ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2013

Digital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Science and Technology 1097

Diversity Underfoot

Systematics and Biogeography of theDictyostelid Social Amoebae

ALLISON L PERRIGO

ISSN 1651-6214ISBN 978-91-554-8804-856urn:nbn:se:uu:diva-210074

Dissertation presented at Uppsala University to be publicly examined in Lindahlsalen,Norbyvägen 18D, Uppsala, Friday, 13 December 2013 at 10:00 for the degree of Doctor ofPhilosophy. The examination will be conducted in English. Faculty examiner: Prof DavidBass (Natural History Museum, London).

AbstractPerrigo, A. L. 2013. Diversity Underfoot. Systematics and Biogeography of the DictyostelidSocial Amoebae. Digital Comprehensive Summaries of Uppsala Dissertations from theFaculty of Science and Technology 1097. 56 pp. Uppsala: Acta Universitatis Upsaliensis.ISBN 978-91-554-8804-856.

Dictyostelids (Amoebozoa) are a group of social amoebae consisting of approximately 150species, which are found in terrestrial habitats worldwide. They are divided into eight majorclades based on molecular phylogeny, and within these clades are many species complexes.Some species are seemingly cosmopolitan in distribution, while others are geographicallyrestricted. In this thesis dictyostelids were recovered from high latitude habitats (soils in Swedenand Iceland) as well as from the soles of shoes. Morphological characters and DNA sequenceanalyses were used to identify isolates that were recovered and delimit new species, as well asto investigate the monophyly of Dictyostelium aureostipes. Nine species were reported fromNorthern Sweden and four from Iceland. Among the isolates recorded in Sweden were twonew species, described as D. barbibulus and Polysphondylium fuscans. P. fuscans was amongthe four species recovered from footwear, contributing evidence for anthropogenic transport ofdictyostelids. Ecological patterns were assessed using linear regression and generalized linearmodels. The ecological analyses of dictyostelids recovered from Iceland indicate that theseorganisms are most frequently found in soils of near-neutral pH, but also exhibit a speciesrichness peak in moderately acidic soils. These analyses indicate that in Iceland dictyostelidspecies richness decreases with altitude, and in the northern hemisphere the species richnessincreases with decreasing latitude. A three-region analysis of the D. aureostipes speciescomplex indicated that this species is in fact made up of at least five phylogenetically distinctclades, and in light of this the group is in need of taxonomic revision. These results indicatethat the dictyostelid species richness is higher than previously known, especially in high-latitude regions, and that even seemingly well-defined species may harbour cryptic diversity.Presently, species ranges may be expanding via anthropogenic dispersal but despite this, thedictyostelids are found to exhibit biogeographic trends well known from macroorganisms, suchas a latitudinal gradient of species richness.

Keywords: Amoeba, biogeography, cryptic species, dictyostelid, latitudinal gradient,multicellularity, protist, social amoeba, phylogenetics, systematics, new species

Allison L Perrigo, Department of Organismal Biology, Systematic Biology, Norbyv. 18 D,Uppsala University, SE-75236 Uppsala, Sweden.

© Allison L Perrigo 2013

ISSN 1651-6214ISBN 978-91-554-8804-856urn:nbn:se:uu:diva-210074 (http://urn.kb.se/resolve?urn=urn:nbn:se:uu:diva-210074)

For Dad

List of Papers

This thesis is based on the following papers, which are referred to in the text by their Roman numerals:

I Perrigo, A.L., Romeralo, M., Baldauf, S.L. (2012) What’s on your boots: an investigation into the role we play in protist dispersal. Journal of Biogeography, 39(5):998–1003

II Perrigo, A.L., Baldauf, S.L., Romeralo, M. (2013) Diversity of dic-tyostelid social amoebae in high latitude habitats of Northern Swe-den. Fungal Diversity, 57(1):185–198

III Perrigo, A.L., Moya-Larano, J., Baldauf, S.L., Romeralo, M. (Sub-mitted) Everything is not everywhere: a latitudinal gradient of pro-tist diversity. Submitted

IV Perrigo, A.L., Romeralo, M., Baldauf, S.L. (Submitted) The yellow slime mold is a red herring: hidden genetic diversity in one protist morphospecies. Submitted

Reprints of published papers were made with permission from the respective publishers. Allison Perrigo conceived the ideas, collected and analyzed the data, and was primarily responsible for the writing in Papers I and IV. In Paper II she contributed to data analysis and writing the paper. In Paper III, she collected the data, did the linear regression analysis for the latitudinal gradi-ent and was primarily responsible for the writing.

Contents

Introduction .................................................................................................... 9  Protists ....................................................................................................... 9  Amoebozoa .............................................................................................. 13  Dictyostelids ............................................................................................ 13  Biogeography ........................................................................................... 18  If everything is everywhere, where is everybody? .................................. 19  The taxonomic dilemma .......................................................................... 20  Aims ......................................................................................................... 21  

Materials and Methods ................................................................................. 22  Collections ............................................................................................... 22  Culture, isolation and DNA extraction .................................................... 23  Morphological diagnoses ......................................................................... 24  Genetic markers ....................................................................................... 27  Phylogenetic Analyses ............................................................................. 28  

Summary of Papers ...................................................................................... 29  Paper I: The boots study .......................................................................... 29  Paper II: Northern Sweden and new species ........................................... 31  Paper III: Iceland and the latitudinal gradient ......................................... 33  Paper IV: Dictyostelium aureostipes species complex ............................ 34  

Conclusions .................................................................................................. 37  

Svensk Sammanfattning ............................................................................... 38  

Acknowledgements ...................................................................................... 41  

References .................................................................................................... 46  

Abbreviations

AMP Adenosine monophosphate BS Bootstrap ca. Circa cf. Confer DNA Deoxyribonucleic acid GPS Global positioning system HI Hay infusion agar ITS Internal transcribed spacer mm Millimeter ml Milliliter MYA Million years ago NNA Non-nutrient agar OTU Operational Taxonomic Unit PCR Polymerase chain reaction PP Posterior probability RAxML Randomized Accelerated Maximum Likelihood rRNA Ribosomal ribonucleic acid s.l. Sensu lato SM Standard media agar sp. Species sp. nov. Species novum SSU Small subunit µm Micrometer UU Uppsala University var. Variety

9

Introduction

“When a biologist studies a group of species, ranging anywhere from, say, elephants with three living species to ants with fourteen thousand species, he or she typically aims to learn everything possible over a large range of bio-logical phenomena. Most researchers working this way… are properly called scientific naturalists. … They will tell you, correctly, that there is infinite de-tail and beauty even in those that people at first find least attractive – slime molds, for example, dung beetles, cobweb spiders, and pit vipers. Their joy is in finding something new, the more surprising the better. They are the ecol-ogists, taxonomists, and biogeographers.”

E.O. Wilson in Letters to a Young Scientist

This thesis is the compilation of four papers and manuscripts that broadly aim to increase the collective knowledge about something many of us didn’t even know existed: dictyostelid social amoebae, or cellular slime molds. Over the course of these studies I have heard these amoebae likened to aliens (or, ‘moon snot’), a microscopic forest, the mood slime from Ghost Busters, an inverse fountain and many other strange and variously accurate images. For now, I will not offer further comparisons. Instead I will focus on famil-iarizing you, my audience, with these creatures, such that you can develop your own understanding and, possibly, analogies. So put up your feet, pour a cup of coffee, and take a few minutes to enjoy the intricacies of these organ-isms that I have spent the last five years sometimes hating but more often loving, and always in awe of.

Protists

The Earth is home to many extraordinary and wonderful creatures. We are all familiar with animals, plants and fungi. Bacteria and viruses are

10

also in our repertoire. However, there is a massive diversity of organisms that are eukaryotic (with a nucleus) that are not animals, plants or fungi. These microorganisms are lumped together into a refuse bin and are collec-tively known as ‘protists’. They are often, but not always, unicellular and they inhabit nearly every environment on earth, from the deepest sea vents right up into the atmosphere. A select few we know: the alveolate Plasmodi-um causes malaria, the foraminiferans are a long-favored workhorse of pale-ontologists, and single-celled oceanic phytoplankton are among the most productive primary producers on Earth. Furthermore, no Gary Larson com-pilation would be complete without a pair of the familiar amoebae on arm-chairs thoughtfully reflecting on the mundane facets of middle-American suburban life (Larson, 2003).

These organisms, the protists, were first acknowledged taxonomically as neither plants nor animals when they were assigned to the kingdom Pro-tozoa by Owen in 1860. Scamardella (1999) outlines the history of protist taxonomy, highlighting the names and taxa included within this ‘group’, which over time has been made up of any and all organisms that could not be confidentially called a plant or an animal at the time. Over the last two centuries various biologists have weighed in with their definition of the “kingdom of primitive forms”. The kingdoms Protoctista (Hogg, 1860), Protozoa (Owen, 1860) and Protista (Haeckel, 1866) have all been proposed and defended - each including an oft-overlapping array of non-plant and non-animal taxa. Haeckel (1866) draws an early representation of the tree of life, showing one theory explaining the relationships within and among all living organisms (Figure 1).

More recent classifications and phylogenies have confirmed that pro-tists are not only morphologically diverse, but they are also phylogenetically divergent, belonging to a variety of eukaryotic super-groups (Whittaker, 1969; Levine et al., 1980; Corliss, 1984; Schlegel, 1991; Cavalier-Smith, 1998, 2003; Adl et al., 2005, 2007, 2012). As such, there is a movement to stress that protists should not be regarded as only the array of ‘primitive forms’ as the name implies. Figure 2 shows a schematic representation of the relationships among eukaryotes.

Throughout this thesis the term ‘protist’ is used not to indicate a mon-ophyletic group, but to collectively refer to all eukaryotic organisms that are not plants, animals or fungi. Although the term does not depite a natural group, the field of protistology remains coherent in its aim to better under-stand these often overlooked organisms.

11

Figure 1. The tree of life, as illustrated by Ernst Haeckel in Generelle Morphologie der Organismen (1866). Hackel divides life into three sections in this ‘genealogy’: Plantae, Protista and Animalia. The dictyostelids are absent from the tree, but their sister clade, the Myxomycetes, are found towards the top of the figure, along with Spongiae, indicating that they are relatively ‘advanced’ compared to the other Pro-tista. Likewise, Mammalia is found at the apex of the Animalia branch, in line with Haeckel’s belief that man is the peak of evolution.

12

Figure 2. The filose amoeba of life. The relationships among major eukaryotes are represented schematically as the filose pseudopodia of an amoeba. This amoeba of life is schematic and only includes a representative selection of taxa. Like an amoe-ba, this phylogeny is inherently without roots, or ‘unrooted’. For more detailed phy-logenies of the eukaryotic super-groups, discussions on the relationships among taxa and the position of the root see Baldauf, 2003; Parfrey et al., 2006, 2010; and Adl et al., 2007, 2012.

13

Amoebozoa

Amoebozoa is one of the eukaryotic ‘super-groups’ (Figure 2). It is the sister taxon to Opisthokonts, which comprises the animals and fungi (Baldauf, 2003). The Amoebozoa is made up of amoebae that are either naked (lacking a shell or covering) or testate (with a shell-like covering, called a ‘test’) (Adl et al., 2012). The relationships among the taxa within Amoebozoa are not well understood and phylogenies vary significantly de-pending on which taxa and data are included in the analyses (Cavalier-Smith et al., 2004; Kudryavtsev, 2005; Tekle et al., 2008; Pawlowski & Burki, 2009; Shadwick et al., 2009).

