distribution functions of protease inhibitor 8 (serpinb8) · 2.17.1 transformation of top10...
TRANSCRIPT
DISTRIBUTION AND FUNCTIONS OF PROTEASE INHIBITOR 8 (SERPINB8)
ANNELIESE GILLARD
MONASH UNIVERSITY
DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY
SUBMITTED IN TOTAL FULFILMENT
OF THE REQUIREMENTS OF THE DEGREE OF
DOCTOR OF PHILOSOPHY
JUNE, 2010
RESUBMITTED WITH AMENDMENTS MAY, 2011
ii
CONTENTS
Abstract vi
Declaration of Authenticity vii
Publications Arising from this Thesis vii
Acknowledgements ix
Comment on Serpin Nomenclature x
Abbreviations xi
Chapter 1: General Introduction 11.1 Serpins 1
1.1.1 Serpin structure 11.1.2 Serpin inhibitory mechanism 31.1.3 Serpin specifi city 51.1.4 Non-functional serpin states – latency and polymers 51.1.5 Serpin Cofactors/Ligands 61.1.5.1 Glycosaminoglycan ligands of serpins 61.1.5.2 Non-inhibitory ligand serpin binding 61.1.6 Serpin phylogeny and nomenclature 7
1.2 Clade B Serpins 71.2.1 The intracellular serpin cytoprotection hypothesis 101.2.2 Mouse Clade B Serpins 111.2.2.1 Clade B Mouse Models 111.2.3 Protease inhibitor 8 (SERPINB8) 141.2.3.1 Targets of PI8 14
1.3 Proprotein Convertases 151.3.1 Proprotein Convertase Structure 151.3.1.1 Domain structure, multiple isoforms 151.3.1.2 Tertiary structure 181.3.1.3 Extended substrate specifi city 181.3.2 Proprotein Convertase maturation 191.3.3 Localisation, regulation and function of proprotein convertases 211.3.3.1 Furin 211.3.4 PC misregulation in humans 271.3.5 Proprotein convertase inhibitors 281.3.5.1 7B2 281.3.5.2 CRES 291.3.5.3 ProSAAS 291.3.5.4 Serpins 291.3.6 Hypothesis 30
1.4 Summary and Aims 32
iii
Chapter 2: Materials & Methods 352.1 Buffers, Media and Solutions 35
2.2 Antibodies and Antisera 38
2.3 Primers 39
2.4 Plasmids and Vectors 40
2.5 Recombinant Proteins 41
2.6 Escherichia coli Strains 41
2.7 Cell Lines 41
2.8 RNA Analyses 412.8.1 Preparation of RNA from mouse tissues 412.8.2 Reverse transcription of RNA 42
2.9 In Situ Hybridisation 42
2.10 DNA Analyses 422.10.1 Transforming competent Escherichia coli 422.10.2 Minipreparations of plasmid DNA 432.10.3 Midipreparations of plasmid DNA 432.10.4 DNA sequencing 43
2.11 Cell Culture 432.11.1 Cell culture conditions 432.11.2 Thawing cells 442.11.3 Passaging cell lines 442.11.4 Storage of cells in liquid nitrogen 442.11.5 Transient transfection of COS-1 cells 442.11.6 Indirect immunofl uorescence 442.11.7 Preparation of cell lysates 452.11.7.1 Laemmli sample buffer (LSB) lysis 452.11.7.2 Detergent lysis 45
2.12 Protein Analyses 452.12.1 Denaturing sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) 452.12.2 Coomassie Brilliant Blue staining 452.12.3 Silver staining 462.12.4 Immunoblotting analysis 46
2.13 Antibody Production 46
2.14 Unilateral Ureteral Obstruction – a reversable mouse model of kidney fi brosis 47
2.15 Immunohistochemistry 472.15.1 Paraffi n embedded tissues 472.15.2 Immunoperoxidase staining of tissue sections 472.15.3 Images 48
2.16 Preparation of Whole Mounts from Mouse Tail 482.16.1 Immunolabelling of whole mounts 482.16.2 Images 49
iv
2.17 Production and Purifi cation of Recombinant mPI8 from Escherichia coli 49
2.17.1 Transformation of TOP10 bacteria 492.17.2 Screening of transformed bacteria for gene expression 492.17.3 Large scale induction of mPI8 492.17.4 Purifi cation of mPI8 for kinetic analysis 502.17.5 Purifi cation of mPI8 for antibody generation 50
2.18 Kinetic Analyses 502.18.1 Stoichiometry of inhibition (SI) 50
Chapter 3: Studies on Recombinant mouse Protease Inhibitor 8 and Investigation into the Cognate Protease 53
3.1 Production of Recombinant mPI8 via Escherichia coli 53
3.2 Creation of mPI8-specifi c Polyclonal Antisera 553.2.1 Screening of mPI8-specifi c polyclonal antisera by immunofl uorescence 553.2.2 Screening of mPI8-specifi c polyclonal antisera by immunoblotting 57
3.3 Assessment of Functional Potential: mPI8 Inhibits Thrombin 60
3.4 Analysis of mPI8 Inhibitory Activity Against Selected Proprotein Convertases 62
3.5 Discussion 66
Chapter 4: Expression of mPI8 within Mouse Tissues 69
4.1 Introduction 69
4.2 Examination of mPI8 and Proprotein Convertase Transcripts by RT-PCR Analysis 70
4.3 Examination of mPI8 Expression by Immunohistochemistry 734.3.1 Expression of mPI8 in the adrenal gland 744.3.2 Expression of mPI8 in the uterus 764.3.3 Expression of mPI8 in the ovaries 784.3.4 Expression of mPI8 in the lung 784.3.5 Expression of mPI8 in the skin 79
4.4 mPI8 is Found within a Distinct Subset of Cells of the Hair Follicle 85
4.5 Discussion 93
v
Chapter 5: Investigation into the Biological Role of mPI8 in Kidney 97
5.1 Introduction 975.1.1 Kidney structure 975.1.2 Kidney disease 97
5.2 The mPI8 Gene is Expressed in Mouse Kidney 1005.2.1 RNA analysis of mPI8 expression in kidney 1005.2.2 Restricted distribution of mPI8 protein in the kidney 100
5.3 Modulation of mPI8 Expression in Mice Recovering from Interstitial Fibrosis of the Kidney 102
5.3.1 A model of interstitial fi brosis induced by UUO 1045.3.2 Recovery from induced interstitial fi brosis: R-UUO 104
5.4 Discussion 1105.4.1 PI8 and proteases in distal tubule cells 1105.4.2 Epithelial-mesenchymal transition 1115.4.3 The PI8 inhibitory target 111
Chapter 6: General Discussion 1136.1 Overview 113
6.2 What is the likely target of PI8? 1136.2.1 PI8 contains the convertase recognition motif RXXR 1136.2.2 PI8 is a good inhibitor of furin and other convertases 1146.2.3 What is the site of RCL cleavage when PI8 undergoes an inhibitory interaction with a convertase? 1146.2.3.1 Cleavage of a second convertase motif in the PI8 RCL may regulate inhibition of convertases 1156.2.4 Is PI8 an inhibitor of more than one convertase target? 115
6.3 Where Does PI8 Function? 1166.3.1 Does the tissue expression of PI8 provide clues to its function? 1166.3.2 PI8 is predominantly expressed within epithelial cell types 1166.3.3 PI8 may play a key role in regulation of convertases within the epithelial stem cell population of the hair follicle 1166.3.4 Is PI8 involved in the regulation of tissue remodelling? 1176.3.5 Epithelial-mesenchymal transition is controlled by convertase substrates 1186.3.6 EMT, cell stress, and release of compartmentalised proteases 118
6.4 Could the Interactions Between PI8 and a Convertase be Consistent with the Clade B Serpin Protection Hypothesis? 119
6.4.1 Proprotein convertases are expressed within the secretory pathway 1196.4.2 The serpin protection hypothesis 1196.4.3 Proprotein convertases may demonstrate ectopic expression and appear outside of the secretory pathway 120
6.5 Concluding Remarks 121
Bibliography 123
vi
ABSTRACT
Protease inhibitor 8 (PI8) / SERPINB8 is an intracellular serpin, a member of a class of protease inhibitors which irreversibly inhibit serine proteases. Other serpins within clade B are also expressed intracellularly but are not secreted, and are usually found in an overlapping distribution pattern with their target protease. Some members of this clade have accepted roles in inhibition of cytotoxic granule proteases. The reactive centre loop (RCL) of PI8, which directs its specifi city towards a target protease, contains two putative proprotein convertase recognition sites, suggesting it may play a physiological role in the inhibition of one or more proprotein convertases.
Furin and other mammalian endopeptidases of the proprotein convertase (PC) family are noted for their specifi city to the amino acid sequence Arg-X-X-(Lys/Arg). Such cleavage is a required step for the activation of numerous proteins involved in normal physiological processes as well as forming the basis of infectivity of viral coat proteins and bacterial toxins, and progression of tumour growth and arthritis. While the activity of PCs has been reported to be controlled at the transcription level, there is also evidence that inhibitory proteins exist which control the action of PCs in vivo. Several members of the serpin family have reportedly demonstrated in vitro activity against various PCs, most prominently, the engineered serpin α1-antitrypsin Portland, which has been postulated as a therapeutic agent (Tsuji et al, 2007). In mammals there is an endogenous serpin, PI8, which demonstrates rapid inhibition of furin, kinetically characteristic of a physiological inhibitory interaction (Dahlen et al, 1998)
In this study the murine tissue mRNA distribution of members of the PC family was correlated with expression of PI8: furin, PC5/6, PACE4 and PC7 showed distribution overlapping with, but not identical to PI8. PI8 expression was also examined in other organs, and was found to be predominantly expressed within epithelial cell types. In a mouse model, mPI8 was shown to be upregulated in the epithelial-mesenchymal transition process in a model of kidney fi brosis. Further, this study demonstrated that recombinant mouse PI8 is able to inhibit the activity of several members of the PC family against the fl uorogenic substrate Boc-RVRR-AMC. Determination of the stoichiometry of inhibition for the interaction showed PI8 ineffi ciently inhibited PACE4, but is a better inhibitor of PC5/6b, and inhibited furin approximately at the physiological ratio of 1:1. This result provides support for the role of PI8 as a physiological inhibitor of furin, and is a novel fi nding of anti-proteolytic activity by PI8 against PACE4 and PC5/6b, suggesting PI8 may be involved in the physiological regulation of several prohormone convertases.
vii
DECLARATION OF AUTHENTICITY
This thesis contains no material which has been accepted for the award of any other degree or diploma in any university or other institution and is less than 100,000 words in length. To the best of my knowledge and belief, this thesis contains no material previously published or written by any person, except where due reference has been made.
COPYRIGHT NOTICE 1
Under the Copyright Act 1968, this thesis must be used only under the normal conditions of scholarly fair dealing. In particular no results or conclusions should be extracted from it, nor should it be copied or closely paraphrased in whole or in part without the written consent of the author. Proper written acknowledgement should be made for any assistance obtained from this thesis.
COPYRIGHT NOTICE 2
I certify that I have made all reasonable efforts to secure copyright permissions for third-party content included in this thesis and have not knowingly added copyright content to my work without the owner’s permission.
Anneliese Gillard
viii
PUBLICATIONS ARISING FROM THIS THESIS
Data presented in this thesis is described in the following papers:
*Gillard, A., Scarff, K., Loveland, K.L., Ricardo, S.D., and Bird, P.I. 2006. Modulation and redistribution of proteinase inhibitor 8 (Serpinb8) during kidney regeneration. Am J Nephrol 26: 34-42.
Data presented in this thesis also contributed to the following papers:
Kaiserman, D., Knaggs, S., Scarff, K.L., Gillard, A., Mirza, G., Cadman, M., McKeone, R., Denny, P., Cooley, J., Benarafa, C., et al. 2002. Comparison of human chromosome 6p25 with mouse chromosome 13 reveals a greatly expanded ov-serpin gene repertoire in the mouse. Genomics 79: 349-362.
*A REPRINT OF THIS MANUSCRIPT IS LOCATED AT THE REAR OF THIS THESIS.
ix
ACKNOWLEDGEMENTS
I’d like to thank my supervisor Dr Phillip Bird for sharing with me the wonders of research, as well as helping me get through the less wondrous parts!
Many thanks to Bird lab members (past and present) – Cathy, Sun, George, Roberta, Claire, Marguerite, Dion (particularly for his critical reading of this thesis), Lauren, Diana, Tracey, Tony, Matt, Michael, Corinne, Alex, Jam, Sarah, Monica, Sonia, Aminah – I have appreciated your company, your assistance, and your empathy along the lengthy PhD process.
This thesis would not have been possible without the assistance of Sharon Ricardo, Ian Smyth, Kate Loveland, and members of their labs, for their guidance and technical support.
Thank you also to the Department of Biochemistry and Molecular Biology for allowing me to complete my doctorate here: to Christina Mitchell, Rob Pike, Rod Devenish, Mibel Aguilar and the amazing behind the scenes staff, particularly Hilary Swinard, who make sure all the wheels don’t fall off!
Thanks to my family for their support over the last 8 years, and for believing that this thesis might really be fi nished one day.
Particular thanks to friends and housemates who have kept me sane, bought me dinner, and listened to me when I needed to rant to someone who didn’t know what PCR was!
Finally, special thanks to Kris, who made me believe that you really can write a thesis one page at a time.
x
COMMENT ON SERPIN NOMENCLATURE
A naming convention based on serpin taxonomy was proposed during the 2nd International Symposium on the Structure and Biology of Serpins, held in 1999 (described in (Silverman et al, 2001)). Serpins are grouped into clades based on amino acid similarity, and the clades have been arbitrarily named A-P, with a prototypical taxa identifi ed for each; for example, clade A contains α1-antitrypsin and closely related serpins: α1-antitrypsin is therefore designated SERPINA1. As common names still predominate throughout serpin literature, for readability the author has chosen to use common names, particularly in the introductory chapter. Nonetheless, serpins will be introduced by both common and taxonomic name. Mouse homologues of human serpins are named in a similar fashion, except they appear in lowercase, i.e., Serpina1. Where referring to genes, a particular serpin will be identifi ed via its clade name, i.e. SERPINA1, or Serpina1 for the corresponding murine gene.
xi
ABBREVIATIONS
α-SMA alpha-smooth muscle actin
α1-AT α1-antitrypsin
α1-AT PDX α1-antitrypsin portland
β- MSH beta-melanocyte-stimulating hormone
AAT α1-antitrypsin
ACT α1-antichymotrypsin
ACTH adrenocorticotropic hormone
BMP bone morphogenic protein
bp base pair
BSA bovine serum albumin
ºC degrees celsius
CBG corticosteroid binding globulin
cDNA complementary DNA
CL cytotoxic lymphocyte
CMK chloromethylketones
CMV cytomegalovirus
COPD chronic obstructive pulmonary disease
CRD cysteine rich domain
CRES cystatin-related epididymal spermatogenic protein
CUK contralateral unobstructed kidney
DAPI 4’,6-diamidino-2-phenylindole
DCT distal convoluted tubule
xii
DEPC diethyl pyrocarbonate
dH2O distilled water
DIG digoxigenin
DNA deoxyribose nucleic acid
Dp1/2 desmoplakin 1/2
ECM extracellular matrix
EIA mouse elastase inhibitor A
EMT epithelial-mesenchymal transition
EPO erythropoietin
ER endoplasmic reticulum
FCS foetal calf serum
FITC fl uiorescein isothiocyanate
GAG glycosaminoglycan
GHRH growth hormone releaseing hormone
h hour/s
hASH-1 human achaete-scute homolog-1
HIV human immunodefi ciency virus
HRP horseradish peroxidase
HSPG heparan sulphate proteoglycan
IMAC immobilised metal affi nity chromatography
IRS inner root sheath
K15 keratin 15
kass second order rate association constant
kDa kiloDalton
xiii
ki inhibitor constant
MASH-1 mammalian achaete-scute homolog-1
MENT myeloid and erythroid nuclear termination stage-specifi c protein
min minute/s
MNEI monocyte/neutrophil elastase inhibitor
mPI8 mouse protease inhibitor 8
mRNA messenger ribonucleic acid
NARC-1 neural apoptosis regulated convertase 1
nt nucleotide/s
ORS outer root sheath
PACS phosphofurin acidic cluster sorting proteins
PAI-1 plasminogen activator inhibitor-1
PAI-2 plasminogen activator inhibitor-2
PBS phosphate buffered saline
PC proprotein convertase
PC1/3 proprotein convertase 1/3
PC2 proprotein convertase 2
PC4 proprotein convertase 4
PACE4 paired basic amino acid converting enzyme 4
PC5/6 proprotein convertase 5/6
PC7 proprotein convertase 7
PCI protein C inhibitor
PCR polymerase chain reaction
Pcsk proprotein convertase subtilisin/kexin type
xiv
PEDF pigment epithelium-derived factor
PI6 protease inhibitor 6
PI8 protease inhibitor 8
PI9 protease inhibitor 9
PI10 protease inhibitor 10
PMSF phenylmethylsulphonyl fl uoride
POMC pro-opiomelanocortin
RCL reactive centre loop
RT room temperature
R-UUO reversal of unilateral ureteral obstruction
S1P site-1 protease
SAMP1 senescence-accelerated mouse prone 1
SAMP1/Sku SPF senescence-accelerated mouse prone 1 substrain
SARS severe acute respiratory syndrome
SCCA1 squamous cell carcinoma antigen 1
SCCA2 squamous cell carcinoma antigen 2
SDS sodium dodecyl sulphate
SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electophoresis
SKI-1 subtilisin-kexin-like protease 1
Spi3 mouse serine protease inhibitor 3
Spi6 mouse serine protease inhibitor 6
SRP-6 Caenorhabditis elegans serpin 6
TAL thick ascending limb
TBG thyroxine binding globulin
xv
TBS tris buffered saline
TE trypsin/EDTA
TGN trans-Golgi network
TRITC tetramethylrhodamine isothiocyanate
UFAP uteroferrin-associated protein
UTMP uterine milk protein
UUO unilateral ureteral obstruction
v/v volume per volume
VLDL very low density lipoprotein
w/v weight per volume
xvi
1
CHAPTER 1: GENERAL INTRODUCTION
1.1 SERPINS
Serpins (Serine protease inhibitors) are a superfamily of proteins comprising over 800 members which are found not only in eukaryota, archaea and bacteria, but also in viruses (Irving et al, 2002). Members of this superfamily adopt a highly conserved tertiary structure and are grouped according to their resemblance to a prototypical member (reviewed in (Silverman et al, 2001)). Although the majority of serpins are functional inhibitors of serine proteases, some members display cross-class inhibition of papain-like cysteine proteases (Scott et al, 1999b; Schick et al, 1998a) or the ability to inhibit caspases (Zhou et al, 1997). Members are also known to have non-inhibitory roles such as in the regulation of blood pressure (reviewed in (Morgan et al, 1996)), prevention of cell migration (Bass et al, 2002), DNA binding (Grigoryev et al, 1999) and hormone binding and transport (reviewed by (Schussler, 2000)).
1.1.1 Serpin structure
Serpins are comparatively large in size for protease inhibitors, and range between 350 and 500 amino acids in length, generating a tertiary structure comprising 3 antiparallel β sheets and at least 7 α helices. The serpin protein is composed of a single globular domain. Its reactive centre loop (RCL) is exposed to solvent space and protrudes well away from the main body of the molecule (Figure 1). Serpins show an unusually high degree of structural identity; it has been shown that 51 buried residues are strictly conserved in over 70% of serpins (Irving et al, 2000). However, the native fold of inhibitory serpins is metastable, and conversion to the energetically favoured, more stable state occurs upon interaction with a protease. During an inhibitory interaction with a protease target, the serpin’s mobile RCL is cleaved and is able to shift from its tethered position in the canonical metastable state to insert into the body of the serpin, undergoing a substantial structural rearrangement in the process. In contrast to other inhibitory families, each serpin specifi cally inhibits one or a few closely related proteases. This specifi city is conferred by an exposed stretch of highly variable amino acid residues within the RCL. The target protease recognises the RCL as a substrate and cleaves it. The point of cleavage is designated the P1-P1’ bond and according to protease nomenclature, residues N-terminal to the P1 are designated P2, P3….Pn away from the cleavage point, while those C-terminal are designated P2’, P3’…. Pn’ (Berger & Schechter, 1970).
2
Figure 1.1 The structure of native α1-antitrypsin
The structure of native α1-antitrypsin, indicating the α-helices (red) and strands of β-sheet, and the positions of the shutter and breach regions. The A-sheet is in yellow, the B-sheet blue and the C-sheet green. The reactive site loop is shown in magenta. The positions of the breach and shutter are labelled.Research Collaboratory for Structural Bioinfomatics Protein Databank (http://www.pdb.org) identifi er: 1 PSI. (Elliot, et al., 1996)
Shutter
Breach
Reactive loop
3
The RCL is fl anked by well-conserved hinge regions which play a role in the RCL’s mobility. The crystal structure has been solved for both cleaved and native α1-antitrypsin (SERPINA1), the prototypical member of the serpin superfamily (Loebermann et al, 1984) (Elliott et al, 1996). Two regions of the serpin molecule are key to its conformational change, the shutter (Stein & Carrell, 1995), and the breach (Whisstock et al, 1998). The shutter is located in the centre of the serpin and is responsible for controlling the opening of the A β-sheet during loop insertion; as such, this region is highly conserved (Krem & Di Cera, 2003). Mutations in the shutter usually lead to dysfunctional serpin activity and often, to disease (Whisstock et al, 2000). Such a mutation was observed in the shutter region of α1-antichymotrypsin (SERPINA3) where a substitution of Leu55 to Pro in the B helix causes distortion of the helix and disruption of the shutter. As a consequence of the reduced inhibitory activity, chronic obstructive pulmonary disease (COPD) was observed in the three generations of the family expressing this mutant allele (Poller et al, 1993). Like the shutter, the breach region demonstrates a signifi cant degree of conservation of residues. The breach, which is located at the apex of the A β-sheet, is the site of initial insertion of the RCL. Upon cleavage, the RCL is also considered to be a part of the A β-sheet.
1.1.2 Serpin inhibitory mechanism
When a serpin is recognised by a serine protease as a pseudo-substrate, cleavage of the RCL occurs in a two-step process. The fi rst step involves formation of a non-covalent Michaelis-Menten like encounter complex as the protease recognises the RCL of the serpin (reviewed by (Gettins, 2002)). Next, the active site serine of the protease attacks the P1- P1’ peptide bond, and forms a tetrahedral intermediate, cleaving the bond and resulting in a covalent linkage between the active site serine of the protease and the serpin P1 residue (Olson et al, 1995). Subsequently, the intermediate may progress to either one of two competing endpoints (Figure 1.2). If the association between the protease and serpin is not favourable for inhibition, proteolysis continues; the serpin’s RCL becomes a true substrate, and is released by the protease, liberating active protease and inactivated, cleaved serpin (Olson et al, 1995). However, if there are favourable inhibitory conditions, the protease is inhibited in an irreversible suicide substrate mechanism. The cleaved RCL inserts into the A β-sheet, dragging the tethered protease 180º across the serpin’s face (Carrell & Stein, 1996). A crystal structure of α1-antitrypsin complexed with trypsin has been solved (Huntington et al, 2000). After translocation, the protease demonstrates loss of tertiary structure and the deformation of its catalytic triad (Huntington et al, 2000), explaining its loss of function. The resulting serpin-protease complex is covalently bound and therefore, is SDS stable (Olson et al, 1995). Effi cacy of binding is measured by two kinetic parameters, the stoichiometry of inhibition (SI), and the second order rate association constant (or kass). The SI represents the number of molecules of inhibitor which encounter a molecule of protease before inhibition occurs, or more simply – how many molecules of inhibitor undergo substrate-like cleavage compared to those forming an inhibitory complex. The kass represents the rate at which the serpin is able to bind to and inhibit the protease.
4
Figure 1.2. The serpin inhibitory mechanism
The exposed serpin reactive centre loop (RCL) acts as a pseudo-substrate for the target proteinase and initial interactions result in the formation of a reversible, noncovalent Michaelis complex. The RCL is then cleaved at the P1 position and inserts into the A β-sheet. During an inhibitory interaction, the serpin conformational change traps the proteinase in a covalent inhibitory complex in which both molecules are inactivated, although over time this complex can decay to release the active proteinase and the cleaved, inactivated serpin. Alternatively, the serpin may act as a classical proteinase substrate. In this instance, no covalent complex is formed and the serpin is cleaved and inactivated while the proteinase remains unaffected. Research Collaboratory for Structural Bioinformatics Protein Databank (http://www.rcsb.org/pdb/) identifi ers: 1ATU (native α1-antitrypsin); 1DP0 (native trypsin); 1OPH (Michaelis complex between α1-antitrypsin Pittsburgh and trypsin S195A); 2ACH (cleaved α1-antitrypsin); 1EZX (inhibitory complex between α1-antitrypsin and trypsin).Adapted with permission from (Kaiserman et al., 2006) © Cambridge Journals
Protease
Serpin
Michaeliscomplex
Protease
Inactiveserpin
Inhibitor
Substrate
Inhibitorycomplex
5
1.1.3 Serpin specifi city
The serpin RCL is key to defi ning which protease will be inhibited, and therefore this region is the most divergent amongst individual serpins. Small changes in the RCL sequence can result in alteration of the serpins’ inhibitory properties. This is most evident with alterations to the P1 residue. The primary determinant of the serpin’s specifi city is its P1 residue. A striking example of this is the naturally occurring Pittsburgh variant of α1-antitrypsin, where the P1 methionine residue is mutated to an arginine (Met358 →Arg). The resulting protein no longer inhibits its physiological target, elastase, but it exhibits a gain of function and ability to inhibit thrombin (Owen et al, 1983), as well as having increased inhibitory activity towards kallikrein, Factor XIa and Factor VII (Scott et al, 1986) . When this mutation occurred in vivo, it led to fatal haemophilia due to dysregulation of the coagulation cascade (Lewis et al, 1978).
1.1.4 Non-functional serpin states – latency and polymers
While the serpin’s metastable fold is key to its inhibitory mechanism, it is possible for a serpin molecule to adopt several conformations which are more energetically favourable, but prevent it from acting in an inhibitory capacity. The latent state occurs when the RCL spontaneously inserts into the A β-sheet as the fourth strand without proteolytic cleavage (Mottonen et al, 1992). The resulting conformation prevents proteases from accessing the RCL, and hence prohibits the serpin from participating in inhibitory activity. PAI-1 (SERPINE1) was the fi rst serpin reported to spontaneously convert to the latent state under physiological conditions (Carrell et al, 1991), however this transition is prevented in vivo by binding to a cofactor vitronectin in plasma. This latency has subsequently been demonstrated for most serpins under various conditions.
Serpins are also able to form polymers by the insertion of the RCL of one serpin into the A or C β-sheet of another. More recent investigations have shown that polymer formation can also involve larger stretches of the protein – two full β-strands – which are swapped between two or more molecules, and each inserts at the corresponding position in the other molecule (Yamasaki et al, 2008). Again, this insertion process inactivates the participating serpins and prevents them from acting as inhibitors (Huntington et al, 1999; Bottomley et al, 1998; Belorgey et al, 2002). The basic polymer subunit is a dimer, and once formed, the dimers are able to interlink to form longer oligomers (Zhou & Carrell, 2008). Although many serpins can form polymers, the propensity to do so is increased by mutations, and this may result in human disease. Most notably, the Z mutant of α1-antitrypsin causes the formation of long serpin polymers which accumulate in hepatocytes, which are associated with liver fi brosis and emphysema (Lomas et al, 1992). There are many examples of mutations causing the formation of serpin polymers which correlate with disease state (reviewed in (Stein & Carrell, 1995)). However, it is yet to be conclusively demonstrated that the polymers themselves are a pathogenic agent, rather than appearing as a consequence of pathogenicity.
6
1.1.5 Serpin Cofactors/Ligands
Although the classical mode of serpin inhibition involves the previously described suicide substrate mechanism, some serpins also interact with non-proteolytic proteins. Such serpins contain an additional protein binding site, known as an exosite, which in many cases binds a cofactor that is able to modulate the serpin’s interaction with its target protease (allostery) (Gettins & Olson, 2009). However, certain serpins do not perform any inhibitory function, but have evolved alternate roles in mechanisms such as hormone transport. Hence, non-proteolytic serpin ligands may be separated into two groups – non-inhibitory ligands, and inhibitory ligands.
1.1.5.1 Glycosaminoglycan ligands of serpins
Some serpins exhibit ligand interactions with molecules as part of their inhibitory interactions, for example, antithrombin (SERPINC1), heparin cofactor II (SERPIND1), protein C inhibitor (PCI, SERPINA5), protease nexin 1 (SERPINE2) and PAI 1 (SERPINE1), are able to interact with members of the glycosaminoglycan (GAG) family of polysaccharides (Pike et al, 2005), of which heparan and heparin are two common forms. Heparin is a highly sulphated linear polysaccharide consisting of repeating disaccharide units of hexuronic acid and glucosamine. The binding of serpin and GAG involves ionic interactions between the sulphates of the pentasaccharide and basic residues of the A and D helix on the N-terminal side of the serpin (reviewed in (Munoz & Linhardt, 2004)). The binding process induces a conformational change in the serpin’s RCL which enhances inhibitory activity. Different GAGs have distinct binding sites, although there is some evidence that these are overlapping (Baglin et al, 2002). GAG binding plays an additionally important role in inhibitory specifi city. Heparin cofactor II (SERPIND1) has P1-P1’ residues identical to that of α1-chymotrypsin (SERPINA3), which would suggest it inhibits chymotrypsin and cathepsin G. Although this is the case in vitro (Church et al, 1985; Pratt et al, 1990), interaction with its physiological target thrombin involves allosteric activation by heparin and dermatan sulphate via the D helix. This generates a 103 – 104 fold increase in activity of heparin cofactor II against thrombin (Pratt et al, 1989).
The serpin PCI (SERPINA5) does not utilise residues of the D helix to bind heparin, and its GAG exosite is not allosteric. Instead, PCI and a protease bind to the same heparin molecule, thus stabilising the Michaelis complex and improving the chance of a positive serpin-protease encounter (Huntington & Li, 2009).
1.1.5.2 Non-inhibitory ligand serpin binding
Serpins which play a physiological role via ligand binding rather than inhibition include hormone transport serpins corticosteroid binding globulin (CBG, or SERPINA6) and thyroxine-binding globulin (TBG, or SERPINA7), the peptide prohormone angiotensinogen (SERPINA8), and the uterine serpins including uterine milk protein (UTMP, or SERPINA14),
7
as well as pigment epithelium-derived factor (PEDF, or SERPINF1) and the collagen binding proteins. Non-inhibitory serpins generally demonstrate similarity to a functional subgroup of serpins and have diverged away from their closest evolutionary ancestors rather than fall into a discrete clade (Irving et al, 2000).
1.1.6 Serpin phylogeny and nomenclature
Serpin genes across all species can be classifi ed on the basis of phylogenetic analysis into 16 clades (Irving et al, 2000). There are 9 clades of serpins which are drawn from higher mammals; members of each clade are grouped on the basis of their genetic similarity to a prototypical member, rather than by functional identity. The remaining 7 clades are derived from lower order animals, viruses and plants, and are grouped by species. In mammals, genes within each clade contain similar numbers and phasing of introns and exons and often cluster to the same chromosomes (Ragg et al, 2001; Scott et al, 1999a).
This understanding of serpin phylogeny gives rise to a systematic naming convention for serpin genes, as determined during the 2nd International Symposium on the Structure and Biology of Serpins, held in 1999. The clades have been arbitrarily named A-P, with a prototypical taxa identifi ed for each; for example, clade A contains α1-antitrypsin and closely related serpins: α1-antitrypsin is designated SERPINA1. Of all the human serpin clades (A-I), only clade B serpins demonstrate intracellular localisation and functionality (Silverman et al, 2001). In this thesis, where required, particular serpins will be described by common name, and/or clade and number, e.g. α1-antitrypsin will be referred to as α1-antitrypsin and/or SERPINA1. Mouse homologues of human serpins are named in a similar fashion, except they appear in lowercase, i.e., Serpina1.
1.2 CLADE B SERPINS
Clade B serpins were previously known as ovalbumin serpins in reference to the prototypical member of that clade, chicken ovalbumin (Remold-O’Donnell, 1993). Intron and exon phasing and number within clade B serpin genes are similar, but not identical. Genes at 6p25 consist of 6 introns and 7 exons (Sun et al, 1998). Of the chromosome 18 serpins, most consist of 7 introns and 8 exons, except for maspin (SERPINB5) and PI8 (SERPINB8) which lack the exon which usually codes for an interhelical variable loop (Scott et al, 1999a). Recent work explains the evolution of the two clade B serpin clusters, with reports linking the clade B serpins to a single cluster in chicken (Benarafa & Remold-O’Donnell, 2005). It appears that the one of 6 intron clade B genes gained an intron between the tetrapoda and amniota radiations, with the locus splitting after the separation of birds and mammals (Kaiserman & Bird, 2005).
Whilst all other human serpins are secreted into the circulatory system where they perform their inhibitory roles, clade B serpins, lacking a classical signal peptide, are predominantly intracellular. It is suggested that they comprise a defence mechanism which
8
Cla
dist
ic
nam
eaC
omm
on n
ame
Cur
rent
ly k
now
n Fu
nctio
nLo
cus
Gen
e st
ruct
ure
Ref.
B1M
onoc
yte/
neut
roph
il el
asta
se in
hibi
tor
Intr
acel
lula
r inh
ibiti
on o
f ela
stas
e6p
256
intro
ns, 7
exo
nsR
emol
d-O
’Don
nell,
et a
l.,
1992
; Eva
ns, e
t al.,
199
5
B2Pl
asm
inog
en a
ctiv
ator
in
hibi
tor 2
Intr
acel
lula
r inh
ibiti
on o
f un
know
n pr
otea
se/s,
ext
race
llula
r in
hibi
tion
of u
Pa, t
Pa
18q2
17
intro
ns, 8
exo
nsK
awan
o, e
t al.,
196
8; Y
e,
et a
l., 1
989
B3Sq
uam
ous c
ell
carc
inom
a an
tigen
1In
trac
ellu
lar i
nhib
ition
of
unkn
own
cyst
eine
pro
teas
e/s
18q2
17
intro
ns, 8
exo
nsSc
hick
, et a
l., 1
998b
; Si
lver
man
, et a
l., 1
998
B4
Squa
mou
s cel
l ca
rcin
oma
antig
en 2
Intr
acel
lula
r inh
ibiti
on o
f un
know
n se
rine
pro
teas
e/s
18q2
17
intro
ns, 8
exo
nsSc
hick
, et a
l., 1
997;
Si
lver
man
et a
l., 1
998
B5M
aspi
nN
on-in
hibi
tory
: tum
or su
ppre
ssor
18q2
16
intro
ns, 7
exo
nsZo
u, e
t al,
1994
; Sc
hnei
der,
et a
l, 19
95
B6Pr
otea
se In
hibi
tor 6
Intr
acel
lula
r inh
ibiti
on o
f ca
thep
sin
G a
nd K
allik
rein
86p
256
intro
ns, 7
exo
nsC
ough
lin, e
t al.,
199
3;
Cou
ghlin
, et a
l., 1
995
Tabl
e 1.
1 C
lade
B se
rpin
s and
thei
r ph
ysio
logi
cal r
ole
This
tabl
e pr
ovid
es a
brie
f sum
mar
y of
the
iden
tity
of th
e cl
ade
B se
rpin
s and
thei
r kno
wn
phys
iolo
gica
l fun
ctio
n. A
bbre
viat
ions
: tPA
, tis
sue-
type
pla
smin
ogen
act
ivat
or; u
PA, u
roki
nase
-type
pla
smin
ogen
act
ivat
or.
Tabl
e co
ntin
ues o
verle
af.
a Cla
dist
ic n
omen
clat
ure
for s
erpi
ns in
clud
es a
SER
PIN
prefi x
(e.g
. SER
PIN
B1) t
hat h
as b
een
rem
oved
her
e.
Table 1.1 Clade B serpins and their physiological role
9
Cla
dist
ic
nam
eaC
omm
on n
ame
Cur
rent
ly k
now
n Fu
nctio
nLo
cus
Gen
e st
ruct
ure
Ref.
B7M
egsi
nIn
trac
ellu
lar i
nhib
ition
of
unkn
own
prot
ease
/s18
q21
7 in
trons
, 8 e
xons
Miy
ata,
et a
l., 1
998;
Sc
ott,
et a
l., 1
999
B8Pr
otea
se In
hibi
tor 8
Intr
acel
lula
r inh
ibito
r of f
urin
18q2
16
intro
ns, 7
exo
nsSp
rech
er, e
t al.,
199
5;
Bar
tusk
i, et
al.,
199
7;
Dah
len,
et a
l., 1
998
B9Pr
otea
se In
hibi
tor 9
Intr
acel
lula
r inh
ibiti
on o
f gr
anzy
me
B6p
256
intro
ns, 7
exo
nsSu
n, e
t al.,
199
6; E
yre,
et
al.,
1996
B10
Bom
apin
Intr
acel
lula
r inh
ibiti
on o
f un
know
n pr
otea
se/s
18q2
17
intro
ns, 8
exo
nsR
iew
ald,
et a
l., 1
995;
B
artu
ski,
et a
l., 1
997
B11
Epip
inIn
trac
ellu
lar i
nhib
ition
of
unkn
own
prot
ease
/s18
q21
7 in
trons
, 8 e
xons
Ask
ew, e
t al.,
200
7
B12
Yuk
opin
Intr
acel
lula
r inh
ibiti
on o
f un
know
n pr
otea
se/s
18q2
17
intro
ns, 8
exo
nsA
skew
, et a
l., 2
001
B13
Hur
pin
Intr
acel
lula
r inh
ibiti
on o
f ca
thep
sin
L18
q21
7 in
trons
, 8 e
xons
Nak
ashi
ma,
et a
l., 2
000;
W
elss
, et a
l., 2
003
10
is utilised by cells in order to prevent inadvertent endogenous protease-mediated injury (Bird, 1999). The clade B serpins, along with their putative targets and known biological functions, are listed in Table 1.1.
1.2.1 The intracellular serpin cytoprotection hypothesis
The majority of clade B serpins are capable of undergoing inhibitory interactions with a target protease; indeed, several are reported to act as inhibitors of serine or cysteine proteases in vitro (reviewed in (Silverman et al, 2004)). It has been proposed that intracellular serpins are so localised in order to protect cells from deleterious proteolytic effects arising from the release of stored endogenous protease from a membrane-bound intracellular compartment into the cytoplasm, perhaps as a result of stress (Bird, 1998). This leakage is clearly exemplifi ed within the lysosome-related organelles of cytotoxic T cells, and various studies have explored the relationship between cellular stress factors and the subsequent loss of membrane integrity that allows for lysosomal proteins to pass into the cell cytoplasm (recently reviewed by (Bird et al, 2009)). Stress factors causing such permeabilisation include exposure to radiation, to radical oxidative species (ROS), or to osmotic shock (Conus et al, 2008; Luke et al, 2007; Ogawa et al, 2004; Terman et al, 2006).
