dna final report
TRANSCRIPT
-
7/29/2019 Dna Final Report
1/36
1. Introduction
Computer chip manufacturers are furiously racing to make the next
microprocessor that will topple speed records. Sooner or later, though, thiscompetition is bound to hit a wall. Microprocessors made of silicon will
eventually reach their limits of speed and miniaturization. Chip makers need
a new material to produce faster computing speeds.
Scientists have found the new material they need to build the next
generation of microprocessors. Millions of natural supercomputers exist
inside living organisms, including your body. DNA (deoxyribonucleic acid)molecules, the material our genes are made of, have the potential to perform
calculations many times faster than the world's most powerful human-built
computers. DNA might one day be integrated into a computer chip to create
a so-called biochip that will push computers even faster. DNA molecules
have already been harnessed to perform complex mathematical problems.
Despite their respective complexities, biological and mathematical
operations have some similarities:
The very complex structure of a living being
is the result of applying simple operations to initial
information encoded in a DNA sequence.
The very complex structure of a living being
is the result of applying simple operations toinitial information encoded in a DNA sequence
(genes).
All complex math problems can be reduced
to simple operations like addition and subtraction.
-
7/29/2019 Dna Final Report
2/36
For the same reasons that DNA was presumably selected for living
organisms as a genetic material, its stability and predictability in reactions,
DNA strings can also be used to encode information for mathematical
systems.
Human DNA
While still in their infancy, DNA computers will be capable of
storing billions of times more data than your personal computer. Scientists
are using genetic material to create nano-computers that might take the place
of silicon-based computers in the next decade.
Israeli scientists have built a DNA computer so tiny that a trillion of
them could fit in a test tube and perform a billion operations per second with
99.8 percent accuracy.
Instead of using figures and formulas to solve a problem, the
microscopic computer's input, output and software are made up of DNA
-
7/29/2019 Dna Final Report
3/36
molecules -- which store and process encoded information in living
organisms.
Scientists see such DNA computers as future competitors to for their
more conventional cousins because miniaturization is reaching its limits and
DNA has the potential to be much faster than conventional computers.
"We have built a nanoscale computer made of biomolecules that is so
small you cannot run them one at a time. When a trillion computers run
together they are capable of performing a billion operations," Professor
Ehud Shapiro of the Weizmann Institute in Israel told.
It is the first programmable autonomous computing machine in which
the input, output, software and hardware are all made of biomolecules.
Although too simple to have any immediate applications it could form
the basis of a DNA computer in the future that could potentially operate
within human cells and act as a monitoring device to detect potentially
disease-causing changes and synthesize drugs to fix them.
The model could also form the basis of computers that could be used
to screen DNA libraries in parallel without sequencing each molecule, which
could speed up the acquisition of knowledge about DNA.
-
7/29/2019 Dna Final Report
4/36
-
7/29/2019 Dna Final Report
5/36
When it is all mixed together in the test tube, the software and
hardware operate on the input molecule to create the output.
The DNA computer also has very low energy consumption, so if it is
put inside the cell it would not require much energy to work.
DNA computing is a very young branch of science that started less
than a decade ago, when Leonard Adleman of the University of Southern
California pioneered the field by using DNA in a test tube to solve a
mathematical problem.
Scientists around the globe are now trying to marry computer
technology and biology by using nature's own design to process information.
DNA to Chip formation
-
7/29/2019 Dna Final Report
6/36
Scientific Idea Of DNA Computer
For biological systems, DNA is a master problem solver, storing and
manipulating prodigious amounts of information. Recently, researchers have
been investigating whether the problem-solving power of DNA can be used
to solve nonbiological problems, specifically, problems from computer
science that are out of the reach of traditional computers. Would a DNA
computer actually work? To answer this question, one must turn to
mathematics.
In a groundbreaking 1994 paper, Leonard Adleman described a
laboratory experiment involving DNA and a problem known as the Directed
Hamiltonian Path Problem. Because of their massive complexity, this problem and others like it have eluded solution by conventional computers;
no known algorithm can solve them in a reasonable amount of time. DNA
has the potential to solve these kinds of problems because of its capacity to
store a great deal of information compactly and to speedily perform
-
7/29/2019 Dna Final Report
7/36
-
7/29/2019 Dna Final Report
8/36
Information Storage In DNA
For traditional computers, these two questions have been answered
affirmatively. And this is why traditional computers work: What they do can
be represented mathematically and proven to produce the right answers.