Although the within-group relationships are not universally agreed upon at present, there are a series of taxa that have been confidently identi-fied as major lineages within Amoebozoa. Most conservatively, Adl et al. (2012) have suggested to divide the Amoebozoa into 13 constituent taxa. Alternately, Pawlowski and Burki (2009) divided Amoebozoa into six major taxa: Conosea, Thecamoebida, Variosea, Flabellinea, Acanthopodida and Tubulinea. Another recent phylogeny suggests a two-subphyla system under which Amoebozoa is divided into Conosa (made up of Mycetozoa, Variosea and Archamoebea) and Lobosa (consisting of Tubulinea, Flabillinea and Longamoebia) (Smirnov et al., 2011). Due to the clear discrepancies among phylogenies it has been proposed that further data, including full genomes from a broad sampling of Amoebozoa species, will be required to confident-ly delimit the branching patterns among these taxa (Glöckner & Noegel, 2013).

It is important to point out that while the Amoebozoa is made up ex-clusively of amoeboid organisms, it is not the only group with amoebae in it. Amoeboid organisms are also found in several other eukaryotic super-groups. A large majority of the non-Amoebozoa amoeboid organisms are found within Rhizaria (including radularians and foraminifera), but further instances are also found in Stramenopiles (Actinophryida), Excavata (Heter-olobosea) and Opisthokonts (Nuclearia) (Pawlowski & Burki, 2009).

Dictyostelids

Dictyostelids (Amoebozoa) were originally known as the ‘cellular slime molds,’ but they are now more frequently referred to by the common name ‘social amoebae.’ The latter term serves to both clear up confusion regarding the taxonomic placement of the group (as slime molds implies they are fungi, not amoebae) and also highlights a striking features in their life cycle: multicellularity, which is the result of a unique form of sociality.

14

Dictyostelids, along with myxogastrids (plasmodial slime molds) and protostelids, make up the Mycetozoa, which is one of the major divisions within the Conosea (Amoebozoa) (Olive, 1970; Baldauf & Doolittle, 1997; Pawlowski & Burki, 2009; Fiore-Donno et al., 2010). Unlike dictyostelids, which are relatively small throughout their life cycle (usually <1.0 centime-ters), myxogastrids have the ability to produce a giant (up to several decime-ters across), multi-nucleate amoeba that will produce fruiting structures (Fiore-Donno et al., 2013). The protostelids, one the other hand, are a poly-phyletic group of amoebae that produce microscopic sorphores each bearing a single spore, but are otherwise morphologically diverse (Olive, 1975; Fiore-Donno et al., 2010).

Sexual and asexual reproduction Under normal conditions, dictyostelid amoebae reproduce asexually

by binary fission. They feed on bacteria and grow until a certain size has been reached, at which point the amoeba divides into two daughter cells. However, under ‘crisis-conditions’ the amoebae respond by producing one of three alternate life phases: multicellular fructifications, macrocysts or microcysts.

The best studied of these three alternate phases is the formation of the multicellular fruiting bodies, which is a direct response to starvation. When starvation conditions arise, dictyostelid amoebae respond by produc-ing a chemoattractant, known as an acrasin. Cyclic AMP was the first acra-sin identified, and later the peptides glorin, folate and neopterin were add-ed to the list (Konijn et al., 1968; Haastert, 1982; Shimomura, 1982; de Wit & Konijn, 1983). Once an acrasin has been secreted the surrounding amoebae will respond by moving towards the chemoattractant and giving off their own acrasin pulse. The amoebae form streams, moving towards a central aggregation point. Upon aggregating the amoebae organize into a slug-shaped mass, which may migrate towards more favorable conditions (such as light, pH or temperature). The slug will then begin to differentiate into a sorocarpic structure, in which about 20% of the amoebae will vacuo-late to form a stalk and the remaining amoebae will become spores in a slimy mass known as a sorus (Raper, 1984). The spores are not actively dispersed, but are dependent on vectors to transport them to a new loca-tion, where they may germinate and begin the cycle anew (Cavender, 1973; Bonner, 2009).

The multicellular phase of the dictyostelid life-cycle has been of par-ticular interest to developmental biologists. As a result of this, Dictyostelium discoideum is now a well-recognized model organism used to study cell-cell signaling, differentiation among cells, social altruism and a host of other processes (reviewed in Muñoz-Braceras et al., 2013). The D. discoideum genome was the first to be fully sequenced, and now three more dictyostelid

15

genomes have been made publicly available (Eichinger et al., 2005; Heidel et al., 2011; Sucgang et al., 2011).

Perhaps surprisingly, this striking pattern of aggregative multicellular-ity with sorocarpic fruiting is not limited to only the dictyostelids, but is found in some form in at least six of the eukaryotic super-groups, including Opisthokonts, Amoebozoa, Excavata, Stramenopiles, Alveolata and Rhizaria (Brown et al., 2012; Brown & Silberman, 2013).

Dictyostelids also are capable of sexual reproduction under certain conditions (Reviewed in Raper, 1984; Bloomfield, 2013). In the same way that the asexual cycle begins, the macrocyst forming sexual cycle is initiated with the production of an acrasin. The signal also initiates aggregation, but the similarities stop here. The two amoebae that initiated the aggregation process become a single diploid cell that cannibalizes the other amoebae responding to the chemical signal. Through this process the diploid macro-cyst grows larger. This cycle is poorly understood in comparison to the mul-ticellular asexual cycle, as it is difficult to initiate in the lab and is also de-pendent on the presence of different mating types within a single strain (Bloomfield et al., 2010). Macrocysts have only been observed in a handful of the described dictyostelid species (Raper, 1984).

The third ‘crisis-induced’ stage that dictyostelids exhibit is the micro-cyst. This is a transient stage, where individual amoebae form thick cellu-lose-rich walls in response to high osmolarity (Blaskovics & Raper, 1957). The amoeba will then germinate in response to a subsequent drop in osmo-larity (Cotter & Raper, 1968). It is expected that under natural conditions this phase is a survival tactic used to survive periods of unfavorable envi-ronmental conditions (Raper, 1984; Budniak & O’Day, 2012).

Ecology Presently there are around 150 species of dictyostelids known, but this

is probably a gross under-representation of the true diversity (Adl et al., 2007). The number of described species has been growing rapidly in recent years. Since the last taxonomic revision of the dictyostelids by K.B. Raper in 1984 the number of described species has more than doubled (Bonner, 2009). This high diversity has been further supported by preliminary results from culture independent dictyostelid surveys (Romeralo & Baldauf, un-published data).

Dictyostelid amoebae occur primarily in the surface layer of forest soils and feed on bacteria (Cavender, 1973; Raper, 1984; Hagiwara, 1989; Swanson et al., 1999). However, they have also been regularly recovered from a variety of other terrestrial habitats including canopy soils, animal dung and agricultural fields (Brefeld, 1869; Cavender et al., 1993; Stephenson & Landolt, 1998). Little is known about which bacterial strains dictyostelids feed on under natural conditions, but it has been suggested that

16

they have preferred strains (Singh, 1947; Raper, 1984). This is corroborated by the recent findings that some species of dictyostelid ‘pack lunch boxes’ and incorporate their preferred bacterial food source into their fruiting bod-ies (Brock et al., 2011).

A number of ecological factors have been assessed in relation to dic-tyostelid species richness (reviewed in Raper, 1984; Cavender, 2013). These include forest type, moisture availability, shade area, pH and temperature. Different dictyostelid species are found in dissimilar forest types, indicating that the species have certain ecological requirements that may be found only in certain habitats (discussed in Cavender, 2013). Some of these habitat re-quirements have been further delimited. For example, Romeralo and colleauges (2011b) showed that dictyostelids in the Iberian Peninsula tend to be recovered more frequently from soils with a near-neutral pH.

It has been observed many times that dictyostelid species richness is correlated with of vascular plant diversity in the sampling area (for example, Cavender & Raper, 1968; Cavender, 1973; Raper, 1984; Vadell et al., 1995; Swanson et al., 1999; Romeralo et al., 2012). Early studies on dictyostelid ecology indicated that even within a small soil sample the dictyostelid spe-cies richness is variable according to the microhabitat (Eisenberg, 1976). It is likely that an increased diversity of vascular plants has a knock-on effect, leading to a higher number of microhabitats for dictyostelids to occupy (Romeralo et al., 2011b).

Larger scale biogeographic patterns have also been reported for dicty-ostelids. A number of papers have noted a latitudinal gradient of species richness (i.e. more species found closer to the equator), but none have tested this pattern statistically (Cavender, 1973, 2013; Raper, 1984; Hagiwara, 1989; Swanson et al., 1999).

Systematics The dictyostelids were first described in the late 1800s when Dicty-

ostelium mucoroides was isolated from horse and rabbit dung (Brefeld, 1869). The genus name translates to ‘netted-stalk’, referring to the fruiting body, and the species epithet refers to the similarity between the sorocarps of D. mucoroides and the erect sporangiophores of the common soil fungus, Mucor mucedo. In subsequent years additional ‘slime mold’ genera were described including Acrasis, Acytostelium, Coenonia, Guttulinopsis, and Polysphondylium (Cienkowski, 1873; Brefeld, 1884; Van Tieghem, 1884; Olive, 1901; Raper, 1956).

A phylogenetic analysis based on DNA sequence data has indicated that only Acytostelium, Dictyostelium and Polysphondylium are dictyostelid ‘slime molds’, and the remaining genera belong to various other sorocarpic amoebae taxa (Brown & Silberman, 2013), with the exception of Coenonia, which has not been isolated again since its description in the 1960s.

17

Figure 3. The three dictyostelid fruiting body (sorocarp) types. A. Acytostelium-type sorocarps are relatively small, and the sorophore (stalk) is acellular. B. Dictyosteli-um-type sorocarps have cellular sorophores. These may lack branches, have an ir-regular branching pattern, bifurcate, or have sessile sori along the sorocarp. C. Poly-sphondylium-type sorocarps have a cellular sorophore and branches occurring in whorls (i.e. at least two branches arising from the same node in at least one position along the sorophore).

The three confirmed genera of dictyostelids are distinguished morpho-

logically by differences in sorophore composition and branching pattern (Figure 3). Acytostelium has the smallest fruiting bodies of the three genera, and is easily recognized by its acellular stalk. The genus Dictyostelium has a cellular stalk made from vacuolated amoebae and has either no branches or irregular branches. The third genus, Polysphondylium, also has a cellular stalk, but can be distinguished from Dictyostelium by the presence of whorled branches (Figure 4). However, this seemingly straightforward clas-sification system based on morphology is not consistent with the dictyoste-lids’ evolutionary history. Recent phylogenetic analyses have indicated that none of these three genera are monophyletic (Swanson et al., 2002; Schaap et al., 2006; Romeralo et al., 2012).

The first multi-region phylogenetic analysis of the dictyostelids indi-cated four major clades, referred to as Dictyostelid Groups 1-4 (Schaap et al., 2006). This was followed by further analyses using different DNA re-gions and more taxa, which supported the earlier phylogeny and further di-vided the taxon into eight major groups (Romeralo et al., 2011a). These eight groups include the earlier Dictyostelid Groups 1-4, of which Dicty-ostelid Group 2 is divided into Group 2A and 2B, along with three species complexes (the polycarpum-complex, polycephalum-complex and the vio-laceum-complex). Accurately rooting the dictyostelid phylogeny proved to be a challenge, but the root has now been confidently placed between Dicty-ostelid Groups 1+2 and Groups 3+4 using genomic information from differ-ent species across the taxon (Glöckner & Noegel, 2013; Romeralo et al., 2013; Sheikh et al. in prep.).

A B C

1mm

18

There have been several estimates made about the age of the dicty-ostelids. Parikh et al. (2010) used the assumption that the rate of protein evolution in plants and animals is similar to that in the Amoebozoa, and extrapolated that Dictyostelid Group 4 had its origin about 400 million years ago. This date was further corroborated by a genome-wide analysis (Sucgang et al., 2011). Other authors have estimated the age of the dictyoste-lids as a whole, placing the origin of the group to ca. 600 mya (Heidel et al., 2011), while a more recent study has estimated the dictyostelid origin to ca. 341-691 mya using multiple protein sequences as well as two fossil calibra-tion points (Fiz-Palacios et al., 2013).