Alternately, clade B serpins may protect against exogenous (for example pathogen-derived) protease entering the cell. This resembles the protective role played by numerous extracellular serpins in the mediation of extracellular protease-driven events: for example, α1-antitrypsin regulates the effect of neutrophil elastase within the lung, preventing the development of emphysema and COPD (Hersh et al, 2004), and PAI-1 has been shown to be cardioprotective and play a role in the maintenance of normal microvascular integrity (Xu et al, 2010).
The intracellular serpin cytoprotection hypothesis is illustrated by the interaction between the clade B serpin PI9 (SERPINB9) and the cytotoxic granule protease granzyme B (Sun et al, 1996) (recently reviewed by (Kaiserman & Bird, 2009)). PI9 has been shown to be highly expressed in cytotoxic lymphocytes which express granzyme B, as well as endothelial and mesothelial cells; which, as bystanders in an immune killing event, may be inadvertently exposed to deleterious granzyme B effects (Bird et al, 1998; Bladergroen et al, 2001; Buzza et al, 2001; Hirst et al, 2003). During T cell and NK activation some granzyme B is evident in the cytoplasm where it initiates apoptosis unless opposed by PI9 (Ida et al, 2003; Laforge et al, 2006). The protection theory has been supported in an animal model, whereby mice lacking Spi6 (Serpinb9a) demonstrate a reduced ability to clear infection, and an increase in apoptosis is evident in knockout CTLs consistent with an excess of leaked granzyme B which is no longer being controlled by Spi6 (Zhang et al, 2006). The C. elegans null mutant of the srp-6 gene provides a further in vivo example of serpin mediated cytoprotection. Worms which lack the SRP-6 gene product, when subjected to osmotic stress, undergo lysosomal disruption, cysteine protease-mediated proteolysis and subsequent death. In the presence of SRP-6, lysosomal injury and death is prevented as the worms are protected from a variety of
11
stressors including heat shock, oxidative stress and hypoxia (Luke et al, 2007).
1.2.2 Mouse Clade B Serpins
Mice provide a useful model system for the exploration of human biology and disease. As there are no reported occurrences of human mutations in clade B serpins which give rise to a disease state, the use of mice to understand the physiological role of intracellular serpins is particularly pertinent. However, mice have a vastly increased complement of clade B serpins in comparison to humans. The simple separation of clade B serpin genes is retained in the mouse, with the human locus 18q21 syntenic to a region of mouse chromosome 1, and 6p25 human serpins found localised to a region of mouse chromosome 13 (Figure 1.3) (Sun et al, 1997). However, the mouse chromosome 13 cluster consists of at least 15 functional genes compared to the 3 found on human chromosome 6 (Kaiserman et al, 2002). The human genes PI6 (SERPINB6) and monocyte-neutrophil elastase inhibitor (MNEI) (SERPINB1) have clear orthologues in mouse (Spi3 (Serpinb6a) and EIA (Serpinb1a)), however it is unclear which of these mouse genes is a direct orthologue of PI9 due to their different expression pattern and weaker granzyme B inhibitory characteristics (Kaiserman et al, 2006a).
This expansion of mouse serpins may be needed to regulate a larger complement of proteinases, e.g. cathepsins and granzymes (Smyth & Trapani, 1995), and as such, investigations into mouse serpins need to be viewed with a degree of caution as to how transferable their fi ndings will be to humans. It is interesting to note, however, that whilst the human chromosome 6 serpins are widely expanded in mice, the same cannot be said for most serpins from chromosome 18 (Kaiserman & Bird, 2005). SCCA1 (SERPINB3) and SCCA2 (SERPINB4) are the only two serpins which have multiple homologues in mice: four genes and three pseudogenes (Askew et al, 2004). This appears to have arisen from a single ancestral mammalian SCCA that has been independently duplicated in each lineage.
1.2.2.1 Clade B Mouse Models
Unlike some of the previously discussed serpins, for example, those involved in polymerisation-based disease states, there are no naturally occurring mutant variants of clade B serpins in humans – or reported occurrences of people born lacking a specifi c clade B serpin protein. For this reason, the generation of null mutants as laboratory models can provide a unique insight into the role of a protein in both its normal function, as well as disease states.
MNEI (SERPINB1)
There are 4 known homologues of MNEI in the mouse, of which one (Serpinb1-ps1) is a pseudogene; another (Serpinb1c) contains an additional exon containing an insertion of retrovirus-like sequence. Of the remaining two genes, only one (EIA, or Serpinb1) demonstrates similar inhibitory activity and mRNA expression to MNEI, and is therefore its mouse ortholog. Like MNEI, EIA is an effi cient inhibitor of neutrophil granule proteases, including cathepsin G, neutrophil elastase and proteinase 3 (Benarafa et al, 2002).
12
Mice lacking Serpinb1 demonstrate a reduced capacity to respond to and recover from bacterial infection of the lungs. This phenotype appears to be due to an increased rate of necrosis in neutrophils; with a reduced number of phagocytes and unchecked action of neutrophil granule proteases in the lung leading to severe infl ammatory processes (Benarafa et al, 2007).
PAI-2 (SERPINB2)
The mouse homologue of PAI-2 was the fi rst intracellular serpin knockout, performed in 1999 (Dougherty et al, 1999). The PAI-2 protein is an in vitro inhibitor of urokinase and tPA which was originally identifi ed from the placenta (Kawano et al, 1970). Given these clearly defi ned roles, a pronounced phenotype or effect on reproductive capacity was projected. However, the mice are viable, and display no overt phenotype; blood cells were normal, wound healing, and fertility were also normal. Somewhat surprisingly, a double knockout line of mice lacking both PAI-1 and PAI-2 were indistinguishable from the PAI-2 single knockout, disproving the hypothesis that the closely related serpin PAI-1 may act in a compensatory mechanism for the lack of PAI-2. It is suggested that perhaps the human PAI-2 gene plays a more important role in the placenta than its mouse counterpart.
More recent analysis of PAI-2 knockout mice demonstrates an unexpected involvement of PAI-2 in adipocyte development. There is an additional effect restricting blood vessel development within gonadal adipose tissues (Lijnen et al, 2007). The authors determined that the mode of PAI-2 involvement in adipocyte development is independent of its anti-fi brinolytic function, but provided no further explanation for this new role.
SPI3 (SERPINB6A)
Spi3, like its human counterpart, the serpin PI6, is a potent inhibitor of the granule protease cathepsin G. Spi3 mice are viable, and exhibit normal fertility and growth, nor do they exhibit any defects of blood cell maturation or differentiation. Spi3 has no obvious protective effect on ischaemic neurons, despite the protein being an effi cient inhibitor of both kallikrein and neuropsin (Scarff et al, 2003; Scarff et al, 2004).
Lack of Spi3 has no discernible effect on the recruitment of leukocytes in macrophage-stimulated mice, and no visible defect in Candida clearance. The only visible phenotype of these mice is a less effective immune response whereby neutrophil capacity to produce antimicrobial proteases is somewhat impaired. However, studies of this model showed that the lack of Spi3 protein in the spleen is accompanied for by an upregulation of the serpin EIA (elastase inhibitor A) (Scarff et al, 2004). A double knockout of both Spi3 and EIA may shed light on this potentially compensatory mechanism.
SPI6 (SERPINB9A)
Spi6 is the mouse counterpart to the human serpin PI9, which plays a well characterised role in immunity via its inhibition of the killer cell granule protease granzyme B. Mice lacking Spi6 display an impaired ability to clear Listeria infection as well as an impaired response to viral infection (Zhang et al, 2006). This model, as well as studies performed
13
Figu
re 1
.3 C
ompa
riso
n of
mou
se a
nd h
uman
cla
de B
serp
in lo
ci
Com
paris
on o
f mou
se a
nd h
uman
cla
de B
serp
in lo
ci. T
he st
ruct
ure
of th
e se
rpin
locu
s in
mou
se a
nd h
uman
is sh
own
with
7-e
xon
serp
in g
enes
in
blu
e, 8
-exo
n se
rpin
gen
es in
red
and
non-
serp
in g
enes
in b
lack
. A
rrow
s ind
icat
e th
e di
rect
ion
of tr
ansc
riptio
n. O
rthol
ogou
s gen
es w
ith st
rong
RC
L co
nser
vatio
n ar
e lin
ked
with
solid
line
s, do
tted
lines
den
ote
inte
r-spe
cies
orth
olog
ues w
ith w
eak
RCL
hom
olog
y.
Ada
pted
with
per
mis
sion
from
(Kai
serm
an e
t al.,
200
5) ©
Kai
serm
an a
nd B
ird; l
icen
see
BioM
ed C
entra
l Ltd
14
by other groups (ours) also demonstrates the capacity of Spi6 to suppress the leakage of granzyme B from immune cell granules.
MASPIN (SERPINB5)
Maspin null mutant mice die in utero (Gao et al, 2004), and embryos implanted into the uterine wall fail to demonstrate subsequent gastrulation. Endodermal development, which was affected in the null mice, relies upon the attachment of endodermal cells to the extracellular matrix, indicating that maspin is required for epiblast morphogenesis. The same group used maspin heterozygotes to demonstrate the involvement of maspin in the development of mammary ductal gland development, showing maspin heterozygotes have defective development of corpora lutea, which leads to a corresponding decrease in the corpora lutea production of progesterone (Shi et al, 2004).
From these knockout models, it can be seen that mice have the potential to be useful models for the investigation of the action of clade B serpins, despite the ambiguity stemming partly from differences in the serpin proteome between species. However, this may mean that even in the absence of a direct phenotype, useful information about the function of the protein and related proteins in vivo may be obtained.
1.2.3 Protease inhibitor 8 (SERPINB8)
Protease inhibitor 8 (PI8) is one of the many clade B serpins whose in vivo inhibitory target is yet to be elucidated. It was originally identifi ed in a placental library screening for PI6-like genes (Sprecher et al, 1995) and despite its chromosomal localisation to 18q21, shares closest sequence identity with the 6p25 genes PI6 and PI9. This original study noted PI8 mRNA expression in most tissues, including pancreas, kidney, skeletal muscle, liver, lung, placenta, brain and heart, although a subsequent analysis reported that PI8 expression was restricted to bone marrow and epithelial cells, although it is likely this latter restricted pattern is due to overly stringent conditions used for Northern blotting (Scott, 2000).
More recent protein analysis observed PI8 expression in the mucosa orpharynx, spleen, placenta, pituitary, epidermis, stomach, colon, kidney, liver, heart, brain and pancreas (Strik et al, 2002). Subcellular distribution of PI8 is predominantly nucleocytoplasmic, with a slightly increased concentration around the nuclear envelope (Bird et al, 2001). Previous studies have determined there is a single homologue of PI8 in mice (Kaiserman et al, 2002). Mouse PI8 (mPI8) RNA has a similar expression pattern to human PI8, and like human PI8, mPI8 appears nucleocytoplasmic in intracellular distribution. The mPI8 protein is 78% identical to human PI8 in an amino acid comparison and is 42kDa in size by SDS-PAGE analysis (Gillard, 2001).
1.2.3.1 Targets of PI8
PI8 is a functional inhibitor of serine proteases in vitro, able to inhibit thrombin (Sprecher et al, 1995), trypsin, factor Xa (Dahlen et al, 1997a) and chymotrypsin (Dahlen
15
et al, 1998a), as well as the bacterial protease subtilisin A (Dahlen et al, 1997a). The best candidate for an in vivo target is furin, as PI8 is able to inhibit furin with a physiologically relevant kass of 6.5 x 105 M -1 s -1 and a Ki of 53.8 pM. However, the reported SI of 10 shows that only 1 in every 10 molecules of PI8 are able to interact in an inhibitory fashion with furin; the remaining 9 are cleaved as substrates, which is inconsistent with a physiologically effective interaction (Dahlen et al, 1998b).
Despite this, PI8 remains a good candidate inhibitor of furin-like proteases, as it contains two copies of the classic furin cleavage motif R X-X-R in the RCL, at amino acids Arg336-Asn337-Ser338-Arg339 and also at Arg339-Cys340-Ser341-Arg342 (Dahlen et al, 1998b).
1.3 PROPROTEIN CONVERTASES
Serine proteases of the proprotein convertase family are found within the secretory pathway of cells and activate proproteins by means of cleavage at specifi c basic recognition sites. Members of the proprotein convertase family are endopeptidases which cleave at the consensus sequence [K/R] Xn–[K/R]↓, where X can be any amino acid other than cysteine, and the number of spacer residues n is 0, 2, 4 or 6 (Seidah & Chretien, 1999). A vast cohort of different proproteins may be substrates; these include but are not limited to growth factors, prohormones, receptors, viral surface glycoproteins, protease zymogens, serum proteins and bacterial exotoxins (reviewed in (Nakayama, 1997). Furin is the prototypical member of this family of mammalian subtilisin-like proteases (Bresnahan et al, 1990); other members include PC2 (Smeekens & Steiner, 1990; Seidah et al, 1990), PC1/3 (Seidah et al, 1991), PACE4 (Kiefer et al, 1991), PC5/6 (Nakagawa et al, 1993a; Lusson et al, 1993), PC8/SPC7 (Bruzzaniti et al, 1996; Constam et al, 1996) and PC4 (Nakayama et al, 1992; Seidah et al, 1992). Unfortunately developing a uniform nomenclature of this family of serine proteases was made diffi cult by their near simultaneous discovery.
Two further proteins have been identifi ed which share some homology with the existing proprotein convertases: SKI-1/S1P and Pcsk9/NARC-1 (Seidah et al, 1999; Seidah et al, 2003). However, SKI-1/S1P is structurally most related to pyrolysin, and Pcsk9 to proteinase K, and unlike the other convertases, SKI-1/S1P and Pcsk9 cleave after non-basic residues with the consensus sequence [K/R]-X2-[L/T]↓ (Lopez, 2008). Due to their functional disparity with the other convertases, these two proteins will not be discussed further.
1.3.1 Proprotein Convertase Structure
1.3.1.1 Domain structure, multiple isoforms
Serine proteases of the proprotein convertase family share domain homology (Van de Ven et al, 1993). Each member is synthesised with a pro-domain which assists in folding and activation (Creemers et al, 1993), a catalytic domain which is similar to that of the bacterial endopeptidase Subtilisin, and a “P” or “Homo B” domain which is also important
16
PC1/
3
PC2
PC4
PAC
E4E-
I
PAC
E4A
-I
PC5/
6A
D H
S
D H
S
D H
S
D H
S
D H
S
PAC
E4B
D H
S
PAC
E4C
SD
H S
PAC
E4D
D H
S
D H
S
PC5/
6BD
H S
PC7/
PC8
D H
S
Furin
D H
S
PAC
E4C
D H
S
Hom
o B
dom
ain
cata
lytic
dom
ain
signa
l pep
tide
prop
eptid
e
cyst
eine
rich
dom
ain
trans
mem
bran
edo
mai
nRG
DRG
S
17
Figu
re 1
.4 D
omai
n st
ruct
ure
and
com
pari
son
of m
amm
alia
n pr
opro
tein
co
nver
tase
s
Mem
bers
of t
he m
amm
alia
n pr
opro
tein
con
vert
ase
fam
ily, d
emon
stra
ting
all p
rote
in
isof
orm
s rep
orte
d to
dat
e. L
ette
rs w
ithin
the c
atal
ytic
dom
ain
box
deno
te th
e cat
alyt
ic
tria
d A
sp, H
is a
nd S
er.
The
furin
clea
vage
site
is d
enot
ed b
y a
stro
ke, a
nd re
pres
ents
th
e C
a2+ d
epen
dent
cle
avag
e ev
ent w
hich
allo
ws
solu
ble
furin
to b
e sh
ed f
rom
the
cell.
An
RGD
, or i
nteg
rin b
indi
ng m
otif,
is fo
und
on a
ll co
nver
tase
s w
hich
con
tain
a
Hom
o B
dom
ain,
exc
ept f
or P
C7/
8, w
here
it is
repl
aced
by
the
RGS,
or r
egul
ator
of
G-p
rote
in si
gnal
ling
mot
if. P
AC
E4A
and
PA
CE4
E ha
ve a
dditi
onal
isof
orm
s (A
-II
and
E-II
) whi
ch la
ck 1
5 am
ino
acid
s in
the
varia
ble
regi
on b
etw
een
the
Hom
o B
and
C
RD
dom
ains
. Th
e is
ofor
m c
arto
ons
are
not d
epic
ted
to s
cale
. A
reas
dep
icte
d as
w
hite
box
es a
re v
aria
ble
regi
ons.
Ada
pted
with
per
mis
sion
from
(Gen
sber
g et
al.,
199
8) ©
Els
eier
18
for autocatalytic activity. Other C-terminal domains include a variable region, which is rich in cysteine residues, and as such is referred to as the cysteine-rich domain (CRD), as well as transmembrane domains (Figure 1.4).
Proprotein convertases undergo glycosylation which is necessary for correct folding and function (Benjannet et al, 1993), with potential N-glycosylation sites ranging between 1 and 13 in number. All convertases share the same catalytic triad characteristic of a serine protease: aspartate, histidine, and the active site serine (Gensberg et al, 1998). With the exception of PACE4B and PC7, all convertases contain an RGD integrin binding motif in the P domain. PC7 instead has an RGS motif, suggesting it has an involvement in G-protein coupled receptor signalling (Gensberg et al, 1998). Convertases PACE4 and PC5/6 are expressed as multiple isoforms as a result of alternative mRNA splicing (Tsuji et al, 1997; De Bie et al, 1996). Furin is able to undergo cleavage N-terminal to its transmembrane domain, resulting in a cleaved, or shed, form, which is released from the cell (Denault et al, 2002).
1.3.1.2 Tertiary structure
The crystal structure of furin was solved in 2003 (Henrich et al, 2003) and demonstrates that furin’s tertiary structure comprises two quaternary domains (Figure 1.5). The fi rst, “Homo B domain”, is a beta sandwich made up of 8 β strands which associate in jelly-roll β barrels. In combination with the pro domain, the Homo B domain is reported to be critical for the proper folding and activity of convertases. It is proposed that the PACE4 isoforms PACE4B and PC4D are therefore catalytically inactive as they both lack the Homo B domain (Tsuji et al, 1997). However, there are no experimental reports to confi rm this hypothesis. The catalytic domain contains a highly twisted β sheet core, composed of seven parallel and one anti-parallel β-strands. It contains two disulfi de bonds. This sheet is fl anked by fi ve adjacent and two peripheral helices, as well as two short β-hairpin loops.
Other proprotein convertases have been modelled based on the crystal structure of furin, as well as that of kexin, the yeast PC homologue (Henrich et al, 2005), to generate predicted structures of PC1/3, PACE4, PC4, PC2, and PC7. It was demonstrated that the secondary structural elements surrounding the catalytic site as described above are shared by all convertases (Henrich et al, 2005). Structural differences observed include the slightly extended N-terminal segments of PC2, PC5/6 and PACE4, which adopt a helical conformation. Signifi cant structural alterations between PCs were only observed in a limited number of exposed surface loops (Henrich et al, 2005). Heinrich and colleagues concluded that PC4, PACE4 and PC5/6 are the most structurally similar to furin overall, with PC1/3, PC2 and PC7 being less similar.
1.3.1.3 Extended substrate specifi city
Although proprotein convertases share a short consensus sequence for cleavage, it is likely that additional substrate specifi city is generated by exosites, and is the infl uencing
19
factor on distinguishing the proteolytic activity of the convertases.
Similar to the nomenclature for numbering residues at the P1 and P1’ sides of a scissile peptide bond, the protease contains several subsites which bind the corresponding protein substrate – these subsites are numbered from the catalytic site S1, S2, Sn, with n increasing away from the catalytic site towards the N-terminus of the protease, and S1’, S2’, etc, towards its C-terminus (Berger & Schechter, 1970). Endopeptidases commonly utilise subsites adjacent to the S1 and S1’ catalytic cleft in their interactions with substrates.
The crystal structure of furin (Figure 1.5) explains its preference for arginine residues at P1 and P4, but additionally, for lysine at P2, which is a result of highly charged complementary subsite pockets (Henrich et al, 2003). At the nonprime furin binding region, the protease is able to utilise a large cluster of negatively charged residues to control its targeting of substrates (Siezen et al, 1994); the structure of furin provides an explanation for furin’s preference for basic residues at P3, P5 and P6 (Henrich et al, 2003). PC5/6 is predicted to share the negatively charged subsites of furin, whereas fewer negative charges were predicted to be observed at the S6 subsite for PACE4 and PC4, and at S6 as well as S3 and S5 subsites for PC2 and PC1/3 (Henrich et al, 2003). As the PC’s substrate alignment segment produced by Henrich does not extend past S4, it is not possible to predict the orientation of bound substrate along the protease cleft on the non-prime side. On the prime side, the S1’ subsite is bordered by the sidechains of strictly conserved histidine residues His194 and His164, as well as residue 193, which is usually positively charged and either Lys, Arg or His, but is a serine in PC2. It is thought that this uncharged S1’ subsite residue explains PC2’s ability to process substrates with a P1’ phenylalanine or tyrosine (Peinado et al, 2003; Henrich et al, 2005). The S2’ subsite residue is well conserved amongst the PCs, where it is leucine in PC2, phenylalanine in PC7, but tryptophan in the remainder. The S3’ groove is formed by a conserved arginine in all convertases.
Thus it is likely that proprotein convertases rely on subsite interactions with their substrates to determine their specifi city, and that such preference is largely determined by interactions of the non-prime subsites. However, solved structures are currently restricted to furin’s ectodomains – and the transmembrane domains, which result in membrane-bound protease in furin, PACE4 and PC5/6, are also able to signifi cantly infl uence the likelihood that a convertase is able to interact with a potential substrate by determining its cellular localisation.
1.3.2 Proprotein Convertase maturation
All proprotein convertases are directed into the endoplasmic reticulum (ER) during translation by means of a signal peptide. The ER translocation event leads to rapid calcium-dependent intramolecular autocatalysis of the convertase, cleaving its own propeptide at the site Arg-Thr-Lys-Arg107↓ (Leduc et al, 1992). Similarly, the convertases PC1/3 (Goodman & Gorman, 1994), PC5/6 (De Bie et al, 1996), PACE4 (Nagahama et al, 1998) and PC7 (Munzer
20
Figure 1.5. Crystal structure of mouse furin
(a) Ribbon plot of soluble furin. Helices, beta-strands and irregular structures of the catalytic domain are shown as red helices, red strands and grey loops; the Homo B domain is blue. F The dec-RVKR-cmk inhibitor residues are shown as stick models: green, carbon; blue, nitrogen; red, oxygen; and the two bound calcium ions as magenta spheres. The view is toward the active-site cleft running horizontally across the catalytic domain surface. (b) Alternative orientation to a, showing more clearly the fold of the Homo B domain. Full-length furin is anchored to the membrane by a probably fl exible linker extending from the bottom of the Homo B domain. The N and C terminals are labelled as such.Research Collaboratory for Structural Bioinformatics Protein Databank (http://www.pdb.org) identifi er: 1P8J.Adapted with permission from (Henrich, et al., 2003) © Macmillan Publishers Ltd
A
B
NC
C
N
Ca1
Ca2
Ca1
Ca2Inhibitor
Homo B domain
Catalytic domain
21
et al, 1997) must undergo a self-activated cleavage event before they can leave the ER. The prosegment of furin (Bissonnette et al, 2004), as well as those of PC1/3 (Boudreault et al, 1998), PC5 (Nour et al, 2003), and PC7 (Zhong et al, 1999), has been demonstrated to act as both a molecular chaperone and an inhibitor, remaining associated in a non-covalent fashion with the protein and preventing activity of the enzyme until it reaches the trans-Golgi network (TGN) and undergoes an additional cleavage event, resulting in its fi nal dissociation. The inhibitory mechanism of the prosegment is such that a transiently associating prosegment may act to inhibit the processing of a PC zymogen into its active form; similarly it is able to prevent processing by mature enzyme of PC substrates in vitro (Nour et al, 2003; Bissonnette et al, 2004). As a consequence, the convertases are only observed in fully activated form in the TGN and beyond (Anderson et al, 2002).
1.3.3 Localisation, regulation and function of proprotein convertases
With the exception of PACE4 isoform D, which lacks a signal peptide to direct it into the ER, all convertases enter the secretory pathway where they encounter their target substrates as early as the TGN, as well as in constitutive or secretory granules, and at the cell surface (Tsuji et al, 1997). The cellular location of the convertases are summarised in Figure 1.6 (Chretien et al, 2008). Control of the subcellular localisation of convertases is largely dependent on the existence of a transmembrane domain at the protein’s C-terminal end, as well as various motifs which exist in the CRD to direct the convertase to and to retrieve it from later compartments.
1.3.3.1 Furin
Furin’s unique mechanism of transport between the Golgi, endosomes/secretory vesicles and cell surface allows it optimum exposure to a diverse range of substrates. Furin is synthesised as a 96 kDa zymogen, and undergoes autocatalytic processing as discussed in the previous section. It has been shown that the autoproteolytic removal of the propeptide is required for the maturation of the protein, although is not suffi cient in itself to result in a catalytically active furin form (Molloy et al, 1994). Once within the TGN, furin is able to cleave its propeptide at a second consensus site Arg-Gly-Val-Thr-Lys-Arg75↓ (Anderson et al, 1997) to become fully activated. Active furin cycles between the cell surface and the TGN, where a proportion of it may be cleaved upstream of the transmembrane site, resulting in shedding of an active form of the enzyme into the extracellular space (reviewed by (Molloy et al, 1999)). The mature glycosylated and sialylated furin exists at either 106 kDa or 100 kDa, compared to the shed form size of 81 kDa (Denault et al, 2002). In order to maintain steady-state levels cycling from the TGN and endosomes, furin’s C-terminal cytoplasmic tail contains a number of features. Return of cell surface furin to the TGN is controlled by a YXXL motif, as well as serine phosphorylation within the acidic CPSDSEEDEG region (Takahashi et al, 1995). Additionally, the cytoplasmic tail contains leucine and isoleucine residues, which controls the ability of many membrane proteins to be sorted to the lysosome
22
Figure 1.6. Cellular localisation of proprotein convertases
Downstream of the Endoplasmic reticulum (ER) along the secretory pathway, activated proprotein convertases can be found in the the Trans-Golgi network (TGN), Secretory granules (SG), Endosomes (END), at the Plasma membrane (PM) as type-1 integral membrane proteins, in the Extracellular matrix (ECM) or at the Cell surface (CS).
Adapted with permission from (Chrétien et al., 2008) © Informa
ERPACE4C + CS
PACE4A + E
23
from the TGN (Trowbridge et al, 1993).
Although it has been suggested that shedding may be a means of downregulating intracellular furin content (Vey et al, 1994), there is some evidence that furin may play a role in the extracellular matrix (ECM), cleaving scaffolding proteins such as profi brillin and growth factors such as BMP-1 (Leighton & Kadler, 2003; Raghunath et al, 1999). At the cell surface, furin is able to process members of the intercellular adhesion family of cadherins (Muller et al, 2004), as well as being involved in the processing of viral coat proteins.
Furin null mutant mice die in utero between day 10.5 and 11.5, apparently due to haemodynamic insuffi ciency associated with morphogenesis defects in the heart. These embryos also do not undergo axial rotation, a process controlled by furin’s regulation of nodal, a key regulator of left-right asymmetry (Roebroek et al, 1998).
1.3.3.2 PC1/3
PC1/3 lacks a conventional transmembrane domain, but shares similar structural elements with furin, and the other convertases. After the autocatalytic removal of its pro-region, PC1/3 is 86 kDa in size, and only partially active. The PC1/3 carboxyl terminus acts to limit the activity of the protease in the ER and Golgi, but is removed in secretory granules, which results in its fully activated soluble 66 kDa form (Jutras et al, 1997). This autoregulatory process is suggested to allow for sequential processing of substrates (Rabah et al, 2007).
The PC1/3 carboxyl terminus is also responsible for the direction of the PC1/3 molecule into secretory granules (Zhou et al, 1995). More specifi cally, three regions, PC1/3 617-625, PC1/3 665-682 and PC1/3 711-753 are predicted to form α-helices which control the membrane association of the protein and sorting to dense core secretory granules (Dikeakos et al, 2009). The stretch of amino acids 711-753 directs the protein to granules, and modulates sorting into dense core secretory granules via a hydrophobic patch, a process which is calcium-dependent (Dikeakos et al, 2009). Region 617-625 has been described as a novel transmembrane domain, which allows PC1/3 to interact with lipid rafts and results in insertion of the protein through the TGN membrane and into the regulated secretory pathway (Lou et al, 2007). PC1/3 demonstrates a neuroendocrine expression pattern, and was originally identifi ed in the adrenal medulla (Deftos et al, 2001; Hofl ehner et al, 1995). It is also known to be regulated on a transcriptional level, its promoter containing thyroid hormone receptor α1 (TRα1) and retinoid X receptor β (RXRβ) regulatory elements, which explains the mechanism whereby hypothyroidism stimulates, and hyperthyroidism suppresses PC1/3 mRNA expression (Shen et al, 2004).
Mice lacking PC1/3 are viable, but exhibit dwarfi sm, and are only 60% of the expected normal size after 10 weeks; an effect likely due to the misregulation of growth hormone-releasing hormone (GHRH). These mice also demonstrate many other hormone related defects, due to reduced or abrogated conversion of proopiomelanocortin (POMC), proinsulin,
24
and intestinal proglucagon (Zhu et al, 2002). However, the reduced processing of POMC does not result in abnormal blood corticosterone levels, which is thought to be due to the compensatory effect of PC2.
1.3.3.3 PC2
PC2 is similar to PC1/3 on a structural level, as well as on its expression pattern, which is also neuroendocrine. Like PC1/3, PC2 lacks a transmembrane domain. It is synthesised as a zymogen glycoprotein of 76 kDa, and autoproteolysis is initiated in the ER and Golgi, before its activated 66 kDa form is sorted into the secretory pathway as a soluble protein (Guest et al, 1992). PC2 aggregation occurs prior to entry into vesicles, and binding to vesicle membranes is calcium and low-pH dependent (Shennan et al, 1994). Unlike PC1/3, the COOH-terminal of PC2 is not solely responsible for its direction into secretory vesicles (Taylor et al, 1998).
PC2 is unique amongst the PCs in requiring the presence of an accessory inhibitory protein, 7B2, for full proteolytic processing and activation (Seidel et al, 1998). Such binding is dependent on interactions with the oxyanion residue, Asp309, as well as with Tyr174 (Benjannet et al, 1995; Benjannet et al, 1998). 7B2 is able to prevent, as well as to reverse pro-PC2 aggregation by its binding to an exposed hydrophobic surface of pro-PC2 molecules, which demonstrate a tendency to aggregate in the absence of 7B2 (Lee & Lindberg, 2008). The released prosegments of both PC2 and 7B2 are thought to act as transient inhibitors of mature PC2. Full maturation occurs when PC2 and 7B2 are transported together to the trans-Golgi network, where furin cleaves both precursors, followed by dissociation of the two proteins; consequently, mature PC2 is able to fully activate via calcium-independent autocatalysis in the highly acidic conditions of the mature secretory granules (Mbikay et al, 2001).
PC2 and 7B2 are both regulated by the transcription factor Pax6, a process which is critical for the synthesis and processing of glucagon, and may also be important for the other key hormones of the pancreas, insulin and somatostatin (Katz et al, 2009).
PC2 null mutant mice demonstrate a very small reduction in growth rate; however, they exhibit chronic fasting hypoglycaemia due to a reduction in circulating glucagon (Furuta et al, 1997). This phenotype appears to be due to a signifi cant reduction in pancreatic islet processing of proinsulin, proglucagon, and prosomatostatin.
1.3.3.4 PC4
PC4 is a soluble convertase, and knock-in LacZ experiments suggest it is expressed within the testis, as well as by macrophage-like cells of the ovary (Tadros et al, 2001) – the most restricted distribution of all the PCs. Structurally, PC4 is most similar to furin (Henrich et al, 2005). Although it is not reported where PC4 localises within the cell, its domain structure and lack of a CRD would suggest it is found early on in the secretory pathway.
Null mutant mice have severe fertility impairments, and eggs fertilised by Pcsk4-/-
spermatozoa do not progress to the blastocyst stage (Mbikay et al, 1997). Cross-breeding
25
PC4 heterozygotes demonstrates a reduction in transmission of the mutant Pcsk4 allele, with a lower than expected incidence of heterozygosity and homozygosity. Pcsk4 is implicated more specifi cally in a reduced binding of sperm to the egg zona pellucida, as well as acrosome-related effects impairing fertility (Gyamera-Acheampong et al, 2006). It would also be expected that, due to ovarian expression of PC4, there may also be an as yet unexplored effect on female fertility (Tadros et al, 2001).
1.3.3.5 PACE4
This proprotein convertase has at least eight different mRNA isoforms, derived from alternative splicing of a gene spanning over 250 kB and 25 exons (Tsuji et al, 1997). It has been suggested that only four gene products, PACE4 isoforms A-I, 4A-II, E-I and E-II represent active enzymes (Zhong et al, 1996; Mori et al, 1997). Structural elements within the isoforms themselves, particularly the CRD, as well as the C terminal regions, determine their cellular location. All expressed PACE4 isoforms are soluble, as no isoform contains a transmembrane domain (Figure 1.4).
PACE isoforms C and CS, which both lack the cysteine rich domain (CRD), reportedly progress no further in the secretory pathway than the ER, where they are retained in zymogen form (Zhong et al, 1996). While it would be expected that a misfolded protein would aggregate and be cleared from the ER, this is not observed for isoform C (Nagamune et al, 1995). Additionally, isoform C exhibits a very specifi c distribution, and is only found within pancreatic β-cells. These results suggest the isoforms C and CS have an unknown physiological function within the ER which is unrelated to enzymatic activity (Tsuji et al, 1997). Isoform D contains neither a signal peptide to enter the secretory pathway, nor does it contain pro domain or Homo B domains which are required for correct folding of the protein (Tsuji et al, 1997). This suggests if a D isoform protein is translated, it will localise to the cell cytosol. No such experimental work has been reported, however D isoform transcript demonstrates a fairly broad distribution similar to the A isoform (Tsuji et al, 1997). However, it is possible isoform D is a transcript artefact of an immortalised cell line and not representative of the normal human transcriptome. Like isoform C, isoform B exhibits an extremely restricted distribution pattern, and its transcript was only reported in a human embryonic kidney cell line, and not in adult kidney mRNA (Kiefer et al, 1991). Zymogen forms of isoform E are 112 kDa in size compared to the mature form 105 kDa (Mori et al, 1997). Both isoform A-I and E are reported to be secreted from cells, although the proportion of protease secreted differs between the two; the secretion of isoform E is retarded by a hydrophobic region of its C-terminus (Mori et al, 1997).
Once secreted from the cell, PACE4 is able to interact with heparan on the cell surface and extracellular matrix (Tsuji et al, 2003). PACE4 contains a heparin binding region at residues 721-760 and has been shown to bind heparin in vitro. Additionally, PACE4 enzymatic activity is also enhanced by the presence of heparin, but not by heparan or chondroitin sulfates. (Tsuji et al, 2003) It is suggested that this heparin binding capability allows PACE4 to interact with extracellular substrates such as members of the bone morphogenic protein
26
(BMP) family and infl uence their regulation of tissue and bone remodelling (Tsuji et al, 2003).
The PACE4 gene contains a number of regulatory elements in its promoter region, and there are reports demonstrating its control via these elements, for example, it can be transcriptionally down regulated by hASH-1 and MASH-1 via its upstream promoter region (Yoshida et al, 2001). Transcriptional control mechanisms are likely to be responsible for the varied expression patterns noted for its isoforms.
Many PACE4 null mutant mice are viable, however, approximately one quarter of embryos develop serious craniofacial defects and other left/right axis defects (similar to those observed for furin knockouts) and are resorbed within 16 days of conception (Constam & Robertson, 2000). These mice demonstrate an additional role for PACE4 as well as furin in asymmetric development, as well as regulating anterior patterning; this is likely to be due to an involvement in processing nodal, pitx2, and lefty (and thus interfering with the nodal-pitx2-lefty symmetry signalling pathway), as well as bone morphogenic proteins (BMPs) (Constam & Robertson, 2000).
1.3.3.6 PC5/6
Two isoforms of PC5/6 exist – the fi rst, PC5/6A, is soluble, and able to be secreted (Nakagawa et al, 1993a; Lusson et al, 1993). It contains a stretch of cationic residues, 683-693 within its CRD which act as a heparin binding domain, in a similar fashion to that observed for PACE4A-I (Tsuji et al, 2003). PC5/6A demonstrates a broad mRNA distribution, and its transcript was initially reported in brain, intestine, stomach, lung, liver, spleen, ovaries, and adrenal glands (Lusson et al, 1993). PC5/6A is directed into dense core secretory granules by means of a 38 amino acid stretch at its carboxyl-terminus (De Bie et al, 1996). Like PACE4A, PC5/6A is also able to bind heparin and interact with the extracellular matrix following secretion (Tsuji et al, 2003). This binding is crucial to allow PC5/6A to use its CRD to interact with tissue inhibitors of matrix metalloproteases (TIMPs), where it is recruited to the cell surface through binding of the TIMP-PC5/6A complex to heparan sulphate proteoglycans (HSPGs) which can be displaced by heparin. This property allows both PC5/6A and PACE4 to utilise their CRD as a cell surface anchor, which favours the processing of substrates that are also found at the cell surface (Nour et al, 2005). Further, there is evidence to suggest that PC5/6A remains inactive until association with HSPGs at the cell surface – a further mechanism of proteolytic control (Mayer et al, 2008).
In comparison, PC5/6B has an extended CRD as well as a transmembrane domain, and its transcript is largely restricted to the intestine (Nakagawa et al, 1993b). The carboxyl-terminal of PC5/6B, which extends into the cell cytoplasm, contains information directing PC5/6B into a TGN compartment distinct from furin and TGN marker integral membrane protein TGN38. Membrane-bound PC5/6B is localised to the Golgi and TGN (De Bie et al, 1996). Passage from the Golgi and subsequent retrieval is directed by a pair of acidic amino acid cluster (AC) motifs; the membrane-proximal AC (AC1) directs TGN localization
27
and interacts with the TGN sorting protein PACS-1, whereas the membrane-distal AC (AC2) helps retain PC5/6B and prevent it from progressing further through the constitutive secretory pathway and maintain a steady-state localisation (Xiang et al, 2000). Endocytosis of the molecule is directed by a canonical tyrosine based motif (Tyr1802GluLysLeu), the same mechanism used for retrieval of furin (Xiang et al, 2000).
Pcsk5 knockouts are homozygous lethal, with embryos dying between implantation and day 7.5 (Essalmani et al, 2006). This study did not link PC5/6A or B to a specifi c role in embryonic development, but PC5/6A is likely to play a key role in the remodelling of the extracellular matrix, a process required during morphogenesis (Scamuffa et al, 2006), and PC5/6 is known to process platelet derived growth factors (PDGFs) and BMPs which are also key to early embryogenesis (Constam & Robertson, 1999).
