3279RESEARCH ARTICLE

INTRODUCTIONIn eukaryotes, complex and specialized mechanisms have evolved

to achieve the union of male and female gametes at fertilization by

regulating attraction, signal exchange and recognition between the

gametes (Boavida et al., 2005; Dresselhaus, 2006; Hirohashi et al.,

2008; Hiscock and Allen, 2008; Kothe, 2008; Lord and Russell,

2002). In plants, the gametes are not produced directly from the

meiotic products as in animals, but rather from multicellular, haploid

gametophytes. Sperm cells of flowering plants are non-motile and

need to be delivered via the haploid male gametophyte (pollen)

(McCormick, 2004) to the female gametophytes (embryo sacs). The

latter are enclosed by the diploid tissues of the ovules that are

themselves deeply embedded in maternal tissues of the pistil. In

compatible interactions, the pollen grain germinates on the stigma

of the pistil producing a pollen tube (PT) that grows through the style

into the transmitting tissue, from where it emerges and is guided to

the micropylar opening of the ovule (Crawford and Yanofsky, 2008;

Dumas and Rogowsky, 2008). In the plant model Arabidopsis,

typically a single PT is guided to each ovule, enters the micropyle

and penetrates the female gametophyte. In Arabidopsis, the female

gametophyte is a seven-celled haploid structure that contains an egg

cell flanked by two synergid cells, a central cell and three antipodals

(Kägi and Gross-Hardt, 2007; Yadegari and Drews, 2004). The PT

penetrates one of the two synergid cells, where it terminates its

growth and ruptures to deliver the two sperm cells – processes

collectively referred to as PT reception (Weterings and Russell,

2004). Subsequently, double fertilization initiates seed development:

one of the sperm cells is transported to, and fuses with, the egg cell

to form the zygote, whereas the second sperm fertilizes the central

cell, thereby initiating endosperm development (Berger et al., 2008).

The precise guidance of the PT from the stigma to the female

gametophyte and successful PT reception followed by gamete

fusions require several complex interactions between the pollen and

the female tissues (Johnson and Lord, 2006). The identification of a

few sporophytic factors that provide guidance cues at early stages of

PT growth has been reported (e.g. Dong et al., 2005; Palanivelu et

al., 2003; Wolters-Arts et al., 1998). However, the signals produced

by the female gametophyte itself, which controls the late stages of

PT guidance, were unknown (Chen et al., 2007; Higashiyama et al.,

2001; Marton et al., 2005) until the recent identification of the

defensin-like LURE polypeptides, which serve as the synergid-

secreted PT attractants in Torenia fournieri (Okuda et al., 2009).

As the PT reaches the micropyle, several interactions between the

PT and the female gametophyte ensue. However, our knowledge

about the molecular and genetic mechanisms that mediate the

interactions between the gametophytes is very limited. In the female

gametophytic Arabidopsis mutants feronia (fer) and sirène (srn),

PTs reach the micropyle but do not arrest their growth and are

unable to rupture (PT overgrowth phenotype), demonstrating that

the female gametophyte controls PT reception (Huck et al., 2003;

Rotman et al., 2003). This indicates that successful PT reception

requires that female and male partners recognize each other (Huck

et al., 2003; Rotman et al., 2003). Interestingly, FER, which is allelic

to SRN, encodes a plasma membrane-localized, synergid-expressed

receptor-like kinase (Escobar-Restrepo et al., 2007). Receptor-like

serine-threonine kinases (RLKs) are transmembrane proteins that

typically receive signals through their extracellular domain and

subsequently activate signaling cascades via their intracellular

Disruption of the pollen-expressed FERONIA homologsANXUR1 and ANXUR2 triggers pollen tube dischargeAurélien Boisson-Dernier1,2,*, Sucharita Roy1, Konstantinos Kritsas1, Monica A. Grobei1, Miloslawa Jaciubek1,Julian I. Schroeder2 and Ueli Grossniklaus1,*

The precise delivery of male to female gametes during reproduction in eukaryotes requires complex signal exchanges and a flawlesscommunication between male and female tissues. In angiosperms, molecular mechanisms have recently been revealed that arecrucial for the dialog between male (pollen tube) and female gametophytes required for successful sperm delivery. When pollentubes reach the female gametophyte, they arrest growth, burst and discharge their sperm cells. These processes are under thecontrol of the female gametophyte via the receptor-like serine-threonine kinase (RLK) FERONIA (FER). However, the male signalingcomponents that control the sperm delivery remain elusive. Here, we show that ANXUR1 and ANXUR2 (ANX1, ANX2), whichencode the closest homologs of the FER-RLK in Arabidopsis, are preferentially expressed in pollen. Moreover, ANX1-YFP and ANX2-YFP fusion proteins display polar localization to the plasma membrane at the tip of the pollen tube. Finally, genetic analysesdemonstrate that ANX1 and ANX2 function redundantly to control the timing of pollen tube discharge as anx1 anx2 double-mutant pollen tubes cease their growth and burst in vitro and fail to reach the female gametophytes in vivo. We propose that ANX-RLKs constitutively inhibit pollen tube rupture and sperm discharge at the tip of growing pollen tubes to sustain their growthwithin maternal tissues until they reach the female gametophytes. Upon arrival, the female FER-dependent signaling cascade isactivated to mediate pollen tube reception and fertilization, while male ANX-dependent signaling is deactivated, enabling thepollen tube to rupture and deliver its sperm cells to effect fertilization.

KEY WORDS: Gametophyte, Pollen tube, Receptor-like kinase, CrRLK1L, Arabidopsis, Fertilization, Pollination, FERONIA, ANXUR, Discharge

Development 136, 3279-3288 (2009) doi:10.1242/dev.040071

1Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich,Zollikerstrasse 107, 8008 Zürich, Switzerland. 2Division of Biological Sciences,Cell and Developmental Biology Section, and Center for Molecular Genetics,University of California San Diego, La Jolla, CA 92093, USA.

*Authors for correspondence (aboisson@access.uzh.ch; grossnik@botinst.uzh.ch)

Accepted 31 July 2009 DEVELO

PMENT

3280

kinase domain (Morillo and Tax, 2006). RLKs are one of the biggest

gene families in plants, with more than 600 members in Arabidopsis(Shiu et al., 2004). FER belongs to the previously uncharacterized

CrRLK1L subfamily, with 17 members in Arabidopsis (Hematy and

Höfte, 2008). Another CrRLK1L subfamily member, THESEUS1

(THE1), has been reported to work as a putative cell wall integrity

sensor, inhibiting cell elongation in hypocotyls lacking cellulose

synthase (Hematy et al., 2007). More recently, FER, THE1 and the

new CrRLK1L subfamily member HERCULES1 (HERK1) have all

been shown to promote cell elongation in leaves and leaf petioles

(Guo et al., 2009). In light of these new findings, a model for the

male-female gametophyte dialog at PT reception has emerged: in

the female gametophyte, FER is able to sense either a ligand

produced by the PT or a ligand resulting from the modification of

the cell wall of either the synergid or PT upon contact, thus

triggering a signaling cascade enabling the female gametophyte to

prepare itself for fertilization; in return, the female gametophyte is

thought to signal back to the PT to arrest its growth, rupture and

deliver the sperm cells (Escobar-Restrepo et al., 2007; McCormick,

2007).