Fuses may blow, screens may freeze up, and the Pentium chip might be
faulty, but the underlying mathematics is flawless. What the DNA computer
needed was similar mathematical bedrock. Happily for the investment
capitalists, mathematicians have provided the proof.
These results lift the DNA computer out of the realm of science
fiction and put it on a firm mathematical foundation.
-
7/29/2019 Dna Final Report
9/36
-
7/29/2019 Dna Final Report
10/36
-
7/29/2019 Dna Final Report
11/36
First Invented DNA Chip
DNA computer components -- logic gates and biochips -- will take
years to develop into a practical, workable DNA computer. If such a
computer is ever built, scientists say that it will be more compact, accurateand efficient than conventional computers. In the next section, we'll look at
how DNA computers could surpass their silicon-based predecessors, and
what tasks these computers would perform.
-
7/29/2019 Dna Final Report
12/36
4. The Experiment
The Adleman experiment
Adleman is often called the inventor of DNA computers. His article in
a 1994 issue of the journal Science outlined how to use DNA to solve a
well-known mathematical problem, called the directed Hamilton Path
problem , also known as the "traveling salesman" problem. The goal of the
problem is to find the shortest route between a numbers of cities, going
through each city only once. As you add more cities to the problem, the
problem becomes more difficult. Adleman chose to find the shortest route between seven cities.
Directed Hamilton Path problem
You could probably draw this problem out on paper and come to a
solution faster than Adleman did using his DNA test-tube computer. Here
are the steps taken in the Adleman DNA computer experiment:
-
7/29/2019 Dna Final Report
13/36
1. Strands of DNA represent the seven cities. In genes,
genetic coding is represented by the letters A, T, C and
G. Some sequence of these four letters represented each
city and possible flight path.2. These molecules are then mixed in a test tube, with some
of these DNA strands sticking together. A chain of these
strands represents a possible answer.
3. Within a few seconds, all of the possible combinations of
DNA strands, which represent answers, are created in the
test tube.
4. Adleman eliminates the wrong molecules through
chemical reactions, which leaves behind only the flight
paths that connect all seven cities.
There is no better way to understand how something works than by
going through an example step by step. So lets solve our own directed
Hamiltonian Path problem, using the DNA methods demonstrated by
Adleman. The concepts are the same but the example has been simplified to
make it easier to follow and present.
Suppose that I need to visit four cities: Houston, Chicago, Miami, and
NY, with NY being my final destination. The airline Im taking has aspecific set of connecting flights that restrict which routes I can take (i.e.
there is a flight from L.A. to Chicago, but no flight from Miami to Chicago).
What should my itinerary be if I want to visit each city only once?
-
7/29/2019 Dna Final Report
14/36
It should take you only a moment to see that there is only one route.
Starting from L.A. you need to fly to Chicago, Dallas, Miami and then to
N.Y. Any other choice of cities will force you to miss a destination, visit a
city twice, or not make it to N.Y. For this example you obviously dont need
the help of a computer to find a solution. For six, seven, or even eight cities,
the problem is still manageable. However, as the number of cities increases,
the problem quickly gets out of hand. Assuming a random distribution of
connecting routes, the number of itineraries you need to check increases
exponentially. Pretty soon you will run out of pen and paper listing all the
possible routes, and it becomes a problem for a computer......or perhaps
DNA. The method Adleman used to solve this problem is basically the
shotgun approach mentioned previously. He first generated all the possible
itineraries and then selected the correct itinerary. This is the advantage of
DNA. Its small and there are combinatorial techniques that can quickly
generate many different data strings. Since the enzymes work on many DNAmolecules at once, the selection process is massively parallel.
When the number of cities gets to around one hundred it could take
hundreds of years of conventional computer time to solve the problem, even
with the most advanced parallel processing available.
Adleman developed a method of manipulating DNA which, in effect,
conducts trillions of computations in parallel. Essentially he coded each city
and each possible flight as a sequence of 4 components. For example he
coded one city as GCAG and another as TCGG.