1.3.3.7 PC7
Like furin and PC5/6B, PC7 contains a transmembrane domain at its C-terminus (Bruzzaniti et al, 1996; Munzer et al, 1997). It is synthesised as a 101 kDa glycosylated zymogen, and processed in the ER to its mature 89 kDa membrane-bound form (Munzer et al, 1997). Subcellular fractionation experiments suggest that PC7 is found, like furin, within the TGN, and co-localising with TGN marker TGN38 (Wouters et al, 1998). However, as PC7 does not contain the acidic motifs found in the cytoplasmic tails of PC5/6B and furin, it is likely to localise discretely from furin. Support for this was found in experiments conducted by Wouters where cell contents derived from ethanol-treated rats showed separation between fractionated granules containing furin, and those containing PC7, whereby furin remained in fractions with TGN38 but PC7 separated into very low density lipoprotein (VLDL)-enriched secretory vesicles (Wouters et al, 1998). Surveys of rat PC7 transcript in its initial characterisation demonstrated it to be ubiquitously expressed, although at higher levels in colon and spleen (Seidah et al, 1996).
Mice lacking PC7 do not demonstrate any observable phenotype (Villeneuve et al, 2002). This is suggested to be due to functional redundancy between PC7 and furin processing as both are observed to have a similar intracellular distribution and expression pattern in tissues; many reports note furin also processes many of the same substrates as PC7 (Scamuffa et al, 2006). However, furin knockouts are homozygous lethal, and it is therefore evident that, during development, PC7 is critically unable to substitute for furin. It is more likely that PC7 may show redundancy with several convertases, or that substrates that are solely regulated by PC7 do not play critical roles in development or normal tissue homeostasis.
1.3.4 PC misregulation in humans
With involvement in a broad range of physiological processes, null mutant models of convertases, as well as observations of naturally occurring human mutations, provide useful information on the critical nature of each convertase, as well as providing some clues to
28
suggest redundancy between the family members is less ubiquitous than in vitro analysis might suggest.
Null mutants of three convertases are reported (furin, PC5/6, PACE4) to cause embryonic lethality in mice. This may provide some explanation as to why there are so few reports of human convertase mutations, as full function of the corresponding human convertase genes is also likely to be crucial for proper development. One of the fi rst reported mutants of PC1/3 involved a heterozygous Gly→Arg483 substitution, as well as a heterozygous splice-site mutation creating a premature stop codon in the catalytic domain and resulting in a failure of the protein to undergo autocatalysis and proper traffi cking (Jackson et al, 1997). The reported subject was described as experiencing severe childhood obesity, and demonstrated abnormal glucose homeostasis, hypogonadism, hypocortisolism and elevated POMC concentrations. A later report described another catalytic site mutant of PC1/3 who was homozygous for the mutation Ser→Leu307. The traffi cking of this mutant enzyme appeared normal; however the subject also was observed to suffer from obesity, although no reactive hypoglycaemia was observed (Farooqi et al, 2007). All subjects with PC1/3 mutations also suffered from persistent diarrhoea. These reports suggest that PC1/3 may play a slightly different role in humans to that observed in mice, as the obesity phenotype observed in humans was not refl ected in PC1/3 null mutant mice.
Given the lack of reported proprotein convertases mutations observed in the human population, it can be suggested that this is due to the crucial functions played by the convertases during embryogenesis, growth, and fertility. Of all the convertases, only PC7 misregulation appears unlikely to result in a physiological effect, possibly due to its functional redundancy with furin. Therefore, the regulation of proprotein convertases is likely to be crucial for normal physiological function.
1.3.5 Proprotein convertase inhibitors
Physiological regulation of proprotein convertases is observed not only at the transcriptional level, but also during their maturation, as described above, and at their site of action within or outside the cell. All convertases undergo some degree of self-inhibition mediated by interaction of their amino-terminal pro-domain region with the catalytic domain (as previously discussed in Section 1.3.2), while PC2 and PC1/3 have additional inhibitors expressed in a physiological setting. Such regulation is required to a) prevent premature activity, b) prevent ectopic activity, and c) to terminate activity.
1.3.5.1 7B2
7B2 is an endogenous binding inhibitor of PC2. Pro7B2 interacts with ProPC2, acting as a chaperone and preventing its premature activation within the secretory pathway (Braks & Martens, 1994). They are both fully activated within the TGN (Mbikay et al, 2001). The mature form of 7B2 is 21 kDa, and this amino terminal portion is responsible for the
29
chaperone activity 7B2 displays. Its 31 amino acid carboxyl terminal (CT) peptide which is cleaved for 7B2 activation, is a potent inhibitor of PC2 (Zhu et al, 1996), and this peptide is sorted to the secretory granules, where it inhibits PC2 until it is inactivated by further cleavage by excess PC2 and carboxypeptidase E (Zhu et al, 1996).
1.3.5.2 CRES
The cystatin-related epididymal spermatogenic protein (CRES) is a specifi c competitive inhibitor of PC2, with a Ki of 25 nM (Cornwall et al, 2003) – it is not able to inhibit PC1 or furin. CRES is highly expressed within the secretory pathway in reproductive and neuroendocrine tissues, where it is thought to help regulate PC2 processing events.
1.3.5.3 ProSAAS
ProSAAS is a neuropeptide precursor protein which has been demonstrated to inhibit PC1/3 activity in a transfected cell line (Fricker et al, 2000). Its effects are specifi c, and it is unable to inhibit PC2. ProSAAS itself contains a PC consensus cleavage site separating its N and C terminal domains, and its inhibitory activity is largely due to the LLRVKR sequence found within the C-terminal domain (Fricker et al, 2000). Like 7B2 and CRES, ProSAAS is also found within the secretory pathway. Although it would seem to act as a possible counterpart to the PC2-specifi c inhibitor, 7B2, the N-terminal domain of ProSAAS does not demonstrate a stabilising effect on its target and seems to act in a functionally distinct fashion to 7B2 (Fortenberry et al, 2002).
1.3.5.4 Serpins
Mammalian Serpins
Unlike the PC inhibitors described above, serpin inhibition is characteristically made by a two-step process whereby a single serpin forms a loose complex with the catalytic site of the protease, subsequently leading to isomerisation into a stable complex (as described in Section 1.1.2). Support for the potential for inhibition by serpins of PCs in the mammalian setting comes from the serpin PI9 and reports of its in vitro inhibition of the bacterial PC homologue Subtilisin A, with a kass of 2.4 x 106 M-1 s-1 (Dahlen et al, 1997b). However, kinetically favourable data also demonstrates inhibition of furin by PI8, which moreover showed that PI8 was able to bind irreversibly to furin with an SI of 10 (Dahlen et al, 1998b).
Unfortunately to date no evidence has conclusively identifi ed serpins as physiological proprotein convertase regulators, although recent work has provided the fi rst physiological evidence of PI8 interacting with furin - in platelet releasates (Leblond et al, 2006). This group suggested that a pre-formed furin-PI8 complex existed within the platelets which is likely to be due to PI8 entering the secretory pathway where it could then interact with furin. However, previous work has demonstrated PI8 is unable to enter the secretory pathway; the addition of a signal sequence is able to direct it to the ER where it remains sequestered (Scott, 2000). Unlike the secretory clade B serpins PAI-2 and SCCA-2, which are directed
30
into the secretory pathway via a non-conventional sequence, the majority of clade B serpins demonstrate obligate nucleocytoplasmic distribution, and it has been shown that PI6, PI9 and maspin are unable to be secreted under any circumstances (Scott et al, 1996; Sun et al, 1996; Teoh et al, 2010). It is likely, then, following the protection hypothesis, that PI8 may only interact with its target protease under times of cell stress.
Serpin Constructs
The fi rst reported serpin inhibitor of furin, was artifi cially created utilising an α1-antitrypsin scaffold, modifying the RCL with arginine substitutions at P1 and P4 in order to create a pseudo-furin recognition site, Arg355-Ile-Pro-Arg358. This construct, known as α1-AT PDX, is able to specifi cally inhibit the processing of HIV-1 glycoprotein 160 (gp160) in virally transfected cells with sub-nanomolar activity (Anderson et al, 1993) and no longer inhibits the physiological target of α1 antitrypsin, elastase. Moreover, the inhibition of furin by α1-AT PDX demonstrates an SI of 2, refl ecting that of all α1-AT PDX molecules interacting with furin, half will progress down the inhibitory pathway(Jean et al, 1998). α1-AT PDX is a slightly less effective inhibitor of PC5/6B, and of PC1/3, with SIs of 8 and 40 respectively, but is unable to form an inhibitory complex with PC2, PACE4, or PC7 (Jean et al, 1998). There appears to have been some discrimination in the inhibition of isoforms of PACE4 observed with α1-AT PDX, whereby rat PACE4 (PACE4A-like) is not inhibited by α1AT PDX (Mains et al, 1997), however α1-AT PDX is able to inhibit human PACE4A-I (Tsuji et al, 1999).
Subsequently, many groups have utilised α1-AT PDX as a tool for studying the in vitro effect of convertase inhibition, and have demonstrated its ability to modulate convertase mediated disease events, such as a reduction in growth and invasiveness of astrocytoma cells (Mercapide et al, 2002), and inhibition of viral replication in a model of HIV infection (Bahbouhi et al, 2001).
Drosophila Serpins
Recent work has identifi ed another serpin, Spn4A, in Drosophila melanogaster, which contains the sequence ArgP4-Arg-Lys-ArgP1 in its RCL – the furin consensus cleavage site (Osterwalder et al, 2004). Like α1-antithrombin, this serpin contains a signal sequence and is found in the secretory pathway (Bruning et al, 2007). Spn4A has been shown to inhibit human furin in vitro with a kass of 3.7 x 107 M -1 s -1, and a SI of approximately 1 (Richer et al, 2004). As would be expected from such a potent cross-organism interaction, Spn4A also inhibits amontillado, the Drosophila homologue of PC2, with a SI of 1 (Richer et al, 2004). This result is interesting, however no direct correlation between Drosophila Spn4A and any human serpin gene is able to be drawn – no mammalian serpin exists which contains a signal sequence for secretion as well as a convertase consensus motif in its RCL.
1.3.6 Hypothesis
The intracellular serpin cytoprotection hypothesis, as applied to PI8 and its potential convertase targets, predicts that PI8 protects cells against the release of soluble PCs from granules, vesicles or other compartments of the TGN, which would otherwise result in
31
Figure 1.7 PI8 is located outside the secretory pathway but may interact with a convertase during vesicular membrane rupture
As pictured above, it is known that the intracellular serpin PI8 demonstrates nuclear (Nu) and cytoplasmic distribution. Proprotein convertases (PCs) are found within the secretory pathway, where they are produced within the rough endoplasmic reticulum (rER) and then localise to various points along the secretory pathway depending on the individual convertase. PCs may be found within the cis-, medial- or trans-Golgi (cG, mG, tG); some are further transported through the constitutive or regulated secretory pathways and are found in vesicles (v) bound for the cell surface, or attached to the cell surface via the extracellular matrix (ECM), as well as being present in vesicles being recycled from the cell surface. Following the protection theory, PI8 is present within the cell’s cytoplasm to protect the cell from ectopic proteolysis which would result from soluble proprotein convertases leaking from their secretory compartments. Such leakage is predicted to take place during times of cell stress, as has been observed by lysosomal granules of regulatory T-cells.
PI8
Convertase
LeakingConvertase
v
vtG
cG
mG
Nu
32
undesired ectopic proteolysis (pictured in Figure 1.7). Although a transmembrane-inserted proprotein convertase would normally remain associated with vesicles and be unable enter the cytoplasm, all proprotein convertases except PC7 are soluble, or have soluble or non-tethered forms arising from processing or alternate splicing. For example, furin can be proteolytically processed to a soluble form in the secretory pathway, and the convertase isoform PC5/6B contains a transmembrane domain, but its alternately spliced form PC5/6A is soluble. Therefore, PC1/3, PC2, PC4 and PACE4, as well as furin and PC5/6A, all have the potential to enter the cytoplasm during (say) stress, and to be targets of cytoplasmic PI8.
The key prediction of the cytoprotection hypothesis, is that PI8 should be found within the same cells which express its cognate target, or targets. Identifi cation of such cell types will allow further investigation of the physiological role of PI8 and its interaction with target protease/s.
1.4 SUMMARY AND AIMS
Protease inhibitor 8 (PI8) is an intracellular serpin, a member of a class of protease inhibitors which irreversibly inhibit serine proteases. Some members of its clade have accepted roles in inhibition of cytotoxic granule proteases; such clade B serpins are expressed intracellularly but are not secreted, and usually found in an overlapping distribution pattern with their target protease. The RCL of PI8, which directs its specifi city towards a target protease, contains two putative proprotein convertase recognition sites, suggesting it may play a physiological role in the inhibition of one or more proprotein convertases.
The initial aim of this study was to perform an mRNA survey of the expression of mPI8 and the seven proprotein convertases, to try and delineate which convertases were more likely to demonstrate the co-expression required for a physiological interaction with mPI8. Further examination of the tissue distribution of mPI8 was carried out in order to provide more specifi c information on the cell-specifi c expression of mPI8, which may provide clues as to its function. During this process, mPI8 was associated with tissue regeneration within the kidney. In order to validate previously published observations of the interaction between PI8 and furin, kinetic analyses were performed. Additional analysis was carried out with convertases PC5/6b and rat PACE4 to determine whether non-furin convertases undergo more favourable in vitro interactions with PI8 than furin itself.
33
34
35
CHAPTER 2: MATERIALS & METHODS
2.1 BUFFERS, MEDIA AND SOLUTIONS
Acrylamide, 30% (w/v) stock29: 1 ratio of acrylamide: N,N’-methylenebisacrylamide.
Bacterial lysis buffer25 mM Na2HPO4, 0.5 M NaCl, 1 μg/ml aprotinin, 1 μg/ml leupeptin, 1 μg/ml pepstatin A, 0.5 μM 4-(2-aminoethyl)-benzenesulfonyl fl uoride, 0.1 μg/ml DNAse.
Bacterial Buffer A0.25 M NaCl, 20 mM Tris-Cl, pH 8.0, 10 mM imidazole, 10 mM 2 mercaptoethanol.
Bacterial Buffer B0.25 M NaCl, 20 mM Tris-Cl, pH 8.0, 0.5 M imidazole, 10 mM 2 mercaptoethanol.
Blotto5% (w/v) skim milk powder in TBS with 0.02% (w/v) sodium azide.
Coomassie R250 Stain Solution0.25% (w/v) Coomassie Brilliant Blue R250 in destain.
DEAE-dextran/ chloroquine400 μg/ml diethylaminoethyl-dextran, 100 μM chloroquine, fi lter sterilised and stored at 4ºC.
Destain30% (v/v) methanol, 10% (v/v) glacial acetic acid.
Denhardt’s Solution50x Denhardt’s soln contains 1% (w/v) Ficol 400, 1% (w/v) polyvinylpyrrolidone, 1% (w/v) bovine serum albumin (Sigma, Fraction V), diluted tenfold in pre hybridisation buffer (6x SSC).
DEPC treated waterddH2O was treated with 0.1% (v/v) DEPC to inactivate contaminating RNAases for 1 hr with stirring at RT, then autoclaved to inactivate DEPC.
DMEM (Dulbecco’s modifi ed Eagle’s medium), completeDMEM (Gibco®) supplemented with 10% (v/v) heat inactivated foetal calf serum (FCS), 2 mM L-glutamine, 50 U/ml penicillin and 50 μg/ml streptomycin.
DMEM, serum freeDMEM (Gibco®) supplemented with 2 mM L-glutamine, 50 U/ml penicillin and 50 μg/ml streptomycin.
36
6x DNA loading buffer0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol FF, 30% (v/v) glycerol.
Dithiothreitol (DTT)1 M DTT in 10 mM sodium acetate, pH 5.2. Stored at -20ºC.
Harris Hematoxylin SolutionACCUSTAIN® Harris Hematoxylin Solution was purchased from Sigma Aldrich and used according to the manufacturer’s instructions.
Hybridisation Buffer10% (w/v) dextran sulphate dissolved in Pre-Hybridisation Buffer, with the addition of 200 μg/ml yeast tRNA and 200 μg/ml Herring Sperm DNA which has been pre heated to 95°C for 10 minutes.
ISH Buffer I100 mM Maleic acid, 150 mM NaCl, pH 7.5.
Laemmli sample buffer (LSB)62.5 mM Tris-Cl, pH 6.8, 2% (w/v) SDS, 10% (v/v) glycerol, 0.001% (w/v) bromophenol blue. DTT was added to a concentration of 100 mM immediately before use.
Luria-Bertani (LB) broth1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl.
LB agar1% (w/v) tryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCl, 1.5% (w/v) agar.
MOWIOL® mounting fl uid12% (w/v) glycerol, 4.8% (w/v) MOWIOL®, 50 mM Tris-Cl, pH 8.5, stored at 20ºC in the dark.
NP-40 lysis buffer1% (v/v) Nonidet P-40 in 50 mM Tris, pH 8.0, 10 mM EDTA, pH 8.0, 150 μg/ml PMSF, 1 μg/ml aprotinin, 0.5 μM leupeptin and 1 μM pepstatin A.
PB buffer0.5% (w/v) skim milk powder, 0.25% (w/v) Fish skin gelatin, 0.5% (v/v) Triton X 100 dissolved in Tail Buffer.
PBG mounting fl uid0.1% (w/v) p-phenylenediamine, 10% (v/v) PBS, 90% (v/v) glycerol. Adjusted to pH 8.0 with 50 mM sodium carbonate buffer, pH 9.6, stored at -20ºC in the dark.
Phenol/chloroform25: 24: 1 phenol: chloroform: iso-amyl alcohol.
Phosphate buffered saline (PBS)137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4, pH 7.4.
37
Pre-Hybridisation Buffer50% (w/v) deionised formamide, 3x SSC, 66mM PBS with the addition of Denhardt’s solution diluted further in dH2O to a total concentration of 1x.
Protease Buffer100 mM HEPES, pH 7.5, 2.5 mM CaCl2, 2mM βME
PVDF Transfer Buffer10% (v/v) methanol, 10 mM 3-[cyclohexylamino]-1-propanesulfonic acid, pH 11.5.
Reverse transcription buffer30 mM KCl, 8 mM MgCl2, 10 mM DTT, 1 mM each dNTP, 50 mM Tris-Cl, pH 8.3.
SDS PAGE running buffer25 mM Tris-Cl, 192 mM glycine, 0.01% (w/v) SDS.
SDS running gel375 mM Tris-Cl, pH 8.8, 0.1% (w/v) SDS, acrylamide added to the required concentration.
SDS stacking gel4% (w/v) acrylamide, 125 mM Tris, pH 6.8, 0.1% (w/v) SDS.
Sodium Carbonate bufferTo make 50 ml of 0.1 M Sodium Carbonate buffer pH 9.6 (32 mM Na2HCO3, 68 mM NaHCO3), 8 ml of 0.2 M Na2HCO3 is added to 25 ml ddH2O along with 17 ml of 0.2M NaHCO3.
Sodium Saline Citrate (SSC), 20x3 M tri-sodium citrate, 3 M NaCl.
Solution I50 mM glucose, 25 mM Tris-Cl, pH 8.0, 10 mM EDTA, pH 8.0.
Solution II0.2 M NaOH, 1% (w/v) SDS.
Solution IIITo make 100 ml of Solution III, 60 ml of 5M potassium acetate is adjusted to pH 5.0 with the addition of 11.5 ml of glacial acetic acid and 28.5 ml dH2O.
Tail Buffer0.9% NaCl, 20 mM HEPES, pH 7.2.
Taq DNA polymerase buffer3.75 mM MgCl2, 50 mM KCl, 0.1% (v/v) Triton X-100, 10 mM Tris-Cl, pH 8.8.
TE-RNAase20 μg/ml RNAase A in 10 mM Tris-Cl, pH 8.0, 1 mM EDTA, pH 8.0.
Transfer buffer25 mM Tris-Cl, 192 mM glycine, 20% (v/v) methanol.
TBE buffer9 mM Tris-Cl, 9 mM boric acid, 2 mM EDTA, pH 8.0.
38
Tris-buffered saline (TBS)20 mM Tris-Cl, pH 7.4, 150 mM NaCl.
Trypsin/EDTA0.025% (v/v) trypsin, 0.1 mM EDTA, pH 8.0, in PBS.
2.2 ANTIBODIES AND ANTISERA
1F3: Mouse monoclonal antibody directed to the hinge region of inhibitory serpins (Hirst et al, 2001)
R5: Rabbit polyclonal antiserum raised to recombinant mPI8 derived from bacteria.
R6: Rabbit polyclonal antiserum raised to recombinant mPI8 derived from bacteria.
anti-SMA: Monoclonal antibody directed against the smooth muscle actin protein. Purchased from Sigma Aldrich.
anti-Keratin 14: Affi nity purifi ed rabbit polyclonal antibody directed against the C-terminus of the mouse keratin 14 protein. Purchased from Covance (PRB-155P).
anti-Keratin 15: Mouse monoclonal antibody raised against 17 amino acids on the C-terminal of human Cytokeratin 15. Antibody was a gift from Fiona Watt of Cancer Research UK (clone name LHK15).
anti-Desmoplakin 1/2: Mouse monoclonal antibody specifi c to Desmoplakins 1 and 2. Purchased from Progen Biotechnik (clone name 236.23.1).
anti-mouse-Ig and anti-rabbit-Ig secondary antibodies raised in sheep and directly conjugated to either horseradish peroxidase (HRP), fl uorescein isothiocyanate (FITC), or tetramethylrhodamine isothiocyanate (TRITC) were purchased from Chemicon®.
anti-mouse-Ig and anti-rabbit-Ig secondary antibodies raised in donkey and directly conjugated to either AlexaFluor 488 or AlexaFluor 594 were purchased from Invitrogen.
39
2.3 PRIMERS
Designation TemplateSense /
AntisenseSequence (5’ – 3’)
PB584 GAPDH S GACCCCTCATTGACCTCAAC
PB585 GAPDH A/S GATGACCTTGCCCACAGCCTT
PB761 Serpinb8 S GGGCTAGCATGGATGACCTCAGTGAA
PB636 Serpinb8 S GTGATTAGGAACGCCCGGTGCTGTAG
PB637 Serpinb8 A/S GATCGGCAGGTTGGCACCATCATG
PB839 Pcsk2 A/S GAAGGCGGAAGCGTGGCCCTAGTTCTT
PB840 Pcsk2 S GAGCCGGCGTCCCAGAGACGACG
PB937 Pcsk4 S CTGGGACAGATCTTCCCT
PB938 Pcsk4 A/S GGTTCTCATCGTTGGGTGTGTA
PB950 Pcsk6 S GTGTGCCGGCCTGCGGTGAGG
PB951 Pcsk6 A/S CTCCACCTGTTCAGGTGCTC
PB972 Pcsk3 S CCAGAGAGCAGCGGCTGCAAGACC
PB973 Pcsk3 A/S TTTGATAGGGTGGGCAGTGGGCTC
PB965 Pcsk7 S CTGAGGAGGATGGCTACACCAT
PB843 Pcsk7 A/S ACATGGGGGAAGCTGGGCTCTGGGG
PB837 Pcsk1 A/S GGGTGCATGAAGATTCCCAACTCAGGC
PB838 Pcsk1 S GGAGAAGCGGCCCACACAAAAGAGCC
PB939 Pcsk5 S GAAGTGTGCCCCAAACTGCG
PB940 Pcsk5 A/S ATATCCACTGGGGCAGCTGG
T7 T7 promoter S GTAATACGACTCACTATAGGGC
SP6 SP6 promoter S GATTTAGGTGACACTATAG
40
2.4 PLASMIDS AND VECTORS
Vector Source/ construction
pCR-Blunt Invitrogen™
pSVTf Dr Phillip I Bird, 1987
pSVTf/mPI8 (Gillard 2001)
pBAD-HisA Invitrogen™
pBAD/mPI8
mPI8 was amplifi ed from IMAGE cDNA clone BG245799 with primers PB761 and PB637, cloned into pCR-Blunt and sequenced. pCR-Blunt/mPI8 was digested with NheI and EcoRV. The pBAD-HisA vector was digested with EcoRI and the overhang fi lled by T4 DNA polymerase, before further digestion by NheI. The mPI8 fragment was ligated to the NheI and blunt site of pBAD-HisA, allowing in frame fusion of the vector encoded His-tag with mPI8.
pGEMT Promega™
pGEMT/mPI8 (fwd)A fragment of mPI8 spanning nucleotides 999-1242 was PCR amplifi ed with primers PB636 and PB637 and ligated into pGEMT.
pGEMT/mPI8 (rev)A fragment of mPI8 spanning nucleotides 999-1242 was PCR amplifi ed with primers PB636 and PB637 and ligated into pGEMT in the antisense orientation.
pSVTf/R86 Dr Dion Kaiserman
pSVTf/Spi3 Dr Dion Kaiserman
pSVTf/EIA Jennii Luu
pSVTf/NK26 Dr Dion Kaiserman
pSVTf/Spi6 Dr Jiuru Sun
pSVTf/hPI8 Dr Fiona Scott (Scott et al, 1999)
pSVTf/PI6 Dr Phillip I. Bird
pSVTF/PI9 Dr Claire Hirst
pEF/Spi6 Dr Dion Kaiserman (Kaiserman et al, 2006)
pEGFP/PAI-2 Adam Calderone
41
2.5 RECOMBINANT PROTEINS
Protein SpeciesProduction
SystemSource/ Reference
Furin HumanDr. A.M. Malfait
(Tortorella et al. 2005)
PACE4 RatDr. A.M. Malfait
(Tortorella et al. 2005)
PC5/6b HumanDr. A.M. Malfait
(Tortorella et al. 2005)
mPI8 Mouse Yeast Jennii Luu
Thrombin HumanIsolated from human plasma
Sigma Aldrich St. Louis, MO, USA, product #T9326
2.6 ESCHERICHIA COLI STRAINS
TOP10: F- mcrA Δ(mrr-hsd RMS-mcrBC) Φ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu)7697 galU galK rpsL (StrR) endA1 nupG
DH5α: Φ80dlacZΔM15 recA1 endA1 gyrA96 thi-1 hsdR17 (rk- mk
+) supE44 relA1 deoR Δ(lacZYA-argF)U169
2.7 CELL LINES
Cell Line Origin Reference
COS-1 African Green Monkey kidney (Gluzman 1981)
2.8 RNA ANALYSES
2.8.1 Preparation of RNA from mouse tissues
Extraction of RNA from mouse (C57BL/6J) tissue samples was performed using the RNAzol™ B RNA isolation system (Tel-Test Inc.), according to manufacturer’s instructions. Briefl y, 100 mg of tissue was homogenised in 2 ml RNAzol™ B using a TH tissue homogeniser (OMNI International, Inc.). 200 μl of chloroform was added and the suspension shaken for 10 seconds, then left on ice for 5 min, followed by centrifugation for 5 min at 12,000 g at 4ºC. The aqueous phase was removed to a new tube and RNA precipitated with an equal volume of isopropanol on ice for 15 min. RNA was collected by centrifugation at 12,000 g for 15 min at 4ºC, washed with 70% ethanol and resuspended in DEPC treated water.
42
To ensure removal of any contaminating DNA, 5 μg of RNA was incubated with 2 units of RQ1 RNAase-free DNAse in Taq DNA polymerase buffer at room temperature for 30 min. DNAse was inactivated by addition of EDTA to a fi nal concentration of 1 mM, and the samples were phenol-extracted.
2.8.2 Reverse transcription of RNA
Approximately 2.5 μg of DNA-free RNA was reverse transcribed with 1 μg of oligo dT in the presence of 20 units RNAase inhibitor and 200 units Moloney Murine Leukaemia Virus reverse transcriptase in a total volume of 25 μL reverse transcription buffer. Parallel reactions lacking reverse transcriptase were performed to verify the absence of genomic DNA. The reactions were incubated at 42ºC for 2 hours. To assess the effi ciency of cDNA synthesis and absence of contaminating genomic DNA, 1 μl from each reaction was used in a 30 cycle PCR with 10 pmol primers specifi c for GAPDH.
2.9 IN SITU HYBRIDISATION
Riboprobes for Serpinb8 were generated from pGEMT/mPI8 (fwd) and pGEMT/mPI8 (rev). Digoxigenin-labelled riboprobes for Serpinb8 were generated following the methods outlined in the dUTP-DIG Labelling Kit (Roche Molecular Biochemicals, Germany). 5 μM tissue sections were cut onto glass slides in an RNAase-free environment. Slides were dewaxed then rehydrated in a graded ethanol series before incubation with Proteinase K at 0.5, 1.0 or 2.0 μg/mL for 30 min at 37°C. Slides were pre-hybridised in Denhardt’s solution at 55 or 60°C before the addition of 150 ng of the riboprobe diluted in hybridisation buffer, using herring sperm DNA as a blocking agent. After overnight hybridisation at 55 or 60°C, slides were washed in decreasing concentrations of SSC buffer at the hybridisation temperature. Sections were blocked, then incubated with anti-DIG antibody conjugated to alkaline phosphatase (Enzo, Roche) diluted 1:1,000 in blocking solution for one hour. After washing the slides in ISH Buffer I, slides were developed with 1-Step™ BCIP/NMT (Pierce, USA) for 48 hours in a light-tight container. Slides were rinsed in tap water and ddH2O before counterstaining with ACCUSTAIN® Harris Haematoxylin Solution and mounting.
2.10 DNA ANALYSES
2.10.1 Transforming competent Escherichia coli
Laboratory stocks of competent DH5α Escherichia coli were produced by a modifi ed RbCl2 method. A 50 μl aliquot of competent DH5α E. coli was transformed with 1-5 μg of DNA on ice for 30 min. Cultures were then heat shocked at 42ºC for 90 s and replaced on ice for 2 min. 800 μl of LB broth was added and cells incubated at 37ºC for 45 min. Cultures were spread onto agar plates containing selection antibiotic and incubated overnight at 37ºC.
43
2.10.2 Minipreparations of plasmid DNA
Single colonies were picked from plates of transformed DH5α E. coli and used to inoculate 3 ml cultures of LB broth containing selection antibiotic, then incubated overnight shaking at 37ºC. 1.5 mL was then transferred to a microcentrifuge tube and centrifuged at 16,000 g for 2 min. The supernatant was removed, and the bacterial pellet re-suspended in 100 μL Solution I. Lysis was achieved with the addition of 200 μL Solution II, and the pH neutralised with 150 μL Solution III. 400 μL chloroform was added and the solution mixed then centrifuged at 16,000 g for 5 min. The aqueous phase was collected and the DNA precipitated with 800 μL 100% ethanol and harvested via centrifugation at 16,000 g for 5 min. The pellet was washed in 70% ethanol and then resuspended in 50 μL TE/RNAase.
2.10.3 Midipreparations of plasmid DNA
Single colonies were picked from plates of transformed DH5α E. coli and used to inoculate 25 ml of LB broth containing selection antibiotic, then incubated overnight at 37ºC. Cells were harvested by centrifugation at 1900 g for 15 min and plasmid DNA extracted using a modifi ed alkaline lysis procedure (Sambrook, 1989). Cells were resuspended in 2 ml Solution I, then lysed with 4 ml Solution II and pH neutralised by addition of 3 ml Solution III. Cell debris was removed by centrifugation at 1,900 g for 15 min and the supernatant was transferred to a fresh tube. Plasmid DNA was isolated via phenol/chloroform extraction and precipitation with an equal volume of iso-propanol at room temperature for 1 h. DNA was collected by centrifugation at 10,000 g for 10 min, resuspended in 300 μl TE/RNAase and incubated at 37ºC for 1 h. Following a further phenol extraction, DNA was precipitated with 120 μl 5 M ammonium acetate and 840 μl ethanol at -20ºC overnight. DNA was collected by centrifugation at 16,000 g for 5 min and washed with 70% ethanol, then resuspended in 100 μl water.
2.10.4 DNA sequencing
Plasmids were sequenced on both strands using an “oligonucleotide walk” strategy. Primers were synthesised by Sigma-Genosys® and used with purifi ed plasmid template DNA in the Big-Dye™ system (Applied Biosystems®). Products were precipitated from residual salts and proteins with the addition of 50 μl ethanol, 2 μl 125 mM EDTA, pH 8.0 and 2 μl of 3 M sodium acetate. Samples were then washed twice with 70% ethanol before being provided to Micromon for analysis on an 373 DNA sequencer (Applied Biosystems®).
2.11 CELL CULTURE
2.11.1 Cell culture conditions
All cells were maintained as sub-confl uent monolayers in 10 cm2 tissue culture dishes in a humidifi ed incubator with a 9: 1 air: CO2 atmosphere.
44
2.11.2 Thawing cells
A vial of cells was removed from liquid nitrogen and rapidly heated in a 37ºC water bath until almost completely thawed. Cells were then transferred to a 10 cm2 tissue culture dish containing 10 ml of appropriate, pre-warmed medium. The following day, cells were washed to remove dead cells and passaged into new dishes.
2.11.3 Passaging cell lines
Adherent cell lines were passaged at approximately 80% confl uency. Monolayers were washed once in PBS and 1 ml of trypsin/EDTA was added for 3-5 min or until cells had completely detached. 9 ml of complete medium was then added and cells were replated at the appropriate density (typically 5 x 105 cells/ml) into tissue culture dishes containing 10 ml complete medium.
2.11.4 Storage of cells in liquid nitrogen
A sub-confl uent dish of cells was collected by trypsin/EDTA treatment and centrifuged at 150 g for 5 min. The supernatant was aspirated and cells resuspended in 2 ml heat inactivated FCS containing 10% DMSO. The suspension was aliquoted into 4 cryotubes and placed on ice for 15 min, then dry ice for a further 15 min before being transferred into liquid nitrogen.
2.11.5 Transient transfection of COS-1 cells
A sub-confl uent dish of COS-1 cells was passaged into 4 new 60 mm dishes at approximately 40% confl uency and allowed to reach exponential growth phase by incubation at 37ºC for 3 to 4 h. Cultures were then washed with PBS and 2.5 ml serum free DMEM was added as well as 100 μl dextran/chloroquine. Between 2-3 μg of DNA was added and cells were again incubated at 37ºC for 2-3 h. Medium was aspirated and replaced with 2 ml 10% DMSO in serum free DMEM, followed by a 2 min incubation at 37ºC. The DMSO-containing medium was then replaced with 4 ml complete DMEM. Cells were analysed 48 hr post-transfection.
2.11.6 Indirect immunofl uorescence
COS-1 cells were collected 24 hr post-transfection, resuspended in complete DMEM at 1x 105 cells/ml and 50 μl transferred to each well of a 12 well slide which was then incubated overnight at 37ºC. The slide was washed with PBS after aspiration of media. Cells were fi xed with 3.7% (w/v) formaldehyde in PBS for 20 min, and autofl uorescence quenched with 20 mM NH4Cl in PBS for at least 20 min. Membranes were disrupted with 0.5% Triton X-100 in PBS for 5 min followed by three washes with PBS to remove the detergent.
Primary antibodies or antisera were diluted in PBS and incubated with cells for 30 min at room temperature. Slides were then washed 3 times in PBS and 20 μl of fl uorophore-
45
conjugated secondary antibody was added, and incubated in the dark for 30 min. Slides were then washed with PBS and a coverslip mounted with PBG. Epifl uorescence was observed using an AH3-RTCA fl uorescence microscope (Olympus®) emitting wide band blue light (450-490 nm) for analysis of FITC-based immunofl uorescence, and wide band green light (520-555 nm) for analysis of TRITC-based immunofl uorescence. Images of epifl uorescence were captured using MCID Image Analysis.
2.11.7 Preparation of cell lysates
2.11.7.1 Laemmli sample buffer (LSB) lysis
Cells were collected by centrifugation at 150 g for 5 min and resuspended in LSB. The lysate was passed through through progressively smaller gauge needles (19-30 gauge) in order to shear the DNA, and samples loaded based on cell number.
2.11.7.2 Detergent lysis
Cells were collected by centrifugation at 150 g for 5 min, resuspended in NP-40 lysis buffer, vortexed briefl y and left on ice for 10 min. Subsequently, the lysate was centrifuged at 13,000 g for 5 min to remove cell nuclei and membranes. Samples were loaded based on protein concentration as assessed with the Bio-Rad protein assay solution (Bio-Rad®).
2.12 PROTEIN ANALYSES
2.12.1 Denaturing sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE)
A 12.5% polyacrylamide running gel was prepared and polymerisation initiated with 0.1% ammonium persulfate (APS), stabilised by 0.01% TEMED. This was immediately poured between the plates of a Mini-Protean II SDS-PAGE apparatus (Bio-Rad®). When the running gel had polymerised, a 4% stacking gel was prepared with 0.1% APS, 0.01% TEMED and poured on top of the running gel. A comb was added into the top of the stacking gel to form wells, and the gel allowed to polymerise.
Samples were mixed with LSB and boiled for 5 min, then loaded into the wells alongside protein markers and electrophoresed at 200 V in a Mini-Protean II assembly (Bio-Rad®) with SDS-PAGE running buffer until the dye front migrated off the bottom of the gel.
2.12.2 Coomassie Brilliant Blue staining
Following electrophoresis, the polyacrylamide gel was removed from the SDS-PAGE apparatus and incubated in Coomassie R250 stain solution for one hour on a rocking platform at room temperature. The staining solution was then removed and the gel incubated in multiple changes of destain solution until the background was clear.
46
2.12.3 Silver staining
Silver staining was performed using the RAPID-Ag-STAIN™ (ICN Radiochemicals) according to the manufacturer’s instructions. Briefl y, the running gel was incubated at room temperature for 15 min in distilled water followed by 10 min at room temperature in Pretreatment solution. The Pretreatment solution was then removed and the gel incubated in Staining solution for 30 min. The gel was then washed 3 times in distilled water and incubated in Developer solution until chromatic fi gures of protein were visible. The gel was then washed a further 3 times in water.
2.12.4 Immunoblotting analysis
After electrophoresis was performed, the stacking gel was removed and the running gel placed on a nitrocellulose membrane between two pieces of 3 mm chromatography paper (Whatman®). This was placed in a Western Transfer Cassette (Biorad®) and electrophoresed for 50 min at 250 mA at 4ºC in a Mini-Protean II electrophoresis tank (Biorad®) containing transfer buffer.
Subsequently, the nitrocellulose membrane was placed in Blotto on a shaking table for at least 30 min, and then washed twice in TBS with 0.1% (v/v) Tween-20. The membrane was then placed in a plastic bag with primary antibody diluted in 3 ml TBS to the specifi ed concentration, the bag was sealed and placed on the shaker for one hour at RT, or allowed to incubate overnight at 4ºC. The membrane was washed four times in TBS with 0.1% (v/v) Tween-20 for 15 minutes each, then placed in a new plastic bag with horseradish peroxidase-conjugated secondary antibody at a 1:5000 dilution in TBS for one hour. The membrane was washed twice in TBS with 0.1% (v/v) Tween-20 to remove excess secondary antibody, then visualised using the Western Lightning™ chemiluminescence kit (PerkinElmer Life Sciences, Inc.) by addition of 1 ml oxidising reagent and 1 ml enhanced luminol reagent for 1 min. The membrane was then placed in a sealed bag, ensuring that there were no air bubbles, and immediately used to expose X-ray fi lm.
2.13 ANTIBODY PRODUCTION
Two New Zealand White rabbits were immunized intramuscularly with fi ve injections of 100 μg of recombinant mPI8 at 10-day intervals. The initial injection was emulsifi ed in Freund’s complete adjuvant, while subsequent injections used Freund’s incomplete adjuvant, in a fi nal volume of 1 ml. Rabbits were bled after 5 rounds of inoculation, and the subsequent antisera (designated R5 and R6) were screened for specifi city using immunofl uorescence and immunoblotting. Experiments were approved by the Monash University Animal Ethics Committee which adheres to the ‘Australian Code of Practive for the Care and Use of Animals for Scientifi c Purposes’.