Since the first report of the fer/srn mutants, two other female

gametophytic Arabidopsis mutants that specifically disrupt PT

reception have been characterized, namely lorelei, which affects

a putative glucosylphosphatidylinositol-anchored protein (GAP)

(Capron et al., 2008), and scylla, for which the corresponding

gene has not yet been identified (Rotman et al., 2008). Besides

these three strictly female gametophytic mutants, the peroxin loss-

of-function mutant abstinence by mutual consent (amc) displays

a similar PT overgrowth phenotype, but only when a mutant PT

interacts with a mutant female gametophyte, suggesting that the

male-female communication required for PT reception relies on

some components of identical nature in both gametophytes

(Boisson-Dernier et al., 2008). Although a male signaling

pathway controlling PT reception is expected to exist, to date no

component acting strictly in the male gametophyte has been

identified.

Here, we report that ANXUR1 and ANXUR2, the pollen-

expressed homologs most closely related to FER, display a polar

localization at the plasma membrane of the PT tip, and function

redundantly to maintain PT integrity during growth, most likely by

regulating the timing of PT discharge. Thus, our study provides the

first genetic evidence of a male counterpart to FER, as a signaling

process that functions in the male gametophyte to potentially control

sperm cell discharge and delivery.

MATERIALS AND METHODSPlant material, growth conditions and mutant genotypingPrimers used in this study are listed in Table 1. The binary vectors

constructed and described below were introduced into Agrobacteriumtumefaciens strain GV3101 by electroporation, which was then used to

transform the wild type by floral dipping (Clough and Bent, 1998).

Arabidopsis thaliana plants (accession Columbia-0) were grown in a

Conviron growth chamber (Controlled Environments, Winnipeg, Canada)

or in a growth room in plastic pots filled with ready-to-use soil (Professional

Blend, Sunshine, Canada, or ED73 Universal Erde, Germany). After

sowing, pots were kept at 4°C for 2-3 days. Growing conditions were 22°C,

60% humidity with a 16-hour light/8-hour dark photoperiod regime at ~75

μmol m–2 s–1.

anx1-1 and anx1-2 mutants of the ANX1 gene (At3g04690), as well as

anx2-1 and anx2-2 mutants of the ANX2 gene (At5g28680), were obtained

from the Arabidopsis Biological Resource Center (ABRC) and correspond

to the SALK_016179 (1398 bp downstream of ATG), SALK_045687 (2145

bp downstream of ATG), SALK_127359 (570 bp upstream of ATG) and

SALK_133057 (1833 downstream of ATG) lines, respectively. Genotyping

PCR reactions for anx1-1 and anx1-2 were performed with primer pairs

1F1/1R1, 1F1/LBa1, 1F2/1R2 and 1F2/LBa1. For anx2-1 and anx2-2genotyping, primer pairs 2F1/2R1, 2F1/LBa1, 2F2/2R2 and 2F2/LBa1 were

used.

In vitro pollen growth assays and Aniline Blue stainingAll in vitro pollen growth assays were performed as described (Boavida and

McCormick, 2007). Flowers were incubated at 22°C for 30 minutes in

moisture incubation boxes, then brushed onto slides containing germination

medium [0.01% boric acid (w/v), 5 mM CaCl2, 5 mM KCl, 1 mM MgSO4,

10% sucrose, pH 7.5, 1.5% low-melting point agarose]. Slides in moisture

incubation boxes were pre-incubated for 30-45 minutes at 30°C before

returning them to 22°C for 30 minutes to several hours. Plasmolysis was

induced by incubating growing pollen tubes with 40% sucrose-containing

liquid germination medium for 20 minutes prior to observation. Pollen

grains and tubes were imaged with a Leica DM6000 digital microscope

using Leica Application Suite Advanced Fluorescence software (Leica

Microsystems, Mannheim, Germany). Pollen germination counts and tube

length measurements were performed manually using ImageJ 1.40g

software (http://rsb.info.nih.gov/ij).

Aniline Blue staining was performed as described (Huck et al., 2003).

Minimal pollination experiments were performed using an eyelash to deposit

4-16 pollen grains on the stigma of receiving pistils.

RT-PCR analysesRT-PCR analyses were performed as described (Boisson-Dernier et al.,

2008). Primer pairs used for ACTIN7 (At5g09810), ANX1 (At3g04690),

ANX2 (At5g28680) and FER (At3g51550) were ACT7-F/ACT7-R,

1F1/1R1, 2F2/2R2 and FER-RTF/FER-RTR.

Transient fusion protein expression in Nicotiana benthamianaTo generate the p35S-ANX1-YFP and p35S-ANX2-YFP constructs, full-

length ANX1 and ANX2 DNA sequences were amplified from BACs F7O18

and F4I4 (ABRC) with the primer pairs 1-BPs/1-BPas and 2-BPs/2-BPas,

respectively. These fragments were cloned into pDNR221 (Invitrogen),

sequenced and then recombined into the binary pXCSG-YFP (Feys et al.,

2005). The pXCSG-YFP vector containing the plasma membrane-targeted

FLS2-YFP fusion (Robatzek et al., 2006), and the pH35YG vector (Kubo et

al., 2005) containing the 35S-YFP, were used as positive controls for

membrane localization and cytosol-nuclear localizations, respectively.

RESEARCH ARTICLE Development 136 (19)

Table 1. Oligonucleotides used in this studyName Sequence (5�-3�)

ACT7-F GGCCGATGGTGAGGATATTCAGCCACTTGACT7-R TCGATGGACCTGACTCATCGTACTCACTCFER-RTF ATCGCTTAGGGTTTCTTCCCFER-RTR GACATCGGAGATCCATATACGG1F1 CATCAATAACAGAACAGCGCAGGC1R1 GCTCACGGAGTGTTCCAAATGCCATG1F2 CACAAAACTTCGATGATTCCAACGTC1R2 TTCGTTTGCAATTCATTGCCC2F1 TTCTTAGTTTAGATTCTTGACCCCC2R1 GGGATCTCATACGTTGCTGGAGC2F2 AAACGTAATCGGAGTAGGAGGG2R2 CACAACGGTTGTGACATGACCACC1-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAAT-

GAGCGGGAAAACTCGG1-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCG-

TCCTTTGGGATTTAC2-BPs GGGGACAAGTTTGTACAAAAAAGCAGGCTTAA-

TGAACGAGAAACTCCGG2-BPas GGGGACCACTTTGTACAAGAAAGCTGGGTATCG-

TCCTTTAGGGTTTAC1-SalI GTCGACATGAGCGGGAAAACTCGGAT1-SpeI TGCGAAAACTAGTCCTCGTCCTTTGGG2-SalI GTCGACATGAACGAGAAACTCCGGA2-SpeI TACGAAAACTAGTCCTCGTCCTTTAGGG D

EVELO

PMENT

Tobacco leaf infiltration was performed as described (Walter et al., 2004).