-
7/29/2019 Dna Final Report
15/36
Giving cities codes
Specifically, the method based on Adlemans experiment would be as
follows:
1. Generate all possible routes.2. Select itineraries that start with the proper city and end
with the final city.
3. Select itineraries with the correct number of cities.
4. Select itineraries that contain each city only once.
Part I: Generate all possible routes
Strategy : Encode city names in short DNA sequences. Encode
itineraries by connecting the city sequences for which routes exist.
-
7/29/2019 Dna Final Report
16/36
DNA can simply be treated as a string of data. For example, each city
can be represented by a "word" of six bases:
1. Los Angeles GCTACG
2. Chicago CTAGTA
3. Dallas TCGTAC
4. Miami CTACGG
5. New York ATGCCG
The entire itinerary can be encoded by simply stringing together these
DNA sequences that represent specific cities. For example, the route from
L.A -> Chicago -> Dallas -> Miami -> New York would simply be
GCTACGCTAGTATCGTACCTACGGATGCCG, or equivalently it could
be represented in double stranded form with its complement sequence.
So how do we generate this? Synthesizing short single stranded DNA
is now a routine process, so encoding the city names is straightforward. The
molecules can be made by a machine called a DNA synthesizer or even
custom ordered from a third party. Itineraries can then be produced from the
city encodings by linking them together in proper order. To accomplish this
you can take advantage of the fact that DNA hybridizes with its
complimentary sequence. For example, you can encode the routes between
cities by encoding the compliment of the second half (last three letters) of
the departure city and the first half (first three letters) of the arrival city. For
example the route between Miami (CTACGG) and NY (ATGCCG) can be
made by taking the second half of the coding for Miami (CGG) and the first
half of the coding for NY (ATG). This gives CGGATG. By taking the
complement of this you get, GCCTAC, which not only uniquely represents
-
7/29/2019 Dna Final Report
17/36
the route from Miami to NY, but will connect the DNA representing Miami
and NY by hybridizing itself to the second half of the code representing
Miami (...CGG) and the first half of the code representing NY (ATG...). For
example:
Random itineraries can be made by mixing city encodings with the
route encodings. Finally, the DNA strands can be connected together by an
enzyme called ligase . What we are left with are strands of DNA representing
itineraries with a random number of cities and random set of routes. For
example:
We can be confident that we have all possible combinations including
the correct one by using an excess of DNA encodings, say 10^13 copies of
each city and each route between cities. Remember DNA is a highly
compact data format, so numbers are on our side.
Part II: Select itineraries that start and end with the correct cities
Strategy : Selectively copy and amplify only the section of the DNA
that starts with LA and ends with NY by using the Polymerase Chain
Reaction .
After Part I , we now have a test tube full of various lengths of DNA
that encode possible routes between cities. What we want are routes that
start with LA and end with NY. To accomplish this we can use a techniquecalled Polymerase Chain Reaction (PCR), which allows you to produce
many copies of a specific sequence of DNA. PCR is an iterative process that
cycles through a series of copying events using an enzyme called
polymerase . Polymerase will copy a section of single stranded DNA
-
7/29/2019 Dna Final Report
18/36
starting at the position of a primer , a short piece of DNA complimentary to
one end of a section of the DNA that you're interested in. By selecting
primers that flank the section of DNA you want to amplify, the polymerase
preferentially amplifies the DNA between these primers, doubling theamount of DNA containing this sequence. After many iterations of PCR, the
DNA you're working on is amplified exponentially. So to selectively
amplify the itineraries that start and stop with our cities of interest, we use
primers that are complimentary to LA and NY. What we end up with after
PCR is a test tube full of double stranded DNA of various lengths, encoding
itineraries that start with LA and end with NY.
Part III: Select itineraries that contain the correct number of
cities.
Strategy : Sort the DNA by length and select the DNA whose length
corresponds to 5 cities.
Our test tube is now filled with DNA encoded itineraries that start
with LA and end with NY, where the number of cities in between LA and
NY varies. We now want to select those itineraries that are five cities long.