47
2.14 UNILATERAL URETERAL OBSTRUCTION – A REVERSABLE MOUSE MODEL OF KIDNEY FIBROSIS
Following the method of Ricardo (Cochrane et al. 2005), unilateral ureteral obstruction (UUO) was carried out. Three groups of male C57BL/6J mice (20–25 g, Monash University Animal House, Australia) were anesthetized with 2% isofl uorane (Abbott Australasia Pty Ltd., Australia) and readied for surgery. Mice underwent 10 days of UUO (n = 3) where the ureter of the left kidney was ligated using a vascular clamp (0.4–1.0 mm; S&T Fine Science Tools, USA) via a fl ank incision. The contralateral unobstructed kidney (CUK) served as an internal negative control. A second group of negative control mice underwent fl ank incision and a sham operation (n = 4). The remaining group underwent 10 days of UUO, after which time the clamp was removed during an additional operation (reversal of UUO, or R-UUO) and the mice were allowed to recover for 14 days (R-UUO group, n = 3). Experiments had been approved by the Monash University Animal Ethics Committee which adheres to the ‘Australian Code of Practice for the Care and Use of Animals for Scientifi c Purposes’.
2.15 IMMUNOHISTOCHEMISTRY
2.15.1 Paraffi n embedded tissues
Wild type C57/Bl6J mice were killed by cervical dislocation and dissected. Harvested organs were fi xed with 10% (w/v) formalin for 5-6 hours and tissues were processed by the Monash University Anatomy Department using a Reichart-Jung tissue processor, before embedding in paraffi n. This process was also followed for mice which had undergone sham, UUO or R-UUO operations as described above.
2.15.2 Immunoperoxidase staining of tissue sections
A microtome was used to cut 5 μm thick sections from paraffi n embedded tissues, which were then fl oated onto a water bath and dried onto Superfrost Plus slides. Sections were allowed to dry overnight at 50°C before being baked onto slides for 1 hour at 60°C. The sections were dewaxed using two changes of xylene, and then allowed to rehydrate with two washes of 95% (v/v) ethanol and one wash in 70% (v/v) ethanol. Slides were further incubated in 0.3% (v/v) hydrogen peroxide in methanol for a 10 minute period in order to quench endogenous peroxidase activity. Sections were allowed to equilibriate in PBS for 10 minutes before antigen retrieval was performed by boiling slides in 10 mM citric acid, pH 6.0 for 10 min. The slides were allowed to cool to room temperature, then washed again in PBS. Incubation for 30 min in 2% (w/v) BSA in PBS was used to block non-specifi c binding. Primary antibodies were diluted in PBS with 1% (w/v) BSA and allowed to incubate overnight at room temperature in a sealed and humidifi ed container. Bound antibody was detected either using a primary antibody conjugated to biotin for 1 hour followed by incubation with streptavidin conjugated to HRP for 1 hour; or an anti-rabbit poly-HRP antibody was used to
48
directly detect mPI8 antibodies.
The Liquid DAB Chromogen Substrate System (DAKO) was used to visualise antigen staining, and sections were counterstained using Harris’ haematoxylin. Slides were then dehydrated with one wash of 70% (v/v) ethanol, two washes of 100% (v/v) ethanol and two changes of xylene, before being mounted in DPX mounting fl uid. An exception was made in the process of staining for α-SMA, where in addition to counterstaining using Harris’ haematoxylin, slides were also stained using eosin, then subjected to the standard dehydration process and mounting.
2.15.3 Images
Images were captured using an Olympus Provis Ax70 microscope using an Olympus DP70 camera and SiS Analysis software.
2.16 PREPARATION OF WHOLE MOUNTS FROM MOUSE TAIL
Following the method of Braun (Braun et al. 2003) to prepare whole mounts of mouse tail epidermis, wild type C57BL/6J mice with follicles predominantly in anagen phase were killed by cervical dislocation, the tail was removed and slit lengthwise. Using forceps, skin was peeled from the tail, cut into 5 mm square pieces and incubated in 5 mM EDTA in PBS at 37°C for four hours. The intact epidermal layer was gently peeled away from the dermis with the use of fi ne forceps, and the epidermal tissue was fi xed for two hours at room temperature in 4% formal saline (Sigma). Fixed epidermal sheets were stored in PBS containing 0.2% sodium azide at 4°C.
2.16.1 Immunolabelling of whole mounts
The epidermal sheet was blocked and permeabilised for 30 min at RT in PB Buffer in a 16 well dish. Primary antibodies were diluted in PB Buffer to a total volume of 200 μl and incubated overnight at RT with gentle agitation. R5 antisera was used at a 1:300 dilution, the anti-K14 and anti-K15 were both used at 1:200 and anti-Desmoplakin1+2 was used at 1:2.
The following day, the samples were washed with PBS containing 0.2% (v/v) Tween 20, with four changes over a four hour period.
Samples were then incubated with species specifi c fl uorophore-labelled secondary antibodies diluted in PB Buffer, and again incubated overnight with gentle agitation at RT. The following day, sections were washed with PBS containing 0.2% (v/v) Tween 20 four times at hourly intervals. As the anti-K14 and R5 were both rabbit polyclonal antibodies, the K14 staining was performed as a subsequent round following incubation of the epidermal sheet with R5 and the corresponding fl uorescent secondary antibody.
49
The nuclear stain 4’,6-diamidino-2-phenylindole (DAPI) was also added for a 10 minute incubation period before the fi nal wash.1,4-diazabicyclo[2,2,2]octane (DABCO) was added to MOWIOL mounting fl uid and allowed to agitate for several hours, and then used to mount the samples on Superfrost glass slides, which were stored in the dark at 4°C.
2.16.2 Images
Images of immunolabelled whole mounts were collected using a Leica TCS NT confocal microscope to perform analysis and capture using TCSNTV software.
2.17 PRODUCTION AND PURIFICATION OF RECOMBINANT MPI8 FROM ESCHERICHIA COLI
2.17.1 Transformation of TOP10 bacteria
Chemically competent TOP10 E. coli cells were obtained from Invitrogen. A 50 μl aliquot of competent DH5α E. coli was transformed with 1 μg of pBAD/His/mPI8 DNA on ice for 30 min. Cultures were then heat shocked at 42ºC for 90 s and replaced on ice for 2 min. Subsequently, 800 μl of LB broth was added and incubated at 37ºC for 45 min. Positive transformants were selected by plating overnight on LB plates containing 50 μg/ml ampicillin. Minipreps were made of transformant DNA, and were sequenced to ensure fusion of the mPI8 gene with the N-terminal His tag.
2.17.2 Screening of transformed bacteria for gene expression
In order to select a high-expressing clone, previously transformed cells were used to inoculate a 1 ml overnight culture of LB media containing 50 μg/ml ampicillin. 0.1 ml of the overnight cultures were used to inoculate 10 ml of LB-ampicillin broth. Cells were grown, shaking at 37°C to an OD600 of approximately 0.5, at which point 1 ml of the cells were removed as a pre-induction sample and the cultures induced for 4 hours with a range of L-arabinose concentrations from 0.00002% to 0.2%). 1ml samples of induced cells were compared to the pre-induction control via Coomassie staining of SDS-PAGE gels. The optimal arabinose induction concentration was determined to be 0.02%, and cultures from several clones that showed optimal expression were pelleted at 13,000 g and stored at -80°C in 50% glycerol/LB for further experimentation.
2.17.3 Large scale induction of mPI8
50 ml of LB media containing 50 μg/ml ampicillin was inoculated with a sample of the pBAD/HisAmPI8 glycerol stock and grown overnight, shaking, at 37°C. 5 ml of this culture was used to inoculate 500 ml LB + 50 μg/ml ampicillin, and was allowed to grow at 37 °C, shaking, until reaching an OD600 of approximately 0.5. L-arabinose was added to a fi nal concentration of 0.02% and the cells were induced for 4 hours. Cell pellets were collected by centrifugation at 4,000 g for 30 mins and stored at -20°C.
50
2.17.4 Purifi cation of mPI8 for kinetic analysis
The bacterial pellet was allowed to thaw by immersion in an ice water bath, before addition of Bacterial binding buffer to a total volume of 35 ml. The suspension was then sonicated on ice for 6 x 30 second bursts using a Soniprep 150 sonicator (Sanyo MSE) before centrifugation at 25,000 g for 30 min to remove the cellular debris. The clarifi ed lysate was then loaded onto a 5 ml HisTrap HP column (GE Healthcare) which had been previously charged with 0.1 M NiSO4 and equilibriated with Bacterial buffer A. The column was washed with 50 ml of 5% Bacterial buffer B, before elution over a 100 ml gradient of 5-100% Bacterial buffer B using an AKTAprime chromatography system (GE Healthcare). 2 ml fractions were collected and assessed for mPI8 content by Coomassie-stained SDS-PAGE. Fractions containing mPI8 (usually fractions 14-18) were pooled and diluted in ddH2O to reduce the salt concentration.
The pooled mPI8 was loaded onto a 1 ml HiTrap Q column (GE Healthcare) which had been previously equilibriated with Anion Buffer A. The column was washed with 50 ml of Anion Buffer A, before elution of 0.5 ml fractions over a 50 ml gradient of 0-100% Anion Buffer B. Protein containing fractions were identifi ed by UV trace and their mPI8 content confi rmed by SDS-PAGE analysis and Coomassie staining.
2.17.5 Purifi cation of mPI8 for antibody generation
Protein used to generate antigenicity in rabbits was purifi ed using a modifi ed version of the Purifi cation of mPI8 for kinetic analysis above. A single step of IMAC was performed using a cobalt-charged Chelating Sepharose Fast Flow column (GE Healthcare), and after SDS-PAGE analysis it was determined to be of suffi cient purity.
2.18 KINETIC ANALYSES
2.18.1 Stoichiometry of i nhibition (SI)
Owing to limited quantities of both enzyme and serpin to assay, the association constant or kass was not able to be determined, however kass was estimated to be at least 104 for any physiologically relevant enzyme interaction. This allowed an estimate of the half-life of the enzyme-serpin interaction to be determined according to:
0.693t ½ = kassx [serpin]
Various concentrations of serpin were incubated in Protease Buffer with a constant concentration of enzyme for at least 5 times the estimated half-life at 37ºC. Residual enzyme activity against Boc-RVRR-AMC substrate was then measured and plotted against the
51
serpin: enzyme ratio. Linear regression analysis of the data was performed Analysis using GraphPad Prism version 5.01 for Windows, GraphPad Software, San Diego California USA, www.graphpad.com, and the X-intercept taken as the stoichiometry of inhibition.
52
53
CHAPTER 3: STUDIES ON RECOMBINANT MOUSE PROTEASE INHIBITOR 8 AND INVESTIGATION INTO THE COGNATE
PROTEASE
Mouse Protease Inhibitor 8 (mPI8, Serpinb8) was initially identifi ed by its predicted RCL amino acid sequence as being homologous to the human serpin Protease Inhibitor 8 (PI8) (Sun et al, 1997). Later investigations determined that mPI8 is the sole homologue (orthologue) of PI8 in the mouse (Kaiserman et al, 2002), and proposed that it is, in fact, a functional counterpart. In support of this hypothesis, previous studies have demonstrated that mPI8 shares the intracellular nucleocytoplasmic distribution of PI8 as well as displaying an extremely high level of RNA and protein identity (Gillard, 2001). Other clade B serpins, for example PI9 and PI6 which are highly similar to PI8, are represented by multiple homologues in the mouse, which complicates understanding of their roles. It appears that studying mPI8 could provide a useful animal model for the determination of the physiological role of PI8, without the added complexities noted for PI9-like and PI6-like mouse serpins.
3.1 PRODUCTION OF RECOMBINANT MPI8 VIA ESCHERICHIA COLI
To aid in the generation of tools for investigation of mPI8, soluble recombinant protein was produced in bacteria using the pBAD/His arabinose inducible expression system. The mPI8 cDNA was obtained from the IMAGE consortium (Lennon et al, 1996) clone BG245799, and used as a PCR template to amplify the entire transcribed region. The resulting PCR product was subcloned into pCR Blunt to allow DNA sequencing to be performed. The mPI8 coding region minus its initiator ATG was excised from pCR-Blunt using restriction endonucleases and ligated to the pBAD/HisA vector, in frame with an amino terminal hexahistidine tag, ensuring that all transcribed protein would contain the His-tag. The pBAD-HisA/mPI8 plasmid was transformed into the recA, endA Escherichia coli strain TOP10 and clones were screened for arabinose-inducible expression by SDS-PAGE.
Recombinant mPI8 present in bacterial lysates was purifi ed using nickel affi nity chromatography via the hexahistidine tag. Coomassie staining was perfomed on selected fractions to determine the purity and presence of recombinant mPI8, which showed a doublet at the predicted size of 42 kDa (Figure 3.1). The upper band doublet represents mPI8 protein in native form; the lower band of mPI8 has been cleaved by endogenous bacterial proteases and migrates faster through the gel due to its slightly reduced size. Fractions expressing pure mPI8 were pooled, concentrated and stored at -80 ºC for further use.
54
Figure 3.1 Recombinant mPI8 purifi ed from TOP10 E. coli cells
A plasmid was constructed to express mPI8 within the pBAD-TOP10 bacterial expression system. pBAD/mPI8 was transformed into TOP10 E. coli cells and mPI8 expression was induced using arabinose over a 4 hour period. Cell pellets were lysed using sonication and the resulting crude extract was eluted over a HiTrap Ni++ column using an imidazole gradient (10 mM - 500 mM). 50 1 mL fractions were collected and an SDS-PAGE gel was used to confi rm which fractions contained pure mPI8 protein. Gels were stained with Coomassie Blue to visualise protein expression. mPI8 is noted from fraction 9 onwards, but is most concentrated in fraction 13.
fr. 25
fr. 27
fr. 31
fr. 29
97.466.2
45
31
kDa
TOP1
0 son
icate
Ni+ fl o
w th
roug
h
fr. 1
fr. 23
fr. 21
fr. 19
fr. 17
fr. 15
fr. 13
fr. 11
fr. 9
fr. 7
fr. 5
fr. 3
55
3.2 CREATION OF MPI8-SPECIFIC POLYCLONAL ANTISERA
Investigation of the properties and distribution of mPI8, requires a specifi c antibody. While previous efforts in this laboratory resulted in the generation of an antibody against human PI8 (Bird et al. 2001), it was not of the appropriate avidity to mPI8 to be useful for such studies. It was therefore decided to generate antisera specifi c to mPI8.
Two New Zealand White rabbits were immunised intramuscularly with injections of 100 �g of recombinant mPI8 at 5-6 10 day intervals. The initial injection was emulsifi ed in Freund’s complete adjuvant, and subsequent injections used Freund’s incomplete adjuvant, to a fi nal volume of 1 ml. Rabbits were bled after 5 rounds of inoculation and the subsequent antibodies R5 and R6 were screened for specifi city using immunofl uorescence and immunoblotting. Experiments had been approved by the Monash University Animal Ethics Committee which adheres to the ‘Australian Code of Practice for the Care and Use of Animals for Scientifi c Purposes’.
3.2.1 Screening of mPI8-specifi c polyclonal antisera by immunofl uorescence
Subsequently, the antisera was screened for specifi city to mPI8 using indirect immunofl uorescence. COS-1 cells were transiently transfected with vectors encoding mPI8 or other mouse clade B serpins including R86 (Serpinb9b), Spi6 (Serpinb9a), and NK26 (Serpinb9e) which are PI9-like; Spi3 (Serpinb6a), which is PI6-like; and EIA (Serpinb1a), which is orthologous to MNEI. Antisera, as well as the pre-immune sera, was used at different dilutions to test for cross-reactivity. The polyserpin antibody 1F3, which is a monoclonal antibody specifi c to the serpin hinge region, was used as a positive control to check expression of the various mouse serpins. Bound antibodies were detected using FITC-conjugated anti-mouse or anti-rabbit IgG and visualised using an AH3-RTCA Olympus microscope. Results are summarised in Figure 3.2 A. The intensity of epifl uorescence was recorded as high, medium, low, or not visible. Representative images are shown in Figure 3.2 b.
Both R5 and R6 were highly specifi c for mPI8, with dilutions of 1:200 and 1:400 generating a high intensity fl uorescent signal. Positive expression of all mouse serpins examined was detected using the monoclonal antibody 1F3. Neither the R5 nor the R6 preimmune sera demonstrated reactivity at a 1:400 or 1:200 dilution with any of the mouse serpin-expressing cells.
56
mock mPI8 R86 NK26 Spi3 Spi6 EIA
2 ° Ab - - - - - - -
1F3 neat + +++ ++ ++ +++ ++ +++
1F3 1:25 -/+ +++ + + +++ + ++
R5 pre 1:200 - - - - - - -
R5 pre1:400 - - - - - - -
R5 1:200 - +++ - - - - -
R5 1:400 - +++ - - - - -
R6 pre1:200 - - - - - - -
R6 pre1:400 - - - - - - -
R6 1:200 - +++ - - - - -
R6 1:400 - +++ - - - - -
Figure 3.2 R5 and R6 antisera are specifi c to the mPI8 protein and do not cross-react with other clade B mouse serpins by immunofl uorescence
a) Indirect immunofl uorescence was performed using transiently-transfected COS–1 cells expressing pSVTf-based clade B mouse serpin cDNAs. Serpins were detected using the monoclonal serpin antisera 1F3 as a positive control, and testing two dilutions of preimmune or immune sera from Rabbits #5 and #6 (R5 and R6). Bound antibody was detected using FITC-conjugated anti-mouse or anti-rabbit igG and visualised via fl uorescence microscopy. Reactivity of each dilution of the antiserum was then compared (+++ = intense staining, for example, R6 1:200 on mPI8-transfected cells as visualised above; - = negative, for example, R6 pre 1:200 on mPI8-transfected cells). Images were captured using a 100x objective.b) Representative images of immunofl uorescence as described above.
R6 1:200mPI8
R6 pre 1:200mPI8
R6 1:200Spi3
a
b
57
3.2.2 Screening of mPI8-specifi c polyclonal antisera by immunoblotting
To demonstrate that the antibodies detect proteins of the correct size, Cos-1 cells expressing mouse clade B serpins were also lysed using a NP-40 detergent-based buffer. 100 μg of each lysate was loaded onto duplicate SDS-PAGE gels and electrophoresed. Proteins were subsequently transferred onto nitrocellulose membranes by immunoblotting, after which the membranes were blocked using a casein-based blocking solution (Blotto) for 30 minutes. The immune antisera and preimmune sera were both diluted in TBS, and each applied to a membrane and allowed to incubate overnight at 4 ºC. The membrane was later washed to remove non-specifi c bound antibody, and further incubated with anti-rabbit HRP conjugated antibody. Signal was detected using chemiluminescence by exposure to X-ray fi lm.
The R6 immunoblot using immune sera detected a strong band at 42 kDa, the predicted size of mPI8, and visible in the mPI8-transfected lane. No cross-reactivity with other mouse serpin constructs (EIA, Spi6, Spi3) was observed (Figure 3.3, a, b).
The R5 immune sera immunoblot similarly detects a strong band at approximately 42 kDa in mPI8-transfected cell lysates (Figure 3.4 a). However, both the R5 preimmune and immune sera immunoblots appear to show a species at the approximate size expected for Spi3 (42 kDa), suggesting that the rabbit sera is inherently cross-reacting with this protein (Figure 3.4, a, b). No cross-reactivity is noted from the other mouse serpin constructs (EIA, Spi6 and NK26) with sera from this rabbit. Given that this Spi3 cross-reactivity was not observed during immunofl uorescence analysis, it is likely that the epitope detected by the R5 sera is only exposed upon SDS denaturation.
Using the R5 immune sera there is also a species of approximately 47.5 kDa in size visible not only in the serpin-transfected cells, but also the mock (R5; Figure 3.4, a). It is likely this is due to (non-specifi c) detection of epitopes of a protein endogenous to COS-1 cells which are only exposed after the complete denaturation that takes place during SDS-PAGE. This band is not consistent with the predicted size of any other clade B serpin. Again, no evidence of cross-reactivity was noted in mock transfected cells analysed by immunofl uorescence (Figure 3.2 b), so these antibodies are specifi c for imaging purposes.
.
58
Figure 3.3 R6 antisera detects the mPI8 protein by immunoblotting
Immunoblotting was performed using the lysates of transiently-transfected COS-1 cells expressing pSVTf- and pEF-based clade B mouse serpin constructs, or empty pSVTf vector. Duplicate 12.5% SDS-PAGE gels were run using the lysate samples and transferred via western blotting onto a nitrocellulose membrane. Immunoblotting was performed using R6 polyclonal antisera at 1:1000 dilution (a) or the corresponding dilution of pre-immune sera (b) and detected using HRP-conjugated anti rabbit IgG and enhanced chemiluminescence. No cross-reactivity with the mouse serpin Spi3 was noted, unlike that observed in the R5 blotting experiments. Nor was cross-reactivity observed for Spi6 or EIA.
kDa
pSVT
f
pSVT
f/mPI
8
pSVT
f/Spi
3pE
F/Sp
i6pS
VTf/E
IA
kDa
a
b
pSVT
f
pSVT
f/mPI
8
pSVT
f/Spi
3pE
F/Sp
i6pS
VTf/E
IA
17580
46
30
23
58
17
17580
46
30
23
58
17
59
Figure 3.4 R5 antisera detects the mPI8 protein by immunoblotting
Immunoblotting was performed using the lysates of transiently-transfected COS-1 cells expressing pSVTf-based clade B mouse serpin constructs. Duplicate 12.5% SDS-PAGE gels were run using the lysate samples and transferred via western blotting onto a nitrocellulose membrane. Immunoblotting was performed using R5 polyclonal antisera at 1:1000 dilution (a) or the corresponding dilution of pre-immune sera (b) and detected using HRP-conjugated anti rabbit IgG and enhanced chemiluminescence. It can be noted that there is some cross-reactivity with the mouse serpin Spi3 from both the pre-immune and immune sera, but this effect was unique to western blotting experiments. No cross-reactivity was observed with Spi6, EIA or NK26.
kDa moc
kpS
VTf/m
PI8
pSVT
f/Spi
3pS
VTf/S
pi6pS
VTf/N
K26
pSVT
f/EIA
kDa moc
kpS
VTf/m
PI8
pSVT
f/Spi
3pS
VTf/S
pi6pS
VTf/N
K26
pSVT
f/EIA
1758362
47.5
32.5
25
1758362
47.5
32.5
25
a
b
60
3.3 ASSESSMENT OF FUNCTIONAL POTENTIAL: MPI8 INHIBITS THROMBIN
Functional interaction between a serpin and a protease involves the formation of a covalent bond between the P1 residue of the serpin’s RCL and the catalytic serine residue of the protease. After the protease cleaves the RCL pseudosubstrate, the cleaved strand translocates 71 Å to the opposite pole of the serpin, inserting into the A β-sheet and dragging the protease with it. The translocation process creates a signifi cant loss of tertiary structure in the protease, resulting in its inactivity (Huntington et al, 2000). The resulting covalently bound serpin-protease complex is irreversible and stable on an SDS-PAGE gel. As the serpin’s native state is metastable and not the most energy effi cient form for the protein, it is possible for serpin to self-associate at room temperature. This phenomenon has been observed for a number of serpins, including the clade B human serpin PI9 (Benning et al, 2004). This self-association is reversible, but self-associated serpin molecules are not able to interact with a target protease in an inhibitory fashion. For this reason it is crucial to determine whether recombinant mPI8 is functionally active.
It has been previously reported that hPI8 inhibits thrombin (Dahlen et al, 1997). Recombinant mPI8 was incubated with commercially obtained recombinant human thrombin at varying molar ratios, however it appeared that bacterially derived recombinant mPI8 was not active, either because it is not foldly correctly; it has gone latent or been polymerised, or the RCL has been cleaved by bacterial proteases during extraction. For this reason, mPI8 was cloned and expressed in a yeast expression system by Jennii Luu, which has previously been shown to produce active human PI8 (P. Bird, personal communication).
Recombinant yeast-derived mPI8 was obtained with the kind assistance of Jennii Luu. In order to assess whether the mPI8 was able to inhibit a protease in vitro, it was expected to interact with human thrombin, as had been previously shown for human PI8 (Dahlen et al, 1997). Yeast derived mPI8 was incubated with recombinant human thrombin for 30 minutes at 37 ºC in varying molar ratios. The resulting samples were then run on an SDS-PAGE gel and Coomassie stained. It can be seen that at a 1:1 ratio of mPI8 to thrombin, a species likely to represent the mPI8-thrombin complex is evident at the predicted size, 75 kDa (Figure 3.5). Where thrombin is in excess, the protease appears to degrade both mPI8 and any mPI8-thrombin complex, and various species sized between 75 kDa can be seen which are likely to represent cleavage products. Where mPI8 is in excess, it can be seen that essentially all the thrombin is able to be shifted into complex form. This means the mPI8 protein preparation is 100% active.
61
Figure 3.5 Yeast-derived mPI8 is active and able to form an SDS-stable complex with thrombin
Recombinant yeast-derived mPI8 was incubated with recombinant human thrombin at varying molar ratios. Incubations with an excess of thrombin give an indication of the proportion of active protein within the mPI8 sample (it is assumed the commercially obtained thrombin is 100% active). At 1:1, nearly all the 33 kDa thrombin band has been shifted into complex with mPI8. However, some mPI8 remains uncomplexed, and breakdown products are also evident, just below the mPI8 alone band, as well as at approximately 62 kDa. Where thrombin is in excess, the mPI8-thrombin complex is no longer as visible, instead, a large number of smaller MW bands appear as a result of the degradation of the SDS-stable complex by free thrombin. Experiment performed by Jennii Luu, Monash University.
1758362
47.5
32.5
25
kDa
mPI
810
:15:1 1:5 1:1
0Th
rom
bin
1:1
complex
62
3.4 ANALYSIS OF MPI8 INHIBITORY ACTIVITY AGAINST SELECTED PROPROTEIN CONVERTASES
As prior reports noted PI8 to be a moderate in vitro inhibitor of Furin (Dahlen et al, 1998), it was hypothesised that mPI8 may interact with a furin-like protease.
There are seven proprotein convertases including furin, and cleavage specifi city between the proprotein convertases is very similar, with the dominant motif being Arg-(Arg/Lys/X)-(Lys/Arg)-Arg (Remacle et al, 2008) for fi ve out of six convertases analysed in that study. It is therefore postulated that proprotein convertases may either show temporospatial-based specifi city or in some cases, act in a functionally redundant fashion. The RCL of mPI8 contains two convertase recognition sites (Arg336-Asn337-Ser338-Arg339 and Arg339-Cys340-Ser341-Arg342) (Dahlen et al, 1997) which enhances the likelihood of it being recognised by and thus able to inhibit one or more target convertases.
This study assessed the interaction between mPI8 and furin, as well as two other members of the proprotein convertase family, PC5/6B, and PACE4. Active recombinant yeast-derived mPI8 was produced as described earlier, and active site titrated recombinant human furin, human PC5/6B, and rat PACE4 were a kind gift of Dr Anne-Marie Malfait (Pfi zer). Unfortunately, the titrated recombinant material provided was not of a suffi cient quantity to allow determination of a rate constant for the interactions between mPI8 and the three convertases. At the time these studies were performed, access to other proprotein convertases was limited, and excluded their analysis in these experiments.
A baseline for protease activity against the fl uorogenic substrate Boc RVRR-AMC was established for furin, PC5/6B and PACE4. Recombinant mPI8 was then incubated together with furin at varying molar ratios, and the sample activity measured in comparison to a furin-alone control. A linear regression analysis was performed to determine the stoichiometry of inhibition (SI) (Figure 3.6). Surprisingly, mPI8 was a far better inhibitor than expected and than previously reported (Dahlen et al, 1998), with an X intercept or SI of 0.7. This is very close to the 1:1 SI which would be expected of the physiological target of mPI8. Although the furin had been active site titrated by Dr Malfait’s group prior to use, an SI of less than 1 suggests that it had lost activity and a fresh active site titration would be required to confi rm a 1:1 interaction.
The procedure was repeated for PC5/6B (Figure 3.7). It appears that PC5/6B is able to be inhibited by mPI8, but poorly – 13 molecules of mPI8 are required to inhibit 1 molecule of PC5/6B. This suggests that PC5/6B is less likely than furin to be an in vivo inhibitory target of mPI8, although does not rule out mPI8 acting physiologically in cells where it is highly expressed compared to PC5/6B.
63
Figure 3.6 Recombinant yeast-derived mPI8 inhibits hFurin
A constant amount of recombinant yeast-derived mPI8 purifi ed by Jennii Luu was incubated with recombinant human Furin (hFurin) at varying molar ratios. The activity of hFurin against the fl uorogenic substrate Boc-RVRR-AMC was measured in comparison to a hFurin-alone control. Linear regression of the residual activity data allowed the stoichiometry of inhibition (SI) to be determined from the X intercept.
mPI8 vs hFurin
0.0 0.2 0.4 0.6 0.80
50
100
150
X int = 0.7
Res
idual
Act
ivit
y
mPI8: hFurin
64
Figure 3.7 Recombinant yeast-derived mPI8 inhibits hPC5/6B
A constant amount of recombinant yeast-derived mPI8 purifi ed by Jennii Luu was incubated with recombinant human PC5/6B at varying molar ratios. The activity of hPC5/6B against the fl uorogenic substrate Boc-RVRR-AMC was measured in comparison to a hPC5/6B-alone control. 1 Unit of Activity was defi ned as Δ fl uorescence (420 nm) of 1 unit s -1. Linear regression of the residual activity data allowed the Stoichiometry of Inhibition (SI) to be determined from the X intercept.
mPI8 vs hPC6b
0 5 10 150.0
0.5
1.0
1.5
X int = 13
mPI8 : hPC6b
Act
ivity
(arb
itra
ry u
nits)
mPI8 vs hPC5/6B
mPI8 : hPC5/6B
65
Figure 3.8 Recombinant yeast-derived mPI8 is an ineffective inhibitor of rPACE4
A constant amount of recombinant yeast-derived mPI8 purifi ed by Jennii Luu was incubated with recombinant rat PACE4 (rPACE4) at varying molar ratios. The activity of rPACE4 against the fl uorogenic substrate Boc-RVRR-AMC was measured in comparison to a rPACE4-alone control. Linear regression of the residual activity data allowed the Stoichiometry of Inhibition (SI) to be estimated to be greater than 25, as no X-intercept is observed.
mPI8 vs rPACE4
0 5 10 15 20 2570
80
90
100
110
120
mPI8 : rPACE4
Res
idual
Act
ivity
X int = >25
66
PACE4 is an even poorer inhibitory target of mPI8 than either furin or PC5/6B (Figure 3.8). The linear regression analysis was unable to determine a SI ratio for the inhibition of PACE4 by mPI8, although it is at least 25. Again, while this does not rule out mPI8’s ability to inhibit PACE4 if present in signifi cant excess in a given cellular environment, it does further support the idea that furin, rather than another member of the convertase family, is the physiological target of mPI8.
These results suggest the original report by Dahlen did not account for a proportion of inactive serpin in the enzyme assay, or that their recombinant serpin may have proceeded towards the latent state whilst in storage, a phenomenon which has been previously observed by colleagues whilst preparing PI6 and PI9 (P. Bird, personal communication). Recently the crystal structure of latent wild-type antithrombin was solved (Yamasaki et al, 2008); the stable dimer was produced by incubation of antithrombin in slightly acidic conditions. Such conditions may arise during the purifi cation phase while producing recombinant serpins such as mPI8, and while such protein would separate and appear at the expected size on a SDS PAGE gel, it may be diffi cult to examine what proportion has undergone transition to latency without repeatedly reviewing its capacity to bind a known protease interactor such as thrombin.
3.5 DISCUSSION
This study suggests that of proprotein convertase furin is a physiological target of PI8. Importantly, this is also the fi rst report of anti-proteolytic activity by mPI8 against PACE4A and PC5/6B.
There is some in vivo precedent for an inhibitory interaction of furin with PI8, a complex having previously been observed within platelet releasates (Leblond et al, 2006). The results presented here lend further support to the physiological signifi cance of the PI8 furin interaction which has been largely overlooked in previous reports, particularly by those searching for convertase inhibitors as drug targets (Jean et al, 1998).
Only one isoform of the other convertases were tested. PC5/6 has two isoforms: the soluble form, PC5/6A, is found within both the constitutive and regulated secretory pathways (Lusson et al, 1993), and a larger, membrane-bound form, PC5/6B found in a late golgi-endosome compartment solely within the constitutive secretory pathway (De Bie et al, 1996). It is possible that the bulky cysteine-rich domain of the membrane bound form, PC5/6B, interferes with the interaction of mPI8 with the enzyme’s catalytic domain, and that the interaction between the soluble PC5/6A and mPI8 may generate a more favourable stoichiometry of inhibition. The convertase PACE4 is represented by 8 isoforms in humans (Tsuji et al, 1997), and some of these multiple isoforms are also reported in other species. Perhaps key residues or regions of the rat PACE4A used for this study are prohibiting an optimal interaction between it and mPI8, and one or others of the PACE4 isoforms may
67
generate a lower SI and be a more physiologically relevant target for PI8.
Unfortunately, the availability of other recombinant proprotein convertases at appropriate concentration and specifi c activity to perform similar studies was limited. Nevertheless, this work provides strong evidence that PI8 is likely to be the physiological inhibitor of one or more proprotein convertases.
68
69
CHAPTER 4: EXPRESSION OF MPI8 WITHIN MOUSE TISSUES
4.1 INTRODUCTION
While kinetic analysis suggests that furin may be the physiological target of mPI8, it is also possible that mPI8 inhibits other proprotein convertases in vivo. PC5/6B and PACE4 were inhibited by mPI8, but neither their alternate isoforms, nor the other proprotein convertases PC1/3, PC2, PC4 or PC7 were tested. It is impossible to rule out these proprotein convertases as alternate targets of mPI8, but examination of the expression profi le of mPI8 may provide clues as to which potential target it is likely to inhibit.
Based on the current paradigm of clade B serpin interactions with target proteases, it would be expected a target of PI8 would be expressed within the same cells as PI8. For example, the clade B serpin PI9 is a good example of an intracellular serpin acting in a cytoprotective fashion, and is able to prevent Granzyme B autolysis within cytotoxic lymphocites (CLs) in vitro (Bird et al, 1998). Together, both play a role in the immune response (Trapani & Sutton, 2003). Mice lacking Spi6, the murine homologue of PI9, have a diminished survival rate in response to immune challenge, which is a direct consequence of the reduced intregrity of cytotoxic granules and the resulting increase of cytoplasmic granzyme B and subsequent induction of apoptosis (Zhang et al, 2006).
Although PI8 has a nucleocytoplasmic distribution and proprotein convertases are generally localised within compartments of the secretory pathway, as well as at the cell surface (Molloy et al, 1999; Nour et al, 2005), any event which places the cell in stress could introduce the possibility of membrane destabilisation and compartment leakage. For example, it has been demonstrated that partial or complete rupture of lysosomes can occur as a result of oxidative stress, as well as exposure to lysosomotropic detergents, aldehydes or overexpression of p53 protein (Terman et al, 2006).
It is diffi cult to predict the result of proprotein convertase release into the cytoplasm, but given the vast number of PC substrates already identifi ed, it is plausible to suggest that their activity outside the general secretory pathway may be deleterious to normal cellular function.
70
4.2 EXAMINATION OF MPI8 AND PROPROTEIN CONVERTASE TRANSCRIPTS BY RT-PCR ANALYSIS
The murine tissue distribution of members of the PC family was examined by RT PCR analysis and an attempt was made to correlate their expression with PI8 (Table 4.1), following the prediction that mPI8 would be co-expressed with its target protease within organs. Expression data obtained in this analysis was largely consistent with previous reported data examining expression of individual convertase RNA in the mouse.
Furin is usually noted as being ubiquitously expressed (Brennan & Nakayama, 1994); however, this study did not detect its transcript within RNA derived from spleen, testis, or uterus. Previous reports have detected furin mRNA expression within mouse testis using in situ hybridisation methods (Torii et al, 1993). In human studies, furin has been demonstrated via immunohistochemistry to be expressed within the endometrium, although the same authors did not detect furin transcript within samples from the proliferative endometrium, only the secretory endometrium (Freyer et al, 2007). However, the same authors were able to detect furin transcript within the proliferative endometrium using real-time PCR. Thus the negative results observed in this experiment may be due to a lack of sensitivity of RT-PCR, rather than a genuine absence of transcript in spleen, testis and uterus. It is possible that some organs which did not return a positive signal do indeed express that gene, although perhaps within a very restricted subpopulation of cells, below the level of detection, thus leading to a false negative result.
A more accurate refl ection of the mRNA pool from a small cell population could be obtained using laser micro-dissection to collect cells from given tissues within an organ and then using these cells to conduct RT-PCR. It may also be possible that, although the mRNA expression of a given gene is low in a particular cell type, post-transcriptional regulation may result in signifi cant and detectable quantities of the gene product being expressed from very low mRNA levels. To confi rm these results in the future, southern blotting of “standard” RT-PCR products could be performed, to increase sensitivity. Alternately, real-time PCR could be used to allow quantitative analysis of the levels of transcript present in the various organs.
Given the hypothesis, it would be expected that although the relative levels within an organ or tissue type may vary, the convertase or convertases which are inhibited by mPI8 will be found within the same subset of organs as Serpinb8 itself. The organs within which Serpinb8 was not detected were bone marrow, small intestine, spleen, and thymus. No convertase gene was detected in spleen either, although GAPDH expression was noted there as a positive control (see Figure 4.1). Furin, PC5/6,PACE4 and PC7 demonstrated expression in bone marrow, and similarly, in thymus, Furin, PC5/6 and PC7 were noted. No organ demonstrated expression of all seven convertases except brain, which was also positive for Serpinb8.
71
Table 4.1 RT-PCR analysis of proprotein convertase and Serpinb8 expression Primers specifi c to mouse gene Serpinb8, as well as to the mouse proprotein convertase genes Pcsk1, Pcsk2, Pcsk3, Pcsk4, Pcsk5, Pcsk6, Pcsk7 (corresponding to PC1/3, PC2, furin, PC4, PC5/6, PACE4 and PC7 gene products respectively, as labelled above), were designed to bridge from the 5’ UTR across the fi rst intron of each gene. RT-PCR was carried out on cDNA generated from RNA extracted from various organs obtained from wild type C56BL/6J mice and the resulting products visualised on a 1% agarose gel. Items scored as follows: -, not detected; +, expression detected.