Fluorescence images were acquired by spinning-disc confocal microscopy

as described (Boisson-Dernier et al., 2008)

Stable fusion protein expression in Arabidopsis pollen tubesTo generate the pACA9-ANX1-YFP and pACA9-ANX2-YFP constructs,

full-length ANX1 and ANX2 DNA sequences were amplified with the primer

pairs 1-SalI/1-SpeI and 2-SalI/2-SpeI, respectively. Fragments were ligated

into pGEM-T Easy (Promega, Madison, WI, USA), sequenced and then

cloned into the SalI/SpeI-cut binary ps779 [ACA9-promoter-TAP2(YFP)]

(Myers et al., 2009) vector that confers hygromycin resistance. Fourteen

(pACA9-ANX1-YFP) and six (pACA9-ANX2-YFP) independent T1

transgenic lines were selected for their strong expression, and all exhibited

a similar expression pattern. After 5 hours of growth in vitro, growing pollen

tubes were imaged as described above.

RESULTSANXUR1 and ANXUR2 display an expressionpattern complementary to that of FERONIAFER is highly expressed in the synergids of the female gametophyte

and in a variety of vegetative tissues, but not in the male

gametophyte (Escobar-Restrepo et al., 2007; Guo et al., 2009).

According to publicly available ATH1 microarray data from various

organs (Zimmermann et al., 2004) and pollen transcriptome studies

(Becker et al., 2003; Honys and Twell, 2004; Pina et al., 2005), the

two closest homologs of FER in Arabidopsis, At3g04690 and

At5g28680 (Hematy and Höfte, 2008) (see Fig. S1A in the

supplementary material), appear to be predominantly expressed in

the male gametophyte (Fig. 1A), but not in the sperm cells (Borges

et al., 2008). The strong and preferential expression of these two

FER homologs in pollen was confirmed by RT-PCR analysis (Fig.

1B). Based on their complementary expression pattern, At3g04690and At5g28680 were renamed ANXUR1 (ANX1) and ANXUR2(ANX2), respectively, after the male consort of the goddess Feronia

in ancient Italy (Funke, 1801). Consistent with this, ANX1 and

ANX2 proteins were both identified in the pollen proteome (Grobei

et al., 2009).

ANXUR1 and ANXUR2 display polar localization atthe plasma membrane of the pollen tube tipAll the CrRLK1L members are predicted to have transmembrane

domains (Hematy and Höfte, 2008). THE1 and HERK1 are

localized uniformly to the plasma membrane of hypocotyl

epidermal cells (Hematy et al., 2007; Guo et al., 2009), whereas

FER displays a uniform plasma membrane localization pattern in

leaf epidermis, but a polar localization within the synergids towards

the filiform apparatus (Escobar-Restrepo et al., 2007). We first

transiently expressed the ANX1-YFP (yellow fluorescent protein)

and ANX2-YFP fusion proteins in tobacco epidermal cells under

the control of the constitutive 35S promoter. Consistent with plasma

membrane localization, ANX1-YFP and ANX2-YFP displayed the

same fluorescence pattern at the cell periphery, similar to that of a

membrane-bound flagellin receptor FLS2-YFP fusion protein

(Robatzek et al., 2006) (see Fig. S1B in the supplementary

material).

Next, we investigated the subcellular localization of ANX-RLKs

in pollen, in which they are expected to function, by stably

transforming Arabidopsis with ANX1-YFP and ANX2-YFP driven

by the strong pollen-specific ACA9 promoter (Schiott et al., 2004).

The ANX1-YFP and ANX2-YFP expression patterns were analyzed

in the growing PTs (as evidenced by time-lapse imaging) of fourteen

and six T1 transgenic lines with good expression, respectively.

These lines did not exhibit any obvious fertilization-related

phenotypes that might otherwise confound our analyses. As

controls, we used transgenic Arabidopsis lines expressing ACA9-

YFP and GFP-CNGC18 in PTs. ACA9-YFP and GFP-CNGC18

have been reported to display a uniform and a polar plasma

membrane localization at the tip of growing PTs, respectively

(Frietsch et al., 2007; Schiott et al., 2004). In contrast to the uniform

plasma membrane expression pattern of the ACA9-YFP fusion

protein, but similar to GFP-CNGC18 expression, PTs expressing

ANX1-YFP and ANX2-YFP exhibited the most intense

fluorescence signal at the cell periphery of the tips (Fig. 2). The

enrichment in the membrane at the tip, but not in the shank, of PTs

for ANX1-YFP, ANX2-YFP and GFP-CNGC18 was also evidenced

by analysis of fluorescence intensity across the growing PT shanks

and tips (Fig. 2). Moreover, PT plasmolysis confirmed localization

of ACA9-YFP, ANX1-YFP and ANX2-YFP at the plasma

membrane (see Fig. S2A in the supplementary material). After

plasmolysis, a weak residual fluorescence signal was consistently

observed close to the cell wall for PTs expressing ANX1-YFP and

ANX2-YFP but not ACA9-YFP (see Fig. S2A in the supplementary

material). In germinating pollen grains, polar localization of the

ANX1-YFP and ANX2-YFP fusion proteins was also observed in

the freshly emerged tip, but did not appear to precede the appearance

of the first bulge (see Fig. S2B in the supplementary material).

Moreover, fluorescence of ANX-YFP fusion proteins was associated

with very dynamic small vesicles (see Movies 1 and 2 in the

supplementary material), consistent with possible exocytosis at the

3281RESEARCH ARTICLEANXUR-RLKs inhibit pollen tube discharge

Fig. 1. ANXUR1 and ANXUR2 are preferentially expressed inArabidopsis pollen. (A) Microarray data for ANXUR1 (At3g04690,ANX1) and ANXUR2 (At5g28680, ANX2) in different organs as retrievedfrom GENEVESTIGATOR (Zimmermann et al., 2004) (downloaded May2009). ANX1 and ANX2 transcripts were detected in every tissue thatcontained pollen. The inset shows microarray data retrieved from Honysand Twell (Honys and Twell, 2004) that illustrates a steady increase inANX1 and ANX2 transcript levels during the course of pollendevelopment. UNM, uninucleate microspores; BCP, bicellular pollen; TCP,immature tricellular pollen; MPG, mature pollen grain; AU, arbitrary units.(B) RT-PCR analysis of ANX1, ANX2 and FER transcripts from cDNAs ofdifferent Arabidopsis tissues indicates that ANX1 and ANX2 are stronglyand preferentially expressed in the male gametophyte, whereas FERexhibits the opposite expression pattern. ACTIN7 (ACT7) was used as acontrol. Amplification was performed for 26 cycles for both ACT7 andFER and for 32 cycles for ANX1 and ANX2.

DEVELO

PMENT

3282

tip subapical region and endocytosis at the apex (Zonia and Munnik,

2009). In dead PTs, in which growth and cytoplasmic streaming had

stopped, the polar distribution of ANX-YFP fusion proteins towards

the tip was completely abolished (see Fig. S2C in the supplementary

material). In conclusion, ANX1-YFP and ANX2-YFP fusion

proteins display an active polar localization at the plasma membrane

of the growing PT tip.