Biogeography

Biogeography is the study of organisms in space and time. It is typi-cally broken into two sub-fields: ecological biogeography and historical biogeography. Ecological biogeography studies the ecological factors affect-ing species distribution. Historical biogeography, on the other hand, focuses on events occurring in the long-term (geological) scale that have shaped species distributions and the evolutionary relationships among organisms. In studies of historical biogeography, the biogeographer is usually searching for either rare dispersal events (population division due to organism move-ment) or vicariance events (population division due to geologic change) to explain distributions.

Ecological and historical biogeography may seem clear and easily dis-tinguished from one another, but it is not so easy to tease them apart when trying to make sense of protist distributions. While macroecologists can count kangaroos, and tell them from wombats, it is much more ‘blurry’ when working with protist taxa – not only do microbiologists have the issue of not easily knowing which species occur where (and more importantly, where they aren’t), but they often cannot tell a kangaroo from a wombat – or, in this case, an Apusomonas from a Thecomonas.

One of the earliest statements about protist biogeography was the much-repeated maxim of Baas Becking (1934), who stated that in the case of microorganisms ‘everything is everywhere, but the environment selects.’ Unfortunately the second part of this quotation was often dropped for the sake of brevity, changing the statement from indicating that microorganisms don’t have historical biogeographic patterns, to the indication that microor-ganisms don’t have any biogeographic patterns at all: historical or ecologi-cal. However, even from this early stage it is clear that Baas Becking under-stood the importance of ecological restrictions on protist distribution.

Indeed, the misinterpretation of Baas Becking's 1934 statement has persisted into recent studies of protist biogeography (discussed in de Wit & Bouvier, 2006). This has led to heated debates regarding the extent of mi-

19

croorganismal endemicity, most notably between W. Foissner and B. Findlay and colleagues (cf Foissner, 1999, 2006; Finlay, 2002; Fenchel & Finlay, 2004).

If everything is everywhere, where is everybody?

If it is true, as some suggest, that protist are only limited by ecology and not by historical factors, then we would expect to find protist dispersal units (spores, cysts, etc.) at a background rate in nearly all environments on Earth.

One of the strongest lines of evidence for this resting-stage diversity is the presence of the rare biosphere. The ‘rare biosphere’ refers to the large number of operational taxonomic units (OTUs) occurring in very low densi-ties in environmental samples, usually as indicated by culture-independent methods (Sogin et al., 2006). It is possible that the rare biosphere is made up of an assortment of organisms dispersed from all over the world. These or-ganisms cannot thrive in that particular locality and are waiting in encysted forms until their surroundings become more favorable. However, if this rare biosphere diversity in fact represents organisms that are only limited by eco-logical conditions, one would expect that given the proper conditions in the lab these dormant stages would become active again.

In an extensive survey of the Arctic myxomycetes (plasmodial slime molds), Stephenson et al. (2000) noted that not a single tropical endemic was recovered from any of the samples, despite recovering nearly two thousand myxomycete isolates. The authors’ survey method was based on recording both fruiting isolates observed in the field, and also recovering dormant iso-lates from bark samples under laboratory conditions. They speculated that if everything was in fact everywhere (and the environment was responsible for the dormant stage remaining dormant) then in the course of the study at least one dormant tropical endemic would have been recovered – but none were.

This is an emblematic case of ‘absence of evidence,’ and while not conclusive in and of itself this does bring up an important question: is ‘eve-rything is everywhere’ falsifiable? Foissner (2006) discusses this and con-cludes that because the statement is in fact a metaphor, instead of a hypothe-sis, it cannot be falsified.

To determine which species occur where we must look at species oc-currence data alongside niche modeling data (for example Aguilar et al., 2013). The currency here is the taxon, either in the form of species or OTUs. Those relying on a morphological species concept will undoubtedly view protists as being primarily cosmopolitan (for example Fenchel & Finlay, 2006). If species are defined using molecular methods and/or a biological species concept many more OTUs will generally be recognized, with im-portant implications for microorganismal endemicity (discussed further in

20

Martiny et al., 2006; Caron, 2009; Bass & Boenigk, 2011; Boenigk et al., 2012).

The taxonomic dilemma

In order to unravel the biogeographic patterns exhibited by protists, it is helpful to first have well-defined taxa to study. This is logical: before we can look at where something is, we need to know what that something is. There are different methods used to define taxa: the morphological species concept, the biological species concept and the phylogenetic species concept are among the most frequently used. Protist taxonomy (as with other organ-ism groups) has hinged on morphologic descriptions for centuries. However, the use of a phylogenetic species concept is now becoming more common – and the results from this method aren’t always consistent with inferences based on morphology. Many taxonomists propose methods of delimitation based on multiple lines of evidence (Mishler & Donoghue, 1982), while some go even further to promote ‘integrative taxonomy’, based on total evi-dence (Dayrat, 2005).

With the recent availability of DNA sequence data available to build increasingly detailed phylogenies it is now becoming clear that in some cas-es what we once considered to be a ‘species’ is in fact a series of genetically distinct taxa, or ‘cryptic species’. Cryptic species are defined as two or more unique taxa that are morphologically indistinguishable from one another.

Furthermore, species may be ‘pseudo-cryptic,’ indicating that they appear to be cryptic species, but in light of a phylogenetic framework diag-nostic morphological characteristics can be identified. It is often the case that the diagnostic features form a continuum within pseudo-cryptic species (for example, the morphologically defined organisms may be 1-8 mm long), but in light of phylogeny this morphological continuum can be divided into more accurate spectra, which are not evident without the phylogenetic framework (in this hypothetical example there are actually two species, one is 1-4 mm long, the other is 5-8 mm long).

Even within well-resolved phylogenies it isn’t always clear where to draw the ‘species’ line. Because of the vast diversity of protists it is nearly impossible to formulate an overarching rule that is applicable in all situa-tions and with all taxa. As such, Boenigk et al. (2012) have emphasized that species are entities created for our own convenience, and we should keep that in mind. If we insist on defining them (which we must if we want to describe their distribution patterns) they should be delimited on a case-by-case basis using all available information – phylogenetic, morphological and ecological – and morphology should only be interpreted in the context of a robust phylogenetic framework.

21

Here, we adhere to a phylogenetic species concept sensu Cracraft, 1983. In practice, this means that dictyostelid species are delimited as a monophyletic group with diagnostic apomorphies. In order to diagnose a dictyostelid isolate there are three steps. First, a tentative morphological diagnosis is made. This diagnosis may be inconclusive, if the features are not consistent with any other described species. Next DNA is extracted, one or more DNA regions are sequenced, and a phylogeny is inferred using the isolate and a wide selection of other closely related species. Finally, the po-sition of the isolate in the phylogeny is assessed, and the morphology of the isolate is compared to that of the most closely related species according to the phylogeny. If the isolate’s morphology is inconsistent with that of its sister taxon then it is described as a new species.

Aims

In this thesis I aim to investigate several aspects of dictyostelid sys-tematics, ecology and biogeography. Paper I investigates a possible major vector of dictyostelid dispersal: humans, and discusses the impact that an-thropogenic dispersal may have on our understanding of protist biogeogra-phy. Paper II looks at the dictyostelid social amoebae in Northern Sweden, which was previously thought to harbor very low dictyostelid species rich-ness. Paper III continues this assessment of dictyostelids in high-latitude environments. The work presented in Paper III looks at both the species richness and ecological trends in Iceland, as well as general species richness trends in the northern hemisphere, especially in relation to latitude. The final paper, Paper IV, is a phylogenetic assessment of a species that is common in high-latitude environments, but also has been found in other localities around the world: Dictyostelium aureostipes.

22

Materials and Methods

The smallest of slimes have I found. Collected - right off of the ground!

Spread it onto a plate, and before it's too late, in extraction fluid it's drowned.

Collections

Over the course of this thesis soil collections were made at a number of locations around the world. All of the isolates that were analyzed in Pa-pers II and III, as well as some of the isolates examined in Paper IV, were collected from Iceland and Sweden. The collection and culture protocols were minimally adapted from the protocols in Cavender & Raper (1965).

Soil samples were taken by collecting 10 to 30 grams of wet-weight matter from the top 1-3 centimeters of the organic matter soil horizon (the top soil layer). Typically 2-3 samples were collected at each locality in order to account for variation in vegetation and microhabitats. Each collection locality was geo-referenced with GPS and the altitude was noted. Any asso-ciated vegetation was also recorded. Samples were placed in Whirl-Pack plastic bags, and kept cool until they were brought back to UU, where they were stored at 4°C until processing.

For Paper I, soils were collected from the bottom and sides of foot-ware using a sterile metal scraping rod and were either stored at 4°C for up to two months, or processed immediately following collection. For logisti-cal reasons these samples were smaller than normal soil samples, varying from 0.02-12.47 grams.

23

Culture, isolation and DNA extraction

In order to isolate dictyostelids from soil samples a standard soil dilu-tion plating technique was employed (Cavender & Raper, 1965). A two-step serial dilution was used for a final plating concentration of 50:1 (water:soil), and 0.50 ml aliquots were plated on hay infusion agar (HI) plates with 0.25 ml of a heavy suspension of Klebsiella aerogenes. Plates were checked daily starting two days after inoculation and continuing for two weeks thereafter. Dictyostelids could be observed once they reached the starvation phase of their asexual cycle and produced fruiting bodies. Spores from these fruiting bodies were then replated with K. aerogenes on non-nutrient agar (NNA; adapted from Raper, 1984; Table 1) for identification.

To extract DNA, pure-culture isolates were cultivated on standard media agar (SM; adapted from Raper, 1984; Table 1) with K. aerogenes. After several days of growth, amoebae from the periphery of the colony were taken using a pipette tip and mixed with MasterAmp Buccal Swab DNA Extraction Solution from Epicentre (Madison, WI, USA) and heated for 30 min at 60 °C followed by 8 min at 98 °C.

Table 1. Recipes for dictyostelid growth media (HI, NNA and SM agar) and spore storage solution (HL5). All ingredients are added to glass flasks, shaken to dissolve, then autoclaved for 20 minutes at 120°C. The agar solutions are then allowed to cool to 60-80°C and 25 ml is added to each Petri dish and allowed to cool to room tem-perature. Hay infusion agar is made in a two-step process. The first step combines 6.2 grams of dried hay (Poa sp.) and 800 ml of ddH2O, which is then autoclaved as described above. This hay-infused water is then used instead of ddH2O when mak-ing the agar plates. Plates are stored at 4°C until use, or for up to one month. HL5 media is allowed to cool to room temperature after autoclaving, and is then stored at 4° for up to three months.

Hay infusion agar (HI)

Non-nutrient agar (NNA)

Standard media agar (SM)

HL5 media

KH2PO4 0.7 g 0.48 g 0.76 g 0.05 g Na2HPO4 0.27 g 0.192 g - 0.05 g Peptone - - 4.0 g 1.4 g Yeast extract - - 0.4 g 0.7 g Glucose - - 4.0 g 1.35 g MgSO4 - - 0.4 g - K2HPO4 - - 0.24 g - Bactoagar 7.0 g 6.0 g 8.0 g - ddH2O 400 ml 400 ml 400 ml 100 ml

24

Spores of all unique isolates recovered over the course of these studies were frozen in HL5 media (Cocucci & Sussman, 1970; Table 1) in triplicate and stored at -80°C at UU. Additionally, any isolates received from other collectors, or from the Dicty Stock Center were similarly stored for future reference. Type isolates from Paper II were deposited at the Dicty Stock Center (Fey et al., 2006).