Serp
inb8
PC1/3
PC2
furin
PC4
PC5/6
PACE
4
PC7
Adrenal + + - + - + + +
Bone Marrow - - - + - - + +
Brain + + + + - + + +
Heart + - - + + + + +
Kidney + - - + - + + +
Liver + + - + + + + -
Lymph Node + + - + - + + +
Lung + - - + - + - +
Ovary + + - + + + + +
Pancreas + - - + - + + +
Skin + - - + - + + +
Small Intestine - - + + + + + +
Spleen - - - - - - - -
Stomach + + + + - + + +
Testis + - - - + + + +
Thymus - - - + - + - +
Uterus + - - - - + + +
72
Figure 4.1 RT-PCR analysis of furin expression
Primers specifi c to mouse proprotein convertase gene Pcsk3, corresponding to the gene product furin, were designed to bridge from the 5’ UTR across the fi rst intron of the gene and generate a 663 bp product (solid arrow). RT-PCR was carried out on cDNA generated from RNA extracted from various organs obtained from wild type C57BL/6J mice and the resulting products visualised on a 1% agarose gel. Samples from cDNA are noted above as (+); the reverse transcription reaction was similarly followed in the absence of reverse transcriptase, and those samples are used as a genomic DNA control above (-). It was noted that the primers demonstrate some cross-reactivity, generating additional product/s. Subsequent BLAST analysis of the Pcsk3 primers noted that they contained a repeat element (approximately 1/3 of total bases of the primer) also present elsewhere within the furin cDNA. Organs were subsequently scored for the presence or absence of furin, as seen in Table 4.1. Primers specifi c to the housekeeping gene GAPDH were used as a positive control to demonstrate the integrity of the cDNA. pUC119 DNA digested with Hinf1 was used as a size standard.
- + - + - + - + - + - + - +
- + - + - + - + - + - + - + - + - + - +
adre
nal g
land
hear
tki
dney
lym
ph no
depa
ncre
assm
all in
testin
esto
mac
h
bone
mar
row
liver
brain
lung
ovar
ysk
insp
leen
testis
thym
usut
erus
1400543517396214
bp
pUC1
19 H
inf1
pUC1
19 H
inf1
pUC1
19 H
inf1
pUC1
19 H
inf1
pUC1
19 H
inf1
1400543517396214
bp
GAPDH
GAPDH
73
Thus, the convertases which demonstrated a highly restricted expression pattern, namely PC1/3, PC2 and the endocrine convertase PC4, which differed signifi cantly from the more widely distributed Serpinb8, appear less likely to represent good potential inhibitory targets. Unfortunately, amongst the remaining convertases assessed by RT-PCR, nonedemonstrated a clear correlation with Serpinb8. Furin, PACE4, PC5/6, and PC7/8 transcripts are all expressed with a tissue distribution that overlaps with, but does not directly resemble that observed for Serpinb8.
The PCR primers used in this experiment were designed to be specifi c for each of the proprotein convertase family and were selected to amplify within a region of the catalytic domain, in order to detect all isoforms of the individual convertase. As a consequence, the variation in expression of isoforms of a single convertase was not examined by this experiment. It is understood that isoforms of the same protein may have different expression patterns; the fi rst rat isoform of PACE4, now known as PACE4A, demonstrated a restricted expression pattern and was found only within brain and pituitary (Johnson et al, 1994). Even furin itself is known to have three transcript isoforms, although these differ only in their 5’ untranslated regions, and are thought to be the key to the effect of different promoters on furin’s expression within different cell types (Ayoubi et al, 1994). Due to the number of transcripts existing for each convertase, and in many cases, the lack of full characterisation of such, it was impractical to use this RT PCR approach to screen for expression of all convertase transcripts.
Although this experiment has not identifi ed a single convertase which demonstrates Serpinb8-like expression, it eliminates PC1/3, PC2 and PC4 as being likely targets, leaving furin, PC5/6, PACE4 and PC7 as potential targets. It is possible that mPI8 is an inhibitor of more than one convertase, with the inhibitory interaction determined by the co location not only within a given organ, but within specifi c cell types, and the chance for exposure of a convertase to mPI8 would be governed by its intracellular location. Some convertase isoforms are membrane bound, either remaining in the TGN and later secretory pathway, or reaching and being retained the cell surface; others are secreted into the extracellular space (Molloy et al, 1999). As previously mentioned, evidence exists to suggest that intracellular membranes can destabilise during periods of cell stress, and it is plausible that cytoplasmic mPI8 may prevent the inadvertent proteolysis of cytoplasmic substrates by a convertase which has leaked into the cell from a transport or secretory vesicle. To gain a better understanding of what mPI8 is doing within an organ, an examination of protein expression and cellular localisation would be valuable.
74
4.3 EXAMINATION OF MPI8 EXPRESSION BY IMMUNOHISTOCHEMISTRY
RNA analysis of mPI8 expression in organs was unable to delineate a physiological target protease from amongst the candidate proprotein convertases examined. It was thought that examination of cellular distribution of mPI8 protein may help to clarify mPI8 function. Two rabbit polyclonal antibodies were previously generated (Chapter 3.2) which appeared to be essentially specifi c for the mPI8 protein as demonstrated by immunofl uorescence screening procedures. The examination of the expression of mPI8 within normal mouse tissues by immunohistology would provide the opportunity to observe protein expression, which is a more useful indication of function than mRNA alone, as well as the ability to locate mPI8 to specifi c subsets of cells within an organ. This may allow a clearer link between mPI8-expressing cell types to be drawn and the resulting correlation provide a better understanding of potential mPI8 targets and function. Tissues for immunohistochemical analysis were selected on the basis of detected mRNA expression of Serpinb8.
Organs were harvested from healthy wild-type C57BL/6J mice and fi xed overnight, before being processed and sectioned. Immunohistochemistry was performed essentially as previously described (Buzza et al, 2001) using either the R5 and R6 antisera at varying dilutions. A poly-HRP secondary antibody was also utilised to enhance the antigen signal – in all cases this was carried out along side unamplifi ed sections and was observed to generate an identical, but stronger, signal, which was more amenable to photography. The antigen detection observed by both R5 and R6 was identical, and representative images were obtained using light microscopy.
A high background signal was observed in three organs surveyed by immunohistochemistry, whereby it was impossible to distinguish between the pre immune sera and the antisera of both R5 and R6. Modifi cations to the method were unable to reduce this background signal and thus the stomach, pancreas and brain are omitted from this survey. Of other organs surveyed, no antigen was observable within the heart, liver, or testis, using either R5 or R6 antisera. This expression pattern is consistent with the low Serpinb8 mRNA observed in these organs by RT-PCR analysis (see Table 4.1). Immunohistochemistry of the kidney demonstrated mPI8 antigen, and will be discussed in greater detail in the next chapter.
4.3.1 Expression of mPI8 in the adrenal gland
Examination of the adrenal gland by immunohistochemistry using the R5 and R6 antisera noted expression of mPI8 antigen in both the adrenal medulla and the cortex (Figure 4.2 b). Corresponding pre-immune sera produced no observable signal (Figure 4.2 a). At higher magnifi cation (Figure 4.2 c) it can be seen that a subpopulation of medullary cells display a weaker signal – these are likely to be chromaffi n cells, which are responsible for the storage and secretion of noradrenaline. Other medullary cells are involved in the
75
Figure 4.2 Expression of mPI8 is predominantly in the adrenal medulla
Detection of mPI8 in mouse lung with anti-mPI8 antibody R5 at 1:1000 dilution (b-d), as compared to the preimmune sera of the same rabbit (a). Images were observed using a 20x objective lens (a,b), 40x (c) and 100x (d). Antigen is most strongly observed in the medullary region of the adrenal gland, although some clusters of cells (likely to be chromaffi n cells) within the medulla display weaker signal. The adrenal cortex also appears to express mPI8, although this is predominantly within the zona fasciulata (ZF), which lies between the outer wall, zona glomerulosa (ZG), and the inner boundary, the zona reticularis (ZR).
a b
c d
Cortex
Medullazf
zg
zr
76
synthesis of adrenaline from noradrenaline via the addition of a further N-methyl group; these cells exhibit a strong mPI8 signal (Figure 4.2d). In contrast, the adrenal cortex, which does demonstrate mPI8 staining, albeit of a lower level, is responsible for the conversion of cholesterol into glucocorticoid, mineralocordicoid and androgenic steroid hormones.
There is no obvious role for a protease or serpin in steroid hormone production, however chromaffi n cells are also responsible for the synthesis of neuropeptides, including [Met]enkephalin and neuropeptide Y (Pelto-Huikko, 1989). Chromaffi n cells are also known to express the convertase PC1/3, which is involved in the generation of secretoneurin from secretogranin II (Hofl ehner et al, 1995). Previous reports suggest furin is also present in the adrenal medulla, although it is only found in membrane-bound, rather than secreted form, and does not co-localise with PC1/3 (Kirchmair et al, 1992). The expression of other convertases within the adrenal gland has not been examined, except on an mRNA level, with PC5 mRNA being highly expressed (Lusson et al, 1993). The RT-PCR analysis conducted in this study noted PC1/3, furin, PC5/6, PACE4 and PC7/8 to be expressed within the adrenal gland. While mPI8 is not expressed solely in neuroendocrine tissues, it is possible it has the potential to inhibit multiple convertase targets, which may include PC1/3 given its co-expression in these cells, or alternately, it may be present to interact with furin or another convertase such as PC5/6, which were co-expressed with mPI8 in a greater number of organs.
4.3.2 Expression of mPI8 in the uterus
Immunohistochemistry was performed on uterine sections using both R5 and R6 antisera. Positive signal was observed predominantly within the endometrial glands, although a lower level of expression of mPI8 was also observed within cells of the perimetrium, myometrium and the endometrial stroma (Figure 4.3).
Endometrial glands are comprised of ciliated columnar epithelia, and are responsible for the secretion of a variety of substances into the uterine lumen. These include enzymes, cytokines, growth factors, hormones, glucose, transport proteins, adhesion molecules, and glycogen (Fazleabas et al, 1994; Martal et al, 1997), although the specifi c components vary depending on the menstrual cycle and implantation status (Ace & Okulicz, 2004).
Furin is known to be highly expressed in the endometrial gland across the menstrual cycle (Freyer et al, 2007) as well as being present in some decidualised cells and stromal fi broblasts; PC7 and PACE4 are also expressed within stromal and glandular components. In comparison, PC5/6 has been previously recognised as being up-regulated during decidualisation and in preparation for implantation (Nie et al, 2005), but is also highly expressed by cells of the glandular epithelium throughout the menstrual cycle (Nie et al, 2005). Matrix metalloproteinases and their tissue inhibitors are involved in the normal menstrual cycle (Salamonsen, 1998) as well as during implantation (Salamonsen, 1999); many MMPs themselves are known substrates for proprotein convertases. This study noted mPI8 is expressed more strongly within endometrial glands and to a lesser extent in stromal
77
Figure 4.3 Expression of mPI8 in the uterus
Detection of mPI8 in mouse uterus with anti-mPI8 antibody R5 (b), as compared to the preimmune sera of the same rabbit (a). Images were observed using a 10x (a,b), 40x (c) or 100x (d) objective lens. There is some faint staining of the myometrium observed, but the most prominent mPI8 positive tissues are the endometrial glands. (My) myometrium; (En) endometrium; (Lu) lumen; (solid arrowheads) endometrial glands.
a b
c d
My
My
My
Lu
En
En
En
78
fi broblasts which correlates with reports of furin’s expression (Freyer et al, 2007). Further analysis of mPI8 expression by immunohistochemistry across the menstrual cycle, as well as during early pregnancy might aid in the elucidation of its inhibitory target, more specifi cally, whether mPI8 expression fl uctuates across the cycle to regulate PC5/6 or remains largely static, like furin.
4.3.3 Expression of mPI8 in the ovaries
Immunohistochemistry was also performed on ovarian sections using R5 and R6 antisera. Compared to the preimmune sera (Figure 4.4 ii; a, c, e), antigen was observed within follicular granulosa cells found in primordial, primary, and Graafi an follicles. There is also some antigen observed within the corpora lutea (identifi ed as CL in overview cartoon, Figure 4.4 i). There is some cross-reactivity seen in both the immune and preimmune sera but this is confi ned to a subset of cells within the ovarian stroma (Figure 4.4 ii; c, d, marked on Figure 4.3 ii; g). It was diffi cult to determine whether the layer of fat surrounding the ovary contained mPI8 or not (seen most distinctly in Figure 4.4 ii; a, b), given the morphology of the fat cells. Interestingly, simple cuboidal cells of the germinal epithelium do not appear to express mPI8 antigen, despite being a precursor to the primary follicles, which do.
Of the proprotein convertases, there are no reports of furin demonstrating ovarian expression, although several publications report the cleavage of substrates containing a “furin” recognition motif. PC4 has been demonstrated to play a role in folliculogenesis (Gyamera-Acheampong & Mbikay, 2009), although no actual expression of PC4 in the ovary has been observed. PC1/3, PC5/6 and PC7 are expressed within the ovary (Bruzzaniti et al, 1996; Dai et al, 1995; Lusson et al, 1993), as is PACE4, the mRNA of which was observed within granulosa cells surrounding secondary follicles (Constam et al, 1996). More specifi cally, PC5/6 is present within the granulosa cells of pre-ovulatory follicles, and can be stimulated by luteinising hormone, suggesting it plays a role in ovulation-responsive cleavage of hormones (Bae et al, 2008). Given the expression pattern of mPI8 overlaps with, but is not identical to PC5/6, there may be a possibility that mPI8 is present in adjacent cells as well as other ovarian cell types to prevent soluble convertase which has been internalised by adjacent cells from undergoing the same PC-based cleavage events as the cell which secreted it. Alternately, mPI8 may be acting on multiple convertase targets within the ovary.
4.3.4 Expression of mPI8 in the lung
Immunohistochemistry was performed on lung sections using both R5 and R6 antisera (Figure 4.5 b, d, e-f, h). In contrast to the preimmune sera (Figure 4.5 a, c, g), positive staining was observed most distinctly within the columnar respiratory epithelia of the bronchiole (Figure 4.5 f, h), as well as to a lesser extent within epithelial cells of the alveoli (Figure 4.5 h). The smooth muscle cells which encircle the bronchiole appear to be negative for mPI8 expression (fi gure 4.5 f, h).
79
The lung is a key site of protease activity from serine, cysteine and matrix metalloproteases, as well as disintegrin metalloproteases of the ADAM family. Lung proteases can function either extracellularly or intracellularly. Previous examination of proprotein convertase mRNA expression in the lung has demonstrated a lack of PC2 and PC1/3 transcripts, however PACE4 appears to be endogenously expressed, as is furin (Mbikay et al, 1997). PC7 has also been shown to exhibit endogenous transcript in the lung (Constam et al, 1996). PC5/6 transcript is expressed in the developing lung (Zheng et al, 1997) and is noted in the adult lung in these studies (Table 4.1). Functionally, furin processes the apical epithelial Na+ channel, ENaC, most important for regulating Na+ and water fl ux across high resistant respiratory epithelia and alveoli, as well as at the bladder, kidney and distal colon. ENaC is not always processed by the time it reach the plasma membrane, and further channel activation at the cell surface by furin may play a role in sodium modulation (Planes & Caughey, 2007). ENaC also expressed in epidermis, but its function there is less clearly understood.
In addition to a functional role in normal cellular processes within the lung epithelia, the proprotein convertases are also taken advantage of for the processing of the HA protein of the infl uenza virus (Remacle et al, 2008), an action which is required for viral budding and further transmission to other cells, or hosts.
Unfortunately, information about the cell type localisation of other clade B serpins, as well as of proprotein convertases or other potential protease targets within the lung is incomplete. There is no clear suggestion that PI8 will inhibit a given protease based upon co-localisation provided by the current literature, and so further studies should concentrate on analysing which cell types within the lung, and other PI8-expressing organs, express members of the proprotein convertase family.
4.3.5 Expression of mPI8 in the skin
Immunohistochemistry was performed on sections of mouse skin using R5 and R6 antisera, along with the corresponding preimmune controls (Figure 4.6 a-f, Figure 4.7 a-d). Antigen is visible in the striated muscle layer lying beneath the skin, the panniculus carnosus (Figure 4.6, a-d), which exists in mice and other animals but is found only in a vestigial capacity in humans. Signifi cant antigen is also expressed in the epidermis, as seen in Figure 4.6 f. Some cross-reactivity is exhibited against sebaceous glands (Figure 4.6 f), although this is not consistently observed across the sections, but does appear in both pre-immune and immune sera, as is seen in the transverse follicle sections of Figure 4.7 a & b.
Strong expression of mPI8 was observed in cells of the hair follicle (Figure 4.6 d, f) – the dark bundles of keratin within the hair itself can be seen in Fig 4.6 d, where the plane of the section runs almost longitudinally through the follicle and hair. The distribution of mPI8 throughout the follicle is clearest in (Figure 4.7 b, d) with a transverse section (Figure 4.7 b) and a longitudinal section (Figure 4.7 d) showing mPI8 is expressed within a subpopulation
80
Figure 4.4 Expression of mPI8 in ovarian tissues
i) Gross structure of the ovary can be observed below (ii), and a cartoon was devised to note the key features.The outer area of the ovary, known as the cortex, is denoted here in pink, and contains the ovarian follicles in various stages of development as well as the connective tissue stroma in between. At the outermost layer of the cortex, the ovary is encapsulated by the germinal epithelium layer. The core stromal region of the ovary is known as the medulla, and contains blood and lymphatic vessels (BV), as well as nerves (not pictured). Primordial follicles (PF) are arrested in growth, and at the beginning of each menstrual cycle, a number of primordial follicles develop into primary follicles (F). Under the infl uence of gonadotrophins and ovarian hormones, primary follicles grow, and a space appears in which follicular fl uid accumulates, known as the follicular antrum (FA). Only one follicle developing into a Graafi an follicle in humans. The Graafi an follicle (GF) is ovulated, expelling the oocyte (O) into the uterine passage. The remaining cells develop into the corpus luteum (CL), which is also the atretic pathway followed by follicles not developing into GF’s. The corpus luteum is responsible for the secretion of progesterone and other hormones required for endometrial maintenance.ii) Detection of mPI8 in mouse ovary with anti-mPI8 antisera R6 (b, d, f-h), as compared to the preimmune sera of the same rabbit (a, c, e). Images were collected using a 4x objective lens (a, b), 10x objective (d, e), 20x objective (e, f) or 40x objective (g, h). There is some cross-reactivity seen with both R6 and preimmune sera, as marked by white triangles (c, g); these cells possibly represent macrophages which have infi ltrated the corpus luteum, or possibly are a subtype of stromal cell. Positive staining is observed in primordial, primary, secondary and Graafi an follicles, particularly cells of the zona granulosa, with lower intensity staining observed in the corpus luteum and the corpus albicans. Positive staining is also observed in the epithelial lining of the oviduct. Stromal cells, aside from the small population possibly demonstrating cross-reactivity to the antisera, do not demonstrate mPI8 staining.
81
PF
PF
BV
GFBV
GF
CL
CL
CL
CL
O
OO
O
O
FA
FA
FAMedulla
Cortex
O
F
FF
i
ii a
c
e
g
b
d
f
h
82
Figure 4.5 Expression of mPI8 in epithelia of the lung
Detection of mPI8 in mouse lung with anti-mPI8 antibody R6 (b, d-f, h), as compared to the preimmune sera of the same rabbit (a, c, g). Images were collected using a 4x objective lens (a,b), 10x objective (c,d), 20x objective (e, f) or a 40x objective (g, h). At low magnifi cation (b, d), the intrapulmonary bronchus branches into bronchioles, where mPI8 is observed in the epithelial lining of the lung in both alveoli and the columnar epithelia of the bronchiole. Smooth muscle cells surrounding the bronchioli do not appear to express mPI8, in contrast with the medium intensity staining of the alveolar squamous epithelia and the high intensity staining of the ciliated simple columnar respiratory epithelium of the bronchiole (e,f,h). (Ac) acini; (Al) alveolus; (Br, and hollow arrowheads) bronchus; (InBr) intrapulmonary bronchus; (solid arrowhead) smooth muscle.
Br
Br
Br
InBr
Ac
Al
Al
a
c
e
g
b
d
f
h
83
Figure 4.6 Mouse skin demonstrates mPI8 expression
Detection of mPI8 in mouse skin with anti-mPI8 antisera R6 at 1:2500 (b, d, f), as compared to the preimmune sera of the same rabbit (a, c, e). Images were collected using a 10x objective lens (a-d), or a 20x objective (e-f). At 10x magnifi cation (b), mPI8 is noted in the epidermal layer, as well as the panniculus carnosus (pc), a muscle layer which exists in mice but not humans. It is also notable that cells of the hair follicle demonstrate strong mPI8 expression, seen most clearly at 20x (d, f). Sebaceous glands sometimes appeared mPI8-positive (f), but this staining pattern was not consistent across all sections and sebaceous cross-reactivity was observed in pre-immune sera as well as immune sera at higher concentrations of antisera (not shown). There also appeared to be some weaker mPI8 signal noted in dermal cells (f).
pc
epidermis
dermis
a
c
e f
b
d
84
Figure 4.7 Cells within the hair follicle demonstrate mPI8 expression
Detection of mPI8 in mouse hair follicle with anti-mPI8 antisera R6 at 1:2500 (b, d), as compared to the preimmune sera of the same rabbit (a, c). Images were collected using a 100x objective lens. At 100x objective, a slightly oblique transverse section (a, b) demonstrates keratin expression within the hair bulb, which is distinctly visible in both preimmune and immune sera. However, in immune-stained sections only (b, d) the keratin of the hair root is enclosed within a surrounding layer of cells which demonstrate strong mPI8 staining. The longitudinal section (d) suggests that mPI8 within the hair follicle is expressed by a distinct subpopulation of follicular cells, but it is not possible to identify these from the sections obtained here.
a
c
b
d
85
of follicular cells, although it is not possible to distinguish these based solely on histological analysis. mPI8 is not noted to be generally expressed within the dermal layer, although individual mPI8-positive cells in this area may be histiocytes, a specialised population of macrophages found predominantly in the skin. Alternately, dermal staining could be an artefact of the sectioning process, given the prevalence of adipose cells below the dermis which are diffi cult to cut cleanly and to deposit on the slide without damage.
Of the proprotein convertases, four are reportedly expressed within the epidermis – furin, PACE4, PC5/6 and PC7 (Pearton et al, 2001); this study noted furin, PACE4, and PC7 transcripts alongside mPI8. Furin is found in both soluble and membrane forms within the epidermis; the membrane-tethered form is found in the basal layer and the granular layer and very low expression in the spinous layer, however active furin is only found at the granular layer and to a lesser extent, in the spinous layer – suggesting differentiation-dependent activation, or upregulation (Pearton et al, 2001). PC7 is expressed ubiquitously throughout the epidermal layers. Furin and PACE4 cleave Notch-1 and profi laggrin, which are both involved in epidermal differentiation (Moriyama et al, 2008; Proksch et al, 2008). There is also evidence suggesting PC1 and PC2 are involved in the processing of POMC in the skin, the expression levels of both convertases shifting from anagen to telogen in epidermal keratinocytes and sebaceous glands (Mazurkiewicz et al, 2000). The expression pattern of POMC-derived peptides ACTH, β-MSH and β-Endorphin also varies across the hair cycle, providing further evidence of the role of PC1/3 and PC2 taking place in the skin.
Further studies of the expression of mPI8 within the follicle and a determination of which subpopulations of cells are mPI8-expressing may help elucidate a role for mPI8, possibly by providing correlation with a specifi c protease, or potential substrates of a protease target.
4.4 MPI8 IS FOUND WITHIN A DISTINCT SUBSET OF CELLS OF THE HAIR FOLLICLE
Examination of mouse skin by immunohistochemistry demonstrated that mPI8 is strongly expressed within the hair follicle, as well as at the epidermis and within the striated muscle underlying the dermis. However, histological analysis was unable to identify which of the cell layers of the follicle were mPI8-expressing.
Developmental studies have identifi ed genetic markers which arise as the embryonic hair follicle grows downwards and the highly proliferative leading edge, otherwise known as the matrix, begins to differentiate into the outer root sheath, inner root sheath, and hair shaft (Muller-Rover et al, 2001). In mice, the development of the hair follicle follows a precise time scale, although after the fi rst cycle of hair growth, the cycles of individual follicles become less synchronised across the body of the animal. As the skin sections obtained for immunohistological analysis in section 4.3 were from adult mice, the follicles seen are in
86
different stages of the hair cycle. Follicles spend the majority of their time in anagen, or growth phase, which is followed by apoptosis-driven regression, known as catogen, and then fi nally in telogen, or quiescent phase.
To allow the identifi cation of mPI8 within the cell layers of the mature follicle, immunofl uorescence was performed on murine wholemounts of epidermis obtained from the tails of juvenile C57BL/6J mice. Epidermal sheets were then immunolabelled with either the R5 antisera or preimmune sera from the same rabbit, as well as with an antibody against the C-terminus of the Keratin 14 protein, which allowed visualisation of cells of the outer root sheath, the interfollicular epidermis as well as the outer layer of the sebaceous gland (Braun et al, 2003). The sections were then counterstained using DAPI which allowed clearer visualisation of the follicular structure, as seen in Figure 4.8.
In comparison to the preimmune sera, Figure 4.8 a, R5 antisera showed specifi c antigen detectionvisible in the bulb of the hair follicle, as well as along the bulge region. This pattern was identical at all dilutions of R5 antisera examined, and showed that R5 is highly specifi c for mPI8 using this technique.
After determining the R5 antisera did not exhibit any cross-reactivity, epidermal sheets were double labelled for mPI8 as well as a monoclonal antibody specifi c to desmoplakins 1 & 2, and then counterstained using the nuclear marker DAPI, which are represented in the merged image in green, red and blue respectively (Figure 4.9 ii). Previous analyses have shown desmoplakin 1 and 2 (Dp1/2) to be expressed in the ORS, but with signifi cant expression in the suprabasal layer, and weaker expression in the basal layer. The companion layer is negative for Dp1/2. Henle’s and Huxley’s layers both express Dp1/2, whereas the inner root sheath cuticle (ICu Figure 4.9 i) and the hair shaft cuticle (Ch Figure 4.9 i) display low or undetectable levels of Dp1/2 (Kurzen et al, 1998).
In this experiment, the strongest Dp1/2 staining is noted in junctions between cells of the suprabasal layer of the ORS, and weaker staining is observed in other areas, as expected (Figure 4.9 ii; c). The companion layer is absent of Dp1/2 staining, although these cells are fully differentiated and present only at the top third of the shaft visible in these images. The dermal papilla does not express Dp1/2 either. Additionally, the fully developed hair shaft is known not to stain using immunocytochemical methods, which explains the general reduction in fl uorescence observed towards the fully developed top end of the follicle.
mPI8 antigen expression correlates fairly well with Dp1/2, although mPI8 expression does not extend further up the shaft from the apex of the dermal papilla on the bulb, instead being most intense at the bulge-based leading edge. The mPI8 antigen is seen in the ORS, as well as all three layers of the IRS. Surprisingly, mPI8 does not appear to be expressed in the nuclei of these cells, or is expressed at a signifi cantly lower level than in the nucleus; this is in contrast to its nucleocytoplasmic distribution observed in immunofl uorescence characterisation experiments (Gillard, 2001). This distribution may be an artefact of the
87
Figure 4.8 The R5 antibody is specifi c for mPI8 expression as noted in the follicular bulb
Epidermal sheets were labelled for keratin 14 (red, c, d) and mPI8 (green, b, d) by double label immunofl uorescence. Skin was collected from tails of juvenile mice and the epidermal layer separated for wholemounting. Staining was performed with either the R5 anti-mPI8 antisera (b, d) or preimmune sera from the same rabbit (a, c). Co-staining was performed using the rabbit polyclonal antibody anti-Keratin 14. Epidermal sections were counterstained with the nuclear marker DAPI (blue, c, d). Images were collected using a 40x objective lens. It can be seen that the anti-mPI8 antisera R5 demonstrates a very specifi c expression pattern within the folliclular bulb and bulge regions which is not present in staining using the preimmune sera. Keratin 14 is expressed in the outer root sheath of the follicle and as such, this marker provides limited information about the intrafollicular expression of mPI8. Keratin 14 staining of sebaceous glands is non-specifi c because of the use of a mouse primary antibody.
a
c
b
d
88
SG
Bu
He Hu
ICuSBaBa
mPI8mPI8
Figure 4.9 Mouse hair follicle bulb demonstrates co-expression of mPI8 with Dp1/2
i) Rapidly proliferating matrix cells at the follicular base (blue) give rise to seven differentiation-specifi c lineages. The various genetic markers for these lineages are shown. Matrix cells express the proliferative marker Ki67. As these cells differentiate, they express keratins differentially. (Ba) basal cells of the ORS, (Ch) hair shaft cuticle; (Co) cortex; (Cp) companion layer; (DP) dermal papilla; (He) Henle’s layer; (Hu) Huxley’s layer; (ICu) inner root sheath cuticle; (IRS) inner root sheath; (Me) medulla; (ORS) outer root sheath; (SBa) suprabasal cells of the ORS. Also labelled on the follicular superstructure are (SG) sebaceous gland; (Bu) stem cell bulge. Cell layers which are mPI8-expressing are marked in green.
Adapted with permission from (Fuchs 2007) © Macmillan Publishers Ltd.
ii) Epidermal sheets were labelled for desmoplakin 1+2 (opposite - red, c, d, g, h) and mPI8 (opposite - green, b, d, f, h) by double label immunofl uorescence. Skin was collected from tails of juvenile mice and the epidermal layer separated for wholemounting. Epidermal sections were counterstained with the nuclear marker DAPI (blue, a, d, e, h). Images were collected using a 100x objective lens. In the merged images (d, h), it can be seen that Dp1/2 and mPI8 correlate most notably within the three layers of cells of the inner root sheath, but are also co-expressed in the outer root sheath. Neither are expressed within the dermal papilla. A sebaceous gland, lying adjacent to the follicular bulb, is visible in the top right-hand corner of the fi rst sequence of images (a, c, d), and mid-left in the second sequence (e, g, h). The outermost layer of nuclei visible represent basal cells of the outer root sheath (a, e).
i
89
ii
a
c
e
g
b
d
f
h
90
SG
mPI8
DP
Bu
91
a
d
g
b
e
h
c
f
i
92
epidermal sheet labelling process, and it is possible the permeabilisation step was not undertaken for long enough to allow the antibody molecules to fully penetrate the nuclear membrane.
Given that mPI8 appears to be expressed in the follicular bulge region (Figure 4.8), and is most highly expressed in cells which have recently differentiated (Figure 4.9 ii) in the hair follicle, it should demonstrate co-localisation with a stem cell bulge marker protein. Cytokeratin 15 is considered to be a marker of stem cells in the hair follicle (Lyle et al, 1998; Ozawa et al, 2004), and this study used a mouse monoclonal antisera raised to a peptide containing the last 17 amino acids of the keratin 15 (K15) polyprotein (Waseem et al, 1999). Cultured primary keratinocytes are reported to lose K15 expression as they undergo differentiation.
Epidermal sheets were again colabelled for mPI8 using the R5 antisera, and for K15 using the monoclonal antibody LHK15, and counterstained using DAPI as a nuclear marker. Imaging focussed on the stem cell bulge region demonstrates that K15 (Figure 4.10 c) and mPI8 (Figure 4.10 b) are both expressed in keratinocytes of the bulge, although their expression pattern does not overlap exactly, as is demonstrated in the merged panel of these image sections, (Figure 4.10 a), where the K15 staining in red is slightly more intense in the cells which are immediately adjacent to the hair follicle, whereas mPI8 expressing cells in green are more evenly distributed across the bulge region.
Observation at higher magnifi cation at the boundary of the extending follicular bulge, however, noted that mPI8 is more strongly expressed by bulge cells adjacent to the hair shaft (Figure 4.10 d, e). At 100x magnifi cation, it can be seen that unlike the follicular cells in Figure 4.9 ii, bulge cells appear to express mPI8 in both the cell nucleus as well as the cytoplasm in the majority of cells visible within the fi eld (Figure 4.10 f-h). Some of the nuclei stained with DAPI are dysmorphic, and in those cells, the mPI8 staining appears punctuate, and in some cases, of a brighter intensity than the normal surrounding cells (Figure 4.10 e-h).
These results suggest that mPI8 may have a role in, or be associated with the regenerative process. While the main purpose of bulge cells is to maintain homeostasis of the hair cycle, bulge cells are also able to repopulate or rebuild the sebaceous gland as well as the epidermis under certain circumstances (Ito et al, 2005). It is postulated that other stem cell populations outside the follicular bulge exist, which are involved in broader epidermal homeostasis, although the bulge population is the best described (Fuchs, 2008). Given the broader distribution of mPI8 outside of the follicular stem cell bulge (i.e., within the epidermis and elsewhere in the skin), it must be assumed that even if mPI8 does play a role in hair regeneration, that this is not its only function in epithelia.
93
4.5 DISCUSSION
The results shown here have provided a broad survey of the expression of mPI8, both at the mRNA and protein level, and served to examine the distribution of mPI8 within individual organs and cell types in order to provide clues to its physiological role, or the identity of its inhibitory target/s. mRNA analysis did not pinpoint a single convertase as the most likely inhibitory target of PI8, although on the basis of these results, it is suggested that PC1/3, PC2 and PC4, all of which exhibit an extremely limited expression pattern, are unlikely to be regulated by PI8. The remaining convertases furin, PACE4, PC5/6 and PC7, appear to be expressed within similar organs to mPI8 – although no convertase showed completely overlapping distribution with mPI8. This RT PCR analysis was largely consistent with previously published studies of the mRNA expression of the seven convertases, although specifi city of this technique could be enhanced by using laser-dissection capture analysis to collect specifi c cells from a given tissue, rather than using whole organ homogenates, and real-time PCR would be optimal for future analysis to allow the quantitation of transcripts.
This immunohistochemical analysis of mPI8 expression demonstrated the protein in organs correlating to those identifi ed in the RT-PCR study, most prominently, in medullary cells of the adrenal gland; within uterine endometrial glands; follicular cells of the ovary; bronchial epithelia of the lung; epidermal epithelia of the skin, as well as cells of the hair follicle. More detailed analysis of the follicle found mPI8 within the follicular stem cell bulge population, as well as in most of the follicular layers of the inner and outer root sheath. From this work it appears that mPI8 is predominantly expressed by epithelial cell types. It can also be found in skeletal muscle cells of the skin, but not in smooth muscle cells of the bronchioli, and by some specialised types of connective tissue, i.e. the uterine myometrial stroma.
The expression pattern of PI8 is not reminiscent of any single convertase. A comprehensive comparative analysis of PI8 expression with PC1/3, furin, PACE4, PC5/6 and PC7 would be extremely useful, as most existing immunohistochemical data reports one or two convertases within a given organ. For those studies where the majority of the convertases have been reported within a single tissue – the uterus, and the skin – there are still questions which remain unanswered. Soluble versus membrane-bound form furin display striking differences in expression within the epidermis; this distribution is also signifi cantly different to that observed for PC7 (Pearton et al, 2001). It is also suggested that PC1/3 plays a key role in folliculogenesis in the skin, but no such suggestions have been made for furin, PACE4, PC5/6 or PC7 (Mazurkiewicz et al, 2000). Previous reported analysis of PCs within the uterus suggests that they exhibit relatively distinct expression patterns, with PC5/6 as the sole convertase varying distribution during the menstrual cycle (Freyer et al, 2007). This suggests that further observations of PI8 within the uterus may be particularly pertinent in determining which convertase it is more likely to inhibit.
Little information is present in current literature about the convertase complement of the hair follicle. A signifi cant proportion of information about the hair follicle to date has
94
arisen with the aim to properly classify and characterise the follicular cell populations, but the functional differences which have arisen in these keratinocyte populations, stem cell bulge aside, is an area in need of urgent future examination. What information that currently exists is focussed on pathology-based conditions arising from specifi c mutations in follicular genes, particularly members of the keratin family (Schweizer et al, 2007).
Unfortunately this dearth of information sheds little light on the hair-follicle specifi c role of mPI8, if one exists. There is evidence that suggests that convertases such as furin may play a role in the hair follicle, given the presence of convertase substrates like Notch1 receptor (Uyttendaele et al, 2004). It is also thought that the hair follicle, and particularly, its stem cell complement, is the site of action as well as production of numerous steroid and polypeptide hormones – though this is an area in need of signifi cant further exploration, it does suggest the presence of hormone-processing, and thus, convertases (Paus et al, 2008). It may be of interest to examine the expression of mPI8 and other convertases across the hair cycle, and to observe via quantitative real-time PCR whether they correlate with markers of hair growth, given the expression of mPI8 in the follicular bulge region. If, however, the expression of mPI8 is not specifi c to regenerative areas within the follicle and epithelium, but is also present in different cell types and stem cell populations, this may suggest the involvement of mPI8 in broader regenerative processes. Exploration of mPI8 in wound healing or other model of tissue remodelling may therefore provide vital clues to its function.
95
96
97
CHAPTER 5: INVESTIGATION INTO THE BIOLOGICAL ROLE OF MPI8 IN KIDNEY
5.1 INTRODUCTION
5.1.1 Kidney structure
The kidney is responsible for regulation of the water and electrolyte content of the body. Additionally, it performs endocrine functions, as well as secreting renin and EPO into the bloodstream. The outer membrane of the kidney is called the renal capsule. Cross-section of the kidney reveals it is divided into two distinct regions: the cortex, and the medulla; see Figure 5.1 a.
Each kidney is made up of hundreds of thousands of nephrons, which in turn consist of a glomerulus and associated tubule structures, as demonstrated in Figure 5.1 b. The nephron is composed of two main parts: the renal corpuscle, and the renal tubule. The renal corpuscle comprises Bowman’s capsule and the glomerulus, a network of blood capillaries that is surrounded by a double membrane. Filtration takes place through the semipermeable walls of the glomerular capillaries. The function of the renal tubule is to selectively reabsorb the majority of the glomerular fi ltrate. It is made up of the proximal convoluted tubule; the medullary loop, or the loop of Henle; and the distal tubule, which fi nally empties into the collecting duct. At the very core of the kidney, urine passes from the collecting ducts at the base of each medullary subunit across the papilla and into the renal calyx and then through the renal pelvis into the ureter. The diagrammatical view of the nephron in Figure 5.1 b also contains descriptions of the cell types of the various substructures.
5.1.2 Kidney disease
Fibrosis of the kidney is commonly observed in disease resulting in renal failure, and a large proportion of patients presenting with fi brosis have suffered some form of obstructive nephropathy (Wen et al, 1999). The pathological biochemical processes which lead to renal fi brosis following the initial obstruction are relatively well understood (reviewed by (Chevalier, 1999; Misseri et al, 2004)). Numerous clinical studies of obstruction have been carried out, and there are a variety of animal models available (reviewed by (Klahr & Morrissey, 2002) (Vaughan et al, 2004; Wen et al, 1999)). By contrast, the repair mechanisms with which the kidney responds to damage are less well understood. It appears that endothelial cells, mesothelial glomerular cells, and proximal tubule cells are able to “trans-differentiate” into earlier phenotypes in response to injury (discussed in (El Nahas, 2003)). This reverse differentiation is also associated with the arrival of hematopoietic stem cells which contribute
98
Figure 5.1 Schematic of the nephron
a) Structural schematic of the gross anatomy of the kidney, which is divided into the outer cortex and the inner medulla. The medulla is comprised of pyramid-shaped subunits. Subunits, known as nephrons span the cortex and medulla. The medullary pyramids convey ducts which converge to discharge urine at the renal papillae, which in turn, empty into the calyces. Calyces converge to form the renal pelvis through which urine is conducted by the ureter to the bladder.
b) Cross-sectional view of the kidney demonstrates the main subunit, the nephron. Spanning the medulla and the cortex, the nephron is responsible for fi ltration of plasma, and the concentration of urine before it reaches the bladder.