Single T-DNA insertional mutants of ANXUR1 andANXUR2 do not exhibit any phenotypeTo further elucidate the role of the ANX-RLKs, we isolated two single

T-DNA insertional mutants for each of the ANX-RLKs, namely anx1-1 and anx1-2 for ANX1 and anx2-1 and anx2-2 for ANX2 (Fig. 3A),

from the Salk Institute Genomic Analysis Laboratory Database

(SIGnAL; La Jolla, CA, USA) (Alonso et al., 2003). RT-PCR analysis

from open-flower cDNAs indicated that for each of the anx1 and anx2alleles, the T-DNA insertions disrupted ANX-RLK gene expression

(Fig. 3B). We anticipated that ANX1 and ANX2 would function

redundantly in pollen because (1) ANX1 and ANX2 share 85.6%

identity at the amino acid level and define a subgroup of the CrRLK1L

subfamily (Hematy and Höfte, 2008); (2) the ANX1-YFP and ANX2-

YFP fusion proteins show overlapping localization patterns; and (3)

the ANX-RLK genes are highly and preferentially expressed in

pollen. Indeed, despite the lack of ANX-RLK gene expression, none

of the four single T-DNA insertion mutants displayed any obvious

phenotype in vegetative or reproductive tissues, seed set, or in PT

growth assays in vitro and in vivo (see below).

anx1 anx2 double mutants exhibit segregationratio distortion and are male gametophytespecificBy crossing the single anx1 and anx2 mutants, we attempted to

generate two independent anx1-1 anx2-1 and anx1-2 anx2-2 double

mutants, as well as the semi-independent anx1-1 anx2-2 double

mutant. However, after genotyping 175 progeny of the F1 crosses,

no double-homozygous mutants could be identified. Therefore, we

decided to first isolate plants homozygous for one anx mutation and

heterozygous for the second. Interestingly, all these plants, namely

anx1-1/anx1-1 anx2-1/ANX2, anx1-1/ANX1 anx2-2/anx2-2 and

anx1-2/anx1-2 anx2-2/ANX2, exhibited a moderately reduced seed

set compared with the wild type (see Table S1 in the supplementary

material). Furthermore, upon self-fertilization, these plants

displayed a segregation ratio of the anx1 anx2 mutants to wild type

of ~1:1 (Table 2) (χ2=1.073, 0.3>P>0.2), indicative of a

gametophytic defect (Howden et al., 1998; Moore et al., 1997). To

determine the transmission efficiency (TE) of the anx1 anx2mutations, we performed reciprocal crosses of the independent

anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2mutants to the wild type. Although transmission through the female

gametophyte was not significantly affected (Table 3) (TEF=78% for

anx1-1 anx2-1, χ2=1.11, 0.3>P>0.2; TEF=86% for anx1-2 anx2-2,

χ2=0.45, 0.7>P>0.5), we did not observe transmission of the anx1-1 anx2-1 (n=99) and anx1-2 anx2-2 (n=90) mutations through the

male gametophyte (Table 3), demonstrating that anx1 anx2 double

mutants are specific to the male gametophyte.

RESEARCH ARTICLE Development 136 (19)

Table 2. Segregation analysis of anx mutations by PCR-based genotyping of the progeny derived from self-fertilizationanx1/anx1 ANX2/ANX2 or anx1/anx1 anx2/ANX2 or

Genotype ANX1/ANX1 anx2/anx2 anx1/ANX1 anx2/anx2 anx1/anx1 anx2/anx2 Ratio of anx1 anx2:WT

anx1-1/anx1-1 anx2-1/ANX2 60 39 0 0.65:1anx1-1/ANX1 anx2-2/anx2-2 39 33 0 0.85:1anx1-2/anx1-2 anx2-2/ANX2 62 70 1 1.13:1

WT, wild type.nd, not determined.

Fig. 2. ANX1-YFP and ANX2-YFP fusion proteins localize polarly to the plasma membrane of growing pollen tube tips. Fluorescencemicrographs of actively growing pollen tubes (PTs) of Arabidopsis transgenic lines expressing YFP, ACA9-YFP, GFP-CNGC18, ANX1-YFP and ANX2-YFP constructs under the control of the pollen-specific ACA9 promoter. Unlike the uniform plasma membrane localization of ACA9-YFP along thePT, ANX1-YFP and ANX2-YFP fusions display polar plasma membrane localization at the tip of growing PTs, similar to GFP-CNGC18. Arrowheadspoint to fluorescence enrichment at the plasma membrane. Fluorescence intensity in arbitrary units (AU) across the PT shank (10μm-long blue lines)or across the PT tip (10μm-long purple lines), as provided below each PT, shows a similar fluorescence distribution for GFP-CNGC18, ANX1-YFP andANX2-YFP. Scale bar: 5μm.

DEVELO

PMENT

As shown in Table 2, one double-homozygous anx1-2 anx2-2mutant plant was recovered from the progeny of a self-fertilized

anx1-2/anx1-2 anx2-2/ANX2 plant. Although no difference was

observed in the vegetative tissues of anx1-2 anx2-2 compared with

the wild type, anx1-2 anx2-2 was almost completely sterile,

producing only 11 seeds from 277 siliques (Fig. 3C). However,

unlike male-sterile dde2-2 mutant flowers, which display a defect in

filament elongation and anther dehiscence (von Malek et al., 2002),

anx1-2 anx2-2 flowers were normal, with obvious signs of

dehiscence and self-pollination (Fig. 3D). When wild-type pollen

was deposited on anx1-2 anx2-2 pistils, siliques elongated (Fig. 3C,

arrows) (n=14 crosses) and were filled normally (see Table S1 in the

supplementary material), consistent with anx1 anx2 mutations not

affecting the female gametophyte. Conversely, deposition of anx1-2 anx2-2 pollen on dde2-2 pistils did not produce any seeds, whereas

pollen from anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 plants led to silique elongation and a normal seed set (see

Fig. S3 and Table S1 in the supplementary material) (n=12 crosses

for each genotype). When anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 plants were manually self-pollinated or used

either as male donor or female receiver in crosses with the wild type,

the resulting siliques were always filled normally (see Table S1 in

the supplementary material). This suggests that during natural self-

pollination of these plants (~80% seed set), single anx mutant pollen

can only partially compensate for the inability of anx double-mutant

pollen to reach female gametophytes (see below), whereas the large

excess of pollen present during manual pollination leads to full

compensation (~92% seed set).

In conclusion, our data provide compelling genetic evidence that

the anx1 anx2 double mutant is male sterile, with very rare

transmission of the anx1 anx2 mutation through the male

gametophyte. Thus, ANX1 and ANX2 function redundantly in the

male gametophyte.

Spontaneous discharge of anx1 anx2 pollen tubesin vitroTo investigate the reason for the transmission failure of anx1 anx2mutations through the male gametophyte, we first carried out in vitro

PT growth assays for the different single and double anx mutants and

visualized pollen growth 5 hours after incubation. Surprisingly, unlike

the wild type and single anx mutants, approximately half of the

germinated pollen from anx1-1/anx1-1 anx2-1/ANX2 and anx1-

2/anx1-2 anx2-2/ANX2 plants had burst in vitro after forming a bulge,

whereas the other half formed normally growing PTs (Fig. 4A; Table

4). Germinated pollen from the two independent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant alleles was either

able to produce normal PTs or to burst in the 1:1 ratio expected for

segregation of the anx1 anx2 mutations (Table 4) (for anx1-1/anx1-1anx2-1/ANX2, χ2=0.03, 0.9>P>0.8; for anx1-2/anx1-2 anx2-2/ANX2,

χ2=0.018, 0.95>P>0.9). Consistently, all the germinated pollen from

the double-homozygous anx1-2 anx2-2 plants burst to leave traces of

cytoplasmic and membrane contents outside the pollen (Fig. 4A;

Table 4). Time-lapse imaging of pollen grown in vitro indicated that

discharge of the anx1 anx2 mutant pollen started after 1 hour of

incubation on germination medium and occurred within 1 second

(Fig. 4B; see Movie 3 and Fig. S4A in the supplementary material).