Morphological diagnoses

Dictyostelids were isolated from HI soil dilution plates (Table 1) by placing a single sorus (terminal ball of spores, illustrated in Figure 4) onto an NNA plate with the bacterium Klebsiella aerogenes as a food source (Cavender & Raper, 1965). The spores from the sorus that was transferred would then germinate, consume the bacteria, reproduce by binary fission and eventually starve, triggering the aggregation process again. This aggregation process leads to the production of asexual, multicellular fruiting bodies that are genetically identical.

These fruiting bodies were then studied morphologically, using a se-ries of morphological characteristics for diagnosis (reviewed in Raper, 1984; Hagiwara, 1989). These features, and variations thereof, are illustrated in Figures 4 and 5. The characters most commonly used in species identifica-tion are: aggregation size, shape and division; early sorogen (slug) shape and migration pattern; coloration at any stage; fruiting body size and shape; fruit-ing body base and tip size and shape; number, size and pattern of lateral branches; sorus size and shape; and finally spore size, shape and pres-ence/absence of vesicles or polar granules. In addition, other ecological and behavioral characters may be used for species identification. Examples of these are temperature preference, exhibited by species like Dictyostelium septentrionalis, which grows preferentially at 17°C and is found only in cooler habitats (Cavender, 1978). Likewise, the act of feeding on other dic-tyostelid amoebae, as exhibited by the ‘cannibalistic’ species D. caveatum is a behavioral trait used for identification (Waddell, 1982).

25

Figure 4. A dictyostelid sorocarp (fruiting body). Morphological features, and their respective variations, that are used for species identification are shown.

elliptical oblong/oval

reniform round

PG-­ PG+

unconsolidated consolidated

irregular  granules

Spores

LateralBranches

irregular  none whorls

Sorophoreacellular

(Acytostelium)cellular

(Dictyostelium  or  Polysphondylium)

(Acytostelium  orDictyostelium)

(Polysphondylium)

Support  Structure

basal  diskno  support  structure

support  cell(s)

Sorus

26

Figure 5. Morphological features of the asexual, multicellular fruiting stage in the dictyostelids that are used for species identification. Tip and base shape diagrams are after Hagiwara (1989).

Aggregation

Slug  

(Early  Sorogen)

Habit

without  subdivision

subdividing  along  streams

subdividing  centrallly

mound

radiate  

solitary

gregarious

clustered

coremiform

not  migrating migrating  without  

stalk  formation

migrating  with  

stalk  formation

Tip  Shape

Base  Shape

simple

complex

piliform/

fusiform

accuminate clavate obtuse capitate

conical round clavate accuminate digitate

27

Genetic markers

In total, three genetic markers were used to infer the phylogenies in Papers I, II and IV. The ribosomal small subunit (SSU) and internal tran-scribed spacer (ITS) are both nuclear markers that were previously utilized to infer dictyostelid-wide phylogenies (Schaap et al., 2006; Romeralo et al., 2007a, 2010). Additionally, primers for a portion of one mitochondrial marker, the ATPase1 (atp1), were developed for dictyostelids for use in Paper IV. The SSU was employed in all three papers, and the ITS and atp1 were used along with the SSU in Paper IV. PCR primers and programs are outlined in Tables 2 and 3. Table 2. PCR primers used to amplify the three genetic markers used in this thesis. The primer name, 5’-3’ sequence and reference is given. Primers marked with an asterisk (*) were used for internal sequencing of longer fragments.

Table 3. PCR programs used to amplify sections of the SSU, ITS and atp1. Region PCR Program Reference SSU 5’-95°, 30x (30”-95°, 1’-56°, 2’-72°), 10’-72° Medlin et al., 1988 atp1 Same as above Paper IV ITS 5’-95°, 30x (1’-94°, 1’-50°, 2’-72°), 10’-72° Romeralo et al., 2010

Primer name 5’-3’ Primer sequence Reference SSU 18S-FA AACCTGGTTGATCCTGCCAG Medlin et al. 1988 18S-RB TGATCCTTCTGCAGGTTCAC Medlin et al. 1988 D542F* ACAATTGGAGGGCAAGTCTG Schaap et al. 2006 D1340R* TCGAGGTCTCGTCCGTTATC Schaap et al. 2006 ITS 18S-5_8-s1 GAGGAAGGAGAAGTCGTAACAAGGTATC Romeralo et al. 2007 ITS_2 GCTTACTGATATGCTTAAGTTCAGCGGG Romeralo et al. 2007 5_8-s1* GAAGACCGTAGCAAACTGCG Romeralo et al. 2007 18S-5_8-s2* TTATCGCAGTTTGCTACGGTCTTC Romeralo et al. 2007 atp1 ATP_352F TGTTAGGAMGAGTAGTWGATGTATTAGG Paper IV ATP_897R TCTCCTGGRTAYGCTTCTCKTCCTGG Paper IV

28

Phylogenetic Analyses

All phylogenies presented herein were inferred using both maximum likelihood and Bayesian inference. Prior to analysis, all datasets were checked for the most suitable model of evolution using either MrModelTest (Nylander, 2004) or JModelTest (Posada, 2008).

The Bayesian analyses presented in Paper I, II and IV were run using MrBayes v.3.2 (Ronquist & Huelsenbeck, 2003). Those in Papers II and IV were executed remotely using the Cipres Web Portal (Miller et al., 2011).

Maximum likelihood analyses for Papers I, II and IV were run using RAxML (Stamatakis, 2006), either through the RAxML BlackBox web por-tal, or the RAxML GUI (Silvestro & Michalak, 2012) with the settings spec-ified in the respective papers.

The resulting phylogenies of all analyses were initially visualized in FigTree v.1.3.1 (Rambaut, 2009), and subsequently edited for publication in either Microsoft PowerPoint or Adobe Illustrator.

29

Summary of Papers

Paper I: The boots study

Perrigo, A.L., Romeralo, M., Baldauf, S.L. (2012) What’s on your boots: an investigation into the role we play in protist dispersal. Journal of Biogeog-raphy, 39(5):998–1003

The dictyostelids are small amoebae that form various resistant stages. These include spores, microcysts and macrocysts – all of which can be dis-persed over long distances. Dictyostelids have no active form of dispersal and are not dispersed by wind. As such, they are dependent on vectors to move them from place to place. Earlier studies have shown that a variety of animals transport dictyostelids, either externally (by adhesion to skin surfac-es) or internally (by ingestion and excretion). These vectors include cave crickets, earthworms, salamanders, bats, birds (including long-distance mi-gratory species) and other small invertebrates (Suthers, 1985; Huss, 1989; Stephenson & Landolt, 1992; Stephenson et al., 2007).

In Paper I, we predicted that while dictyostelids resistant stages may have evolved to be transported by these smaller organisms, humans could now be moving them around at an unprecedented rate. To investigate this we collected soil and debris from the soles of footwear and cultivated it using standard dictyostelid recovery methods. We found that of the 18 pairs of shoes that were assessed, four carried dictyostelids that were able to form viable amoeba populations. Two of the pairs of shoes carried two species, and the other two carried only a single species. The species that were recov-ered were identified using both morphological characters and phylogenetic reconstruction. The species found were Dictyostelium leptosomopsis, D. minutum, D. sphaerocephalum and Polysphondylium fuscans. P. fuscans was still undescribed at the time of publication of Paper I, but was later formally described in Paper II.

In Paper I we suggest that the morphology of the dictyostelid fruiting bodies may play a major role in the dispersal potential of different species. During this study D. sphaerocephalum was recovered three times. This spe-

30

cies has some of the largest sori of any dictyostelids, and also has been pre-viously noted for its high dispersal and colonization potential, as it is often found in disturbed sites and agricultural fields around the world (Swanson et al., 1999; Paper III). Undoubtedly, as one of the few taxonomically well-delimited and cosmopolitan species (Swanson et al., 1999; Romeralo et al., 2007b), this dictyostelid has specialized as one of the ‘weeds’ of the protist world.

Anthropogenic dispersal of dictyostelids has major implications for our understanding of these microorganisms’ biogeographical patterns. In particular, historical biogeographical patterns that depend on rare events over geologic time may be confounded by human activities that include fre-quent movement over long distances. To this end it is interesting to note that the four sets of footwear that were found to be carrying dictyostelids had four of the five largest amounts of soil adhering to them. This suggests that the simple act of ‘wiping your feet at the door’ could drastically decrease the incidence of invasive protist introductions.

31

Paper II: Northern Sweden and new species

Perrigo, A.L., Baldauf, S.L., Romeralo, M. (2013) Diversity of dictyostelid social amoebae in high latitude habitats of Northern Sweden. Fungal Diver-sity, 57(1):185–198

Paper II investigates dictyostelids of Northern Sweden in order to as-

sess species richness in high-latitude environments. The only previous study of dictyostelid social amoebae in Sweden investigated eight localities span-ning the length of the country, but only used morphological criteria for spe-cies descriptions (Kawabe, 1995). In Paper II we expanded on Kawabe’s work by including 29 sampling localities. These sites were selected to cover a large range of vegetation types. All dictyostelid species were initially iden-tified based on morphology and subsequently confirmed with nuclear SSU sequence data.

Nine dictyostelid species were recovered from Northern Sweden, two of which were previously undescribed. These are described in Paper II as Dictyostelium barbibulus and Polysphondylium fuscans. D. barbibulus be-longs to Dictyostelid Group 4, and is morphologically most similar to D. septentrionalis, but differs in key characters such as sorocarp height, clus-tered growth pattern and the presence of a basal disk. D. barbibulus exhibits a strongly stoloniferous habit, whereby newly germinated amoebae aggre-gate directly upon collapse of a sorus. This trait is also shared with D. chor-datum and D. implicatum, which together form a clade with D. barbibulus.

The second new species, Polysphondylium fuscans, is part of the vio-laceum-complex, and exhibits characteristics typical of this group including whorled branches and purple coloration of the sori. In fact, P. fuscans would fit into the broad morphological description of P. violaceum s.l., but the phylogeny based on SSU data indicates that P. fuscans is molecularly dis-tinct from P. violaceum. Furthermore, several morphological characteristics differentiate it from P. violaceum senso Raper (1984), such as the lower number of whorls and the light coloration of the sori for which it is named. This species was first recovered in Paper I, and has since been recovered from several localities in Norway (Romeralo et al., unpublished data).

Of the nine species, seven are new records for Sweden. Only D. mu-coroides and D. minutum had been recovered earlier (Palm, 1935; Kawabe, 1995; Paper I). Three other species that had been recovered in Sweden pre-viously, D. purpureum, P. pallidum, and P. violaceum were not recovered in this study. The reasons for finding different species are discussed in detail in Paper II, and probably are due in part to the presence of pseudo-cryptic species, such as P. fuscans, which looks similar to P. violaceum, but is phy-logenetically unique and morphologically differentiable in light of the phy-logeny.

32

This study emphasized that the species richness of dictyostelids in the high-latitude regions of the northern hemisphere may be greater than initial-ly expected. More thorough sampling efforts in these regions may still re-cover previously unknown species, as was demonstrated by the two species described here. Furthermore, by looking at both morphological differences along with phylogenetic methods it is possible to delimit species that may otherwise be identified as belonging to larger species complexes.

33

Paper III: Iceland and the latitudinal gradient

Perrigo, A.L., Moya-Larano, J., Baldauf, S.L., Romeralo, M. (Submitted) Everything is not everywhere: a latitudinal gradient of protist diversity.

After finding that the species richness of Sweden was much higher

than previously known (Paper II), we moved on to work in an area at a similar latitude, but much more geographically isolated than Sweden: Ice-land. Here we assessed both the dictyostelid species richness of the island and also conducted statistical analyses to find ecological patterns in habitat preferences. Additionally, a global analysis of previously published reports of dictyostelid species occurrence was conducted in order to assess the num-ber of species anticipated at different latitudes. This was used to investigate if the dictyostelid exhibit a latitudinal gradient of species richness.