Elements of plasma are fi ltered from the glomerular capillaries to the space between the glomerulus and Bowman’s capsule, which then passes into the proximal convoluted tubule (PCT). The glomerulus is comprised of epithelial glomerular capillaries, which have prominent basement membranes. The mesangium is comprised of mesangial cells and is a specialised connective tissue subtype. Podocytes of Bowman’s capsule extend their primary processes around capillaries and are key to fi ltration.
Epithelial cells of this segment of the nephron exhibit a brush border - a dense covering of microvilli at their surface. The proximal tubule regulates the pH of the urine by ion exchange, and the process of fi ltrate reabsorption is driven by Na+/K+ antiporters in the basolateral membrane of these cells.
The loop of Henle descends from the PCT as a straight, thin-walled limb, which loops back upon itself as a thicker-walled limb known as the thick ascending limb (TAL) which connects to the distal convoluted tubule (DCT). The loop of Henle generates a high osmotic pressure in the extracellular fl uid of the renal medulla via Na2+ pumps, and provides additional ion reabsorption. Descending limb cells are simple squamous epithelia with rounded shape. The TAL is lined by low cuboidal epithelium, and its cells are also rounded.
The distal convoluted tubule is shorter and less convoluted than the PCT, and Na2+ ion reabsorption is controlled in the DCT via an aldosterone-mediated process. From the DCT, fl uids pass into the collecting ducts which merge to form ducts of Bellini in the renal medulla. DCT cells are cuboidal epithelia without a brush border, have a more clearly defi ned lumen than PCT cells and are seen less frequently on histological cross-section as the DCT is shorter than the PCT. Cells of the collecting ducts are tall columnar epithelia, and do not display a brush border.
Adapted from (Wheater et al, 1987)
99
+ Bowman’scapsule
cortex
calyx
renal vein
medulla
capsule
ureter
renal artery
renal pelvis
a
b
100
to the process of tissue remodelling and repopulation of the atrophied renal region (reviewed by (Poulsom et al, 2003)). Convertase substrates such as TGF-β1, lefty and some MMPs play a key role in the process of epithelial-mesenchymal transition, particularly in ECM remodelling (Cannito et al, 2010). It is therefore likely that furin, PC5A and PACE4, which have demonstrated a role in processing these substrates, have a critical involvement in the EMT regeneration process (Blakytny et al, 2004; Blanchette et al, 1997; Mayer et al, 2008). In addition, genetic background may infl uence the likelihood of long-term recovery from fi brotic kidney disease: for example, SAMP1/Sku lineage mice are predisposed to a higher severity of tubular interstitial nephropathy (Yabuki et al, 2005).
SERPINB8, or PI8, is a clade B serpin for which no physiological role has been described, although in vitro experiments, including those described earlier in Chapter 3, suggest it is an inhibitor of the furin-like prohormone convertases (Dahlen et al, 1998). In mouse, transcripts of the PI8 orthologue Serpinb8 / Spi8 (mPI8) are evident in kidney, skin, adrenal glands, uterus and lung with lower levels in brain, heart, liver, lymph nodes, ovary, pancreas, stomach and testis (Table 4.1). Previous protein analysis has suggested that PI8 is restricted to squamous epithelia, monocytes and cells of neuroendocrine origin (Strik et al, 2002). Histological analysis performed in this study has demonstrated mPI8 expression in neuronal cells of the adrenal medulla, epithelial cells of the uterine endometrium, epidermis, and lung, as well as steroid-secreting cells of the epithelial-derived follicles and of the corpus luteum in ovary, and in particular lineages of keratinocytes of hair follicles.
In this chapter, the expression of mPI8 in the kidney has been examined. mPI8 is present in the ascending limb and convoluted section of the distal tubules. In an injury repair model, mPI8 is upregulated in regions of the kidney undergoing tubular and extracellular matrix remodeling. It is possible that mPI8 regulates a prohormone convertase involved in these processes.
5.2 THE MPI8 GENE IS EXPRESSED IN MOUSE KIDNEY
5.2.1 RNA analysis of mPI8 expression in kidney
It has been previously observed that mPI8 is abundantly expressed in kidney (Table 4.1), which is illustrated by the results of RT-PCR analysis shown in Figure 5.2 a. To determine which specifi c cell types or regions of the kidney produce mPI8, in situ hybridization (ISH) was performed on normal mouse kidney sections (Figure 5.2 b). mPI8 was not found ubiquitously within the kidney (Figure 5.2 b ii), appearing to be restricted to distal convoluted tubules of the renal cortex and straight portions of tubules in the corticomedullary region. This experiment was performed twice using two different hybridization temperatures (55 ºC and 60 ºC); both experiments yielded similar results.
101
Figure 5.2 The mPI8 gene is expressed in mouse kidney
RT-PCR analysis was performed on adult mouse kidney RNA using primers specifi c for mPI8. GAPDH primers were used as a control (a). In situ hybridisation (ISH) was performed on normal mouse kidney sections using an mPI8-specifi c probe, and images were collecting using a microscope at 10x objective (b, ii). A sense probe was used as negative control (i). ISH on adult mouse kidney demonstrates that the mPI8 transcript localises to distal tubular cells which are found predominantly in the medullary region, but also in the renal cortex (b, ii). Both R5 and R6 antisera detected mPI8 in mouse kidney homogenate via immunoblotting at the predicted size of 42 kDa (c). Preimmune sera from both rabbits serve as negative controls.
i ii
a
b
mPI8
GAPDH
-RT
+RT
Kidney
ckDa
1758362
47.5
32.5
25
R6 pre
R6 an
ti-mPI
8
R5 pre
R5 an
ti-mPI
8
102
5.2.2 Restricted distribution of mPI8 protein in the kidney
To confi rm the in situ hybridization results and determine the distribution of mPI8 protein in the kidney, two polyclonal antisera to recombinant mPI8 were used. Due to the number, similarity, and potentially overlapping distribution of clade B serpins, it was important to ascertain whether the antibodies were specifi c to mPI8, as discussed in Chapter 3. Both the R5 and R6 antisera were screened against the highly-related mouse serpins MNEI, Spi3, Spi6, and NK26 (Kaiserman et al, 2002), which were transiently expressed in transfected COS-1 cells. Both antisera were essentially specifi c for mPI8 as determined via immunofl uorescence and immunoblotting (Figure 3.2 & 3.3).
Both antisera detected a protein of predicted size for mPI8 (42 kDa) in mouse kidney homogenates when used at a 1:1000 dilution (Figure 5.2 c). The R5 antibody also appeared to recognize a slightly smaller species, which may represent an mPI8 cleavage product. To identify which cells within the kidney express mPI8, immunohistochemical analysis was performed on kidneys from control mice, and similar results were obtained using both antisera. Images were obtained for both R5 and R6 antisera, and R5 antisera-based images are representative of both antisera (Figure 3.2). This analysis revealed that mPI8 is mainly present within the renal medulla (Figure 5.3 b), and only to a limited extent in the cortex. Closer examination of the cortical / medullary boundary (Figure 5.3 d) suggested that mPI8 is found within tubules belonging to the loop of Henle, given that only a small proportion of cortical cells appeared positive. Due to the morphology of positive tubules it can be surmised that mPI8 is in the thick ascending limb of the distal tubule of the loop of Henle. Proximal tubules, as well as glomeruli, do not appear to express mPI8. In addition to its tubular expression, mPI8 was also observed within cuboidal epithelial cells of the ducts of Bellini as well as the transitional epithelial layer of the renal calyx (Figure 5.3 f), but was absent from papillary collecting tubules which lead up to the ducts of Bellini.
5.3 MODULATION OF MPI8 EXPRESSION IN MICE RECOVERING FROM INTERSTITIAL FIBROSIS OF THE KIDNEY
mPI8 has the characteristics of an inhibitor of a furin-like proteases (Dahlen et al, 1998). These proteases have been implicated in pro-hormone processing, infl ammation and wound repair. The restricted localization of mPI8 within the kidney suggests that it is regulating a specifi c protease or process that may alter during injury or repair, with a corresponding alteration in mPI8 distribution. We therefore examined mPI8 expression in the kidneys of mice which had undergone unilateral ureteral obstruction (UUO), as a model of interstitial nephropathy. This model involves operating on an anaesthetised mouse, with ureteral clamps inserted on one ureter, leaving the other kidney untouched as a negative control (contralateral unobstructed kidney, or CUK). A similarly treated control group was also operated on but without the addition of clamps (sham). A diagram of the UUO model is presented in Figure 5.4. After allowing for a period of fi brotic build-up sutures were
103
Figure 5.3 Localisation of mPI8 to the distal tubules of normal mouse kidney
Panels show immunohistochemistry of normal mouse kidney stained with the anti-mPI8 polyclonal antibody R5 (b, d-f) as compared to the preimmune control sera (a, c). The mPI8 antigen is detected predominantly in cells of the medullary region of the kidney and in only a small population of cells within the cortex (b). The boundary between the cortex and the medulla is denoted by arrows (b), and also shown at higher magnifi cation (d). Cells belonging to the distal tubules of the loop of Henle are positive for mPI8 (e). Due to their elliptic shape, these cells comprise part of the straight thick ascending limb (e), however mPI8 was also observed within cells of the convoluted distal tubule (not shown). mPI8 is present within cells of the transitional epithelial wall of the calyx as well as within the renal papillary columnar epithelial cells of the ducts of Bellini (f). Images were captured using a 4x objective lens (a, b), 10x (c, d), 20x (f) or 100x (e).
a
c
e
b
d
f
104
removed and the sham and UUO animals were sacrifi ced, whilst a further group had their clamps removed (reverse UUO, or RUUO), in order to observe their recovery from fi brosis.
5.3.1 A model of interstitial fi brosis induced by UUO
Cohorts of mice underwent 10 days of UUO with or without a 14 day recovery period (R-UUO). Immunohistochemistry was performed on sections from the contralateral unobstructed (CUK) kidney, as well as the obstructed kidneys from UUO mice,and R-UUO animals. As expected, the CUK kidney demonstrated mPI8 staining within distal tubular cells (Figure 5.5 a) but not proximal tubules or glomeruli. Some non-specifi c binding of both preimmune and immune sera to the proteinaceous debris found within degenerating ducts tubules was noted (as indicated by arrowheads, Figure 5.5 b and c), however the localization of mPI8 in kidneys where interstitial fi brosis is evident were no different from that of normal kidney. Specifi cally, proximal tubules, glomeruli and collecting ducts remained negative, and the only positive staining was in distal tubules (arrows, Figure 5.5 c), as well as in a small number of macrophage-like cells present in the interstitium (arrow, Figure 5.5 d).
5.3.2 Recovery from induced interstitial fi brosis: R-UUO
By contrast, after a two week period following R-UUO, kidneys demonstrated mPI8 staining in a wider range of cells (Figure 5.5 f). When compared to the preimmune sera control (Figure 5.5 e), mPI8 was apparent in regions of the kidney which were undergoing or had recently completed tubular re-epithelialisation and extracellular matrix remodeling (Figure 5.5 f). The transitional epithelial layer remained mPI8 positive but occupies a far greater region of the R UUO kidney than in its healthy counterpart. In glomeruli from R-UUO mice (Figure 5.5 f; solid box arrows, Figure 5.5 B), mPI8 staining was observed in cells of the Bowman’s capsule, as well as in the glomerular and tubulointerstitial space, an area containing signifi cant numbers of infi ltrating macrophages. In the R-UUO mice, an altered pattern of α smooth muscle actin (α-SMA) protein localization was observed in tubular epithelial cells during endogenous renal repair associated with resolving renal injury (box arrows, Figure 5.5 D, E, F). The expression of α-SMA is used as a marker for myofi broblasts, is upregulated during nephropathy, and represents areas undergoing regeneration (Badid et al, 1999). In addition to glomerular and tubulointerstitial areas showing myofi broblast accumulation, α-SMA was also evident in tubular epithelial cells in areas of kidney regeneration and remodeling that was positive for PI-8 localization. Thus mPI8 expression and localization is signifi cantly altered during kidney regeneration.
105
anaesthetised mice operated on
sham operationclamps used to obstruct one kidney
10 days progression
UUO kidney
CUK kidneysham kidneys
clamp removed, 14 days recovery
CUK kidney
R-UUO kidney
Figure 5.4 Unilateral ureteral obstruction and reversal of UUO: a kidney fi brosis model
Mice are operated on and may have a clamp inserted over one ureter, as pictured in the above cartoon. Kidneys from sham-operated animals as well as the controlateral unobstructed kidney (CUK) serve as a negative control. Fibrosis is allowed to progress for 10 days before animals are either sacrifi ced and their sham, CUK or UUO kidneys collected for histology. Some UUO animals are not sacrifi ced, and have their clamps removed, and are allowed a 14 day recovery period, during which the previously obstructed kidney is able to partially regenerate; this is designated reversal of unilateral ureteral obstruction (R-UUO). These animals are then sacrifi ced and their kidneys also collected for histology.
106
Figure 5.5 Expression of mPI8 is modulated in a model of kidney fi brotic disease followed by structural and functional recovery
The diagram demonstrates which areas of contralateral unobstructed kidney (CUK), unilateral ureteral obstruction (UUO) kidneys or reversal of unilateral ureteral obstruction (R-UUO) kidneys are represented by micrographs.Immunohistochemistry was performed on kidneys which had undergone unilateral ureteral obstruction (UUO) (n = 3) and compared to the contralateral unobstructed kidney (CUK) control (a) using either preimmune sera (b) or the anti-mPI8 polyclonal antibody R5 (c, d). Further immunohistochemistry was performed following a 14-day period of reversal of UUO (R-UUO) (n = e) using either preimmune sera (e, A) or the anti-mPI8 polyclonal antibody R5 (f, B). CUK kidneys exhibited mPI8 antigen solely in distal tubular cells (a, arrows). Representative micrographs show there is some non-specifi c binding of both preimmune (b) and immune (c, d) sera to proteinaceous debris found within collecting ducts and tubules (arrowheads), however it can be seen that mPI8 (arrows) still localises solely to distal tubular cells and is not present in the glomeruli (gl), collecting ducts (cd) or proximal tubules (pt). Macrophages expressing mPI8 were identifi ed in the interstitium of UUO kidneys by morphological criteria (arrow, d). Images were captured using a 20x objective (a), 40x objective (b, c, e, f), or 100x objective (d).
107
gl
gl
gl
gl
gl
gl
gl
cd
pt
pt
pt
CUK kidney UUO kidney
a
e, f
b, c, d
R-UUO kidney
a
c
e
b
d
f
108
Figure 5.5 Expression of mPI8 is modulated in a model of kidney fi brotic disease followed by structural and functional recovery (ctd)
The diagram demonstrates which areas of reversal of unilateral ureteral obstruction (R-UUO) kidneys are represented by micrographs.The R-UUO kidney shows mPI8 in regions of tubular re-epithelialisation where staining was localised to cortical glomeruli, as well as both distal and proximal tubular segments (B). The R-UUO kidney is also encapsulated by a vast span of stratifi ed transitional urinary epithelium which stains positively for mPI8 (f, B). Compared to negative controls (C), α-smooth muscle actin (α-SMA) was localised to cortical arterioles (D, arrow) and myofi broblasts in the glomerular and tubulointerstitium (D, bars). At greater magnifi cation (E, F), α-SMA was also found to localise to the tubular epithelial cells in areas of regeneration following UUO (box arrows). These areas showing cellular replacement and resolving interstitial expansion also showed mPI8-labeled tubular segments (B, solid box arrows). α-SMA-positive afferent arterioles can also be seen adjacent to the glomeruli in the renal cortex (E, F, arrows). Sections stained for α-SMA underwent staining and counterstaining with haematoxylin and eosin (C-F), rather than just haematoxylin counterstaining (A, B). Images were captured using a 20x objective (C, D), or a 100x objective (A, B, E, F)
109
A-F
R-UUO kidney
a
c
e
b
d
f
110
5.4 DISCUSSION
This work shows for the fi rst time that mPI8 protein is present in kidney - primarily in the thick ascending limb and the convoluted region of distal tubules - and that its distribution alters during regeneration. These observations suggest that there is a correlation between PI8 and regulatory processes within the kidney. The original analysis of human PI8 mRNA indicated a broad pattern of expression including kidney (Sprecher et al, 1995), but subsequent immunohistochemical observation suggested the protein is restricted to monocytes, a subpopulation of epithelial cells, and neuroendocrine cells of the pituitary, colon and pancreas (Strik et al, 2002). PI8 expression was not noted by the latter workers in the tubules or other structures of the kidney, but appeared in kidney tissue macrophages. The immunohistological results presented here showing mPI8 in the kidney proper are consistent with the original RNA analysis. Observations presented here can possibly be attributed to higher avidity of the R5 and R6 antibodies in comparison to the monoclonal antibody used in the study by Strik et al. It appears likely that the authors observed only highly PI8-expressing cells, rather than all PI8-expressing cells. Nevertheless, the results presented here analysing obstructed and recovering kidney supports the observation of PI8 within macrophages.
5.4.1 PI8 and proteases in distal tubule cells
At present the physiological role of PI8 is unknown. It has been proposed that clade B serpins are usually present within protease-producing cells to protect against autolysis and death (Bird, 1999; Silverman et al, 2004). If this is the case, a PI8-regulated serine protease should be present in distal tubules. Distal tubules have a role in ion transport, predominantly being responsible for sodium/chlorine/potassium (reviewed in (Reilly & Ellison, 2000)). Hormones which act on the distal tubule to regulate ion transport have been profi led in numerous studies and are reviewed in (Feraille & Doucet, 2001). Unfortunately, the protease complement of distal tubular cells not been specifi cally studied, nor has a role for such proteases been identifi ed in the generation of hormones or other secretory proteins at this site. However, furin is known to be involved in the activation of the epithelial sodium transport protein ENaC which is found in the kidney, and it is suggested that other convertases may also be involved in this process (recently reviewed by (Rossier & Stutts, 2009)). Experimental identifi cation of such convertases within the distal tubule would provide further support for the correlation between mPI8 and one or more convertases, as well as potentially narrowing down the identity of the PI8 target.
The present study assessed the localization of PI8 in a mouse model undergoing endogenous renal recovery following interstitial matrix expansion and tubular atrophy (Cochrane et al, 2005). 10 days after UUO, the obstructed kidney shows collagen accumulation, interstitial macrophage infi ltration and ablation of the outer medulla. By 2 to 6 weeks following R-UUO, structural and functional recovery is evident, and is associated with decreased interstitial matrix expansion, decreased collagen content, reduced numbers of macrophages, epithelial cell replacement of the medullary nephrons and recovery of
111
glomerular fi ltration rate (Cochrane et al, 2005).
5.4.2 Epithelial-mesenchymal transition
In the R-UUO kidneys there were obvious areas of tubular and interstitial remodelling adjacent to areas that already showed evidence of repair. PI8 was observed in proximal and distal tubular epithelial cells of the R-UUO kidney in areas demonstrating cell regeneration. During recovery from injury, both glomerular and tubular cells have been shown to change phenotype (Bonventre, 2003; El Nahas, 2003) losing their epithelial phenotype and undergoing mesenchymal transformation (Liu, 2004; Ng et al, 1998). This process, termed epithelial-mesenchymal transition (EMT), is also associated with the epithelial cell expression of α-SMA and loss of e-cadherin. The present study showed that epithelial cells in renal endogenous repair in R-UUO mice also showed evidence of α-SMA expression, suggesting that EMT was occurring.
5.4.3 The PI8 inhibitory target
We propose that PI8 may regulate a prohormone convertase in the kidney, and that the up-regulation of PI8 during kidney regeneration is consistent with the need to control a prohormone convertase participating in extracellular matrix remodeling. Further similar immunohistochemical analysis within this model system evaluating the localisation of furin, as well as PACE4, PC5/6, and PC7, would be required to further validate the correlation between the expression of mPI8 and a putative target convertase during the regenerative process.
It is hypothesised that cytoplasmic mPI8 would only interact with a proprotein convertase under conditions of cellular stress, such as during infl ammation, necrosis, and subsequent remodelling; such an event may potentially cause the destabilisation of intracellular membranes and subsequent leakage of convertase into the cytoplasm from secretory granules. To observe whether mPI8 and a convertase are found in subcellular proximity within this model of EMT, co immunofl uorescence and confocal microscopy of the paraffi n-fi xed kidneys may be of additional value.
In conclusion, the presence of PI8 in the normal kidney may suggest the unreported co-expression of a prohormone convertase functioning as an intracrine enzyme; further additional investigation is required to determine whether mPI8 and such a convertase could interact in an in vivo regenerative setting. Given the apparent link between mPI8 and tissue regeneration, as well as the known role of some proprotein convertases in embryogenesis (Taylor et al, 2003; Thomas, 2002), it would be interesting to examine whether mPI8 is expressed during kidney development.
112
113
CHAPTER 6: GENERAL DISCUSSION
6.1 OVERVIEW
At the commencement of this body of work, the identity of the cognate protease inhibited by the serpin PI8 was unknown. Like the serpin, PI9, with which it was co-identifi ed, and characteristic of the B clade, PI8 had been found to be both nuclear and cytoplasmic in expression (Bird et al, 2001). PI8 expression was noted in most organs surveyed by mRNA analysis (Sprecher et al, 1995). Subsequent to the identifi cation of PI8 and PI9, studies went on to demonstrate PI9’s inhibition of the cytotoxic serine protease granzyme B (Bird et al, 1998; Sun et al, 1996), then to examine the expression of PI9 within specifi c human cell types (Bladergroen et al, 2001), and to identify PI9 co-expression with its cognate serine protease within those cell types (Buzza et al, 2001; Hirst, 2002). Further to this, the conditions under which PI9 and granzyme B are able to interact in a physiological setting has been elucidated (Buzza et al, 2001; Hirst et al, 2003), and the cytoprotective role of PI9 has been further substantiated (Jiang et al, 2007), reviewed recently by Kaiserman and Bird (Kaiserman & Bird, 2010).
Before it would be possible to demonstrate in a similar fashion that PI8 is cytoprotective, it would be necessary to identify the protease target of PI8. Of several model proteases previously examined in vitro, PI8 demonstrated the most effi cacious inhibition of furin (Dahlen et al, 1997; Dahlen et al, 1998b). As studies prior to the commencement of the candidate examined the expression of PI8 on a very limited basis as described above, identifi cation of the cell types within which PI8 is present and further observation of the expression of a putative target protease within these same cells would be necessary to establish the physiological role of PI8. If PI8 were to exhibit cytoprotective properties, evidence would need to be provided to demonstrate that its target protease can be released from an intracellular compartment in response to a signal or stress, as has been shown for granzyme B (reviewed by (Lord et al, 2003)). Therefore, the analyses performed within this thesis form a sound basis for further exploration to determine whether PI8 conforms to the serpin cytoprotective hypothesis.
6.2 WHAT IS THE LIKELY TARGET OF PI8?
6.2.1 PI8 contains the convertase recognition motif RXXR
A motif appearing in the PI8 RCL (RNSR336-339) suggests PI8 interacts with furin, which recognizes and cleaves after RXXR (Dahlen et al, 1998a; Molloy et al, 1992). Furin is the prototypical member of a family of seven mammalian processing enzymes known as the proprotein or prohormone convertases (reviewed in (Seidah & Chretien, 1999; Taylor et al,
114
2003; Thomas, 2002)). Members of this family have a diverse range of substrates including cell surface receptors, bacterial toxins, extracellular matrix proteins and peptide hormones and growth factors (Molloy et al, 1999). In addition, they activate matrix metalloproteinases which are involved in remodelling during wound healing, embryonic development and tumour invasion; the conversion of stromelysin-3 and MMP-28 by furin within the secretory pathway or at the cell surface being just two examples (Pei & Weiss, 1995; Rodgers et al, 2009).
6.2.2 PI8 is a good inhibitor of furin and other convertases
Results presented here have demonstrated that PI8 is a better inhibitor of furin than previously reported, generating a SI of approximately 1, which refl ects an interaction of physiological signifi cance. This result correlates with previous work suggesting PI8 is a physiological inhibitor of furin in platelet releasates (Leblond et al, 2006). It is also shown for the fi rst time that mPI8 is able to inhibit rat PACE4 (rPACE4), as well as PC5/6B, although these interactions are apparently less favourable than those observed between mPI8 and soluble furin.
Since other isoforms of the latter proteins exist which contain signifi cant variations in their protein domains, it is possible that alternate isoforms of the convertases assayed, for example, PC5/6A, the smaller, secreted isoform PC5/6B, may be more effi ciently inhibited by PI8. It would also seem more likely that PI8 would inhibit PC5/6A in a physiological setting rather than its membrane-bound isoform, as PI8 has no means of entering the secretory pathway or reaching the cell surface.
6.2.3 What is the site of RCL cleavage when PI8 undergoes an inhibitory interaction with a convertase?
While PI8 contains an additional RXXR motif (RCSR) within its RCL, these residues sit closer to the distal hinge region, which would potentially affect the inhibitory action of the serpin. Following proteolytic cleavage, the N-terminal portion of a serpin’s RCL inserts into the A β-sheet, dragging with it the protease which is bound to the P1 residue; in order for the protease to be subsequently deformed, it has been shown that the free N-terminal portion of the RCL needs to be long enough for complete insertion to occur, and a shift of just two residues away from the predicted P1 is enough to prevent full insertion, thereby converting the serpin into a substrate (Zhou et al, 2001). Amino acid sequencing of PI8 after interaction with furin and other convertases is crucial to confi rm that the predicted P4-P1 of PI8 is RNSR336-339 and that peptide bond cleavage therefore occurs between arginine339 and the adjacent cysteine residue during the formation of PI8-convertase inhibitory complex.
There is some evidence to suggest clade B serpins can use alternate P1 residues in their interaction with different targets; for example, PI6 is able to inhibit chymotrypsin utilising Met340 as its P1 residue, whereas when it is undergoing an inhibitory interaction with thrombin, the P1 residue is Arg341 (Riewald & Schleef, 1996). Similar experiments
115
have shown PI8 is able to utilise alternate P1 residues during interactions with thrombin (Arg339) and chymotrypsin (Ser341) (Dahlen et al, 1998a). However, it would more likely that proteolysis generating alternate P1 residues would arise from proteases with different proteolytic specifi city, as in the two cases above, which would not be the case for members of the convertase family; additionally, such in vitro inhibition of chymotrypsin and thrombin is not representative of a physiological interaction for either PI6 or PI8.
6.2.3.1 Cleavage of a second convertase motif in the PI8 RCL may regulate inhibition of convertases
If convertases are able to cleave PI8 at the RCSR motif, it is likely that this cleavage would not result in an inhibitory event, and thus may represent a mechanism whereby PI8 could be inactivated by a convertase in the physiological setting. This may provide a feedback loop for the regulation of the inhibition of PI8’s main target protease by another convertase, or by higher levels of the same convertase. Evidence suggests that convertases are regulated by a variety of mechanisms, including transcription, modulation of activation, co expression with inhibitory proteins, localisation and receptor mediated signalling (Antenos et al, 2008; Blanchette et al, 1997; Blanchette et al, 2001; Cornwall et al, 2003; Katz et al, 2009; Rabah et al, 2007; Shen et al, 2004; Yoshida et al, 2001). In the event of signifi cant cellular stress and engagement of the apoptotic pathway, it is possible that, should convertases leak into the cytoplasm, their presence may aid in the degradation of key endogenous proteins during the cell death process, and thus, abrogation of convertase inhibition by proteolytic inactivation of PI8 is useful.
6.2.4 Is PI8 an inhibitor of more than one convertase target?
Given the appearance of the generic proprotein convertase motif, RXXR, within the PI8 RCL, it is tempting to suggest that PI8 is able to undergo an inhibitory interaction with multiple convertase targets in a physiological setting. The inhibition of rPACE4 and PC5/6B by mPI8 provides some support for this hypothesis, although it would be expected that a true physiological interaction would demonstrate a more favourable SI. However, in theory, a less effi cient interaction refl ected by a poor SI may be partially overcome by a signifi cant excess of PI8 being present at the site of interaction with a convertase.
From the experiments conducted in this body of work it is impossible to conclude whether PI8 inhibits multiple targets in vivo. However, this question could be further addressed by conducting further kinetic analysis of PI8’s interactions with all untested soluble convertases, particularly with the alternate isoforms of PC5/6 and PACE4. An accurate assessment of the SI of each interaction, as well as determination of the rate association constant kass, and identifi cation of the P1 residue would provide a basis for further exploration of a PI8-convertase interaction in a physiological setting. However, this requires signifi cant quantities of protease which are not yet available.
116
In summary, it is clear that PI8 is an excellent inhibitor of furin and may regulate it in vivo, and that it may have additional physiological roles in the inhibition of other convertases.
6.3 WHERE DOES PI8 FUNCTION?
6.3.1 Does the tissue expression of PI8 provide clues to its function?
Studies conducted in this body of work have contributed signifi cantly to the understanding of where PI8 is expressed throughout the body. The mRNA comparison between mPI8 and the various convertases did not pinpoint a single clear target for PI8 based upon co-expression. This may either be due to PI8 inhibiting more than one convertase or convertase isoform in a physiological setting, or the lack of ability to differentiate between cell types within tissues.
Analysis using laser capture microdissection would be recommended to obtain a clearer picture of the co-expression of PI8 and convertases within specifi c PI8-positive cells, for example, bronchiolar epithelia, or endometrial epithelia of the uterus. This approach may also be of value to examine the expression of PI8 in tissues of organs such as the pancreas, brain or stomach, which were positive for PI8 mRNA by RT-PCR analysis, but for which cross-reactivity prevented immunohistological examination of protein expression.
Previous immunohistological analysis of PI8 within human tissues observed a more restricted localisation of the protein; limited to monocytes, keratinocytes and neuroendocrine cells (Strik et al, 2002). The study performed by Strik and colleagues appears to have utilised a monoclonal antibody of lower avidity than the polyclonal antisera used in this body of work; however, the general trends of expression observed by both studies are similar - allowing for differences between mouse and human tissue - particularly as both note distinctive expression within the follicle and epidermis. The complement of tissues analysed by Strik and colleagues does not overlap exactly with those analysed in this body of work, and hence, signifi cant additional inferences may be drawn from the examination of mPI8 within uterus and ovary that is unique to this study.
6.3.2 PI8 is predominantly expressed within epithelial cell types
Results of this study determined that PI8 is expressed across a wide range of organs as surveyed by immunohistological analysis, most specifi cally, in medullary cells of the adrenal gland; within uterine endometrial glands; follicular cells of the ovary; bronchial epithelia of the lung; epidermal epithelia of the skin, as well as cells of the hair follicle. It appears that mPI8 is predominantly expressed by epithelial cell types, however it was also found in some (but not all) skeletal muscle cells (sub-dermal panniculus carnosus), and by some specialised types of connective tissue, i.e. the uterine myometrial stroma.
117
6.3.3 PI8 may play a key role in regulation of convertases within the epithelial stem cell population of the hair follicle
More specifi c analysis of the follicle found mPI8 within the follicular stem cell bulge population, as well as in most of the follicular layers of the inner and outer root sheath. It has recently been recognised that the hair follicle is a signifi cant site of non-classical production and metabolism of steroid and peptide hormones (reviewed in (Paus et al, 2008)). This suggests a signifi cant potential involvement of the proprotein convertases within the hair follicle epithelia and follicular stem cell population. For example, parathyroid hormone-related protein (PTHrP), which is a substrate of furin, is expressed by epithelial skin cells and modulates signalling pathways within the follicular bulge, as well as within the wider skin epithelia (Liu et al, 1995; Thomson et al, 2003). Several investigations have begun to examine the localisation of proprotein convertases and a limited number of substrates within the skin, however the expression of convertases within the follicle and particularly, within follicular stem cells remains an area requiring further exploration (Mazurkiewicz et al, 2000; Pearton et al, 2001; Wallis et al, 2003). Similarly, exploration of the broader mechanisms of hormonal response and control within hair follicle epithelial stem cells to date is yet to generate a systematic understanding of hormonal events within the follicle.
In order to confi rm a potential convertase inhibitory target for PI8, further information examining the expression of convertases via immunohistochemical techniques would be extremely valuable. Information available from the literature suggests that a comprehensive global survey of convertase protein expression has yet to be performed, although appropriate reagents such as specifi c antibodies have become more readily available in the last few years. Even in situations where an organ has been comprehensively surveyed for convertase expression by IHC, as has been conducted for the uterus, further questions arise – does PI8 expression vary throughout the menstrual cycle and upon implantation (like PC5/6), or is it constitutively expressed (like PACE4 and PC7) (Freyer et al, 2007)?
6.3.4 Is PI8 involved in the regulation of tissue remodelling?
The expression of PI8 was found to be modulated in a model of fi brotic kidney disease known as unilateral ureteral obstruction (UUO); it was further observed during recovery (R-UUO) to be expressed within cells undergoing epithelial-mesenchymal transition (EMT). The EMT process is involved in pathophysiological conditions, namely fi brosis of other organs, as well as cancer metastasis (recently reviewed by (Iwatsuki et al, 2010; Lopez-Novoa & Nieto, 2009)). However, EMT is also inherently involved in embryogenesis, where successful morphogenesis requires the regulation of extracellular remodelling and cell migration processes (reviewed by (Nakaya & Sheng, 2008)).
EMT activation involves additional tissue-specifi c signals, including components of the extracellular matrix, bone morphogenic proteins (BMPs), matrix metalloproteases (MMPs) and growth factors, including PGDF, FGF and members of the TGFβ family (Boyer et al, 1999; Molloy et al, 2008; Tan et al, 2010; Yan et al; Zeisberg et al, 2003).
118
6.3.5 Epithelial-mesenchymal transition is controlled by convertase substrates
Members of the proprotein convertase family are critical for the proper processing and activation of growth factor TGFβ, as well as BMPs including BMP 1, and matrix metalloproteases (Blanchette et al, 1997; Constam & Robertson, 1999; Constam & Robertson, 2000; Fan et al, 1999; Ra & Parks, 2007; Zhou et al, 2009; Leighton & Kadler, 2003). Further to this, PACE4, PC5/6, and PC7 have been demonstrated to be co-expressed with BMP-2, -4 and -7 within the apical epidermal ridge of developing mouse embryos (Constam et al, 1996). BMP-dependent embryogenic processes are also able to be specifi cally blocked by the ectopic expression of α1-AT PDX, the specifi c inhibitor of convertases (Cui et al, 1998; Tsuji et al, 1999). In addition, null mutants of furin and PACE4 also demonstrate critical failures in embryogenesis which are likely to be due in part to misregulation of EMT-dependent embryogenesis (Constam & Robertson, 2000; Roebroek et al, 1998). It is therefore highly likely that proprotein convertase-dependent cleavage events are key regulators of several pathways which activate the EMT process.
As it appears that proprotein convertases should play an integral role in the process of EMT, it is logical to conclude that many cells undergoing EMT will undergo a modulation of PC expression in a fashion similar to that observed for PI8. Examination of proprotein convertase expression via immunohistochemistry and mRNA analysis in a model of EMT, such as the kidney fi brosis R-UUO model utilised in these studies, would provide further validation for the critical involvement of convertases and further, the likelihood that PI8 is an in vivo convertase inhibitor.
6.3.6 EMT, cell stress, and release of compartmentalised proteases
It is well established that cell stress is able to induce lysosomal instability in vitro (reviewed by (Terman et al, 2006)). Experimental evidence suggests that an anti-chymotrypsin-like mouse serpin, Spi2a, is able to protect transfected cells from ROS-mediated cell death induced by the redox cycling quinone Napthazarin (Liu et al, 2004). Similarly, ventricular myocytes transiently expressing the viral serpin protein CrmA are protected from hypoxia-mediated apoptosis (Gurevich et al, 2001). In a more physiologically representative setting, the C. elegans intracellular serpin SRP-6 prevents necrotic cell death of the animal. More specifi cally, a hypo-osmotic lethal phenotype in the srp-6 null mutant worm is due to the extraneous release of lysosomal proteases; reintroducing the srp-6 gene into these worms resulted in the prevention of necrosis induced by heat stress and ion fl ux – a direct result of SRP-6 inhibition of cathepsin L and K (Luke et al, 2007).
A key role has recently been proposed for redox signalling as a control mechanism for EMT (Cannito et al, 2008; Radisky et al, 2005). There is also strong evidence to suggest that oxidative stress, as well as to a lesser extent, osmotic stress, is involved in the pathological
119
progression of kidney fi brosis in the UUO model (Kawada et al, 1999; Mizuguchi et al, 2008; Masaki et al, 2003). Other forms of cell stress may be more relevant a threat to different PI8 and convertase-expressing tissues; for example, ultraviolet light exposure to the epidermis, which is able to induce the expression of stress-related heat shock proteins (Hsps) in keratinocytes, a stress process which can also lead to activation of the cell death pathway (reviewed by (Jonak et al, 2009)).
Given the weight of evidence arising in recent years, it is reasonable to believe that secretory vesicles including lysosomes, in human cell types, may experience membrane instability in the presence of cellular stress. Such a situation would be expected to lead to the leakage of secretory proteins into the cell cytosol. The cytoplasmic and nuclear expression of PI8 would therefore act in a cytoprotective fashion, restricting any extraneous proteolysis which may be conducted by a PC which has leaked from the secretory pathway.
6.4 COULD THE INTERACTIONS BETWEEN PI8 AND A CONVERTASE BE CONSISTENT WITH THE CLADE B SERPIN PROTECTION HYPOTHESIS?
6.4.1 Proprotein convertases are expressed within the secretory pathway
Proprotein convertases are expressed within the constitutive and regulated secretory pathway, although their sub-cellular distribution is varied and dependent upon domains found at the C-terminal of the protein, most specifi cally, residues within the cysteine-rich domain (CRD), or the presence of a transmembrane domain (TMD). Some convertases, such as furin, are present in both a membrane-bound form, as well as a secreted form – convertases other than furin generate such species based upon differential mRNA splicing, rather than proteolytic control. In contrast, mPI8 is an obligate intracellular protein, lacks a signal sequence, and is expressed within the cytoplasm and nucleus of the cell. Under what circumstances, then, would PI8 be able to inhibit convertases, given that they are in different biological compartments?
6.4.2 The serpin protection hypothesis
Under the clade B serpin protection hypothesis, a serpin such as PI8 would be expressed within a cell’s cytosol to protect it from leakage of a protease from secretory granules such as lysosomes during times of cell stress (reviewed in (Bird, 1999)). Lysosomal leakage is a well-established cellular phenomenon that can occur as the consequence of cellular stimuli, including radiation, ROS exposure or osmotic stress (Conus et al, 2008; Luke et al, 2007; Ogawa et al, 2004; Terman et al, 2006). Dependent upon the type and the severity of stimulus, subsequent lysosomal permeabilisation and leakage may result in cellular injury or even death, as the proteolytic components of the lysosome interact with apoptotic pathways (Blomgran et al, 2007; Ollinger & Brunk, 1995) (reviewed by (Ferri & Kroemer, 2001)).