The frequency of pollen discharge gradually increased from 0%

initially (n=198) to 39.1% at 2 hours (n=289), 59.9% at 3 hours

(n=142), 73% at 4 hours (n=100), and eventually reached 93.2% at 8

hours of in vitro incubation (n=192). Closer examination of the anx1anx2 mutant pollen 3 hours after incubation indicated that 59.8% of

the grains that had burst had formed a bulge (between 2 and 5 μm in

length), 13.8% an emerging tip (between 5 and 10 μm) and 3.4% a

clear PT longer than 10 μm (see Fig. S4B in the supplementary

material) before discharging (n=174). We could not discriminate

between the absence of a bulge and bulge formation behind the grain

(and therefore not visible) in the remaining 23% of the pollen grains

that had burst. When an emerging tip or PT was formed, first the tube

ceased its growth, then the discharge occurred in the subapical region

of the tip, rather than at the apex itself (Fig. 4B; see Movie 3 in the

supplementary material). Astonishingly, pollen discharge did not

always result in immediate death of the pollen, as evidenced by

residual cytoplasmic streaming that could last for several hours and,

occasionally, pollen could discharge several times (see Fig. S4A and

Movie 4 in the supplementary material). These results provide strong

evidence that disruption of ANX1 and ANX2 triggers spontaneous

discharge of the germinating pollen in vitro.

anx1 anx2 pollen germinates normally in vivo onstigmas but fails to reach the femalegametophytesTo corroborate the in vitro defect of anx1 anx2 pollen, an in vivo

analysis of PT growth was carried out using Aniline Blue staining.

First, pollination experiments with a limited amount of pollen were

3283RESEARCH ARTICLEANXUR-RLKs inhibit pollen tube discharge

Table 3. Segregation analysis of anx mutations by PCR-based genotyping of the progeny resulting from reciprocal crosses withthe wild type (Col-0)Female � male anx1/ANX1 ANX2/ANX2 (a) anx1/ANX1 anx2/ANX2 (b) TE (%)

anx1-1/anx1-1 anx2-1/ANX2 � Col-0 41 32 78anx1-2/anx1-2 anx2-2/ANX2 � Col-0 43 37 86Col-0 � anx1-1/anx1-1 anx2-1/ANX2 99 0 0Col-0 � anx1-2/anx1-2 anx2-2/ANX2 90 0 0

TE, transmission efficiency: TE=(b/a)�100%.

Table 4. Segregation analysis of spontaneous pollen tube discharge after 5 hours of growth in vitroTotal pollen Non-germinated % Pollen

Genotype Intact PTs PT discharge germinated pollen germination % PT discharge

Col-0 583 8 591 248 70.8 1.4anx1-1/anx1-1 249 4 253 61 80.6 1.6anx2-1/anx2-1 221 6 227 81 73.7 2.6anx1-1/anx1-1 anx2-1/ANX2 243 246 489 174 73.8 50.3anx1-2/anx1-2 anx2-2/ANX2 245 249 494 186 72.6 50.4anx1-2/anx1-2 anx2-2/anx2-2 0 561 561 106 84.1 100 D

EVELO

PMENT

3284

performed, with ~4-16 anx1-1/anx1-1, anx2-1/anx2-1, anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant pollen

grains deposited on wild-type pistils. Eighteen hours after

pollination, pistils were stained with Aniline Blue to reveal callose

deposition in the PTs. First, no difference was observed for the

pollen germination rate on the stigma between single and double

segregating anx mutants (Table 5; Fig. 5A), indicating that anx1anx2 pollen grains are able to germinate and produce PTs in vivo.

Secondly, we attempted to visually locate the tip of each PT in order

to assign it to either of two classes: (1) wandering in the transmitting

tract or (2) targeting an ovule. When pollen grains from single anxmutants were used, tips could be clearly identified for ~86% of the

growing PTs (Table 5; Fig. 5A, left panel). By contrast, tips could be

located for only ~47% of anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant PTs (Table 5; Fig. 5A, right panel).

These results suggest that anx1 anx2 mutant PTs are unable to reach

the locules of the ovary.

To confirm this, normal pollination of wild-type pistils by pollen

of either wild-type (n=12 pistils) or double-homozygous anx1-2anx2-2 (n=12 pistils) plants was performed. Eighteen hours after

RESEARCH ARTICLE Development 136 (19)

Fig. 3. Double-homozygous anx1-2 anx2-2 mutant plants are malesterile. (A) The genomic organization of the intron-less ANX1 and ANX2genes and positions of the anx1-1, anx1-2, anx2-1 and anx2-2 T-DNAinsertions. The orientation of the left border sequence of the respective T-DNAs is represented by black arrows. The positions of the primers used togenotype the mutants are indicated. (B) RT-PCR analysis from open-flowercDNAs shows no ANX1 transcripts in the ANX1 T-DNA disruption linesanx1-1 and anx1-2 and no ANX2 transcripts in the ANX2 T-DNAdisruption lines anx2-1 and anx2-2. ACT7 was used as a control.Amplification was performed for 28 cycles for ACT7 and for 34 cycles forANX1 and ANX2. (C) The double-homozygous anx1-2 anx2-2 mutantplant shows normal vegetative development, but only short pistils wereobserved that never developed further into siliques. This phenotype wascompletely reversible when wild-type pollen was used to pollinate anx1-2anx2-2 pistils (white arrows). Conversely, when pollen from anx1-2 anx2-2 plants was deposited on dde2-2 pistils, no siliques or seeds developed(see Fig. S3 in the supplementary material). (D) Unlike male-sterile dde2-2mutant flowers, the filaments and anthers of which fail to elongate andrelease pollen, anx1-2 anx2-2 flowers were normal, anthers dehisced,and pistils were efficiently self-pollinated (black arrow). Scale bar: 1 mm.

Fig. 4. In vitro pollen growth assays reveal that anx1 anx2mutant pollen tubes discharge spontaneously. (A) (Top row) Fivehours after incubation in vitro, wild-type pollen germinated very welland produced actively growing PTs. By contrast, anx1-2/anx1-2 anx2-2/anx2-2 mutant pollen grew very poorly, and segregating anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant pollenexhibited an intermediate pollen growth phenotype. (Bottom row)Higher magnification reveals that all the germinated anx1-2/anx1-2anx2-2/anx2-2 mutant pollen had burst. Germinated pollen fromindependent anx1-1/anx1-1 anx2-1/ANX2 and anx1-2/anx1-2 anx2-2/ANX2 mutant alleles either produced actively growing PTs or burst,phenotypes that were observed in a 1:1 ratio as expected forsegregation of anx1 anx2 pollen grains. Pollen donor genotype isindicated at the top. (B) Time-lapse imaging of anx1-2 anx2-2 mutantpollen in vitro showed that pollen discharge is an explosivephenomenon that occurs in less than 1 second after formation of eitherbulges or an emerging tip, or more rarely a real PT (see also Fig. S4 andMovie 3 in the supplementary material). Note that the PT stoppedelongating. White arrows indicate the location of the discharge at thesubapical region of the PT tip, rather than at the tip itself. Time isindicated in minutes:seconds. Scale bars: 50μm in top row in A; 25μmin bottom row in A; 5μm in B.