To accomplish this we can use a technique called Gel Electrophoresis ,
which is a common procedure used to resolve the size of DNA. The basic
principle behind Gel Electrophoresis is to force DNA through a gel matrix
by using an electric field. DNA is a negatively charged molecule under mostconditions, so if placed in an electric field it will be attracted to the positive
potential. However since the charge density of DNA is constant (charge per
length) long pieces of DNA move as fast as short pieces when suspended in
a fluid. This is why you use a gel matrix. The gel is made up of a polymer
-
7/29/2019 Dna Final Report
19/36
that forms a meshwork of linked strands. The DNA now is forced to thread
its way through the tiny spaces between these strands, which slows down the
DNA at different rates depending on its length. What we typically end up
with after running a gel is a series of DNA bands, with each bandcorresponding to a certain length. We can then simply cut out the band of
interest to isolate DNA of a specific length. Since we known that each city is
encoded with 6 base pairs of DNA, knowing the length of the itinerary gives
us the number of cities. In this case we would isolate the DNA that was 30
base pairs long (5 cities times 6 base pairs).
Part IV: Select itineraries that have a complete set of cities
Strategy : Successively filter the DNA molecules by city, one city at a
time. Since the DNA we start with contains five cities, we will be left with
strands that encode each city once.
DNA containing a specific sequence can be purified from a sample of
mixed DNA by a technique called affinity purification . This is
accomplished by attaching the compliment of the sequence in question to a
substrate like a magnetic bead. The beads are then mixed with the DNA.
DNA, which contains the sequence you're after then hybridizes with the
complement sequence on the beads. These beads can then be retrieved and
the DNA isolated.
So we now affinity purifies fives times, using a different city
complement for each run. For example, for the first run we use L.A.'-beads
(where the ' indicates compliment strand) to fish out DNA sequences which
contain the encoding for L.A. (which should be all the DNA because of step
-
7/29/2019 Dna Final Report
20/36
3), the next run we use Dallas'-beads, and then Chicago'-beads, Miami'-
beads, and finally NY'-beads. The order isnt important. If an itinerary is
missing a city, then it will not be "fished out" during one of the runs and will
be removed from the candidate pool. What we are left with are the itinerariesthat start in LA, visit each city once, and end in NY. This is exactly what we
are looking for. If the answer exists we would retrieve it at this step.
Reading out the answer
One possible way to find the result would be to simply sequence the
DNA strands. However, since we already have the sequence of the cityencodings we can use an alternate method called graduated PCR . Here we
do a series of PCR amplifications using the primer corresponding to L.A.,
with a different primer for each city in succession. By measuring the various
lengths of DNA for each PCR product we can piece together the final
sequence of cities in our itinerary. For example, we know that the DNA
itinerary starts with LA and is 30 base pairs long, so if the PCR product for
the LA and Dallas primers was 24 base pairs long, you know Dallas is the
fourth city in the itinerary (24 divided by 6). Finally, if we were careful in
our DNA manipulations the only DNA left in our test tube should be DNA
itinerary encoding LA, Chicago, Miami, Dallas, and NY. So if the
succession of primers used is LA & Chicago, LA & Miami, LA & Dallas,
and LA & NY, then we would get PCR products with lengths 12, 18, 24, and
30 base pairs.
The incredible thing is that once the DNA sequences had been created
he simply "just added water" to initiate the "computation". The DNA strands
then began their highly efficient process of creating new sequences based on
-
7/29/2019 Dna Final Report
21/36
the input sequences.
If an "answer" to the problem for a given set of inputs existed then it
should amongst these trillions of sequences. The next (difficult) step was to
isolate the "answer" sequences. To do this Adleman used a range of DNAtools. For example, one technique can test for the correct start and end
sequences, indicating that the strand has a solution for the start and end
cities. Another step involved selecting only those strands which have the
correct length, based on the total number of cities in the problem
(remembering that each city is visited once).
Finally another technique was used to determine if the sequence for each
city was included in the strand. If any strands were left after these processes
then:
A solution to the problem existed, and
The answer(s) would be in the sequence(s)
on the remaining strands.
His attempt at solving a seven-city, 14 flight map took seven days of
lab work. This particular problem can be manually solved in a few minutes
but the key point about Adleman's work is that it will work on a much larger
scale, when manual or conventional computing techniques become
overwhelmed. "The DNA computer provides enormous parallelism... in one
fiftieth of a teaspoon of solution approximately 10 to the power 14 DNA
'flight numbers' were simultaneously concatenated in about one second".
