dna history, components, function, replication, & biotechnology nancy dow jill hansen tammy...
TRANSCRIPT
DNAHistory, Components, Function, Replication, & Biotechnology
Nancy DowJill Hansen
Tammy Stundon
September 29, 2012Gulf Coast State College Panhandle Area Educational Consortium
5230 West Highway 98 753 West Boulevard
Panama City, Florida 32401 Chipley, Florida 32428
850-769-1551 877-873-7232
www.gulfcoast.edu
Biology Partnership
(A Teacher Quality Grant)
Pre-testQ and A boardWhat is DNA?
How do we use DNA?
Does everything have the same DNA?What is alike and what is different about it?
Florida Next Generation Sunshine State Standards
SC.912.L.16.3 Describe the basic process of DNA replication and how it relates to the transmission and conservation of the genetic information.
Also Assesses SC.912.L.16.4 Explain how mutations in the DNA sequence mayor may not result in phenotypic change. Explain how mutations in gametes may result in phenotypic changes in offspring. (will begin today but will define phenotype until the genetics session)
SC.912.L.16.5 Explain the basic processes of transcription and
translation, and how they result in the expression of genes. (next session)
SC.912.L.16.9 Explain how and why the genetic code is universal
and is common to almost all organisms
Florida Next Generation Sunshine State Standards
Benchmark Clarifications•Students will describe the process of DNA replication and/or its role in the transmission and conservation of genetic information.•Students will describe gene and chromosomal mutations in the DNA sequence.•Students will explain how gene and chromosomal mutations may or may not result in a phenotypic change.•Students will explain the basic processes of transcription and/or•translation, and their roles in the expression of genes.
Florida Next Generation Sunshine State Standards
Clarifications•Students will explain that the basic components of DNA areuniversal in organisms.•Students will explain how similarities in the genetic codes oforganisms are due to common ancestry and the process of inheritance.
Content Limits Items requiring the analysis of base pairs for gene mutations are meiosis.•Items will not require memorization of specific conditions resulting rom chromosomal mutations.•Items may refer to the process of meiosis in the context of mutations but will not assess meiosis in isolation
Florida Next Generation Sunshine State Standards
SC.912.L.16.10 Evaluate the impact of biotechnology on the individual, society and the environment, including medical and ethical issues. Clarification•Students will evaluate examples and/or explain the possible impact of biotechnology on the individual, society, and/or the environment.Content Limits •Items may assess current issues but will not require knowledge of specific biotechnologies or specific medical issues.•Items assessing the possible impacts of biotechnology will not assess monetary impacts.
Carbon molecule needs how many bonds
to be stable?
Macromolecules1.Carbohydrates2.Proteins3.Nucleic Acids• Functions• Examples
What is the easiest bond to break?
DNA stands for deoxyribonucleic acid.
DNA double helixes are organized into 23 pairs of chromosomes in every cell in your
body.
This set of chromosomes is the instruction manual to make YOU.
Each different instruction is called a gene.
The gene instructions are written in a DNA code – the genetic code.
New coded copies are made when the DNA double helix unzips down the middle.
We have to clearly distinguish for the
kids various terms that involve DNA Chromatin
Chromatid
Sister Chromatid
Chromosome
DNA into Chromosomes-I show this at least twice (start and end) with no volume
Human Onion
Newt
Fruit fly
Amoeba
BACTERIA
ARCHAEA
PROTISTS
PLANTS
FUNGI
ANIMALS
DNA HELPS TO SHOWEVOLUTIONARY
RELATIONSHIPS OF ORGANISMS
Watson and Crick, on the right determined in the 1950’s that DNA was a “Double Helix’ that was twisted. Watson later led the work on the human genome project.
Dr. Watson's Funny Story
• Watson and Crick’s discovery built on the work of Rosalind Franklin and Erwin Chargaff.
– Franklin’s x-ray images suggested that DNA was a double helix of even width.
– Chargaff’s rules stated that A=T and C=G.
GENOMEAn organism’s complete set of DNA. In eukaryotes, this information can be found in the nucleus of virtually every cell.
CHROMOSOMEOne or more unique pieces ofDNA—circular in prokaryotes, linear in eukaryotes—that together make up an organism's genome. Chromosomes vary in length and can consist of hundreds of millions of base pairs.
GENEA specific sequence of DNA,on average about 3,000 bases long, that contains the information necessary to produce all or part of a protein molecule.
Humans have 23 unique chromosomes and we have two copies of each: one from our mother and one from our father, for a total of 46).
Eukaryotic cellNucleus
FROM GENOME TO GENE
Protein
Protein production
• DNA is made up of nucleotides
• Nucleotides are made up of:– Phosphate– Sugar– Nitrogenous base – the base can vary
4 Nitrogenous basesFound in DNA -Adenine (A) -Thymine (T) -Cytosine (C) -Guanine (G)
DNA structure
Every living thing has the SAME 4 bases!
Every 3 bases = a code = amino acid!
• The two strands are connected by hydrogen bonds between the nitrogen bases
• Nitrogen bases combine in a particular way
-A combines with T-G combines with C
DNA structureComplementary Base Pairing (Base Pair Rule)
•DNA is double stranded.
•The two chains or strands of nucleotides twist around one another.
DNA structure
Note: chromatids vs sister chromatids
The DNA inside the nucleus controls the production of proteins.
Where does protein synthesis occur?- ribosomes in cytoplasm and
rough ERHow does information from the nucleus get into the cytoplasm so that protein synthesis can occur?
