illness came upon me so suddenly and I am still dizzy and nauseated. I will resume research once school starts, as I am going to be out of town from this Friday. Enjoy the rest of the summer!

dna rafts

Technology

ul of solution

ul of dna solution

ul of buffer

dna stock solution

solution heat solution

dna deposition

homogenous solution

diluting dna