DEVELO

PMENT

pollination, wild-type PTs had grown through the entire style and

transmitting tract of all pistils and were targeting the ovules normally

(Fig. 5B, left panel). By contrast, the majority of anx1-2 anx2-2 PTs

were arrested between the stigma and the style or in the style itself,

with a few exceptional PTs (n=12 out of more than 500) that reached

the top of the ovary locule (Fig. 5B, right panel). However, within

the twelve pollinated pistils, not a single female gametophyte was

targeted by anx1-2 anx2-2 PTs, consistent with the fact that the

anx1-2 anx2-2 plant produced only 11 seeds. In conclusion, our

results strongly suggest that anx1 anx2 mutant pollen grains are able

to germinate and produce PTs that will eventually burst in the style,

long before reaching and fertilizing the female gametophytes.

DISCUSSIONANX1 and ANX2 receptor-like kinases are requiredfor maintenance of pollen tube growthOur analyses have shown that ANX1 and ANX2 play a role in PT

discharge, but they are not required for pollen germination, as in

vitro no fewer than 77% of the anx1 anx2 double-mutant pollen at

least formed a bulge prior to bursting. Consistent with this, anx1anx2 double-mutant pollen grains germinate normally on the

stigmatic cells in vivo. However, in vitro, as soon as they have

established polar tip growth, the pollen bulges, tips or tubes rapidly

and systematically explode, such that PTs longer than 10 μm are an

exception. These results indicate that ANX-RLKs are required for

the maintenance of PT growth in vitro. In vivo, anx1 anx2 PTs can

grow over a longer distance (>60 μm), as they generally grow

through the entire stigma, arresting in the style. This observation

illustrates the beneficial effect of the female sporophytic tissues on

PT growth during compatible interactions (Crawford and Yanofsky,

2008; Higashiyama et al., 1998; Johnson and Lord, 2006; Palanivelu

and Preuss, 2006). However, in the in vivo analyses, anx1 anx2 PTs

very rarely reached the locules of the ovary (n=12 out of more than

500) and none of these PTs targeted a female gametophyte.

Consistent with this, the double-homozygous anx1-2 anx2-2 mutant

plant produced only 11 seeds out of 277 siliques analyzed. In

segregating anx double mutant plants, single anx mutant PTs can

compensate for the inability of double anx mutant PTs to reach the

female gametophytes (see Table S1 in the supplementary material).

To date, only the Arabidopsis vanguard1 (vgd1) mutant has been

reported to exhibit a phenotype similar to that triggered by the

disruption of the ANX-RLKs, although the defects appear milder

(Jiang et al., 2005). In vivo, vgd1 mutant PTs germinate normally and

arrest only in the transmitting tract. However, vgd1 PTs more easily

and frequently reach the ovary locules and female gametophytes than

anx1 anx2 PTs. Consequently, each silique of homozygous vgd1mutant plants produces a few seeds (Jiang et al., 2005). Although less

well documented, vgd1 mutant pollen has also been reported to

germinate and burst in vitro (Jiang et al., 2005). Interestingly, VGD1is strongly expressed in pollen and encodes a wall-localized pectin

methylesterase (PME; E.C. 3.1.1.11) (Jiang et al., 2005). PMEs

catalyze the specific demethylesterification of the linear homopolymer

(1,4)-linked-α-D-galacturonic acid homogalaturonan (HGA), a major

pectic constituent of the cell wall (Micheli, 2001; Pelloux et al., 2007;

Willats et al., 2001). HGA is deposited in a highly methyl-esterified

form in the cell wall and is subsequently demethylesterified in muro

by PMEs, the activities of which are regulated by PME inhibitor

(PMEI) proteins (Juge, 2006). The degree of esterification of pectins

is essential for cell wall mechanics, as unesterified pectins are able to

bind Ca2+ and induce pectin gelation, which rigidifies the cell wall

(Willats et al., 2001). Consistent with this, the PME multigene family

functions in a wide range of organs, tissues and processes related to

plant defense and cell elongation (Pelloux et al., 2007). Besides

VGD1, the involvement of PMEs and PMEIs in PT growth is well

documented (for reviews, see Chebli and Geitmann, 2007; Cheung

and Wu, 2008; Krichevsky et al., 2007; Zonia and Munnik, 2009).

Indeed, pectins are the major, polarly distributed constituent of the PT

cell wall (Li et al., 1994). At the tip of the PT, where expansibility is

required for polarized tip growth and where pectins are secreted, the

methyl-esterified pectic ‘loose’ forms are predominant, whereas in the

lateral regions of the tube wall that need to be more resistant, esterified

3285RESEARCH ARTICLEANXUR-RLKs inhibit pollen tube discharge

Fig. 5. anx1 anx2 pollen germinate normally on stigma butproduce pollen tubes that fail to reach the female gametophytes.(A) Aniline Blue staining of wild-type pistils pollinated with a few anx2-1single-mutant (left) or anx1-1/anx1-1 anx2-1/ANX2 double-mutant (right)pollen grains. Eighteen hours after pollination, most of the tips of anx2-1PTs (left) were observed in the ovary locules (rectangle). By contrast, onlyabout half of the tips of germinated (arrows) anx1-1/anx1-1 anx2-1/ANX2 PTs (arrowheads) were found in the ovary locules. (B) Aniline Bluestaining of wild-type pistils pollinated with numerous wild-type (left) oranx1-2 anx2-2 double-homozygous mutant (right) pollen grains.Eighteen hours after manual pollination, wild-type PTs (left) had grownthrough the entire pistil to reach the micropyles of the ovules (asterisks).Although they germinated on the stigma, most of the anx1-2 anx2-2mutant PTs (right) were arrested in the style, with only very few havingreached the top end of the ovary (arrows). The boxed regions are shownat high magnification below and reveal the very low density of anx1-2anx2-2 PTs (right) in the transition zone between the style and the ovarylocules in comparison to wild-type PTs (left). Scale bars: 100μm in A andin top row in B; 25μm in bottom row in B.

DEVELO

PMENT

3286

‘rigid’ pectins are prevalent (Bosch and Hepler, 2005; Bosh et al.,

2005; Li et al., 1994; Parre and Geitmann, 2005). Interestingly, this

polar distribution could well be the consequence of the interactions

between PMEs and PMEIs at the PT tip, whereas in the lateral region

of the PT wall only PMEs appear to be present (Röckel et al., 2008).