Only four dictyostelid species were recovered from Iceland. This was surprising, considering that much higher numbers of species were recovered from other high-latitude localities. This may be a result of historical process-es similar to those that have contributed to the low vascular plant diversity on Iceland, such as the island’s distance from other landmasses and the rela-tively infrequent rate of successful dispersal from the mainland to Iceland. Here we found that the dictyostelid richness on Iceland was significantly correlated with both soil pH and with altitude. However, it is possible that the effect of altitude could be correlated to other untested factors such as vegetation diversity.

The global analysis of dictyostelid occurrence found a significant negative correlation with latitude, i.e. more species are expected towards the equator (P=0.003). This trend, known as the latitudinal gradient of species richness, is well known in macroorganisms, but very little evidence has been presented for a similar trend in microorganisms.

Paper III suggests that dictyostelids exhibit similar ecological bioge-ographic trends as larger organisms. It also presents evidence for the envi-ronmental limitations (pH and altitude) of dictyostelid occurrence, which corroborate earlier findings (Romeralo et al., 2011b).

34

Paper IV: Dictyostelium aureostipes species complex

Perrigo, A.L., Romeralo, M., and Baldauf, S.L. (Submitted). The yellow slime mold is a red herring: large hidden diversity in a single protest morphospecies.

Dictyostelium aureostipes is a Group 1 dictyostelid that is notable for

the yellow coloration of its fruiting bodies and its often highly-branching sorophores. Early dictyostelid phylogenies indicated that D. aureostipes var. aureostipes and D. aureostipes var. helveticum together may not be mono-phyletic (Schaap et al., 2006; Romeralo et al., 2011a). In Paper IV we as-sessed the monophyly of D. aureostipes in order to a) better understand the species relationships in Dictyostelid Group 1 and b) to determine if D. aureostipes is in fact a single, cosmopolitan species, or if it is made up of a number of species.

Fifty-seven isolates of D. aureostipes and closely related species were collected and the SSU and ITS regions were sequenced, along with the atp1, a mitochondrial marker designed for this study. These combined sequence data were used to infer a phylogeny for D. aureostipes and several closely related species, selected based on earlier molecular phylogenies (Schaap et al., 2006; Romeralo et al., 2011a).

The resulting phylogeny (Figure 6) indicates that the isolates identi-fied as D. aureostipes do not form a monophyletic group, and in fact make up at least five genetically distinct clades that are interspersed with other dictyostelid morphospecies. Furthermore, these five clades each show unique biogeographical patterns.

Each of the five D. aureostipes clades is well-supported in the phy-logeny, and these clades probably represent at least as many species. How-ever, further morphological work will be needed in order to delimit and de-scribe the species in this complex. It is notable that the deeper nodes in this phylogeny are not well supported (Figure 6). This could be due to the use of inappropriate markers (too quickly evolving) in regards to this specific issue, but biological explanations are also possible.

Paper IV concludes that D. aureostipes is one of a number of protist ‘species complexes’ which are delimited by a striking morphological feature – in this case yellow pigmentation. Species complexes are a leading reason that protist species richness is routinely underestimated. Furthermore, spe-cies delimited by morphology alone often appear to be cosmopolitan, when in fact they are made up of a series of geographically limited cryptic or pseudo-cryptic species (Heger et al., 2009). This has important implications

35

for both conservation and invasion biology. For these reasons we emphasize the need for well-sampled multi-gene phylogenies as a basis for taxonomic delimitation and biogeographic studies in protists.

Figure 6. Phylogeny of Dictyostelid Group 1A+B including multiple isolates of Dictyostelium aureostipes and D. fasciculatum morphospecies. The tree was derived by Bayesian analysis of combined SSU and atp1 sequences. The names indicated on the phylogeny refer to various isolates identified as D. aureostipes as indicated by the key in the upper left. Names in bold italics indicate holotypes. Maximum likeli-hood bootstrap support (BS) over 50% and Bayesian inference posterior probabili-ties (PP) over 0.70 are shown on the branches to the left and right of the slash mark,

NZ125BD. fasciculatum NZ155B1

NZ40C

TAS30AD. antarcticum NZ43B

OZ17A

OH438GSE7B

KAL7A

Chile10B1D. fasciculatum SmokOW9A

D. fasciculatum Nor84ED. fasciculatum Nor86DD. fasciculatum HM595

D. fasciculatum Ice238A2

Got9A1D. fasciculatum SH3

Got5B4Got8A1

AKL43C

TH4BTH3B

D. delicatum TNS226

D. aureostipes I3

YA6

KP3

OH110 BW6OH111

BP7BMAQ52B

JKS150

Thai3A2

LR2

CR6B1

Got3A2

SF2

Thai2C1

TH18DB15ATH39AAU7B

OH396

Nor90A

Nor83C

D. myxobasis NT2ATH1A

Sweden8W

HM593HM592HM594

Sweden14-1AKL28B

Nor99A

D. medusoides OH592 D. granulophorum CH11-4

D. aureostipes var. helveticum GE1

Sweden11F

D. mexicanum Mex-TF4B1

0.4 substitutions per site

THC11X

D. stellatum SAB7B

D. bifurcatum UK5

D. parvisporum OS126D. microsporum Hagiwara143

D. amphisporum BM9AD. macrocarpumMGE2D. exiguum KP94

52A1

89/1.0

100/1.0

100/1.0

100/1.0

77/1.0

61/1.0

-/0.95

69/0.99

71/0.9957/0.71

100/1.0

100/1.0

100/1.0

93/1.0

93/1.095/1.0

92/1.0

-/0.94

-/0.94

‘FAD’ Clade

Aureostipes Clade

Thailand Clade

Myxobasis Clade

HelveticumClade

Outgroups

Dictyostelium aureostipesD. (cf) aureostipesD. spD. aureostipes var. helveticum

36

respectively. The five well-supported clades including D. aureostipes isolates are indicated by colored backgrounds with proposed group names specified to the right. The phylogeny is rooted following Schaap et al. (2006).

37

Conclusions

This thesis consists of four papers that explore the systematics and bi-ogeography of dictyostelid social amoebae. The findings expand on previous knowledge of global dictyostelid species richness and distribution patterns. Furthermore, the results have several implications for the possible endemici-ty of species in the group as well as the limitations of the current taxonomy.

The papers in this thesis highlight some of the ecological biogeo-graphic patterns exhibited by dictyostelids. Building on earlier evidence, Paper III shows that in Iceland dictyostelid species occurrence peaks in near neutral pH soils, and also at lower altitudes. Furthermore, a global anal-ysis confirmed that dictyostelids follow a latitudinal gradient of species richness in the Northern hemisphere – a pattern that had been observed but never statistically tested. However, though high latitude regions, such as Sweden, have fewer species than the tropic this does not mean that the rela-tively low species richness of these areas is fully known. In Paper II two new species are described, Dictyostelium barbibulus and Polysphondylium fuscans, and five further species were reported from Sweden for the first time. Together, the data suggest that dictyostelids show some ecological patterns that are similar to those seen in macroorganisms, and that continued work is needed to know how speciose this group is.

In the context of the ‘everything is everywhere debate,’ several points can be made based on the results of the papers in this thesis. Some species, which are morphologically defined, appear to be cosmopolitan. This was the case with Dictyostelium aureostipes in Paper IV. After this morphospecies was assessed in a phylogenetic context it became clear that it is in fact not everywhere, and is instead a species complex made up of a series of distinct clades with varying distributions. This is a case of taxonomic confusion, which is a major problem when assessing species distributions. Furthermore, the results from Paper I, where four species of dictyostelid were recovered from boots, are evidence of anthropogenic dispersal in these microorgan-isms. If dictyostelids are being frequently transported by humans, as seems to be the case, this may be rapidly expanding species distributions. This has consequences for our understanding of historical biogeographic patterns, which may be obscured before they are detected.

38

Svensk Sammanfattning

Förundra dig över allt, även det mest alldagliga.

Valspråk av Carl von Linné (1707-1778)

Denna avhandling behandlar systematiken och biogeografin hos dic-tyostelida sociala amöbor. Dictyostelider är bakterieätande amöbor som lever i marken och kan hittas över hela världen. Det finns runt 150 kända arter, men troligtvis är den verkliga artrikedom betydligt högre. Dicty-ostelider är medlemmar av Amoebozoa, och kan mer allmänt betraktas som "protister." Protister är en generellt benämning för alla eukaryota organismer som inte är växter, djur eller svampar.

Dictyosteliderna är ett intressant protistiskt taxon då de också har ett äkta multicellulärt stadium under deras livscykel. När amöborna svälter skickar de ut en kemisk signal, ett så kallat akrasin, vilket initierar en ag-gregering med alla närliggande amöbor. Tillsammans bildar de en snigel-liknande organism som kan migrera korta sträckor innan den slutligen for-mar en fruktkropp. Fruktkroppen består av en stjälk på upp till cirka en cen-timeter, med ett sorus (”kula”) av sporer i slutänden, och ibland också med ytterligare sori på eventuella sidogrenar. Det är denna multicellulära fruktkropp, den såkallade sorocarpen, som oftast används när en dictyostelid ska artbestämmas.

Dictyosteliderna är indelade i tre släkten: Acytostelium (med acellulä-ra stjälkar), Dictyostelium (med cellulära stjälkar och antingen oregelbundna eller inga grenar), samt Polysphondylium (med cellulära stjälkar och vridna grenar). Trots de morfologiska likheterna inom de olika släktena så har ge-netiska studier visat att alla tre släkten är polyfyletiska. Baserat på dicty-ostelidernas fylogeni kan istället åtta större grupper urskiljas: Dictyostelid Grupp 1, 2A, 2B, 3 och 4, samt violaceum-komplexet, polycarpum-komplexet och polycephalum-komplexet.

En av de viktigaste biogeografiska frågorna när det gäller såväl dicty-ostelider som andra eukaryota mikroorganismer är huruvida dessa organis-mer har en begränsad utbredning och vad detta i så fall beror på. Om en art har en sådan utbredning så kan man vidare ställa sig frågan: Är detta ett resultat av ekologiska eller historiska processer, eller en kombination av båda?

39

Artikel I behandlade en möjlig spridningsväg för dictyostelider: Människor. Det har tidigare visats att en mängd små djur, så som syrsor, maskar och fåglar, kan transportera dictyostelider till nya platser, men att också människan kan ha en inverkan på dess spridning hade hittills inte varit känt. I denna artikel hade smuts från 18 par skor analyserats. Det visade sig att åtminstone fyra av paren hade levande dictyostelider under skosulorna. Dessa fyra par bar på totalt tre olika arter av dictyostelider, inklusive en ny art som vid artikelns publicering ännu inte beskrivits. I artikel II beskrevs denna nya art som Polysphondylium fuscans (sp.nov.).

Artikel II undersökte artrikedomen av dictyotelider i norra Sverige. Nio arter återfanns i denna studie, varav två nya arter: Dictyostelium barbib-ulus (sp.nov.) samt P. fuscans (sp.nov.). Denna artikel belyste även fördelen med att använda gensekvensering för identifiering av dictyostelider. Vidare diskuterade artikeln även svårigheten med att identifiera vissa arter som liknar varandra morfologiskt men är distinkta enligt molekylära fyloge-netiska analyser. Även förekomsten av artkomplex inom flera av de stora fylogenetiskt definierade grupperna av dictyostelider behandlades.

Artikel III fokuserade på de ekologiska mönstren av dictyostelidernas biogeografi. Här undersöktes hur olika miljöförhållanden relaterar till förekomsten av dictyostelider. Det visades att antalet arter av dictyostelider på Island korrelerar negativt med höjden (dvs. fler arter vid lägre latituder). Det visades också att majoriteten av alla dictyostelider påträffas vid nära neutrala pH-värden, även om ytterligare en topp i förekomst kunde ses runt pH=5. I artikel III gjordes dessutom en global analys, baserat på tidigare publicerade artiklar i ämnet, av de dictyostelider som beskrivits från norra halvklotet med syftet att kunna förutsäga hur gruppens artrikedom förändras beroende på latituden. Resultatet av detta visade att dictyostelidernas mång-fald minskar signifikant med ökande latitud, ett mönster som också kan ses hos de flesta makroorganismer och som kommit att kallas den ”latitudinella gradienten av arternas diversitet”.