-
7/29/2019 Dna Final Report
22/36
Caveats
Adleman's experiment solved a seven city problem, but there are two
major shortcomings preventing a large scaling up of his computation. The
complexity of the traveling salesman problem simply doesnt disappear
when applying a different method of solution - it still increases
exponentially. For Adlemans method, what scales exponentially is not the
computing time, but rather the amount of DNA. Unfortunately this places
some hard restrictions on the number of cities that can be solved; after the
Adleman article was published, more than a few people have pointed out
that using his method to solve a 200 city HP problem would take an amount
of DNA that weighed more than the earth. Another factor that places limits
on his method is the error rate for each operation. Since these operations are
not deterministic but stochastically driven (we are doing chemistry here),
each step contains statistical errors, limiting the number of iterations you can
do successively before the probability of producing an error becomes greater
than producing the correct result. For example an error rate of 1% is fine for 10 iterations, giving less than 10% error, but after 100 iterations this error
grows to 63%.
Conclusions of Experiment
So will DNA ever be used to solve a traveling salesman problem with
a higher number of cities than can be done with traditional computers? Well,considering that the record is a whopping 13,509 cities, it certainly will not
be done with the procedure described above. It took this group only three
months, using three Digital Alpha Server 4100s (a total of 12 processors)
and a cluster of 32 Pentium-II PCs. The solution was possible not because of
-
7/29/2019 Dna Final Report
23/36
brute force computing power, but because they used some very efficient
branching rules. This first demonstration of DNA computing used a rather
unsophisticated algorithm, but as the formalism of DNA computing becomes
refined, new algorithms perhaps will one day allow DNA to overtakeconventional computation and set a new record.
On the side of the "hardware" (or should I say "wetware"),
improvements in biotechnology are happening at a rate similar to the
advances made in the semiconductor industry. For instance, look at
sequencing ; what once took a graduate student 5 years to do for a PhD
thesis takes Celera just one day. With the amount of government funded
research dollars flowing into genetic-related R&D and with the large
potential payoffs from the lucrative pharmaceutical and medical-related
markets, this isn't surprising. Just look at the number of advances in DNA-
related technology that happened in the last five years. Today we have not
one but several companies making "DNA chips," where DNA strands are
attached to a silicon substrate in large arrays (for example Affymetrix's genechip). Production technology of MEMS is advancing rapidly, allowing for
novel integrated small scale DNA processing devices. The Human Genome
Project is producing rapid innovations in sequencing technology. The future
of DNA manipulation is speed, automation, and miniaturization.
And of course we are talking about DNA here, the genetic code of life
itself. It certainly has been the molecule of this century and most likely the
next one. Considering all the attention that DNA has garnered, it isnt too
hard to imagine that one day we might have the tools and talent to produce a
small integrated desktop machine that uses DNA, or a DNA-like
biopolymer, as a computing substrate along with set of designer enzymes.
http://www.affymetrix.com/http://www.affymetrix.com/ -
7/29/2019 Dna Final Report
24/36
Perhaps it wont be used to play Quake IV or surf the web -- things that
traditional computers are good at -- but it certainly might be used in the
study of logic, encryption, genetic programming and algorithms, automata,
language systems, and lots of other interesting things that haven't even beeninvented yet.
The Restricted Model:
Since Adleman's original experiment, several methods to reduce error
and improve efficiency have been developed. The problems with
implementing a DNA computer can be separated into two types:
o Physical obstructions: difficulties with large scale
systems and coping with errors
o Logical obstructions: concerning the versatility of
molecular computers and their capacity to
efficiently accommodate a wide variety of
computational problems
The Restricted model of DNA computing solves several physical
problems with the unrestricted model. The Restricted model simplifies the
physical obstructions in exchange for some additional logical considerations.
The purpose of this restructuring is to simplify biochemical operations and
reduce the errors due to physical obstructions.
-
7/29/2019 Dna Final Report
25/36
The Restricted model of DNA computing:
o Separate: isolate a subset of DNA from a sample
o Merging: pour two test tubes into one to perform
union
o Detection: Confirm presence/absence of DNA in a
given test tube
Despite these restrictions, this model can still solve NP-complete
problems such as the 3-colourability problem, which decides if a map can be
colored with three colors in such a way that no two adjacent territories havethe same color.