Upon in vitro germination, anx1 anx2 PT growth prematurely

terminates, followed by tip rupture. Despite bursting, cytoplasmic

streaming remained active and new bulges were often produced,

which subsequently burst. This suggests that ANX-RLKs are not

driving PT growth per se, but are rather required to sustain PT

growth and prevent discharge. With the identification of more than

50 mutations that affect pollen germination, PT growth and shape

(Cheung and Wu, 2008), it is surprising that only vgd1 and anx1anx2 mutations systematically lead to PT bursting. Although

unlikely, the in vitro and in vivo phenotypic similarities of anx and

vgd1 PTs could be circumstantial. However, given the importance

of the balance between esterified and de-esterified pectins for PT

growth, how the ANX-RLKs and PME/PMEIs are interrelated is of

interest. One among many possible models is that once polar tip

growth has been established, ANX-RLKs are secreted to the plasma

membrane at the PT tip to monitor the cell wall status or sense

external stimuli. This information is relayed to the interior by the

ANX-RLKs to control the synthesis of specific cell wall material via

regulation of cell wall modifying enzymes such as PMEs and

PMEIs. Therefore, it would be interesting to analyze the cell wall

composition and mechanical properties of anx and vgd1 mutant PTs.

FERONIA and ANXUR-RLKs, the perfect match tocontrol pollen tube reception?Our results show that anx1 anx2 mutant PTs burst in vitro and are most

likely to do so in vivo as well. Time-lapse imaging indicates that this

process is explosive and rapid, as the expulsed intracellular content

can regularly be found as far as 40 μm from the rupture site and occurs

within 1 second. Moreover, when PTs were formed in vitro, they first

ceased to grow then burst at the subapical region of the PT tip.

Interestingly, these characteristics are reminiscent of the explosive

discharge of PTs in the synergid cells of the female gametophyte

during PT reception (Higashiyama et al., 2000; Palanivelu and Preuss,

2006; Rotman et al., 2003; Sandaklie-Nikolova et al., 2007).

ANX1 and ANX2 are the closest homologs of FER in

Arabidopsis, displaying an overall 55.1% identity at the amino acid

level to FER, which increases up to 77.5% for the kinase domain

(see Fig. S1A in the supplementary material). FER is strongly

expressed in the synergids of the female gametophyte and encodes

a RLK that is polarly localized towards the filiform apparatus, which

is the entry point of the PT into the synergid (Escobar-Restrepo et

al., 2007). Moreover, fer mutant female gametophytes are unable to

be fertilized, as PTs approaching them do not arrest their growth and

fail to rupture, showing that FER inhibits PT growth and positively

regulates PT discharge (Huck et al., 2003; Rotman et al., 2003).

Besides its strong expression in synergids, FER is also widely

expressed in vegetative tissues but not in pollen (Escobar-Restrepo

et al., 2007; Guo et al., 2009). Conversely, ANX1 and ANX2 are

strongly expressed in the male gametophyte and ANX-YFP fusion

proteins are polarly localized in the plasma membrane of the

growing PT tip, the contact point with the filiform apparatus during

PT reception. Therefore, one might expect that ANX1 and ANX2

play a similar role in the PT as FER does in the female gametophyte,

i.e. to negatively regulate PT growth. Surprisingly, we provide

compelling evidence that ANX1 and ANX2 function in exactly the

opposite way, as disruption of ANX1 and ANX2 leads to PT growth

arrest and discharge. Therefore, we propose a new model for PT

reception based on the phenotypes of the1, herk1, fer (see below)

and anx mutants, as well as on live imaging of PT reception in

Arabidopsis (Escobar-Restrepo et al., 2007; Huck et al., 2003;

Palanivelu and Preuss, 2006; Rotman et al., 2003; Sandaklie-

Nikolova et al., 2007). Once the polar tip growth is established, we

propose that ANX-RLKs are secreted to the PT tip to monitor the

status of the cell wall and sustain growth within the female tissues

until PTs reach the female gametophytes. Upon contact at the

filiform apparatus, first, the female FER-dependent signaling

cascade is activated allowing the female gametophyte to prepare

itself for fertilization. Subsequently, the male ANX-dependent

signaling process is deactivated, enabling the PT to arrest growth, to

rupture and deliver the sperm cells to effect fertilization.

Alternatively, ANX-RLKs could also function to maintain PT

integrity during growth within the female tissues without playing

any specific role during PT reception.

The CrRLK1L family appears to be specialized inthe control of cell elongation in diverse contextsANX1 and ANX2 define a subgroup of the receptor-like serine-

threonine kinase CrRLK1 subfamily in Arabidopsis (Hematy and

Höfte, 2008) and have close homologs in various dicotyledonous

and monocotyledonous species (see Fig. S5 in the supplementary

material). Out of the 17 Arabidopsis CrRLK1 subfamily members,

five (ANX1, ANX2, FER, HERK1 and THE1) have been

characterized and all are proposed to function in the control of cell

elongation during various processes. HERK1, THE1 and FER have

been reported to be required for optimum cell elongation in

hypocotyls and petioles, as herk1 the1 double-mutant and FERknockdown transgenic lines all exhibit dwarf phenotypes (Guo et

al., 2009). However, disruption of THE1 in several cellulose

synthase-deficient backgrounds promotes cell elongation (Hematy

et al., 2007), demonstrating that THE1 can regulate cell elongation

both positively and negatively. Unlike HERK1, THE1 and FER,

ANX1 and ANX2 appear to function specifically in the male

gametophyte but not in vegetative tissues. An anx1 anx2 double-

mutant plant was neither stunted nor did it exhibit any vegetative

phenotypes, consistent with the preferential expression of ANX1 and

ANX2 in pollen. However, we cannot exclude the possibility that

anx1 anx2 mutants exhibit discrete vegetative phenotypes or that the

role of ANX1 and ANX2 during vegetative growth can only be

revealed in some cell wall-damaged mutant backgrounds, as has

been shown for THE1 (Hematy et al., 2007). Interestingly, in

addition to the similar phenotypes of anx1 anx2 and PME-deficient

RESEARCH ARTICLE Development 136 (19)

Table 5. Location of pollen tube tips after pollination of wild-type pistils with a small number of pollen grainsPollen genotype Total PG PG germinated % Pollen germination Tip in micropyle Tip in ovary locules % Tip not located

anx1-1/anx1-1 109 91 83.5 58 21 13.2anx2-1/anx2-1 93 70 75.4 39 20 15.7anx1-1/anx1-1 anx2-1/ANX2 112 86 76.8 27 15 51.2anx1-2/anx1-2 anx2-2/ANX2 124 98 79 31 12 56.1

PG, pollen grain.

DEVELO

PMENT

vgd1 mutant PTs, THE1 and HERK1 have been reported to influence

the expression of some cell wall-modifying enzymes, including

expansins and PMEs (Guo et al., 2009; Hematy et al., 2007).

The extracellular domains of the CrRLK1L subfamily members

do not exhibit any homology with domains of known function and

no ligands have yet been identified for any of its members.

Therefore, the nature of the ligand(s) for the extracellular domains

of CrRLK1L subfamily RLKs cannot be predicted. The

identification of the first ligand, as well as the intracellular

interacting partners, for any CrRLK1L subfamily member will

undoubtedly shed light on the very important mechanisms that

tightly control the relationship between cell wall composition, cell

elongation and cell-cell communication during plant growth.