I den sista artikeln, artikel IV, behandlades den möjliga polyfylin in-om Grupp 1 dictyosteliden Dictyostelium aureostipes. Ett protokoll för att amplifiera den mitokondriella atp1-region i dictyostelider utvecklades för denna studie. Denna region användes vidare som supplement till de mer allmänt använda SSU och ITS för att härleda fylogenin hos D. aureostipes och andra närbesläktade dictyostelider. Dessa tre genetiska markörer ampli-fierades utifrån 57 isolat bestående av D. aureostipes och närbesläktade ar-ter. Den resulterande fylogenin visade att de isolat som tidigare identifierats som D. aureostipes inte är en enhetlig monofyletisk grupp, utan snarare ut-görs av ett antal olika arter.

Artiklarna i denna avhandling belyser tillsammans svårigheterna med att identifiera och avgränsa olika dictyostelida arter, vilket tydligt framgår i artikel II och IV. De ekologiska faktorer som bidrar till dictyostelidernas

40

naturliga utbredning utreds i artikel III, där en latitudinell förändring av deras mångfald förutsägs och bekräftas, vilket tyder på att dessa eukaryota mikroorganismer uppvisar liknande biogeografiska mönster som observerats hos makroorganismer. I artikel I identifieras slutligen människan som en viktig bidragande faktor till spridningen av dictyostelider – något som avsevärt kan försvåra analysen av dessa organismers historiska utbredning.

41

Acknowledgements

I would like to start by thanking my supervisors, Sandie and Maria,

for all of the energy and time you have committed to me over the last five years. Nothing here would have been possible without you.

Sandie, you have taught me so much about science. Especially in my writing, you have shown me the power of brevity and clarity. I have also enjoyed all of our time chatting about cats, gardens and stateside visits.

Maria R, your patience with me during the endless hours I spent on the microscope asking questions was amazing. The amount that you taught me about these awesome little amoebae is so much more than I ever ex-pected. Your support and encouragement really got me through much more than I ever could have handled on my own. You are one of the strong, wom-en researchers that I aspire to be like.

To my fellow PhD students at SystBio: Anders L, Anders R, Anja, Anneleen, Astrid, Chanda, Ding, Hugo, John, Maria L, Ping, Sanea, Sarina, Stina W, Sunniva and Vichith. Every one of you has, at some point, support-ed me by hashing out ideas, providing moral support or (most importantly?) by sharing delicious fika. The PhD students of SystBio seem to work on an unspoken open-door policy, and I am grateful to have been able to take ad-vantage of that. We’re all in this together.

I would especially like to thank my colleagues that read this thesis and provided me with valuable feedback: Magnus, Maria, Martin, Mats, Mikael, Petra and Åsa. They caught many errors and provided interesting discussion on numerous topics. Any remaining oversights in the thesis are mine alone.

Emma Arvestål transformed my Swedish summary from a Google-translate mess into something coherent and readable. John did the final touch-ups. Thank you both.

Afsaneh and Nahid, thank you for your help in the lab, Swedish prac-

tice, and hints on integrating into Swedish life and culture. Anneleen: you, unlike Hugo, are a pretty good acknowledgement

writer (see de Boer, 2012; Kool, 2012). I’m not sure what exactly it was that

42

you and Cajsa saw in me during the VEM course in 2007, but I suspect you picked up on my fika ability early on – leading to my recruitment as your student, ice-cream-on-the-lawn partner, floating-in-the-pool-in-Marrakech companion and donkey stealer (sorry, Floris). You are the only other person insane enough to agree to take off to Jordan for a week with the goals of a) writing manuscripts and b) riding camels in the desert wearing lab jackets (not necessarily in that order). I hope there are many more efficiency excur-sions and synchronized tomatoes in our future. Mora, mora.

Hugo, you’re OK too. Thanks for teaching me the art of applying for external money and how to be shamelessly confident and self-promoting. I think you out-American me at times. Also, thanks for helping me tow my car half way across Uppsala by a dodgy rope attached to the engine (and various other car fiascos). Good judgment should never get in the way of getting things done.

Karin L, you have shown impressive patience with me. One would think that after five years I could operate Tur-Retur on my own, but alas: no. It was always a pleasure to bother you for admin help.

Marianne, you saved me from more teaching disasters than I could probably count. Thanks for being so on top of it.

Mikael, the bad cop: thank you for explaining the difference between maximum likelihood and Bayesian analysis. After three glasses of wine it made perfect sense. You always know when I need to be taken down a notch and as much as you try not to be, you are an excellent support. And now I know that yes, it is attached.

Petra, the good cop, and the first person I got to know at SystBio: you are an inspiration. Not only your ability to juggle kids, work, teaching and some PhD students, but also your capacity to keep a positive attitude throughout it all. You always have time for my questions, musings and rants – and I don’t know how you do it.

I have shared an office with some pretty fantastic people over the last five years: Anja, Henrik L, Anneleen, Stina B, Crystal, Stephanie, Henrik S, Sanea, Sarina and Yan. I also shared it with some pretty gross stick bugs. Sorry about that, Anja. But thanks Ralf and Michi for taking some of them off my hands.

(A selection of) the SystBio kids: Floris, Bente, Dirk, Julius, Raphael. The hours you spent playing in my office may not have been the most pro-ductive for me, but they were among the most fun. You all know that I keep the most important items in the bottom drawer.

All of my students: you have probably taught me much more than I ever managed to teach you. I am happy that so many of you are now among my peers: Glib, Sanea, Stina B and Stina W, and others.

43

A special thanks to the project students I had the privilege to super-vise: Karin S and Albert. The energy you bring to your projects is a fun re-minder that this is pretty cool stuff we get to do.

The professors at the department: Inga, Leif, Magnus, Mats, Mikael, Petra, Sandie and Thomas. You are such a wealth of knowledge and I am happy to have learned from all of you.

The SystBio young researchers: Baset, Maria R, Martin, Omar, Paco, Sanja and Åsa. For a PhD student, you guys are one of the best resources and (hopefully) a glimpse into what comes after the defense.

The other members of the Baldauf Lab: CJ, Ding, Gemma, Johanna, Maria R, Omar, Ping and Sanea. It has been a pleasure to work with all of you.

Many more colleagues and co-workers who have made it fun to come to work every day: Agneta, Elisabeth B, Elisabeth L, Henrik V and Katarina.

Johanna and Maria L: life can be unfair and unjustly short. You both showed so much strength and unbelievable positive attitudes. You are missed.

Everyone at Palaeo: Aodhán, Emma, Graham, Heda, Illiam, Jenny, Linda, Luka, Michi, Oskar, Ralf and Steve - thank you for the many beers, TGIFs and a little outside perspective.

Birgitta, Elisabet and Lars-Göran, my Swedish family, thank you for many lovely visits at Hunnebostrand. You make me feel at home here.

My friends in Kirkland, Vancouver, Uppsala and those spread around the rest of the world: I am happy to be associated with such a diverse and remarkable group of people. The world feels a bit smaller knowing that wherever I go I am likely to meet up with an old friend.

Over the course of my studies I received funding, grants and stipends

from a number of groups. These allowed me to attend conferences and courses, do field work, meet with collaborators, and buy laboratory and field equipment. I am grateful to: Anna Maria Lundins Stipendiefond, Colorado State University: Summer Soil Institute, EBC Graduaue School on Genomes and Phenotypes, ForBio Research School in Biosystematics, Gertrud Thelins Resestipendium, Helge Ax:son Johnsons Stiftelse, Liljewalchs Resestipen-dium, National Geographic Global Exploration Fund, Sernanders Stiftelse, Signhild Engqvists Stiftelse, Stiftelsen Lars Hiertas Minne and Tullbergs för Biologisk Forskning.

Many people back home have influenced me and helped me get here:

Sharon Winter, my high school biology teacher, and the first person to introduce me to PCR (done by hand). I didn’t know it at the time, but you set me on the right path. Thank you.

44

Dr. Bowerman, and everyone at the Cat & Dog Clinic: thanks for keeping me around. My years there were the most comprehensive animal biology course I’ve had to date. More importantly you guys taught me about responsibility, dealing with people and how to have plenty of fun while get-ting lots done.

The first PhD students I ever met, Andrew and Louise at Earth and Ocean Sciences, UBC: you guys showed me what a life in research was, and that it is where I belong.

Wayne Goodey at UBC: thank you for loaning me books and making a 300-person ecology course feel a little smaller.

Susan: I am now aware that you are not my grandmother, but you are family. I’m looking forward to my next Medford visit.

Laurent, the only person with as much energy as Lia: it is always an adventure to visit you guys (in France or LA) and to join your boisterous French family for a few days.

Cousin Megan: very few people visited me here in Sweden, and the number of times you have taken the initiative to come and visit has meant so much to me… and not only because we have epic adventures… although that doesn’t hurt.

The rest of the Perrigos, Babbs, Wilsons and Gandees: Grandma Hon-ey & Grandpa Jim, Grandma Mary & Grandpa George, Susie, Rick, Mary Kay, Tom, Christine, Paul, Mary Sue, Megan, Orion, Kevin, Tracy, Elliott, Julie, Robbie, Tami, Tommy & all the kids. Thanks for being a fantastic family. I’m lucky.

Chris: you have been an unwavering source of support over the last five years. You have always known when I needed a glass of wine after work and when to encourage a lazy Sunday. You have managed to make my research sound exciting when I shy away from talking about it. Thank you for encouraging me to undertake a PhD in the first place and for joining me in Sweden.

And finally, thank you to my family. Thank you dad for teaching me to do long division to keep me quiet on road trips, for building me a circuit board to play with, showing me how to chart the temperature to see when it would start to snow, taking me fossil hunting and taking me to your amateur astronomy lectures. Mom: thank you for putting up with a clone of dad. It couldn’t be easy to have two of us in the house (the same thank you also goes to Lia). Thank you for never forcing me to go to school when I didn’t feel like it, for never pushing me to do my homework and for always letting me just be myself. Somehow this all backfired and I turned into a motivated person. Thank you guys for sending me to Space Camp, and for letting me take off to other countries to pursue my education and my life. Thank you Lia for trying to keep me from being too serious, for reminding me that sometimes it isn’t all about being cheap, and for sneakily morphing from an

45

annoying little sister into a good friend and someone I can always count on. Also thank you for your dramatic readings of early versions of this thesis in your best David Attenborough voice. I love you guys. I am sure I have forgotten to include some people. I’m sorry for any over-sights, please add yourself here: ____________ thank you for ____________, but Allison you are a _______ (your name) (happy memory we have together) (insult) for forgetting to include me in your acknowledgements.

46

References

Adl S.M., Leander B.S., Simpson A.G.B., Archibald J.M., Anderson O.R., Bass D., Bowser S.S., Brugerolle G., Farmer M.A., Karpov S., Kolisko M., Lane C.E., Lodge D.J., Mann D.G., Meisterfeld R., Mendoza L., Moestrup Ø., Mozley-Standridge S.E., Smirnov A.V., & Spiegel F. (2007) Diversity, Nomenclature, and Taxonomy of Protists. Systematic Biology, 56, 684–689.