120
This interaction is exemplifi ed by the clade B serpin PI9 and its inhibition of the granule protease granzyme B (Bird et al, 1998). During targeted killing events, which often correspond with mechanisms of cellular stress, or after receiving a receptor-mediated signal of cell death, it is possible for lysosomal granules within cytotoxic lymphocyte to destabilise, resulting in release of granular proteases into the cell’s own cytoplasm (reviewed in (Bird et al, 2009)). In the case of granzyme B, the protease is then able to activate the caspase-dependent cell death pathway (reviewed by (Trapani & Sutton, 2003)). It is appropriate that targeted release of death effector proteases such as granzyme B can cause cell death – however, the cells that express these proteases require a means of protection from incidental leakage of their own proteases that may otherwise result in the premature death of the T-cell.
It must be assumed that convertases, with such a broad range of proteolytic substrates, would have a deleterious effect on cell viability if released into the cytoplasm. This assumption reduces the likelihood that PC2 and PC1/3 are targets of PI8, as the activity of both proteases is dependent not only on the presence of calcium, but also upon the acidic conditions found within secretory granules (Shennan et al, 1994; Zhou & Lindberg, 1993). It can also be assumed that convertases that are only expressed in membrane-bound form, such as PC7, and the PC5/6B isoform, would not be able to leak from secretory vesicles or other endosomes in the manner of soluble proteases such as granzyme B.
In order to test the assumption that convertases in the cytosol would be deleterious for normal cellular processes, recombinant PCs could be microinjected into the cytosol of cultured cells, and the cells monitored for apoptosis, irregular growth or other evidence of destabilisation of cellular homeostasis. To further test the hypothesis that convertases, like the lysosomal protease granzyme B, are able to leak out of their specifi c compartments during conditions of cellular stress, a neutral pH-dependent fl uorescent tag could be engineered onto a protease such as PC2, which is normally only functional in an acidic compartment. Use of such pH sensitive reporter tags, eGFP and ecliptic pHluoirin, has been recently reported for granzyme B fusion proteins, whereby the reporter constructs demonstrated granular localisation as expected for granzyme B, but fl uoresced upon perturbation of cell pH or lysosomal membrane integrity by various chemical agents (Bird et al, 2010). If such reporter tags were to be engineered on to a convertase, construct-transfected cells could then be exposed to radiation or H2O2 and confocal microscopy techniques used to determine whether the convertase can be found leaking into the cell cytoplasm.
6.4.3 Proprotein convertases may demonstrate ectopic expression and appear outside of the secretory pathway
Another feature of clade B serpins is their nucleocytoplasmic distribution (Bird et al, 2001), which suggests that they may regulate nuclear proteases or functions. PI8 has been observed in the nuclei of cells (Bird et al, 2010; Strik et al, 2002), although a cognate nuclear protease has not been identifi ed. However there is emerging evidence that proteases which are normally secreted can be found in the nucleus (Goulet et al, 2004): indeed, one report
121
suggests that PC1/3 may enter the nucleus under certain circumstances (St Germain et al, 2005). It is possible that other convertases may be able to enter the nucleus by a mechanism similar to that observed for PC1/3, in which case PI8 may well be required to tightly regulate the potentially deleterious effects of such convertase localisation.
Alternately, nuclear or cytosolic localisation of a convertase may arise due to alternate splicing of a convertase. Multiple transcripts for furin, PC4, and PC5/6, as well as PACE4, have been reported (Ayoubi et al, 1994; De Bie et al, 1996; Mbikay et al, 1994; Tsuji et al, 1997). Indeed, the D mRNA isoform of PACE4 lacks a signal peptide or propeptide coding region, and is predicted to lack catalytic activity, as the propeptide domain have been previously described as essential for correct folding (Tsuji et al, 1997). However, it is possible that enzymatic activity for PACE4D may be attained via interaction with alternate folding cofactors. If active, PACE4D would be the only convertase with cytosolic expression!
Alternate splicing has been reported to modulate the localisation of cathepsin B, which is normally found within granules, and similar splicing-based effects have been observed for cathepsins H and L (Bestvater et al, 2005; Goulet et al, 2004; Waghray et al, 2002). It is likely these proteases would demonstrate interaction with non-conventional folding cofactors in order to gain activity outside the secretory pathway. Given alternate mRNA forms of convertases have already been identifi ed, it can be imagined that additional isoforms may be present within specifi c cells, during a pathogenic event or other conditions of dysregulation, and that the products of such isoforms could demonstrate cytosolic or nuclear localisation. In such a case, PI8 would be readily able to inhibit the otherwise deleterious effects that may be mediated by catalytic convertase activity in these cellular compartments.
6.5 CONCLUDING REMARKS
In conclusion, experiments performed in this body of work provide further support to the hypothesis that the clade B serpin PI8 is a physiological inhibitor of furin; additionally providing the fi rst evidence that PI8 may also inhibit other proprotein convertases. These experiments show that mPI8 is widely expressed, although it is predominantly localised to epithelial cells throughout various organs. Expression of PI8 is modulated during the process of epithelial mesenchymal transition in a mouse model of kidney fi brosis. It is suggested that cellular stress may be responsible for the destabilisation of granules; additionally, that such stress occurring during the EMT process may cause endosomal membrane leakage. In the EMT model of obstructed kidney nephropathy, it is possible that osmotic stress is responsible for the destabilisation of lysosomes in a fashion similar to that observed within the previously established C. elegans model. Under such circumstances, a soluble proprotein convertase leaking from endosomes would be inhibited by PI8, which is endogenously expressed within the cytosol of many epithelial cells.
122
123
BIBLIOGRAPHY
Ace CI, Okulicz WC (2004) Microarray profi ling of progesterone-regulated endometrial genes during the rhesus monkey secretory phase. Reprod Biol Endocrinol 2: 54
Anderson ED, Molloy SS, Jean F, Fei H, Shimamura S, Thomas G (2002) The ordered and compartment-specfi fi c autoproteolytic removal of the furin intramolecular chaperone is required for enzyme activation. J Biol Chem 277: 12879-12890
Anderson ED, Thomas L, Hayfl ick JS, Thomas G (1993) Inhibition of HIV-1 gp160-dependent membrane fusion by a furin-directed α1-antitrypsin variant. J Biol Chem 268: 24887-24891
Anderson ED, VanSlyke JK, Thulin CD, Jean F, Thomas G (1997) Activation of the furin endoprotease is a multiple-step process: requirements for acidifi cation and internal propeptide cleavage. Embo J 16: 1508-1518
Antenos M, Zhu J, Jetly NM, Woodruff TK (2008) An activin/furin regulatory loop modulates the processing and secretion of inhibin α- and β B-subunit dimers in pituitary gonadotrope cells. J Biol Chem 283: 33059-33068
Askew DJ, Askew YS, Kato Y, Turner RF, Dewar K, Lehoczky J, Silverman GA (2004) Comparative genomic analysis of the clade B serpin cluster at human chromosome 18q21: amplifi cation within the mouse squamous cell carcinoma antigen gene locus. Genomics 84: 176-184
Askew DJ, Cataltepe S, Kumar V, Edwards C, Pace SM, Howarth RN, Pak SC, Askew YS, Bromme D, Luke CJ, Whisstock JC, Silverman GA (2007) SERPINB11 is a new noninhibitory intracellular serpin. Common single nucleotide polymorphisms in the scaffold impair conformational change. J Biol Chem 282: 24948-24960
Askew YS, Pak SC, Luke CJ, Askew DJ, Cataltepe S, Mills DR, Kato H, Lehoczky J, Dewar K, Birren B, Silverman GA (2001) SERPINB12 is a novel member of the human ov-serpin family that is widely expressed and inhibits trypsin-like serine proteinases. J Biol Chem 276: 49320-49330
Ayoubi TA, Creemers JW, Roebroek AJ, Van de Ven WJ (1994) Expression of the dibasic proprotein processing enzyme furin is directed by multiple promoters. J Biol Chem 269: 9298-9303
Badid C, Desmouliere A, McGregor B, Costa AM, Fouque D, Hadj Aissa A, Laville M (1999) Interstitial α-smooth muscle actin: a prognostic marker in membranous nephropathy. Clin Nephrol 52: 210-217
Bae JA, Park HJ, Seo YM, Roh J, Hsueh AJ, Chun SY (2008) Hormonal regulation of proprotein convertase subtilisin/kexin type 5 expression during ovarian follicle development in the rat. Mol Cell Endocrinol 289: 29-37
Baglin TP, Carrell RW, Church FC, Esmon CT, Huntington JA (2002) Crystal structures of native and thrombin-complexed heparin cofactor II reveal a multistep allosteric mechanism. Proc Natl Acad Sci USA 99: 11079-11084
124
Bahbouhi B, Bendjennat M, Chiva C, Kogan M, Albericio F, Giralt E, Seidah NG, Bahraoui E (2001) Inhibition of HIV-2(ROD) replication in a lymphoblastoid cell line by the α1-antitrypsin Portland variant (α1-PDX) and the decRVKRcmk peptide: comparison with HIV-1(LAI). Microbes Infect 3: 1073-1084
Bartuski AJ, Kamachi Y, Schick C, Overhauser J, Silverman GA (1997) Cytoplasmic antiproteinase 2 (PI8) and bomapin (PI10) map to the serpin cluster at 18q21.3. Genomics 43: 321-328
Bass R, Fernandez AM, Ellis V (2002) Maspin inhibits cell migration in the absence of protease inhibitory activity. J Biol Chem 277: 46845-46848
Belorgey D, Crowther DC, Mahadeva R, Lomas DA (2002) Mutant Neuroserpin (S49P) that causes familial encephalopathy with neuroserpin inclusion bodies is a poor proteinase inhibitor and readily forms polymers in vitro. J Biol Chem 277: 17367-17373
Benarafa C, Cooley J, Zeng W, Bird PI, Remold-O’Donnell E (2002) Characterization of four murine homologs of the human ov-serpin monocyte neutrophil elastase inhibitor MNEI (SERPINB1). J Biol Chem 277: 42028-42033
Benarafa C, Priebe GP, Remold-O’Donnell E (2007) The neutrophil serine protease inhibitor serpinb1 preserves lung defense functions in Pseudomonas aeruginosa infection. J Exp Med 204: 1901-1909
Benarafa C, Remold-O’Donnell E (2005) The ovalbumin serpins revisited: perspective from the chicken genome of clade B serpin evolution in vertebrates. Proc Natl Acad Sci USA 102: 11367-11372
Benjannet S, Lusson J, Hamelin J, Savaria D, Chretien M, Seidah NG (1995) Structure-function studies on the biosynthesis and bioactivity of the precursor convertase PC2 and the formation of the PC2/7B2 complex. FEBS Lett 362: 151-155
Benjannet S, Mamarbachi AM, Hamelin J, Savaria D, Munzer JS, Chretien M, Seidah NG (1998) Residues unique to the pro-hormone convertase PC2 modulate its autoactivation, binding to 7B2 and enzymatic activity. FEBS Lett 428: 37-42
Benjannet S, Rondeau N, Paquet L, Boudreault A, Lazure C, Chretien M, Seidah NG (1993) Comparative biosynthesis, covalent post-translational modifi cations and effi ciency of prosegment cleavage of the prohormone convertases PC1 and PC2: glycosylation, sulphation and identifi cation of the intracellular site of prosegment cleavage of PC1 and PC2. Biochem J 294 ( Pt 3): 735-743
Benning LN, Whisstock JC, Sun J, Bird PI, Bottomley SP (2004) The human serpin proteinase inhibitor-9 self-associates at physiological temperatures. Protein Sci 13: 1859-1864
Berger A, Schechter I (1970) Mapping the active site of papain with the aid of peptide substrates and inhibitors. Philos Trans R Soc Lond B Biol Sci 257: 249-264
Bestvater F, Dallner C, Spiess E (2005) The C-terminal subunit of artifi cially truncated human cathepsin B mediates its nuclear targeting and contributes to cell viability. BMC Cell Biol 6: 16
125
Bird CH, Blink EJ, Hirst CE, Buzza MS, Steele PM, Sun J, Jans DA, Bird PI (2001) Nucleocytoplasmic distribution of the ovalbumin serpin PI-9 requires a nonconventional nuclear import pathway and the export factor Crm1. Mol Cell Biol 21: 5396-5407
Bird CH, Rizzitelli A, Harper I, Prescott M, Bird PI (2010) Use of Granzyme B - based fl uorescent protein reporters to visualise granzyme distribution and granule integrity in live natural killer cells. Biol Chem 391: 999-1004
Bird CH, Sutton VR, Sun J, Hirst CE, Novak A, Kumar S, Trapani JA, Bird PI (1998) Selective regulation of apoptosis: the cytotoxic lymphocyte serpin proteinase inhibitor 9 protects against granzyme B-mediated apoptosis without perturbing the Fas cell death pathway. Mol Cell Biol 18: 6387-6398
Bird PI (1998) Serpins and regulation of cell death. Results Probl Cell Differ 24: 63-89Bird PI (1999) Regulation of pro-apoptotic leucocyte granule serine proteinases by
intracellular serpins. Immunol Cell Biol 77: 47-57Bird PI, Trapani JA, Villadangos JA (2009) Endolysosomal proteases and their inhibitors in
immunity. Nat Rev Immunol 9: 871-882Bissonnette L, Charest G, Longpre JM, Lavigne P, Leduc R (2004) Identifi cation of furin
pro-region determinants involved in folding and activation. Biochem J 379: 757-763Bladergroen BA, Strik MC, Bovenschen N, van Berkum O, Scheffer GL, Meijer CJ, Hack
CE, Kummer JA (2001) The granzyme B inhibitor, protease inhibitor 9, is mainly expressed by dendritic cells and at immune-privileged sites. J Immunol 166: 3218-3225
Blakytny R, Ludlow A, Martin GE, Ireland G, Lund LR, Ferguson MW, Brunner G (2004) Latent TGF-β1 activation by platelets. J Cell Physiol 199: 67-76
Blanchette F, Day R, Dong W, Laprise MH, Dubois CM (1997) TGFβ1 regulates gene expression of its own converting enzyme furin. J Clin Invest 99: 1974-1983
Blanchette F, Rivard N, Rudd P, Grondin F, Attisano L, Dubois CM (2001) Cross-talk between the p42/p44 MAP kinase and Smad pathways in transforming growth factor β 1-induced furin gene transactivation. J Biol Chem 276: 33986-33994
Blomgran R, Zheng L, Stendahl O (2007) Cathepsin-cleaved Bid promotes apoptosis in human neutrophils via oxidative stress-induced lysosomal membrane permeabilization. J Leukoc Biol 81: 1213-1223
Bonventre JV (2003) Dedifferentiation and proliferation of surviving epithelial cells in acute renal failure. J Am Soc Nephrol 14 Suppl 1: S55-61
Bottomley SP, Hopkins PC, Whisstock JC (1998) α1-antitrypsin polymerisation can occur by both loop A and C sheet mechanisms. Biochem Biophys Res Commun 251: 1-5
Boudreault A, Gauthier D, Lazure C (1998) Proprotein convertase PC1/3-related peptides are potent slow tight-binding inhibitors of murine PC1/3 and Hfurin. J Biol Chem 273: 31574-31580
Boyer AS, Ayerinskas, II, Vincent EB, McKinney LA, Weeks DL, Runyan RB (1999) TGFβ2 and TGFβ3 have separate and sequential activities during epithelial-mesenchymal cell transformation in the embryonic heart. Dev Biol 208: 530-545
126
Braks JA, Martens GJ (1994) 7B2 is a neuroendocrine chaperone that transiently interacts with prohormone convertase PC2 in the secretory pathway. Cell 78: 263-273
Braun KM, Niemann C, Jensen UB, Sundberg JP, Silva-Vargas V, Watt FM (2003) Manipulation of stem cell proliferation and lineage commitment: visualisation of label-retaining cells in wholemounts of mouse epidermis. Development 130: 5241-5255
Brennan SO, Nakayama K (1994) Furin has the proalbumin substrate specifi city and serpin inhibitory properties of an in situ hepatic convertase. FEBS Lett 338: 147-151
Bresnahan PA, Leduc R, Thomas L, Thorner J, Gibson HL, Brake AJ, Barr PJ, Thomas G (1990) Human fur gene encodes a yeast KEX2-like endoprotease that cleaves pro-β-NGF in vivo. J Cell Biol 111: 2851-2859
Bruning M, Lummer M, Bentele C, Smolenaars MM, Rodenburg KW, Ragg H (2007) The Spn4 gene from Drosophila melanogaster is a multipurpose defence tool directed against proteases from three different peptidase families. Biochem J 401: 325-331
Bruzzaniti A, Goodge K, Jay P, Taviaux SA, Lam MH, Berta P, Martin TJ, Moseley JM, Gillespie MT (1996) PC8 [corrected], a new member of the convertase family. Biochem J 314 ( Pt 3): 727-731
Buzza MS, Hirst CE, Bird CH, Hosking P, McKendrick J, Bird PI (2001) The granzyme B inhibitor, PI-9, is present in endothelial and mesothelial cells, suggesting that it protects bystander cells during immune responses. Cell Immunol 210: 21-29
Cannito S, Novo E, Compagnone A, Valfre di Bonzo L, Busletta C, Zamara E, Paternostro C, Povero D, Bandino A, Bozzo F, Cravanzola C, Bravoco V, Colombatto S, Parola M (2008) Redox mechanisms switch on hypoxia-dependent epithelial-mesenchymal transition in cancer cells. Carcinogenesis 29: 2267-2278
Cannito S, Novo E, Di Bonzo LV, Busletta C, Colombatto S, Parola M (2010) Epithelial-Mesenchymal Transition: From Molecular Mechanisms, Redox Regulation to Implications in Human Health and Disease. Antioxid Redox Signal 12: 1383-1430
Carrell RW, Evans DL, Stein PE (1991) Mobile reactive centre of serpins and the control of thrombosis. Nature 353: 576-578
Carrell RW, Stein PE (1996) The biostructural pathology of the serpins: critical function of sheet opening mechanism. Biol Chem Hoppe Seyler 377: 1-17
Chevalier RL (1999) Molecular and cellular pathophysiology of obstructive nephropathy. Pediatr Nephrol 13: 612-619
Chretien M, Seidah NG, Basak A, Mbikay M (2008) Proprotein convertases as therapeutic targets. Expert Opin Ther Targets 12: 1289-1300
Church FC, Noyes CM, Griffi th MJ (1985) Inhibition of chymotrypsin by heparin cofactor II. Proc Natl Acad Sci USA 82: 6431-6434
Cochrane AL, Kett MM, Samuel CS, Campanale NV, Anderson WP, Hume DA, Little MH, Bertram JF, Ricardo SD (2005) Renal structural and functional repair in a mouse model of reversal of ureteral obstruction. J Am Soc Nephrol 16: 3623-3630
127
Constam DB, Calfon M, Robertson EJ (1996) SPC4, SPC6, and the novel protease SPC7 are coexpressed with bone morphogenetic proteins at distinct sites during embryogenesis. J Cell Biol 134: 181-191
Constam DB, Robertson EJ (1999) Regulation of bone morphogenetic protein activity by pro domains and proprotein convertases. J Cell Biol 144: 139-149
Constam DB, Robertson EJ (2000) SPC4/PACE4 regulates a TGFβ signaling network during axis formation. Genes Dev 14: 1146-1155
Conus S, Perozzo R, Reinheckel T, Peters C, Scapozza L, Yousefi S, Simon HU (2008) Caspase-8 is activated by cathepsin D initiating neutrophil apoptosis during the resolution of infl ammation. J Exp Med 205: 685-698
Cornwall GA, Cameron A, Lindberg I, Hardy DM, Cormier N, Hsia N (2003) The cystatin-related epididymal spermatogenic protein inhibits the serine protease prohormone convertase 2. Endocrinology 144: 901-908
Coughlin P, Nicholl J, Sun J, Salem H, Bird P, Sutherland GR (1995) Chromosomal mapping of the human proteinase inhibitor 6 (PI6) gene to 6p25 by fl uorescence in situ hybridization. Genomics 26: 431-433
Coughlin P, Sun J, Cerruti L, Salem HH, Bird P (1993) Cloning and molecular characterization of a human intracellular serine proteinase inhibitor. Proc Natl Acad Sci USA 90: 9417-9421
Creemers JW, Siezen RJ, Roebroek AJ, Ayoubi TA, Huylebroeck D, Van de Ven WJ (1993) Modulation of furin-mediated proprotein processing activity by site-directed mutagenesis. J Biol Chem 268: 21826-21834
Cui Y, Jean F, Thomas G, Christian JL (1998) BMP-4 is proteolytically activated by furin and/or PC6 during vertebrate embryonic development. Embo J 17: 4735-4743
Dahlen JR, Foster DC, Kisiel W (1997a) Expression, Purifi cation, and Inhibitory Properties of Human Proteinase Inhibitor 8. Biochemistry 36: 14874-14882
Dahlen JR, Foster DC, Kisiel W (1997b) Human proteinase inhibitor 9 (PI9) is a potent inhibitor of subtilisin A. Biochem Biophys Res Commun 238: 329-333
Dahlen JR, Foster DC, Kisiel W (1998a) The inhibitory specifi city of human proteinase inhibitor 8 is expanded through the use of multiple reactive site residues. Biochem Biophys Res Commun 244: 172-177
Dahlen JR, Jean F, Thomas G, Foster DC, Kisiel W (1998b) Inhibition of soluble recombinant furin by human proteinase inhibitor 8. J Biol Chem 273: 1851-1854
Dai G, Smeekens SP, Steiner DF, McMurtry JP, Kwok SC (1995) Characterization of multiple prohormone convertase PC1/3 transcripts in porcine ovary. Biochim Biophys Acta 1264: 1-6
De Bie I, Marcinkiewicz M, Malide D, Lazure C, Nakayama K, Bendayan M, Seidah NG (1996) The isoforms of proprotein convertase PC5 are sorted to different subcellular compartments. J Cell Biol 135: 1261-1275
128
Deftos LJ, Burton D, Hastings RH, Terkeltaub R, Hook VY (2001) Comparative tissue distribution of the processing enzymes “prohormone thiol protease,” and prohormone convertases 1 and 2, in human PTHrP-producing cell lines and mammalian neuroendocrine tissues. Endocrine 15: 217-224
Denault J, Bissonnette L, Longpre J, Charest G, Lavigne P, Leduc R (2002) Ectodomain shedding of furin: kinetics and role of the cysteine-rich region. FEBS Lett 527: 309-314
Dikeakos JD, Di Lello P, Lacombe MJ, Ghirlando R, Legault P, Reudelhuber TL, Omichinski JG (2009) Functional and structural characterization of a dense core secretory granule sorting domain from the PC1/3 protease. Proc Natl Acad Sci USA 106: 7408-7413
Dougherty KM, Pearson JM, Yang AY, Westrick RJ, Baker MS, Ginsburg D (1999) The plasminogen activator inhibitor-2 gene is not required for normal murine development or survival. Proc Natl Acad Sci USA 96: 686-691
Elliott PR, Lomas DA, Carrell RW, Abrahams JP (1996) Inhibitory conformation of the reactive loop of α1-antitrypsin. Nat Struct Biol 3: 676-681
El Nahas M (2003) Kidney remodelling and scarring: the plasticity of cells. Nephrol Dial Transplant 18: 1959-1962
Essalmani R, Hamelin J, Marcinkiewicz J, Chamberland A, Mbikay M, Chretien M, Seidah NG, Prat A (2006) Deletion of the gene encoding proprotein convertase 5/6 causes early embryonic lethality in the mouse. Mol Cell Biol 26: 354-361
Evans E, Cooley J, Remold-O’Donnell E (1995) Characterization and chromosomal localization of ELANH2, the gene encoding human monocyte/neutrophil elastase inhibitor. Genomics 28: 235-240
Eyre HJ, Sun J, Sutherland GR, Bird P (1996) Chromosomal mapping of the gene (PI9) encoding the intracellular serpin proteinase inhibitor 9 to 6p25 by fl uorescence in situ hybridization. Genomics 37: 406-408
Fan JM, Ng YY, Hill PA, Nikolic-Paterson DJ, Mu W, Atkins RC, Lan HY (1999) Transforming growth factor-β regulates tubular epithelial-myofi broblast transdifferentiation in vitro. Kidney Int 56: 1455-1467
Farooqi IS, Volders K, Stanhope R, Heuschkel R, White A, Lank E, Keogh J, O’Rahilly S, Creemers JW (2007) Hyperphagia and early-onset obesity due to a novel homozygous missense mutation in prohormone convertase 1/3. J Clin Endocrinol Metab 92: 3369-3373
Fazleabas AT, Hild-Petito S, Verhage HG (1994) Secretory proteins and growth factors of the baboon (Papio anubis) uterus: potential roles in pregnancy. Cell Biol Int 18: 1145-1153
Feraille E, Doucet A (2001) Sodium-potassium-adenosinetriphosphatase-dependent sodium transport in the kidney: hormonal control. Physiol Rev 81: 345-418
Ferri KF, Kroemer G (2001) Organelle-specifi c initiation of cell death pathways. Nat Cell Biol 3: E255-263
Fortenberry Y, Hwang JR, Apletalina EV, Lindberg I (2002) Functional characterization of ProSAAS: similarities and differences with 7B2. J Biol Chem 277: 5175-5186
129
Freyer C, Kilpatrick LM, Salamonsen LA, Nie G (2007) Pro-protein convertases (PCs) other than PC6 are not tightly regulated for implantation in the human endometrium. Reproduction 133: 1189-1197
Fricker LD, McKinzie AA, Sun J, Curran E, Qian Y, Yan L, Patterson SD, Courchesne PL, Richards B, Levin N, Mzhavia N, Devi LA, Douglass J (2000) Identifi cation and characterization of proSAAS, a granin-like neuroendocrine peptide precursor that inhibits prohormone processing. J Neurosci 20: 639-648
Fuchs E (2007) Scratching the surface of skin development. Nature 445: 834-842Fuchs E (2008) Skin stem cells: rising to the surface. J Cell Biol 180: 273-284Furuta M, Yano H, Zhou A, Rouille Y, Holst JJ, Carroll R, Ravazzola M, Orci L, Furuta
H, Steiner DF (1997) Defective prohormone processing and altered pancreatic islet morphology in mice lacking active SPC2. Proc Natl Acad Sci USA 94: 6646-6651
Gao F, Shi HY, Daughty C, Cella N, Zhang M (2004) Maspin plays an essential role in early embryonic development. Development 131: 1479-1489
Gensberg K, Jan S, Matthews GM (1998) Subtilisin-related serine proteases in the mammalian constitutive secretory pathway. Semin Cell Dev Biol 9: 11-17
Gettins PG (2002) Serpin structure, mechanism, and function. Chem Rev 102: 4751-4804Gettins PG, Olson ST (2009) Exosite determinants of serpin specifi city. J Biol Chem 284:
20441-20445Gillard A (2001) Studies on the intracellular serpin Proteinase Inhibitor 8 (PI8). Monash
University, Melbourne M. Sc. (Part I) Thesis: 1-46Gillard A, Scarff K, Loveland KL, Ricardo SD, Bird PI (2006) Modulation and redistribution
of proteinase inhibitor 8 (Serpinb8) during kidney regeneration. Am J Nephrol 26: 34-42
Gluzman Y (1981) SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23: 175-182
Goodman LJ, Gorman CM (1994) Autoproteolytic activation of the mouse prohormone convertase mPC1. Biochem Biophys Res Commun 201: 795-804
Goulet B, Baruch A, Moon NS, Poirier M, Sansregret LL, Erickson A, Bogyo M, Nepveu A (2004) A cathepsin L isoform that is devoid of a signal peptide localizes to the nucleus in S phase and processes the CDP/Cux transcription factor. Mol Cell 14: 207-219
Grigoryev SA, Bednar J, Woodcock CL (1999) MENT, a heterochromatin protein that mediates higher order chromatin folding, is a new serpin family member. J Biol Chem 274: 5626-5636
Guest PC, Arden SD, Bennett DL, Clark A, Rutherford NG, Hutton JC (1992) The post-translational processing and intracellular sorting of PC2 in the islets of Langerhans. J Biol Chem 267: 22401-22406
Gurevich RM, Regula KM, Kirshenbaum LA (2001) Serpin protein CrmA suppresses hypoxia-mediated apoptosis of ventricular myocytes. Circulation 103: 1984-1991
Gyamera-Acheampong C, Mbikay M (2009) Proprotein convertase subtilisin/kexin type 4 in mammalian fertility: a review. Hum Reprod Update 15: 237-247
130
Gyamera-Acheampong C, Tantibhedhyangkul J, Weerachatyanukul W, Tadros H, Xu H, van de Loo JW, Pelletier RM, Tanphaichitr N, Mbikay M (2006) Sperm from mice genetically defi cient for the PCSK4 proteinase exhibit accelerated capacitation, precocious acrosome reaction, reduced binding to egg zona pellucida, and impaired fertilizing ability. Biol Reprod 74: 666-673
Henrich S, Cameron A, Bourenkov GP, Kiefersauer R, Huber R, Lindberg I, Bode W, Than ME (2003) The crystal structure of the proprotein processing proteinase furin explains its stringent specifi city. Nat Struct Biol 10: 520-526
Henrich S, Lindberg I, Bode W, Than ME (2005) Proprotein convertase models based on the crystal structures of furin and kexin: explanation of their specifi city. J Mol Biol 345: 211-227
Hersh CP, Dahl M, Ly NP, Berkey CS, Nordestgaard BG, Silverman EK (2004) Chronic obstructive pulmonary disease in α1-antitrypsin PI MZ heterozygotes: a meta-analysis. Thorax 59: 843-849
Hirst CE (2002) Tissue Distribution and Regulation of the Granzyme B inhibitor, Protease Inhibitor 9. Doctoral Thesis
Hirst CE, Buzza MS, Bird CH, Warren HS, Cameron PU, Zhang M, Ashton-Rickardt PG, Bird PI (2003) The intracellular granzyme B inhibitor, proteinase inhibitor 9, is up-regulated during accessory cell maturation and effector cell degranulation, and its overexpression enhances CTL potency. J Immunol 170: 805-815
Hirst CE, Buzza MS, Sutton VR, Trapani JA, Loveland KL, Bird PI (2001) Perforin-independent expression of granzyme B and proteinase inhibitor 9 in human testis and placenta suggests a role for granzyme B-mediated proteolysis in reproduction. Mol Hum Reprod 7: 1133-1142
Hofl ehner J, Eder U, Laslop A, Seidah NG, Fischer-Colbrie R, Winkler H (1995) Processing of secretogranin II by prohormone convertases: importance of PC1 in generation of secretoneurin. FEBS Lett 360: 294-298
Huntington JA, Li W (2009) Structural insights into the multiple functions of protein C inhibitor. Cell Mol Life Sci 66: 113-121
Huntington JA, Pannu NS, Hazes B, Read RJ, Lomas DA, Carrell RW (1999) A 2.6 A structure of a serpin polymer and implications for conformational disease. J Mol Biol 293: 449-455
Huntington JA, Read RJ, Carrell RW (2000) Structure of a serpin-protease complex shows inhibition by deformation. Nature 407: 923-926
Ida H, Nakashima T, Kedersha NL, Yamasaki S, Huang M, Izumi Y, Miyashita T, Origuchi T, Kawakami A, Migita K, Bird PI, Anderson P, Eguchi K (2003) Granzyme B leakage-induced cell death: a new type of activation-induced natural killer cell death. Eur J Immunol 33: 3284-3292
Irving JA, Pike RN, Lesk AM, Whisstock JC (2000) Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome Res 10: 1845-1864
131
Irving JA, Steenbakkers PJ, Lesk AM, Op den Camp HJ, Pike RN, Whisstock JC (2002) Serpins in prokaryotes. Mol Biol Evol 19: 1881-1890
Ito M, Liu Y, Yang Z, Nguyen J, Liang F, Morris RJ, Cotsarelis G (2005) Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Nat Med 11: 1351-1354
Iwatsuki M, Mimori K, Yokobori T, Ishi H, Beppu T, Nakamori S, Baba H, Mori M (2010) Epithelial-mesenchymal transition in cancer development and its clinical signifi cance. Cancer Sci 101: 293-299
Jackson RS, Creemers JW, Ohagi S, Raffi n-Sanson ML, Sanders L, Montague CT, Hutton JC, O’Rahilly S (1997) Obesity and impaired prohormone processing associated with mutations in the human prohormone convertase 1 gene. Nat Genet 16: 303-306
Jean F, Stella K, Thomas L, Liu G, Xiang Y, Reason AJ, Thomas G (1998) α1-Antitrypsin Portland, a bioengineered serpin highly selective for furin: application as an antipathogenic agent. Proc Natl Acad Sci USA 95: 7293-7298
Jiang X, Ellison SJ, Alarid ET, Shapiro DJ (2007) Interplay between the levels of estrogen and estrogen receptor controls the level of the granzyme inhibitor, proteinase inhibitor 9 and susceptibility to immune surveillance by natural killer cells. Oncogene 26: 4106-4114
Johnson RC, Darlington DN, Hand TA, Bloomquist BT, Mains RE (1994) PACE4: a subtilisin-like endoprotease prevalent in the anterior pituitary and regulated by thyroid status. Endocrinology 135: 1178-1185
Jonak C, Klosner G, Trautinger F (2009) Signifi cance of heat shock proteins in the skin upon UV exposure. Front Biosci 14: 4758-4768
Jutras I, Seidah NG, Reudelhuber TL, Brechler V (1997) Two activation states of the prohormone convertase PC1 in the secretory pathway. J Biol Chem 272: 15184-15188
Kaiserman D, Bird CH, Sun J, Matthews A, Ung K, Whisstock JC, Thompson PE, Trapani JA, Bird PI (2006a) The major human and mouse granzymes are structurally and functionally divergent. J Cell Biol 175: 619-630
Kaiserman D, Bird PI (2005) Analysis of vertebrate genomes suggests a new model for clade B serpin evolution. BMC Genomics 6: 167
Kaiserman D, Bird PI (2010) Control of granzymes by serpins. Cell Death Differ 17: 586-595Kaiserman D, Knaggs S, Scarff KL, Gillard A, Mirza G, Cadman M, McKeone R, Denny P,
Cooley J, Benarafa C, Remold-O’Donnell E, Ragoussis J, Bird PI (2002) Comparison of human chromosome 6p25 with mouse chromosome 13 reveals a greatly expanded ov-serpin gene repertoire in the mouse. Genomics 79: 349-362
Kaiserman D, Whisstock JC, Bird PI (2006b) Mechanisms of serpin dysfunction in disease. Expert Rev Mol Med 8: 1-19
Katz LS, Gosmain Y, Marthinet E, Philippe J (2009) Pax6 regulates the proglucagon processing enzyme PC2 and its chaperone 7B2. Mol Cell Biol 29: 2322-2334
Kawada N, Moriyama T, Ando A, Fukunaga M, Miyata T, Kurokawa K, Imai E, Hori M (1999) Increased oxidative stress in mouse kidneys with unilateral ureteral obstruction. Kidney Int 56: 1004-1013
132
Kawano T, Morimoto K, Uemura Y (1968) Urokinase inhibitor in human placenta. Nature 217: 253-254
Kawano T, Morimoto K, Uemura Y (1970) Partial purifi cation and properties of urokinase inhibitor from human placenta. J Biochem 67: 333-342
Kiefer MC, Tucker JE, Joh R, Landsberg KE, Saltman D, Barr PJ (1991) Identifi cation of a second human subtilisin-like protease gene in the fes/fps region of chromosome 15. DNA Cell Biol 10: 757-769
Kirchmair R, Egger C, Gee P, Hogue-Angeletti R, Fischer-Colbrie R, Laslop A, Winkler H (1992) Differential subcellular distribution of PC1, PC2 and furin in bovine adrenal medulla and secretion of PC1 and PC2 from this tissue. Neurosci Lett 143: 143-145
Klahr S, Morrissey J (2002) Obstructive nephropathy and renal fi brosis. Am J Physiol Renal Physiol 283: F861-875
Krem MM, Di Cera E (2003) Conserved Ser residues, the shutter region, and speciation in serpin evolution. J Biol Chem 278: 37810-37814
Kurzen H, Moll I, Moll R, Schafer S, Simics E, Amagai M, Wheelock MJ, Franke WW (1998) Compositionally different desmosomes in the various compartments of the human hair follicle. Differentiation 63: 295-304
Laforge M, Bidere N, Carmona S, Devocelle A, Charpentier B, Senik A (2006) Apoptotic death concurrent with CD3 stimulation in primary human CD8+ T lymphocytes: a role for endogenous granzyme B. J Immunol 176: 3966-3977
Leblond J, Laprise MH, Gaudreau S, Grondin F, Kisiel W, Dubois CM (2006) The serpin proteinase inhibitor 8: an endogenous furin inhibitor released from human platelets. Thromb Haemost 95: 243-252
Leduc R, Molloy SS, Thorne BA, Thomas G (1992) Activation of human furin precursor processing endoprotease occurs by an intramolecular autoproteolytic cleavage. J Biol Chem 267: 14304-14308
Lee SN, Lindberg I (2008) 7B2 prevents unfolding and aggregation of prohormone convertase 2. Endocrinology 149: 4116-4127
Leighton M, Kadler KE (2003) Paired basic/Furin-like proprotein convertase cleavage of Pro-BMP-1 in the trans-Golgi network. J Biol Chem 278: 18478-18484
Lennon G, Auffray C, Polymeropoulos M, Soares MB (1996) The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics 33: 151-152
Lewis JH, Iammarino RM, Spero JA, Hasiba U (1978) Antithrombin Pittsburgh: an α1-antitrypsin variant causing hemorrhagic disease. Blood 51: 129-137
Lijnen HR, Frederix L, Scroyen I (2007) Defi ciency of plasminogen activator inhibitor-2 impairs nutritionally induced murine adipose tissue development. J Thromb Haemost 5: 2259-2265
Liu B, Goltzman D, Rabbani SA (1995) Processing of pro-PTHRP by the prohormone convertase, furin: effect on biological activity. Am J Physiol 268: E832-838
Liu N, Wang Y, Ashton-Rickardt PG (2004) Serine protease inhibitor 2A inhibits caspase-independent cell death. FEBS Lett 569: 49-53
133
Liu Y (2004) Epithelial to mesenchymal transition in renal fi brogenesis: pathologic signifi cance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol 15: 1-12
Loebermann H, Tokuoka R, Deisenhofer J, Huber R (1984) Human α1-proteinase inhibitor. Crystal structure analysis of two crystal modifi cations, molecular model and preliminary analysis of the implications for function. J Mol Biol 177: 531-557
Lomas DA, Evans DL, Finch JT, Carrell RW (1992) The mechanism of Z α1-antitrypsin accumulation in the liver. Nature 357: 605-607
Lopez D (2008) PCSK9: an enigmatic protease. Biochim Biophys Acta 1781: 184-191Lopez-Novoa JM, Nieto MA (2009) Infl ammation and EMT: an alliance towards organ
fi brosis and cancer progression. EMBO Mol Med 1: 303-314Lord SJ, Rajotte RV, Korbutt GS, Bleackley RC (2003) Granzyme B: a natural born killer.