-RNA
What happens to DNA ?
DNA (replication- once in every cell cycle)
DNA (TRANSCRIPTION)
RNA
(TRANSLATION)
Proteins
What happens to DNA ?
DNA replication-- DNA duplicates itself during interphase of cell cycle- S stage of Interphase (in nucleus) - Chromatin Chromatids replication strands (sister chromatids)
- “normal functions” of the cell stop - Steps of cell division follow
(More info in a session this fall) transcription & translation – Steps of protein synthesis (next session!)- during G1 of interphase
What happens to DNA ?
• DNA molecule uncoils and unzips (DNA Polymerase) – Nucleotides are fit into place on each of the parent strand
– Corrects base pair errors too
• Each parent strand is a template to form a complementary strand
• Each THREE base pairs is the DNA’s Code
DNA Replication
DNA Replication Yield:–2 double stranded DNA molecules identical to each other
–Half of each double helix is new (daughter strand) and half is the original (parent strand)
DNA Replication
DNA replication
Mistakes. . . . .• Parent strands act as templates, so mistakes during replication are minimized
• Each cell has repair enzymes that repair the damage
• An error that persists is a mutation
Mistakes. . . . .OOOPS!. . . .estimated that one error is made for every 2x109 nucleotides
DNA replicationBUT. . .
Human cells contains 46 chromosomes consisting of 3 billion base pairs
. . . . .that averages to five errors per cell!!!!
Damage to the DNA code can cause changes to protein production
TYPES OF MUTATIONS
BASE-PAIR SUBSTITUTION
BASE-PAIR INSERTION
BASE-PAIR
DELETION
GENE DELETION
GENE RELOCATION
GENE DUPLICATION
NormalDNAmRNANormalprotein
DNA
mRNAMutatedprotein
DNA
mRNAMutatedprotein
DNAmRNAMutatedprotein
POINT MUTATIONS CHROMOSOMALABERRATIONS
Normal chromosome
Gene 2
Gene 1
Gene 3
Gene 1
Gene 3
Gene 2
Gene 3
Gene 2
Gene 3
Gene 2DELETED
Gene 1 RELOCATED to a different chromosome
Gene 1DUPLICATED
Insertions and deletions can be much more harmful than substitutions because they can alter the reading frame for the rest of the gene.
In point mutations, one base pair is changed, whereas in chromosomal aberrations, entire sections of a chromosome are altered.
Some mutations are harmless, some beneficial, others are neutral, others can be detrimental or fatal to the organism.
Mutations on DNA can be the result of various causes (UV
rays, radiation, chemicals like nicotine) or can be
spontaneous.
When DNA is a detective ...
An introduction into biotechnology… will go into more detail over various techniques in future sessions
•Genetic engineering –def: use of technology to alter the genes of viruses, bacteria, and other cells for medical or industrial purposes to better the quality of life
–Altering genes of unicellular organisms and plants and animals
Biotechnology
Recombinant DNA (rDNA) Technology
Ex. Human genes can be spliced into the DNA of bacteria to produce insulin
Combination of genes from 2 different organisms
• bacteria that eat oil are engineered to do better
• recombinant bacteria used to extract copper, uranium, gold from low-grade sources
• recombinant bacteria used to extract sulfur from coal before it is burned
More rDNA:Manipulating the DNA of
bacteria
• DNA extracted from blood and sperm can be cut by restriction enzymes– enzyme cuts at a particular base sequence
– since everyone’s DNA is different, different lengths of DNA are created when you use the same restriction enzyme on different DNA
DNA fingerprinting
Person 1: ACTGTGTGTATGGGATGTGACACACTTCCTCACTGTCATACCCTACACTGTGTGAAGG
Person 2: ACTGTGTGATGTGACACACTACGGGTTCCTCACTGTCTACACTGTGTGATGCCCAAGG
Bt CORNBacterium (Bacillus thuringiensis)
Bt crystal gene
Corn genomePlant cell
Bt crystals—toxic to insect pests—are now produced by the corn plantitself, reducing the amount ofpesticides the farmer must use.
Bacterial gene coding for Btcrystals, which are poisonous tothe insect pests, is inserteddirectly into the corn plant’s DNA.
Corn plant destroyedby insect pests
1 2 3
Manipulating the DNA
GOLDEN RICE
Genes in the pathway forbeta-carotene productionare introduced into thewhite rice genome.
Almost 10% of the world’s people suffer from vitamin A deficiencies—leading to 250,00 cases of blindness each year. The addition of beta-carotene-producing genes to white rice has increased its vitamin A content almost 25-fold.
Daffodil Bacteria
White rice
Beta-carotene
Golden rice
Manipulating the
DNA
GENETICALLY MODIFIED CROPS IN THE UNITED STATES
Proportion of crops that are not genetically modifiedProportion of crops that are genetically modified
Corn Cotton Soybeans
55% 45% 76%24% 15%85%
Manipulating the DNA
Commonly called GM Foods
rDNA of animalsCloning - produce a copy of a gene
Organ Transplant - across speciesGene Therapy – insert a missing piece of DNA to cure a person of a disease.
Other types/examples of Biotechnology
More in other sessions!
Caught by a Kiss!
Crime Scene
Using enzyme amylase
Isolate DNA evidence from saliva
Forensic Science!
Ready to use what you know in the ‘real world’?
Dr. Watson explaining base pairing National DNA teaching Day
DNA interactive
DDC Education CenterFamily portrait interactiveBeaded DNA braceletOrigami DNA double Helix