Adl S.M., Simpson A.G.B., Farmer M.A., Andersen R.A., Anderson O.R., Barta J.R., Bowser S.S., Brugerolle G., Fensome R.A., Fredericq S., James T.Y., Karpov S., Kugrens P., Krug J., Lane C.E., Lewis L.A., Lodge J., Lynn D.H., Mann D.G., Mccourt R.M., Mendoza L., Moestrup O., Mozley-Standridge S.E., Nerad T.A., Shearer C.A., Smirnov A.V., Spiegel F.W., & Taylor M.F.J.R. (2005) The new higher level classification of eukaryotes with emphasis on the tax-onomy of protists. The Journal of Eukaryotic Microbiology, 52, 399–451.

Adl S.M., Simpson A.G.B., Lane C.E., Lukeš J., Bass D., Bowser S.S., Brown M.W., Burki F., Dunthorn M., Hampl V., Heiss A., Hop-penrath M., Lara E., le Gall L., Lynn D.H., McManus H., Mitchell E.A.D., Mozley-Stanridge S.E., Parfrey L.W., Pawlowski J., Rueck-ert S., Shadwick L., Schoch C.L., Smirnov A., & Spiegel F.W. (2012) The revised classification of eukaryotes. Journal of Eukary-otic Microbiology, 59, 429–514.

Aguilar M., Fiore-Donno A.-M., Lado C., & Cavalier-Smith T. (2013) Using environmental niche models to test the “everything is everywhere” hypothesis for Badhamia. The ISME Journal.

Baas Becking L. (1934) Geobiologie of inleiding tot de milieukunde. WP Van Stockum & Zoon, The Hague.

Baldauf S.L. (2003) The Deep Roots of Eukaryotes. Science, 300, 1703–1706.

47

Baldauf S.L. & Doolittle W. (1997) Origin and evolution of the slime molds (Mycetozoa). Proceedings of the National Academy of Sciences of the United States of America, 94, 12007–12012.

Bass D. & Boenigk J. (2011) Everything is everywhere: a twenty-first centu-ry de-/reconstruction with respect to protists. Biogeography of Mi-croscopic Organisms pp. 88–110. Cambridge University Press, Cambridge, UK.

Blaskovics J. & Raper K.B. (1957) Encystment stages of Dictyostelium. The Biological Bulletin, 113, 58–88.

Bloomfield G. (2013) Sex in Dictyostelia. Dictyostelids (ed. by M. Romera-lo, S. Baldauf, and R. Escalante), pp. 129–148. Springer Berlin Hei-delberg, Berlin, Heidelberg.

Bloomfield G., Skelton J., Ivens A., Tanaka Y., & Kay R.R. (2010) Sex Determination in the Social Amoeba Dictyostelium discoideum. Science, 330, 1533–1536.

Boenigk J., Ereshefsky M., Hoef-Emden K., Mallet J., & Bass D. (2012) Concepts in protistology: Species definitions and boundaries. Euro-pean Journal of Protistology, 48, 96–102.

De Boer H. (2012) Snake Gourds, Parasites and Mother Roasting: Medici-nal plants, plant repellents, and Trichosanthes (Cucurbitaceae) in Lao PDR. Uppsala University, Uppsala, Sweden.

Bonner J.T. (2009) The social amoebae the biology of cellular slime molds. Princeton University Press, Princeton.

Brefeld O. (1869) Dictyostelium mucoroides. Ein neuer Organismus aus der Verwandtschaft der Myxomyceten. Abhandl Senckenb Naturforsch Ges, 85–107.

Brefeld O. (1884) Polysphondylium violaceum und Dictyostelium mu-coroides nebst Bemerkungen zur Systematik der Schleimpilze. Un-ters Gesammtgeb Mykol, 6, 1–34.

Brock D.A., Douglas T.E., Queller D.C., & Strassmann J.E. (2011) Primi-tive agriculture in a social amoeba. Nature, 469, 393–396.

Brown M.W., Kolisko M., Silberman J.D., & Roger A.J. (2012) Aggregative Multicellularity Evolved Independently in the Eukaryotic Super-group Rhizaria. Current Biology, 22, 1123–1127.

48

Brown M.W. & Silberman J.D. (2013) The Non-dictyostelid Sorocarpic Amoebae. Dictyostelids (ed. by M. Romeralo, S. Baldauf, and R. Escalante), pp. 219–242. Springer Berlin Heidelberg, Berlin, Hei-delberg.

Budniak A.A. & O’Day D.H. (2012) Microcysts: The Third Developmental Pathway of Social Amoebozoans. Protist, 163, 2–14.

Caron D.A. (2009) Past President’s Address: Protistan Biogeography: Why All The Fuss? Journal of Eukaryotic Microbiology, 56, 105–112.

Cavalier-Smith T. (1998) A revised six-kingdom system of life. Biological Reviews of the Cambridge Philosophical Society, 73, 203–266.

Cavalier-Smith T. (2003) Protist phylogeny and the high-level classification of Protozoa. European Journal of Protistology, 39, 338–348.

Cavalier-Smith T., Chao E.E.-Y., & Oates B. (2004) Molecular phylogeny of Amoebozoa and the evolutionary significance of the unikont Phalansterium. European Journal of Protistology, 40, 21–48.

Cavender J.C. (1973) Geographical distribution of the Acrasiae. Mycologia, 65, 1044–1054.

Cavender J.C. (1978) Cellular slime molds in tundra and forest soils of Alaska including a new species, Dictyostelium septentrionalis. Ca-nadian Journal of Botany, 56, 1326–1332.

Cavender J.C. (2013) A Global Overview of Dictyostelid Ecology with Spe-cial Emphasis in North American Forest. Dictyostelids (ed. by M. Romeralo, S. Baldauf, and R. Escalante), pp. 149–166. Springer Berlin Heidelberg, Berlin, Heidelberg.

Cavender J.C., Bradshaw R.A., Regner J.P., & Damio T. (1993) Response of soil dictyostelid slime molds to agricultural disturbance in a tropical environment. Biotropica, 25, 245–248.

Cavender J.C. & Raper K.B. (1965) The Acrasieae in nature. III. Occurrence and distribution in forests of eastern North America. American Journal of Botany, 52, 302–308.

Cavender J.C. & Raper K.B. (1968) The ocurrence and distribution of Acra-sieae in forests of subtropical and tropical America. American Jour-nal of Botany, 55, 504–513.

49

Cienkowski L. (1873) Guttulina rosea. Trans. Bot. Sect. 4th Meeting Russian Naturalists at Kazan.

Cocucci S.M. & Sussman M. (1970) RNA in cytoplasmic and nuclear frac-tions of cellular slime mold amebas. The Journal of Cell Biology, 45, 399–407.

Corliss J.O. (1984) The kingdom PROTISTA and its 45 phyla. Biosystems, 17, 87–126.

Cotter D. & Raper K.B. (1968) Spore germination in strains of Dictyosteli-um discoideum and other members of the Dictyosteliaceae. Journal of Bacteriology, 96, 1690–1695.

Cracraft J. (1983) Species concepts and speciation analysis. Current Orni-thology Plenum Press.

Dayrat B. (2005) Towards integrative taxonomy. Biological Journal of the Linnean Society, 85, 407–415.

Eichinger L., Pachebat J.A., Glöckner G., Rajandream M.-A., Sucgang R., et al. (2005) The genome of the social amoeba Dictyostelium dis-coideum. Nature, 435, 43–57.

Eisenberg R. (1976) Two-dimensional microdistribution of cellular slime molds in forest soil. Ecology, 57, 380–384.

Fenchel T. & Finlay B.J. (2004) The Ubiquity of Small Species: Patterns of Local and Global Diversity. BioScience, 54, 777.

Fenchel T. & Finlay B.J. (2006) The diversity of microbes: resurgence of the phenotype. Philosophical Transactions of the Royal Society B: Bio-logical Sciences, 361, 1965–1973.

Fey P., Gaudet P., Pilcher K.E., Franke J., & Chisholm R.L. (2006) dicty-Base and the Dicty Stock Center. Dictyostelium discoideum Proto-cols pp. 51–74. Humana Press, New Jersey.

Finlay B.J. (2002) Global Dispersal of Free-Living Microbial Eukaryote Species. Science, 296, 1061–1063.

Fiore-Donno A.M., Clissmann F., Meyer M., Schnittler M., & Cavalier-Smith T. (2013) Two-Gene Phylogeny of Bright-Spored Myxomy-cetes (Slime Moulds, Superorder Lucisporidia). PLoS ONE, 8, e62586.

50

Fiore-Donno A.M., Nikolaev S.I., Nelson M., Pawlowski J., Cavalier-Smith T., & Baldauf S.L. (2010) Deep Phylogeny and Evolution of Slime Moulds (Mycetozoa). Protist, 161, 55–70.

Fiz-Palacios O., Romeralo M., Ahmadzadeh A., Weststrand S., Ahlberg P.E., & Baldauf S. (2013) Did Terrestrial Diversification of Amoe-bas (Amoebozoa) Occur in Synchrony with Land Plants? PLoS ONE, 8, e74374.

Foissner W. (1999) Protist diversity: estimates of the near-imponderable. Protist, 150, 363–368.

Foissner W. (2006) Biogeography and dispersal of micro-organisms: a re-view emphasizing protists. Acta Protozoologica, 45, 111–136.

Glöckner G. & Noegel A.A. (2013) Comparative genomics in the Amoebo-zoa clade: Comparative genomics in the Amoebozoa clade. Biologi-cal Reviews, 88, 215–225.

Haastert P.J.M.V. (1982) Identification of a Pterin as the Acrasin of the Cel-lular Slime Mold Dictyostelium lacteum. Proceedings of the Na-tional Academy of Sciences, 79, 6270–6274.

Haeckel E. (1866) Generelle Morphologie der Organismen: allgemeine Grundzüge der organischen Formen-Wissenschaft, mechanisch be-gründet durch die von Charles Darwin reformirte Descendenz-Theorie. G. Reimer, Berlin.

Hagiwara H. (1989) The taxonomic study of Japanese dictyostelid cellular slime molds. National Science Museum, Tokyo.

Heger T.J., Mitchell E.A.D., Ledeganck P., Vincke S., Van de Vijver B., & Beyens L. (2009) The curse of taxonomic uncertainty in biogeo-graphical studies of free-living terrestrial protists: a case study of testate amoebae from Amsterdam Island. Journal of Biogeography, 36, 1551–1560.

Heidel A.J., Lawal H.M., Felder M., Schilde C., Helps N.R., Tunggal B., Rivero F., John U., Schleicher M., Eichinger L., Platzer M., Noegel A.A., Schaap P., & Glockner G. (2011) Phylogeny-wide analysis of social amoeba genomes highlights ancient origins for complex inter-cellular communication. Genome Research, 21, 1882–1891.

51

Hogg J. (1860) On the distinctions of a plant and an animal and on a Fourth Kingdom of Nature. Edinburgh New Philosophical Journal, 12, 216–225.

Huss M. (1989) Dispersal of cellular slime molds by two soil invertebrates. Mycologia, 81, 677–682.

Kawabe K. (1995) Distribution of Dictyostelid Cellular Slime Molds in For-est Soils of Sweden. Bulletin of Japanese Society of Microbial Ecol-ogy, 10, 115–118.

Konijn T., Barkley D., & Bonner J. (1968) Cyclic AMP: A naturally occur-ring acrasin in the cellular slime molds. The American Naturalist, 102, 225–233.

Kool A. (2012) Desert Plants and Deserted Islands: Systematics and Ethno-botany in Caryophyllaceae. Uppsala University, Uppsala, Sweden.

Kudryavtsev A. (2005) 18S Ribosomal RNA Gene Sequences of (Hi-matismenida) and the Phylogeny of Amoebozoa. Protist, 156, 215–224.

Larson G. (2003) The complete Far side. Andrews McMeel Pub, Kansas City, Mo.

Levine N.D., Corliss J.O., Cox F.E.G., Deroux G., Grain J., Honigberg B.M., Leedale G.F., Loeblich A.R., Lom I.J., Lynn D., Merinfeld E.G., Page F.C., Poljansky G., Sprague V., Vavra J., & Wallace F.G. (1980) A Newly Revised Classification of the Protozoa. The Journal of Protozoology, 27, 37–58.