Certain assumptions must be made about the oligonucleotides used in
the manipulations:
o Under easily achievable conditions (temperature,
pH, etc.) each oligonucleotide reliably forms stable
hybrids with its Watson-Crick complement
o Under easily achievable conditions, each
oligonucleotide reliably dissociates from its
Watson-Crick complement
o Under neither of the conditions above does any
oligonucleotide form hybrids with itself or another
oligonucleotide (except its complement), nor
another oligonucleotide's Watson-Crick
complement
-
7/29/2019 Dna Final Report
26/36
Error control is achieved mainly through logical operations, such as
running all DNA samples showing positive results a second time to reduce
false positives. Some molecular proposals, such as using DNA with a
peptide backbone for stability, have also been recommended.
-
7/29/2019 Dna Final Report
27/36
Sequence of DNA Representation
-
7/29/2019 Dna Final Report
28/36
Image of DNA representation
Bit Representation Using DNA
-
7/29/2019 Dna Final Report
29/36
-
7/29/2019 Dna Final Report
30/36
6. Comparison of DNA & Silicon
DNA, with its unique data structure and ability to perform many
parallel operations, allows you to look at a computational problem from a
different point of view. Transistor-based computers typically handle
operations in a sequential manner. Of course there are multi-processor
computers, and modern CPUs incorporate some parallel processing, but in
general, in the basic von Neumann architecture computer, instructions are
handled sequentially. A von Neumann machine, which is what all modernCPUs are, basically repeats the same "fetch and execute cycle" over and
over again; it fetches an instruction and the appropriate data from main
memory, and it executes the instruction. It does these many, many times in a
row, really, really fast. The great Richard Feynman, in his Lectures on
Computation, summed up von Neumann computers by saying, "the inside of
a computer is as dumb as hell, but it goes like mad!" DNA computers,
however, are non-von Neuman, stochastic machines that approach
computation in a different way from ordinary computers for the purpose of
solving a different class of problems.
Typically, increasing performance of silicon computing means faster
clock cycles (and larger data paths), where the emphasis is on the speed of
the CPU and not on the size of the memory. For example, will doubling theclock speed or doubling your RAM give you better performance? For DNA
computing, though, the power comes from the memory capacity and parallel
processing. If forced to behave sequentially, DNA loses its appeal. For
example, let's look at the read and write rate of DNA. In bacteria, DNA can
-
7/29/2019 Dna Final Report
31/36
be replicated at a rate of about 500 base pairs a second. Biologically this is
quite fast (10 times faster than human cells) and considering the low error
rates, an impressive achievement. But this is only 1000 bits/sec, which is a
snail's pace when compared to the data throughput of an average hard drive.But look what happens if you allow many copies of the replication enzymes
to work on DNA in parallel. First of all, the replication enzymes can start on
the second replicated strand of DNA even before they're finished copying
the first one. So already the data rate jumps to 2000 bits/sec. But look what
happens after each replication is finished - the number of DNA strands
increases exponentially (2^n after n iterations). With each additional strand,
the data rate increases by 1000 bits/sec. So after 10 iterations, the DNA is
being replicated at a rate of about 1Mbit/sec; after 30 iterations it increases
to 1000 Gbits/sec. This is beyond the sustained data rates of the fastest hard
drives.
Now let's consider how you would solve a nontrivial example of the
traveling salesman problem (# of cities > 10) with silicon vs. DNA. With avon Neumann computer, one naive method would be to set up a search tree,
measure each complete branch sequentially, and keep the shortest one.
Improvements could be made with better search algorithms, such as pruning
the search tree when one of the branches you are measuring is already longer
than the best candidate. A method you certainly would not use would be to
first generate all possible paths and then search the entire list. Why? Well,
consider that the entire list of routes for a 20 city problem could theoretically
take 45 million GBytes of memory (18! routes with 7 byte words)! Also for
a 100 MIPS computer, it would take two years just to generate all paths
(assuming one instruction cycle to generate each city in every path).
-
7/29/2019 Dna Final Report
32/36
However, using DNA computing, this method becomes feasible! 10^15 is
just a nanomole of material, a relatively small number for biochemistry.
Also, routes no longer have to be searched through sequentially. Operations
can be done all in parallel.