Immunol Rev 193: 31-38Lou H, Smith AM, Coates LC, Cawley NX, Loh YP, Birch NP (2007) The transmembrane
domain of the prohormone convertase PC3: a key motif for targeting to the regulated secretory pathway. Mol Cell Endocrinol 267: 17-25
Luke CJ, Pak SC, Askew YS, Naviglia TL, Askew DJ, Nobar SM, Vetica AC, Long OS, Watkins SC, Stolz DB, Barstead RJ, Moulder GL, Bromme D, Silverman GA (2007) An intracellular serpin regulates necrosis by inhibiting the induction and sequelae of lysosomal injury. Cell 130: 1108-1119
Lusson J, Vieau D, Hamelin J, Day R, Chretien M, Seidah NG (1993) cDNA structure of the mouse and rat subtilisin/kexin-like PC5: a candidate proprotein convertase expressed in endocrine and nonendocrine cells. Proc Natl Acad Sci USA 90: 6691-6695
Lyle S, Christofi dou-Solomidou M, Liu Y, Elder DE, Albelda S, Cotsarelis G (1998) The C8/144B monoclonal antibody recognizes cytokeratin 15 and defi nes the location of human hair follicle stem cells. J Cell Sci 111 ( Pt 21): 3179-3188
Mains RE, Berard CA, Denault JB, Zhou A, Johnson RC, Leduc R (1997) PACE4: a subtilisin-like endoprotease with unique properties. Biochem J 321 ( Pt 3): 587-593
Masaki T, Foti R, Hill PA, Ikezumi Y, Atkins RC, Nikolic-Paterson DJ (2003) Activation of the ERK pathway precedes tubular proliferation in the obstructed rat kidney. Kidney Int 63: 1256-1264
Martal J, Chene N, Camous S, Huynh L, Lantier F, Hermier P, L’Haridon R, Charpigny G, Charlier M, Chaouat G (1997) Recent developments and potentialities for reducing embryo mortality in ruminants: the role of IFN-τ and other cytokines in early pregnancy. Reprod Fertil Dev 9: 355-380
Mayer G, Hamelin J, Asselin MC, Pasquato A, Marcinkiewicz E, Tang M, Tabibzadeh S, Seidah NG (2008) The regulated cell surface zymogen activation of the proprotein convertase PC5A directs the processing of its secretory substrates. J Biol Chem 283: 2373-2384
Mazurkiewicz JE, Corliss D, Slominski A (2000) Spatiotemporal expression, distribution, and processing of POMC and POMC-derived peptides in murine skin. J Histochem Cytochem 48: 905-914
134
Mbikay M, Raffi n-Sanson ML, Tadros H, Sirois F, Seidah NG, Chretien M (1994) Structure of the gene for the testis-specifi c proprotein convertase 4 and of its alternate messenger RNA isoforms. Genomics 20: 231-237
Mbikay M, Seidah NG, Chretien M (2001) Neuroendocrine secretory protein 7B2: structure, expression and functions. Biochem J 357: 329-342
Mbikay M, Sirois F, Yao J, Seidah NG, Chretien M (1997) Comparative analysis of expression of the proprotein convertases furin, PACE4, PC1 and PC2 in human lung tumours. Br J Cancer 75: 1509-1514
Mbikay M, Tadros H, Ishida N, Lerner CP, De Lamirande E, Chen A, El-Alfy M, Clermont Y, Seidah NG, Chretien M, Gagnon C, Simpson EM (1997) Impaired fertility in mice defi cient for the testicular germ-cell protease PC4. Proc Natl Acad Sci USA 94: 6842-6846
Mercapide J, Lopez De Cicco R, Bassi DE, Castresana JS, Thomas G, Klein-Szanto AJ (2002) Inhibition of furin-mediated processing results in suppression of astrocytoma cell growth and invasiveness. Clin Cancer Res 8: 1740-1746
Misseri R, Rink RC, Meldrum DR, Meldrum KK (2004) Infl ammatory mediators and growth factors in obstructive renal injury. J Surg Res 119: 149-159
Miyata T, Nangaku M, Suzuki D, Inagi R, Uragami K, Sakai H, Okubo K, Kurokawa K (1998) A mesangium-predominant gene, megsin, is a new serpin upregulated in IgA nephropathy. J Clin Invest 102: 828-836
Mizuguchi Y, Chen J, Seshan SV, Poppas DP, Szeto HH, Felsen D (2008) A novel cell-permeable antioxidant peptide decreases renal tubular apoptosis and damage in unilateral ureteral obstruction. Am J Physiol Renal Physiol 295: F1545-1553
Molloy EL, Adams A, Moore JB, Masterson JC, Madrigal-Estebas L, Mahon BP, O’Dea S (2008) BMP4 induces an epithelial-mesenchymal transition-like response in adult airway epithelial cells. Growth Factors 26: 12-22
Molloy SS, Bresnahan PA, Leppla SH, Klimpel KR, Thomas G (1992) Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and effi ciently cleaves anthrax toxin protective antigen. J Biol Chem 267: 16396-16402
Molloy SS, Anderson ED, Jean F, Thomas G (1999) Bi-cycling the furin pathway: from TGN localization to pathogen activation and embryogenesis. Trends Cell Biol 9: 28-35
Molloy SS, Thomas L, VanSlyke JK, Stenberg PE, Thomas G (1994) Intracellular traffi cking and activation of the furin proprotein convertase: localization to the TGN and recycling from the cell surface. Embo J 13: 18-33
Morgan L, Broughton Pipkin F, Kalsheker N (1996) Angiotensinogen: molecular biology, biochemistry and physiology. Int J Biochem Cell Biol 28: 1211-1222
Mori K, Kii S, Tsuji A, Nagahama M, Imamaki A, Hayashi K, Akamatsu T, Nagamune H, Matsuda Y (1997) A novel human PACE4 isoform, PACE4E is an active processing protease containing a hydrophobic cluster at the carboxy terminus. J Biochem 121: 941-948
135
Moriyama M, Durham AD, Moriyama H, Hasegawa K, Nishikawa S, Radtke F, Osawa M (2008) Multiple roles of Notch signaling in the regulation of epidermal development. Dev Cell 14: 594-604
Mottonen J, Strand A, Symersky J, Sweet RM, Danley DE, Geoghegan KF, Gerard RD, Goldsmith EJ (1992) Structural basis of latency in plasminogen activator inhibitor-1. Nature 355: 270-273
Muller EJ, Caldelari R, Posthaus H (2004) Role of subtilisin-like convertases in cadherin processing or the conundrum to stall cadherin function by convertase inhibitors in cancer therapy. J Mol Histol 35: 263-275
Muller-Rover S, Handjiski B, van der Veen C, Eichmuller S, Foitzik K, McKay IA, Stenn KS, Paus R (2001) A comprehensive guide for the accurate classifi cation of murine hair follicles in distinct hair cycle stages. J Invest Dermatol 117: 3-15
Munoz EM, Linhardt RJ (2004) Heparin-binding domains in vascular biology. Arterioscler Thromb Vasc Biol 24: 1549-1557
Munzer JS, Basak A, Zhong M, Mamarbachi A, Hamelin J, Savaria D, Lazure C, Hendy GN, Benjannet S, Chretien M, Seidah NG (1997) In vitro characterization of the novel proprotein convertase PC7. J Biol Chem 272: 19672-19681
Nagahama M, Taniguchi T, Hashimoto E, Imamaki A, Mori K, Tsuji A, Matsuda Y (1998) Biosynthetic processing and quaternary interactions of proprotein convertase SPC4 (PACE4). FEBS Lett 434: 155-159
Nagamune H, Muramatsu K, Akamatsu T, Tamai Y, Izumi K, Tsuji A, Matsuda Y (1995) Distribution of the Kexin family proteases in pancreatic islets: PACE4C is specifi cally expressed in B cells of pancreatic islets. Endocrinology 136: 357-360
Nakagawa T, Hosaka M, Torii S, Watanabe T, Murakami K, Nakayama K (1993a) Identifi cation and functional expression of a new member of the mammalian Kex2-like processing endoprotease family: its striking structural similarity to PACE4. J Biochem (Tokyo) 113: 132-135
Nakagawa T, Murakami K, Nakayama K (1993b) Identifi cation of an isoform with an extremely large Cys-rich region of PC6, a Kex2-like processing endoprotease. FEBS Lett 327: 165-171
Nakashima T, Pak SC, Silverman GA, Spring PM, Frederick MJ, Clayman GL (2000) Genomic cloning, mapping, structure and promoter analysis of HEADPIN, a serpin which is down-regulated in head and neck cancer cells. Biochim Biophys Acta 1492: 441-446
Nakaya Y, Sheng G (2008) Epithelial to mesenchymal transition during gastrulation: an embryological view. Dev Growth Differ 50: 755-766
Nakayama K (1997) Furin: a mammalian subtilisin/Kex2p-like endoprotease involved in processing of a wide variety of precursor proteins. Biochem J 327 ( Pt 3): 625-635
Nakayama K, Kim WS, Torii S, Hosaka M, Nakagawa T, Ikemizu J, Baba T, Murakami K (1992) Identifi cation of the fourth member of the mammalian endoprotease family homologous to the yeast Kex2 protease. Its testis-specifi c expression. J Biol Chem 267: 5897-5900
136
Ng YY, Huang TP, Yang WC, Chen ZP, Yang AH, Mu W, Nikolic-Paterson DJ, Atkins RC, Lan HY (1998) Tubular epithelial-myofi broblast transdifferentiation in progressive tubulointerstitial fi brosis in 5/6 nephrectomized rats. Kidney Int 54: 864-876
Nie G, Li Y, Wang M, Liu YX, Findlay JK, Salamonsen LA (2005) Inhibiting uterine PC6 blocks embryo implantation: an obligatory role for a proprotein convertase in fertility. Biol Reprod 72: 1029-1036
Nour N, Basak A, Chretien M, Seidah NG (2003) Structure-function analysis of the prosegment of the proprotein convertase PC5A. J Biol Chem 278: 2886-2895
Nour N, Mayer G, Mort JS, Salvas A, Mbikay M, Morrison CJ, Overall CM, Seidah NG (2005) The cysteine-rich domain of the secreted proprotein convertases PC5A and PACE4 functions as a cell surface anchor and interacts with tissue inhibitors of metalloproteinases. Mol Biol Cell 16: 5215-5226
Ogawa Y, Kobayashi T, Nishioka A, Kariya S, Ohnishi T, Hamasato S, Seguchi H, Yoshida S (2004) Reactive oxygen species-producing site in radiation and hydrogen peroxide-induced apoptosis of human peripheral T cells: Involvement of lysosomal membrane destabilization. Int J Mol Med 13: 655-660
Ollinger K, Brunk UT (1995) Cellular injury induced by oxidative stress is mediated through lysosomal damage. Free Radic Biol Med 19: 565-574
Olson ST, Bock PE, Kvassman J, Shore JD, Lawrence DA, Ginsburg D, Bjork I (1995) Role of the catalytic serine in the interactions of serine proteinases with protein inhibitors of the serpin family. Contribution of a covalent interaction to the binding energy of serpin-proteinase complexes. J Biol Chem 270: 30007-30017
Osterwalder T, Kuhnen A, Leiserson WM, Kim YS, Keshishian H (2004) Drosophila serpin 4 functions as a neuroserpin-like inhibitor of subtilisin-like proprotein convertases. J Neurosci 24: 5482-5491
Owen MC, Brennan SO, Lewis JH, Carrell RW (1983) Mutation of antitrypsin to antithrombin. α1-antitrypsin Pittsburgh (358 Met leads to Arg), a fatal bleeding disorder. N Engl J Med 309: 694-698
Ozawa M, Aiba S, Kurosawa M, Tagami H (2004) Ber-EP4 antigen is a marker for a cell population related to the secondary hair germ. Exp Dermatol 13: 401-405
Paus R, Arck P, Tiede S (2008) (Neuro-)endocrinology of epithelial hair follicle stem cells. Mol Cell Endocrinol 288: 38-51
Pearton DJ, Nirunsuksiri W, Rehemtulla A, Lewis SP, Presland RB, Dale BA (2001) Proprotein convertase expression and localization in epidermis: evidence for multiple roles and substrates. Exp Dermatol 10: 193-203
Pei D, Weiss SJ (1995) Furin-dependent intracellular activation of the human stromelysin-3 zymogen. Nature 375: 244-247
Peinado JR, Li H, Johanning K, Lindberg I (2003) Cleavage of recombinant proenkephalin and blockade mutants by prohormone convertases 1 and 2: an in vitro specifi city study. J Neurochem 87: 868-878
Pelto-Huikko M (1989) Immunocytochemical localization of neuropeptides in the adrenal medulla. J Electron Microsc Tech 12: 364-379
137
Pike RN, Buckle AM, le Bonniec BF, Church FC (2005) Control of the coagulation system by serpins. Getting by with a little help from glycosaminoglycans. FEBS J 272: 4842-4851
Planes C, Caughey GH (2007) Regulation of the epithelial Na+ channel by peptidases. Curr Top Dev Biol 78: 23-46
Poller W, Faber JP, Weidinger S, Tief K, Scholz S, Fischer M, Olek K, Kirchgesser M, Heidtmann HH (1993) A leucine-to-proline substitution causes a defective α1-antichymotrypsin allele associated with familial obstructive lung disease. Genomics 17: 740-743
Poulsom R, Alison MR, Cook T, Jeffery R, Ryan E, Forbes SJ, Hunt T, Wyles S, Wright NA (2003) Bone marrow stem cells contribute to healing of the kidney. J Am Soc Nephrol 14 Suppl 1: S48-54
Pratt CW, Tobin RB, Church FC (1990) Interaction of heparin cofactor II with neutrophil elastase and cathepsin G. J Biol Chem 265: 6092-6097
Pratt CW, Whinna HC, Meade JB, Treanor RE, Church FC (1989) Physicochemical aspects of heparin cofactor II. Ann N Y Acad Sci 556: 104-115
Proksch E, Brandner JM, Jensen JM (2008) The skin: an indispensable barrier. Exp Dermatol 17: 1063-1072
Ra HJ, Parks WC (2007) Control of matrix metalloproteinase catalytic activity. Matrix Biol 26: 587-596
Rabah N, Gauthier D, Dikeakos JD, Reudelhuber TL, Lazure C (2007) The C-terminal region of the proprotein convertase 1/3 (PC1/3) exerts a bimodal regulation of the enzyme activity in vitro. FEBS J 274: 3482-3491
Radisky DC, Levy DD, Littlepage LE, Liu H, Nelson CM, Fata JE, Leake D, Godden EL, Albertson DG, Nieto MA, Werb Z, Bissell MJ (2005) Rac1b and reactive oxygen species mediate MMP-3-induced EMT and genomic instability. Nature 436: 123-127
Ragg H, Lokot T, Kamp PB, Atchley WR, Dress A (2001) Vertebrate serpins: construction of a confl ict-free phylogeny by combining exon-intron and diagnostic site analyses. Mol Biol Evol 18: 577-584
Raghunath M, Putnam EA, Ritty T, Hamstra D, Park ES, Tschodrich-Rotter M, Peters R, Rehemtulla A, Milewicz DM (1999) Carboxy-terminal conversion of profi brillin to fi brillin at a basic site by PACE/furin-like activity required for incorporation in the matrix. J Cell Sci 112 ( Pt 7): 1093-1100
Reilly RF, Ellison DH (2000) Mammalian distal tubule: physiology, pathophysiology, and molecular anatomy. Physiol Rev 80: 277-313
Remacle AG, Shiryaev SA, Oh ES, Cieplak P, Srinivasan A, Wei G, Liddington RC, Ratnikov BI, Parent A, Desjardins R, Day R, Smith JW, Lebl M, Strongin AY (2008) Substrate cleavage analysis of furin and related proprotein convertases. A comparative study. J Biol Chem 283: 20897-20906
Remold-O’Donnell E (1993) The ovalbumin family of serpin proteins. FEBS Lett 315: 105-108
138
Remold-O’Donnell E, Chin J, Alberts M (1992) Sequence and molecular characterization of human monocyte/neutrophil elastase inhibitor. Proc Natl Acad Sci USA 89: 5635-5639
Richer MJ, Keays CA, Waterhouse J, Minhas J, Hashimoto C, Jean F (2004) The Spn4 gene of Drosophila encodes a potent furin-directed secretory pathway serpin. Proc Natl Acad Sci USA 101: 10560-10565
Riewald M, Schleef RR (1995) Molecular cloning of bomapin (protease inhibitor 10), a novel human serpin that is expressed specifi cally in the bone marrow. J Biol Chem 270: 26754-26757
Riewald M, Schleef RR (1996) Human cytoplasmic antiproteinase neutralizes rapidly and effi ciently chymotrypsin and trypsin-like proteases utilizing distinct reactive site residues. J Biol Chem 271: 14526-14532
Rodgers UR, Kevorkian L, Surridge AK, Waters JG, Swingler TE, Culley K, Illman S, Lohi J, Parker AE, Clark IM (2009) Expression and function of matrix metalloproteinase (MMP)-28. Matrix Biol 28: 263-272
Roebroek AJ, Umans L, Pauli IG, Robertson EJ, van Leuven F, Van de Ven WJ, Constam DB (1998) Failure of ventral closure and axial rotation in embryos lacking the proprotein convertase Furin. Development 125: 4863-4876
Rossier BC, Stutts MJ (2009) Activation of the epithelial sodium channel (ENaC) by serine proteases. Annu Rev Physiol 71: 361-379
Salamonsen LA (1998) Current concepts of the mechanisms of menstruation: a normal process of tissue destruction. Trends Endocrinol Metab 9: 305-309
Salamonsen LA (1999) Role of proteases in implantation. Rev Reprod 4: 11-22Scamuffa N, Calvo F, Chretien M, Seidah NG, Khatib AM (2006) Proprotein convertases:
lessons from knockouts. Faseb J 20: 1954-1963Scarff KL, Ung KS, Nandurkar H, Crack PJ, Bird CH, Bird PI (2004) Targeted disruption
of SPI3/Serpinb6 does not result in developmental or growth defects, leukocyte dysfunction, or susceptibility to stroke. Mol Cell Biol 24: 4075-4082
Scarff KL, Ung KS, Sun J, Bird PI (2003) A retained selection cassette increases reporter gene expression without affecting tissue distribution in SPI3 knockout/GFP knock-in mice. Genesis 36: 149-157
Shen X, Li QL, Brent GA, Friedman TC (2004) Thyroid hormone regulation of prohormone convertase 1 (PC1): regional expression in rat brain and in vitro characterization of negative thyroid hormone response elements. J Mol Endocrinol 33: 21-33
Schick C, Bromme D, Bartuski AJ, Uemura Y, Schechter NM, Silverman GA (1998a) The reactive site loop of the serpin SCCA1 is essential for cysteine proteinase inhibition. Proc Natl Acad Sci USA 95: 13465-13470
Schick C, Kamachi Y, Bartuski AJ, Cataltepe S, Schechter NM, Pemberton PA, Silverman GA (1997) Squamous cell carcinoma antigen 2 is a novel serpin that inhibits the chymotrypsin-like proteinases cathepsin G and mast cell chymase. J Biol Chem 272: 1849-1855
139
Schick C, Pemberton PA, Shi GP, Kamachi Y, Cataltepe S, Bartuski AJ, Gornstein ER, Bromme D, Chapman HA, Silverman GA (1998b) Cross-class inhibition of the cysteine proteinases cathepsins K, L, and S by the serpin squamous cell carcinoma antigen 1: a kinetic analysis. Biochemistry 37: 5258-5266
Schneider SS, Schick C, Fish KE, Miller E, Pena JC, Treter SD, Hui SM, Silverman GA (1995) A serine proteinase inhibitor locus at 18q21.3 contains a tandem duplication of the human squamous cell carcinoma antigen gene. Proc Natl Acad Sci USA 92: 3147-3151
Schussler GC (2000) The thyroxine-binding proteins. Thyroid 10: 141-149Schweizer J, Langbein L, Rogers MA, Winter H (2007) Hair follicle-specifi c keratins and
their diseases. Exp Cell Res 313: 2010-2020Scott CF, Carrell RW, Glaser CB, Kueppers F, Lewis JH, Colman RW (1986) α1-antitrypsin-
Pittsburgh. A potent inhibitor of human plasma factor XIa, kallikrein, and factor XIIf. J Clin Invest 77: 631-634
Scott FL (2000) Biology and evolution of two intracellular serpins. Monash University, Melbourne Doctoral Thesis: 1-171
Scott FL, Coughlin PB, Bird C, Cerruti L, Hayman JA, Bird P (1996) Proteinase inhibitor 6 cannot be secreted, which suggests it is a new type of cellular serpin. J Biol Chem 271: 1605-1612
Scott FL, Eyre HJ, Lioumi M, Ragoussis J, Irving JA, Sutherland GA, Bird PI (1999a) Human ovalbumin serpin evolution: phylogenic analysis, gene organization, and identifi cation of new PI8-related genes suggest that two interchromosomal and several intrachromosomal duplications generated the gene clusters at 18q21-q23 and 6p25. Genomics 62: 490-499
Scott FL, Hirst CE, Sun J, Bird CH, Bottomley SP, Bird PI (1999b) The intracellular serpin proteinase inhibitor 6 is expressed in monocytes and granulocytes and is a potent inhibitor of the azurophilic granule protease, cathepsin G. Blood 93: 2089-2097
Seidah NG, Benjannet S, Wickham L, Marcinkiewicz J, Jasmin SB, Stifani S, Basak A, Prat A, Chretien M (2003) The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation. Proc Natl Acad Sci USA 100: 928-933
Seidah NG, Chretien M (1999) Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides. Brain Res 848: 45-62
Seidah NG, Day R, Hamelin J, Gaspar A, Collard MW, Chretien M (1992) Testicular expression of PC4 in the rat: molecular diversity of a novel germ cell-specifi c Kex2/subtilisin-like proprotein convertase. Mol Endocrinol 6: 1559-1570
Seidah NG, Gaspar L, Mion P, Marcinkiewicz M, Mbikay M, Chretien M (1990) cDNA sequence of two distinct pituitary proteins homologous to Kex2 and furin gene products: tissue-specifi c mRNAs encoding candidates for pro-hormone processing proteinases. DNA Cell Biol 9: 789
140
Seidah NG, Hamelin J, Mamarbachi M, Dong W, Tardos H, Mbikay M, Chretien M, Day R (1996) cDNA structure, tissue distribution, and chromosomal localization of rat PC7, a novel mammalian proprotein convertase closest to yeast kexin-like proteinases. Proc Natl Acad Sci USA 93: 3388-3393
Seidah NG, Marcinkiewicz M, Benjannet S, Gaspar L, Beaubien G, Mattei MG, Lazure C, Mbikay M, Chretien M (1991) Cloning and primary sequence of a mouse candidate prohormone convertase PC1 homologous to PC2, Furin, and Kex2: distinct chromosomal localization and messenger RNA distribution in brain and pituitary compared to PC2. Mol Endocrinol 5: 111-122
Seidah NG, Mowla SJ, Hamelin J, Mamarbachi AM, Benjannet S, Toure BB, Basak A, Munzer JS, Marcinkiewicz J, Zhong M, Barale JC, Lazure C, Murphy RA, Chretien M, Marcinkiewicz M (1999) Mammalian subtilisin/kexin isozyme SKI-1: A widely expressed proprotein convertase with a unique cleavage specifi city and cellular localization. Proc Natl Acad Sci USA 96: 1321-1326
Seidel B, Dong W, Savaria D, Zheng M, Pintar JE, Day R (1998) Neuroendocrine protein 7B2 is essential for proteolytic conversion and activation of proprotein convertase 2 in vivo. DNA Cell Biol 17: 1017-1029
Shen X, Li QL, Brent GA, Friedman TC (2004) Thyroid hormone regulation of prohormone convertase 1 (PC1): regional expression in rat brain and in vitro characterization of negative thyroid hormone response elements. J Mol Endocrinol 33: 21-33
Shennan KI, Taylor NA, Docherty K (1994) Calcium- and pH-dependent aggregation and membrane association of the precursor of the prohormone convertase PC2. J Biol Chem 269: 18646-18650
Shi HY, Lydon JP, Zhang M (2004) Hormonal defect in maspin heterozygous mice reveals a role of progesterone in pubertal ductal development. Mol Endocrinol 18: 2196-2207
Siezen RJ, Creemers JW, Van de Ven WJ (1994) Homology modelling of the catalytic domain of human furin. A model for the eukaryotic subtilisin-like proprotein convertases. Eur J Biochem 222: 255-266
Silverman GA, Bartuski AJ, Cataltepe S, Gornstein ER, Kamachi Y, Schick C, Uemura Y (1998) SCCA1 and SCCA2 are proteinase inhibitors that map to the serpin cluster at 18q21.3. Tumour Biol 19: 480-487
Silverman GA, Bird PI, Carrell RW, Church FC, Coughlin PB, Gettins PG, Irving JA, Lomas DA, Luke CJ, Moyer RW, Pemberton PA, Remold-O’Donnell E, Salvesen GS, Travis J, Whisstock JC (2001) The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. J Biol Chem 276: 33293-33296
Silverman GA, Whisstock JC, Askew DJ, Pak SC, Luke CJ, Cataltepe S, Irving JA, Bird PI (2004) Human clade B serpins (ov-serpins) belong to a cohort of evolutionarily dispersed intracellular proteinase inhibitor clades that protect cells from promiscuous proteolysis. Cell Mol Life Sci 61: 301-325
141
Smeekens SP, Steiner DF (1990) Identifi cation of a human insulinoma cDNA encoding a novel mammalian protein structurally related to the yeast dibasic processing protease Kex2. J Biol Chem 265: 2997-3000
Smyth MJ, Trapani JA (1995) Granzymes: exogenous proteinases that induce target cell apoptosis. Immunol Today 16: 202-206
Sprecher CA, Morgenstern KA, Mathewes S, Dahlen JR, Schrader SK, Foster DC, Kisiel W (1995) Molecular cloning, expression, and partial characterization of two novel members of the ovalbumin family of serine proteinase inhibitors. J Biol Chem 270: 29854-29861
Stein PE, Carrell RW (1995) What do dysfunctional serpins tell us about molecular mobility and disease? Nat Struct Biol 2: 96-113
St Germain C, Croissandeau G, Mayne J, Baltz JM, Chretien M, Mbikay M (2005) Expression and transient nuclear translocation of proprotein convertase 1 (PC1) during mouse preimplantation embryonic development. Mol Reprod Dev 72: 483-493
Strik MC, Bladergroen BA, Wouters D, Kisiel W, Hooijberg JH, Verlaan AR, Hordijk PL, Schneider P, Hack CE, Kummer JA (2002) Distribution of the human intracellular serpin protease inhibitor 8 in human tissues. J Histochem Cytochem 50: 1443-1454
Sun J, Bird CH, Sutton V, McDonald L, Coughlin PB, De Jong TA, Trapani JA, Bird PI (1996) A cytosolic granzyme B inhibitor related to the viral apoptotic regulator cytokine response modifi er A is present in cytotoxic lymphocytes. J Biol Chem 271: 27802-27809
Sun J, Ooms L, Bird CH, Sutton VR, Trapani JA, Bird PI (1997) A new family of 10 murine ovalbumin serpins includes two homologs of proteinase inhibitor 8 and two homologs of the granzyme B inhibitor (proteinase inhibitor 9). J Biol Chem 272: 15434-15441
Sun J, Stephens R, Mirza G, Kanai H, Ragoussis J, Bird PI (1998) A serpin gene cluster on human chromosome 6p25 contains PI6, PI9 and ELANH2 which have a common structure almost identical to the 18q21 ovalbumin serpin genes. Cytogenet Cell Genet 82: 273-277
Tadros H, Chretien M, Mbikay M (2001) The testicular germ-cell protease PC4 is also expressed in macrophage-like cells of the ovary. J Reprod Immunol 49: 133-152
Takahashi S, Nakagawa T, Banno T, Watanabe T, Murakami K, Nakayama K (1995) Localization of furin to the trans-Golgi network and recycling from the cell surface involves Ser and Tyr residues within the cytoplasmic domain. J Biol Chem 270: 28397-28401
Tan TK, Zheng G, Hsu TT, Wang Y, Lee VW, Tian X, Wang Y, Cao Q, Wang Y, Harris DC (2010) Macrophage matrix metalloproteinase-9 mediates epithelial-mesenchymal transition in vitro in murine renal tubular cells. Am J Pathol 176: 1256-1270
Taylor NA, Jan G, Scougall KT, Docherty K, Shennan KI (1998) Sorting of PC2 to the regulated secretory pathway in AtT20 cells. J Mol Endocrinol 21: 209-216
Taylor NA, Van De Ven WJ, Creemers JW (2003) Curbing activation: proprotein convertases in homeostasis and pathology. Faseb J 17: 1215-1227
142
Teoh SS, Whisstock JC, Bird PI (2010) Maspin (serpinb5) is an obligate intracellular serpin. J Biol Chem 285: 10862-10869
Terman A, Kurz T, Gustafsson B, Brunk UT (2006) Lysosomal labilization. IUBMB Life 58: 531-539
Thomas G (2002) Furin at the cutting edge: from protein traffi c to embryogenesis and disease. Nat Rev Mol Cell Biol 3: 753-766
Thomson M, McCarroll J, Bond J, Gordon-Thomson C, E DW, Moore GP (2003) Parathyroid hormone-related peptide modulates signal pathways in skin and hair follicle cells. Exp Dermatol 12: 389-395
Torii S, Yamagishi T, Murakami K, Nakayama K (1993) Localization of Kex2-like processing endoproteases, furin and PC4, within mouse testis by in situ hybridization. FEBS Lett 316: 12-16
Tortorella MD, Arner EC, Hills R, Gormley J, Fok K, Pegg L, Munie G, Malfait AM (2005) ADAMTS-4 (aggrecanase-1): N-terminal activation mechanisms. Arch Biochem Biophys 444: 34-44
Trapani JA, Sutton VR (2003) Granzyme B: pro-apoptotic, antiviral and antitumor functions. Curr Opin Immunol 15: 533-543
Trowbridge IS, Collawn JF, Hopkins CR (1993) Signal-dependent membrane protein traffi cking in the endocytic pathway. Annu Rev Cell Biol 9: 129-161
Tsuji A, Hashimoto E, Ikoma T, Taniguchi T, Mori K, Nagahama M, Matsuda Y (1999) Inactivation of proprotein convertase, PACE4, by α1-antitrypsin Portland (α1-PDX), a blocker of proteolytic activation of bone morphogenetic protein during embryogenesis: evidence that PACE4 is able to form an SDS-stable acyl intermediate with α1-PDX. J Biochem 126: 591-603
Tsuji A, Hine C, Tamai Y, Yonemoto K, Mori K, Yoshida S, Bando M, Sakai E, Mori K, Akamatsu T, Matsuda Y (1997) Genomic organization and alternative splicing of human PACE4 (SPC4), kexin-like processing endoprotease. J Biochem 122: 438-452
Tsuji A, Sakurai K, Kiyokage E, Yamazaki T, Koide S, Toida K, Ishimura K, Matsuda Y (2003) Secretory proprotein convertases PACE4 and PC6A are heparin-binding proteins which are localized in the extracellular matrix. Potential role of PACE4 in the activation of proproteins in the extracellular matrix. Biochim Biophys Acta 1645: 95-104
Tsuji A, Kanie H, Makise H, Yuasa K, Nagahama M, Matsuda Y (2007) Engineering of alpha1-antitrypsin variants selective for subtilisin-like proprotein convertases PACE4 and PC6: importance of the P2’ residue in stable complex formation of the serpin with proprotein convertase. Protein Eng Des Sel 20: 163-170
Uyttendaele H, Panteleyev AA, de Berker D, Tobin DT, Christiano AM (2004) Activation of Notch1 in the hair follicle leads to cell-fate switch and Mohawk alopecia. Differentiation 72: 396-409
Van de Ven WJ, Roebroek AJ, Van Duijnhoven HL (1993) Structure and function of eukaryotic proprotein processing enzymes of the subtilisin family of serine proteases. Crit Rev Oncog 4: 115-136
143
Vaughan ED, Jr., Marion D, Poppas DP, Felsen D (2004) Pathophysiology of unilateral ureteral obstruction: studies from Charlottesville to New York. J Urol 172: 2563-2569
Vey M, Schafer W, Berghofer S, Klenk HD, Garten W (1994) Maturation of the trans-Golgi network protease furin: compartmentalization of propeptide removal, substrate cleavage, and COOH-terminal truncation. J Cell Biol 127: 1829-1842
Villeneuve P, Feliciangeli S, Croissandeau G, Seidah NG, Mbikay M, Kitabgi P, Beaudet A (2002) Altered processing of the neurotensin/neuromedin N precursor in PC2 knock down mice: a biochemical and immunohistochemical study. J Neurochem 82: 783-793
Waghray A, Keppler D, Sloane BF, Schuger L, Chen YQ (2002) Analysis of a truncated form of cathepsin H in human prostate tumor cells. J Biol Chem 277: 11533-11538
Wallis DD, Putnam EA, Cretoiu JS, Carmical SG, Cao SN, Thomas G, Milewicz DM (2003) Profi brillin-1 maturation by human dermal fi broblasts: proteolytic processing and molecular chaperones. J Cell Biochem 90: 641-652
Waseem A, Dogan B, Tidman N, Alam Y, Purkis P, Jackson S, Lalli A, Machesney M, Leigh IM (1999) Keratin 15 expression in stratifi ed epithelia: downregulation in activated keratinocytes. J Invest Dermatol 112: 362-369
Welss T, Sun J, Irving JA, Blum R, Smith AI, Whisstock JC, Pike RN, von Mikecz A, Ruzicka T, Bird PI, Abts HF (2003) Hurpin is a selective inhibitor of lysosomal cathepsin L and protects keratinocytes from ultraviolet-induced apoptosis. Biochemistry 42: 7381-7389
Wen JG, Frokiaer J, Jorgensen TM, Djurhuus JC (1999) Obstructive nephropathy: an update of the experimental research. Urol Res 27: 29-39
Wheater PR (1979) Functional histology : a text and colour atlas / Paul R. Wheater, H. George Burkitt, Victor G. Daniels ; illustrated by Philip J. Deakin ; prepared in the Department of Pathology, University of Nottingham ; foreword by Roger Warwick, Edinburgh ; New York : New York :: Churchill Livingstone ; distributed in the U.S. by Longman.
Whisstock J, Skinner R, Lesk AM (1998) An atlas of serpin conformations. Trends Biochem Sci 23: 63-67
Whisstock JC, Skinner R, Carrell RW, Lesk AM (2000) Conformational changes in serpins: I. The native and cleaved conformations of α1-antitrypsin. J Mol Biol 296: 685-699
Wouters S, Leruth M, Decroly E, Vandenbranden M, Creemers JW, van de Loo JW, Ruysschaert JM, Courtoy PJ (1998) Furin and proprotein convertase 7 (PC7)/lymphoma PC endogenously expressed in rat liver can be resolved into distinct post-Golgi compartments. Biochem J 336 ( Pt 2): 311-316
Xiang Y, Molloy SS, Thomas L, Thomas G (2000) The PC6B cytoplasmic domain contains two acidic clusters that direct sorting to distinct trans-Golgi network/endosomal compartments. Mol Biol Cell 11: 1257-1273
Xu Z, Castellino FJ, Ploplis VA (2010) Plasminogen activator inhibitor-1 (PAI-1) is cardioprotective in mice by maintaining microvascular integrity and cardiac architecture. Blood 115: 2038-2047
144
Yabuki A, Maeda M, Matsumoto M, Kamimura R, Masuyama T, Suzuki S (2005) SAMP1/Sku as a murine model for tubulointerstitial nephritis: a study using unilateral ureteral obstruction. Exp Anim 54: 53-60
Yamasaki M, Li W, Johnson DJ, Huntington JA (2008) Crystal structure of a stable dimer reveals the molecular basis of serpin polymerization. Nature 455: 1255-1258
Yan C, Grimm WA, Garner WL, Qin L, Travis T, Tan N, Han YP (2010) Epithelial to Mesenchymal Transition in Human Skin Wound Healing Is Induced by Tumor Necrosis Factor-α through Bone Morphogenic Protein-2. Am J Pathol 176
Ye RD, Ahern SM, Le Beau MM, Lebo RV, Sadler JE (1989) Structure of the gene for human plasminogen activator inhibitor-2. The nearest mammalian homologue of chicken ovalbumin. J Biol Chem 264: 5495-5502
Yoshida I, Koide S, Hasegawa SI, Nakagawara A, Tsuji A, Matsuda Y (2001) Proprotein convertase PACE4 is down-regulated by the basic helix-loop-helix transcription factor hASH-1 and MASH-1. Biochem J 360: 683-689
Zeisberg M, Hanai J, Sugimoto H, Mammoto T, Charytan D, Strutz F, Kalluri R (2003) BMP-7 counteracts TGF-β1-induced epithelial-to-mesenchymal transition and reverses chronic renal injury. Nat Med 9: 964-968
Zhang M, Park SM, Wang Y, Shah R, Liu N, Murmann AE, Wang CR, Peter ME, Ashton-Rickardt PG (2006) Serine protease inhibitor 6 protects cytotoxic T cells from self-infl icted injury by ensuring the integrity of cytotoxic granules. Immunity 24: 451-461
Zheng M, Seidah NG, Pintar JE (1997) The developmental expression in the rat CNS and peripheral tissues of proteases PC5 and PACE4 mRNAs: comparison with other proprotein processing enzymes. Dev Biol 181: 268-283
Zhong M, Benjannet S, Lazure C, Munzer S, Seidah NG (1996) Functional analysis of human PACE4-A and PACE4-C isoforms: identifi cation of a new PACE4-CS isoform. FEBS Lett 396: 31-36
Zhong M, Munzer JS, Basak A, Benjannet S, Mowla SJ, Decroly E, Chretien M, Seidah NG (1999) The prosegments of furin and PC7 as potent inhibitors of proprotein convertases. In vitro and ex vivo assessment of their effi cacy and selectivity. J Biol Chem 274: 33913-33920
Zhou A, Carrell RW (2008) Dimers initiate and propagate serine protease inhibitor polymerisation. J Mol Biol 375: 36-42
Zhou A, Paquet L, Mains RE (1995) Structural elements that direct specifi c processing of different mammalian subtilisin-like prohormone convertases. J Biol Chem 270: 21509-21516
Zhou Q, Snipas S, Orth K, Muzio M, Dixit VM, Salvesen GS (1997) Target protease specifi city of the viral serpin CrmA. Analysis of fi ve caspases. J Biol Chem 272: 7797-7800
Zhou Y, Lindberg I (1993) Purifi cation and characterization of the prohormone convertase PC1(PC3). J Biol Chem 268: 5615-5623
Zhou Z, Shen T, Zhang BH, Lv XY, Lin HY, Zhu C, Xue LQ, Wang H (2009) The proprotein convertase furin in human trophoblast: Possible role in promoting trophoblast cell migration and invasion. Placenta 30: 929-938
145
Zhu X, Rouille Y, Lamango NS, Steiner DF, Lindberg I (1996) Internal cleavage of the inhibitory 7B2 carboxyl-terminal peptide by PC2: a potential mechanism for its inactivation. Proc Natl Acad Sci USA 93: 4919-4924
Zhu X, Zhou A, Dey A, Norrbom C, Carroll R, Zhang C, Laurent V, Lindberg I, Ugleholdt R, Holst JJ, Steiner DF (2002) Disruption of PC1/3 expression in mice causes dwarfi sm and multiple neuroendocrine peptide processing defects. Proc Natl Acad Sci USA 99: 10293-10298
Zou Z, Anisowicz A, Hendrix MJ, Thor A, Neveu M, Sheng S, Rafi di K, Seftor E, Sager R (1994) Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells. Science 263: 526-529
146