Martiny J.B.H., Bohannan B.J.M., Brown J.H., Colwell R.K., Fuhrman J.A., Green J.L., Horner-Devine M.C., Kane M., Krumins J.A., Kuske C.R., Morin P.J., Naeem S., Øvreås L., Reysenbach A.-L., Smith V.H., & Staley J.T. (2006) Microbial biogeography: putting micro-organisms on the map. Nature Reviews Microbiology, 4, 102–112.

Medlin L., Elwood H.J., Stickel S., & Sogin M.L. (1988) The characteriza-tion of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene, 71, 491–499.

Miller M.A., Pfeiffer W., & Schwartz T. (2011) The CIPRES science gate-way: a community resource for phylogenetic analyses. 1.

52

Mishler B.D. & Donoghue M.J. (1982) Species Concepts: A Case for Plural-ism. Systematic Biology, 31, 491–503.

Muñoz-Braceras S., Mesquita A., & Escalante R. (2013) Dictyostelium dis-coideum as a Model in Biomedical Research. Dictyostelids (ed. by M. Romeralo, S. Baldauf, and R. Escalante), pp. 1–34. Springer Ber-lin Heidelberg, Berlin, Heidelberg.

Nylander J. (2004) MrModeltest. Evolutionary Biology Center, Uppsala University., Uppsala, Sweden.

Olive E. (1901) A preliminary enumeration of the Sorophoreæ. Proceedings of the American Academy of Arts and Sciences, 37, 333–344.

Olive L. (1970) The Mycetozoa: A revised classification. The Botanical Review, 36, 59–89.

Olive L.S. (1975) The mycetozoans. Academic Press, New York.

Owen R. (1860) Palaeontology. Adam and Charles Black, Edinburgh, Scot-land.

Palm B. (1935) Ett fynd av Dictyostelium mucoroides i Sydsverige. Svensk Botanisk Tidskrift, 29, 365–366.

Parfrey L.W., Barbero E., Lasser E., Dunthorn M., Bhattacharya D., Patter-son D.J., & Katz L.A. (2006) Evaluating Support for the Current Classification of Eukaryotic Diversity. PLoS Genetics, 2, e220.

Parfrey L.W., Grant J., Tekle Y.I., Lasek-Nesselquist E., Morrison H.G., Sogin M.L., Patterson D.J., & Katz L.A. (2010) Broadly Sampled Multigene Analyses Yield a Well-Resolved Eukaryotic Tree of Life. Systematic Biology, 59, 518–533.

Parikh A., Miranda E.R., Katoh-Kurasawa M., Fuller D., Rot G., Zagar L., Curk T., Sucgang R., Chen R., Zupan B., Loomis W.F., Kuspa A., & Shaulsky G. (2010) Conserved developmental transcriptomes in evolutionarily divergent species. Genome Biology, 11, R35.

Pawlowski J. & Burki F. (2009) Untangling the Phylogeny of Amoeboid Protists. Journal of Eukaryotic Microbiology, 56, 16–25.

Posada D. (2008) jModelTest: Phylogenetic Model Averaging. Molecular Biology and Evolution, 25, 1253–1256.

53

Rambaut A. (2009) FigTree v.1.3.1. Computer program distributed by the author, University of Oxford.

Raper K.B. (1956) Factors affecting growth and differentiation in simple slime molds. Mycologia, 48, 169–205.

Raper K.B. (1984) The dictyostelids. Princeton University Press, Princeton, N.J.

Romeralo M., Cavender J.C., Landolt J.C., Stephenson S.L., & Baldauf S.L. (2011a) An expanded phylogeny of social amoebas (Dictyostelia) shows increasing diversity and new morphological patterns. BMC Evolutionary Biology, 11, 84.

Romeralo M., Escalante R., & Baldauf S.L. (2012) Evolution and Diversity of Dictyostelid Social Amoebae. Protist, 163, 327–343.

Romeralo M., Escalante R., Sastre L., & Lado C. (2007a) Molecular Sys-tematics of Dictyostelids: 5.8S Ribosomal DNA and Internal Tran-scribed Spacer Region Analyses. Eukaryotic Cell, 6, 110–116.

Romeralo M., Fiz-Palacios O., Lado C., & Cavender J.C. (2007b) A new concept for Dictyostelium sphaerocephalum based on morphology and phylogenetic analysis of nuclear ribosomal internal transcribed spacer region sequences. Canadian Journal of Botany, 85, 104–110.

Romeralo M., Moya-Laraño J., & Lado C. (2011b) Social Amoebae: Envi-ronmental Factors Influencing Their Distribution and Diversity Across South-Western Europe. Microbial Ecology, 61, 154–165.

Romeralo M., Skiba A., Gonzalez-Voyer A., Schilde C., Lawal H., Kedziora S., Cavender J.C., Glockner G., Urushihara H., & Schaap P. (2013) Analysis of phenotypic evolution in Dictyostelia highlights devel-opmental plasticity as a likely consequence of colonial multicellular-ity. Proceedings of the Royal Society B: Biological Sciences, 280, 20130976–20130976.

Romeralo M., Spiegel F.W., & Baldauf S.L. (2010) A Fully Resolved Phy-logeny of the Social Amoebas (Dictyostelia) Based on Combined SSU and ITS rDNA Sequences. Protist, 161, 539–548.

Ronquist F. & Huelsenbeck J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574.

54

Scamardella J. (1999) Not plants or animals: a brief history of the origin of Kingdoms Protozoa, Protista and Protoctista. International Microbi-ology, 2, 207–216.

Schaap P., Winckler T., Nelson M., Alvarez-Curto E., Elgie B., Hagiwara H., Cavender J., Milano-Curto A., Rozen D.E., Dingermann T., Mutzel R., & Baldauf S.L. (2006) Molecular Phylogeny and Evolu-tion of Morphology in the Social Amoebas. Science, 314, 661–663.

Schlegel M. (1991) Protist evolution and phylogeny as discerned from small subunit ribosomal RNA sequence comparisons. European Journal of Protistology, 27, 207–219.

Shadwick L.L., Spiegel F.W., Shadwick J.D.L., Brown M.W., & Silberman J.D. (2009) Eumycetozoa = Amoebozoa?: SSUrDNA Phylogeny of Protosteloid Slime Molds and Its Significance for the Amoebozoan Supergroup. PLoS ONE, 4, e6754.

Shimomura O. (1982) Chemical Identity of the Acrasin of the Cellular Slime Mold Polysphondylium violaceum. Proceedings of the National Academy of Sciences, 79, 7376–7379.

Silvestro D. & Michalak I. (2012) raxmlGUI: a graphical front-end for RAxML. Organisms Diversity & Evolution, 12, 335–337.

Singh B.N. (1947) Studies on Soil Acrasieae: 2. The Active Life of Species of Dictyostelium in Soil and the Influence thereon of Soil Moisture and Bacterial Food. Journal of General Microbiology, 1, 361–367.

Smirnov A.V., Chao E., Nassonova E.S., & Cavalier-Smith T. (2011) A Revised Classification of Naked Lobose Amoebae (Amoebozoa: Lobosa). Protist, 162, 545–570.

Sogin M.L., Morrison H.G., Huber J.A., Welch D.M., Huse S.M., Neal P.R., Arrieta J.M., & Herndl G.J. (2006) Microbial diversity in the deep sea and the underexplored “rare biosphere.” Proceedings of the Na-tional Academy of Sciences, 103, 12115–12120.

Stamatakis A. (2006) RAxML-VI-HPC: maximum likelihood-based phylo-genetic analyses with thousands of taxa and mixed models. Bioin-formatics, 22, 2688–2690.

Stephenson S.L. & Landolt J.C. (1992) Vertebrates as vectors of cellular slime moulds in temperate forests. Mycological Research, 96, 670–672.

55

Stephenson S.L. & Landolt J.C. (1998) Dictyostelid Cellular Slime Molds in Canopy Soils of Tropical Forests. Biotropica, 30, 657–661.

Stephenson S.L., Novozhilov Y.K., & Schnittler M. (2000) Distribution and ecology of myxomycetes in high-latitude regions of the Northern Hemisphere. Journal of Biogeography, 27, 741–754.

Stephenson S.L., Slay M.E., Slay C.A., & Tuggle A.E. (2007) Cave crickets (Orthoptera: Rhaphidophoridae) as vectors of dictyostelids (Protista: Dictyosteliida). Entomological News, 118, 292–295.

Sucgang R., Kuo A., Tian X., Salerno W., Parikh A., Feasley C.L., Dalin E., Tu H., Huang E., Barry K., Lindquist E., Shapiro H., Bruce D., Schmutz J., Salamov A., Fey P., Gaudet P., Anjard C., Babu M.M., Basu S., Bushmanova Y., van der Wel H., Katoh-Kurasawa M., Dinh C., Coutinho P.M., Saito T., Elias M., Schaap P., Kay R.R., Henrissat B., Eichinger L., Rivero F., Putnam N.H., West C.M., Loomis W.F., Chisholm R.L., Shaulsky G., Strassmann J.E., Queller D.C., Kuspa A., & Grigoriev I.V. (2011) Comparative genomics of the social amoebae Dictyostelium discoideum and Dictyostelium purpureum. Genome Biology, 12, R20.

Suthers H.B. (1985) Ground-feeding migratory songbirds as cellular slime mold distribution vectors. Oecologia, 65, 526–530.

Swanson A.R., Spiegel F.W., & Cavender J.C. (2002) Taxonomy, slime molds, and the questions we ask. Mycologia, 94, 968–979.

Swanson A.R., Vadell E.M., & Cavender J.C. (1999) Global distribution of forest soil dictyostelids. Journal of Biogeography, 26, 133–148.

Tekle Y.I., Grant J., Anderson O.R., Nerad T.A., Cole J.C., Patterson D.J., & Katz L.A. (2008) Phylogenetic placement of diverse amoebae in-ferred from multigene analyses and assessment of clade stability within “Amoebozoa” upon removal of varying rate classes of SSU-rDNA. Molecular Phylogenetics and Evolution, 47, 339–352.

Van Tieghem P. (1884) Coenonia, genre nouveau de Myxomycètes à plas-mode agrégé. Bulletin de la Société botanique de France, 34, 303–306.

Vadell E.M., Holmes M., & Cavender J.C. (1995) Dictyostelium citrinum, D. medusoides and D. granulophorum: Three new members of the Dictyosteliaceae from forest soils of Tikal, Guatemala. Mycologia, 87, 551–559.

56

Waddell D.R. (1982) A predatory slime mould. Nature, 298, 464–466.

Whittaker R.H. (1969) New Concepts of Kingdoms of Organisms. Science, 163, 150–160.

De Wit R. & Bouvier T. (2006) “Everything is everywhere, but, the envi-ronment selects”; what did Baas Becking and Beijerinck really say? Environmental Microbiology, 8, 755–758.

De Wit R.W. & Konijn T.M. (1983) Identification of the acrasin of Dicty-ostelium minutum as a derivative of folic acid. Cell Differentiation, 12, 205–210.

Acta Universitatis UpsaliensisDigital Comprehensive Summaries of Uppsala Dissertationsfrom the Faculty of Science and Technology 1097

Editor: The Dean of the Faculty of Science and Technology

A doctoral dissertation from the Faculty of Science andTechnology, Uppsala University, is usually a summary of anumber of papers. A few copies of the complete dissertationare kept at major Swedish research libraries, while thesummary alone is distributed internationally throughthe series Digital Comprehensive Summaries of UppsalaDissertations from the Faculty of Science and Technology.

Distribution: publications.uu.seurn:nbn:se:uu:diva-210074

ACTAUNIVERSITATIS

UPSALIENSISUPPSALA

2013