-
7/29/2019 Dna Final Report
33/36
7. Conclusion
A Successor to Silicon
Silicon microprocessors have been the heart of the computing world
for more than 40 years. In that time, manufacturers have crammed more and
more electronic devices onto their microprocessors. In accordance with
Moore's Law , the number of electronic devices put on a microprocessor has
doubled every 18 months. Moore's Law is named after Intel founder Gordon
Moore, who predicted in 1965 that microprocessors would double incomplexity every two years. Many have predicted that Moore's Law will
soon reach its end, because of the physical speed and miniaturization
limitations of silicon microprocessors.
DNA computers have the potential to take computing to new levels,
picking up where Moore's Law leaves off. There are several advantages to
using DNA instead of silicon:
As long as there are cellular organisms, there will always
be a supply of DNA.
The large supply of DNA makes it a cheap resource.
Unlike the toxic materials used to make traditional
microprocessors, DNA biochips can be made cleanly .
DNA computers are many times smaller than today's
computers.
DNA's key advantage is that it will make computers smaller than any
computer that has come before them, while at the same time holding more
-
7/29/2019 Dna Final Report
34/36
data. One pound of DNA has the capacity to store more information than all
the electronic computers ever built; and the computing power of a teardrop-
sized DNA computer, using the DNA logic gates, will be more powerful
than the world's most powerful supercomputer. More than 10 trillion DNAmolecules can fit into an area no larger than 1 cubic centimeter (0.06 cubic
inches). With this small amount of DNA, a computer would be able to hold
10 terabytes of data, and perform 10 trillion calculations at a time. By
adding more DNA, more calculations could be performed.
Unlike conventional computers, DNA computers perform calculations
parallel to other calculations. Conventional computers operate linearly,
taking on tasks one at a time. It is parallel computing that allows DNA to
solve complex mathematical problems in hours, whereas it might take
electrical computers hundreds of years to complete them.
The first DNA computers are unlikely to feature word processing,
e-mailing and solitaire programs. Instead, their powerful computing power
will be used by national governments for cracking secret codes, or by
airlines wanting to map more efficient routes. Studying DNA computers
may also lead us to a better understanding of a more complex computer --
the human brain.
-
7/29/2019 Dna Final Report
35/36
8. Bibliography
Books
1. Adleman, L. 1994. Molecular computation of solutions to
combinatorial problems. Science 266:1021-1024.
2. Lipton, R. J. Speeding up computations via molecular biology.
(unpublished manuscript)
3. Boneh, D., Lipton, R. J. Making DNA computers error
resistant. (unpublished manuscript )
4. Kari, L. 1997. DNA computing: the arrival of biological
mathematics. (Unpublished manuscript).
5. Adleman, L. 1995. On constructing a molecular computer.
(unpublished manuscript )
Web Sites
1. www.usc.edu/dept/molecular-science/fm-papers.htm
2. www.arstechnica.com/reviews/2q00/dna
3. www.brooklynuniv.molacular.edu/dna_computer.html
4. www.hypography.com/article.cfm/32402.html
5. www.howstuffworks.com/computer/future
6. www.bioplanet.com/chat/discuss/messages/1095.htm
7. www.4tpgi.com.au/users/aoaug/dna_comp.html
http://www.usc.edu/dept/molecular-science/fm-papers.htmhttp://www.arstechnica.com/reviews/2q00/dnahttp://www.brooklynuniv.molacular.edu/dna_computer.htmlhttp://www.hypography.com/article.cfm/32402.htmlhttp://www.howstuffworks.com/computer/futurehttp://www.bioplanet.com/chat/discuss/messages/1095.htmhttp://www.4tpgi.com.au/users/aoaug/dna_comp.htmlhttp://www.usc.edu/dept/molecular-science/fm-papers.htmhttp://www.arstechnica.com/reviews/2q00/dnahttp://www.brooklynuniv.molacular.edu/dna_computer.htmlhttp://www.hypography.com/article.cfm/32402.htmlhttp://www.howstuffworks.com/computer/futurehttp://www.bioplanet.com/chat/discuss/messages/1095.htmhttp://www.4tpgi.com.au/users/aoaug/dna_comp.html -
7/29/2019 Dna Final Report
36/36