Note added in proofSaori Miyazaki and colleagues have recently reported similar

findings on ANXUR1 and ANXUR2 (Miyazaki et al., 2009).

AcknowledgementsWe thank Tae-Houn Kim, Maik Bohmer, Noriyuki Nishimura (University ofCalifornia, San Diego, CA, USA), Sharon Kessler, Christian Draeger, CeliaBaroux, Quy Ngo, Valeria Gagliardini, Christoph Ringli and ChristofEichenberger (University of Zürich, Switzerland) for enriching discussions ortechnical support; Jeffrey Harper (University of Nevada, Reno, NV, USA) forproviding ps779, pACA9-ACA9-YFP and pACA9-GFP-CNGC18 transgeniclines; Mayank Pururawa (UZH) for providing dde2-2 plants; and MitsuyasuHasebe and Saori Miyazaki for exchanging information prior to publication.This work was supported by the Research Priority Program in FunctionalGenomics/Systems Biology of the University of Zürich, and grants from theNational Institutes of Health (R01 GM060396) and the National ScienceFoundation USA (MCB 0417118) to J.I.S., and from the Swiss National ScienceFoundation (31003A-112489) and SystemsX.ch (Plant Growth) to U.G.Deposited in PMC for release after 12 months.

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/136/19/3279/DC1

ReferencesAlonso, J. M., Stepanova, A. N., Leisse, T. J., Kim, C. J., Chen, H., Shinn, P.,

Stevenson, D. K., Zimmerman, J., Barajas, P., Cheuk, R. et al. (2003).Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 301,653-657.

Becker, J. D., Boavida, L. C., Carneiro, J., Haury, M. and Feijo, J. A. (2003).Transcriptional profiling of Arabidopsis tissues reveals the unique characteristicsof the pollen transcriptome. Plant Physiol. 133, 713-725.

Berger, F., Hamamura, Y., Ingouff, M. and Higashiyama, T. (2008). Doublefertilization-caught in the act. Trends Plant Sci. 13, 437-443.

Boavida, L. C. and McCormick, S. (2007). Temperature as a determinant factorfor increased and reproducible in vitro pollen germination in Arabidopsisthaliana. Plant J. 52, 570-582.

Boavida, L. C., Vieira, A. M., Becker, J. D. and Feijo, J. A. (2005). Gametophyteinteraction and sexual reproduction: how plants make a zygote. Int. J. Dev. Biol.49, 615-632.

Boisson-Dernier, A., Frietsch, S., Kim, T. H., Dizon, M. B. and Schroeder, J. I.(2008). The peroxin loss-of-function mutation abstinence by mutual consentdisrupts male-female gametophyte recognition. Curr. Biol. 18, 63-68.

Borges, F., Gomes, G., Gardner, R., Moreno, N., McCormick, S., Feijo, J. A.and Becker, J. D. (2008). Comparative transcriptomics of Arabidopsis spermcells. Plant Physiol. 148, 1168-1181.

Bosch, M. and Hepler, P. K. (2005). Pectin methylesterases and pectin dynamicsin pollen tubes. Plant Cell 17, 3219-3226.

Bosch, M., Cheung, A. Y. and Hepler, P. K. (2005). Pectin methylesterase, aregulator of pollen tube growth. Plant Physiol. 138, 1334-1346.

Capron, A., Gourgues, M., Neiva, L. S., Faure, J. E., Berger, F., Pagnussat, G.,Krishnan, A., Alvarez-Mejia, C., Vielle-Calzada, J. P., Lee, Y. R. et al.(2008). Maternal control of male-gamete delivery in Arabidopsis involves aputative GPI-anchored protein encoded by the LORELEI gene. Plant Cell 20,3038-3049.

Chebli, Y. and Geitmann, A. (2007). Mechanical principles governing pollen tubegrowth. Funct. Plant Sci. Biotechnol. 1, 232-245.

Chen, Y. H., Li, H. J., Shi, D. Q., Yuan, L., Liu, J., Sreenivasan, R., Baskar, R.,Grossniklaus, U. and Yang, W. C. (2007). The central cell plays a critical role inpollen tube guidance in Arabidopsis. Plant Cell 19, 3563-3577.

Cheung, A. Y. and Wu, H. M. (2008). Structural and signaling networks for thepolar cell growth machinery in pollen tubes. Annu. Rev. Plant Biol. 59, 547-572.

Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735-743.

Crawford, B. C. and Yanofsky, M. F. (2008). The formation and function of thefemale reproductive tract in flowering plants. Curr. Biol. 18, R972-R978.

Dong, J., Kim, S. T. and Lord, E. M. (2005). Plantacyanin plays a role inreproduction in Arabidopsis. Plant Physiol. 138, 778-789.

Dresselhaus, T. (2006). Cell-cell communication during double fertilization. Curr.Opin. Plant Biol. 9, 41-47.

Dumas, C. and Rogowsky, P. (2008). Fertilization and early seed formation. C. R.Biol. 331, 715-725.

Escobar-Restrepo, J. M., Huck, N., Kessler, S., Gagliardini, V., Gheyselinck, J.,Yang, W. C. and Grossniklaus, U. (2007). The FERONIA receptor-like kinasemediates male-female interactions during pollen tube reception. Science 317,656-660.

Feys, B. J., Wiermer, M., Bhat, R. A., Moisan, L. J., Medina-Escobar, N., Neu,C., Cabral, A. and Parker, J. E. (2005). Arabidopsis SENESCENCE-ASSOCIATEDGENE101 stabilizes and signals within an ENHANCED DISEASE SUSCEPTIBILITY1complex in plant innate immunity. Plant Cell 17, 2601-2613.

Frietsch, S., Wang, Y. F., Sladek, C., Poulsen, L. R., Romanowsky, S. M.,Schroeder, J. I. and Harper, J. F. (2007). A cyclic nucleotide-gated channel isessential for polarized tip growth of pollen. Proc. Natl. Acad. Sci. USA 104,14531-14536.

Funke, C. P. (1801). Neues Real-Schullexicon enthaltend die zur Erklärung deralten Klassiker nothwendigen Hülfswissenschaften, vernämlich Geographie,Geschichte, Philosophie, Alterthümer und Mythologie. Zweiter Theil.Schulbuchhandlung, Braunschweig, Germany.

Grobei, M. A., Qeli, E., Brunner, E., Rehrauer, H., Zhang, R., Roschitzki, B.,Basler, K., Ahrens, C. H. and Grossniklaus, U. (2009). Deterministic proteininference for shotgun proteomics data provides new insights into Arabidopsispollen development and function. Genome Res. (in press).

Guo, H., Li, L., Ye, H., Yu, X., Algreen, A. and Yin, Y. (2009). Three relatedreceptor-like kinases are required for optimal cell elongation in Arabidopsisthaliana. Proc. Natl. Acad. Sci. USA 106, 7648-7653.

Hematy, K. and Hofte, H. (2008). Novel receptor kinases involved in growthregulation. Curr. Opin. Plant Biol. 11, 321-328.

Hematy, K., Sado, P. E., Van Tuinen, A., Rochange, S., Desnos, T., Balzergue,S., Pelletier, S., Renou, J. P. and Hofte, H. (2007). A receptor-like kinasemediates the response of Arabidopsis cells to the inhibition of cellulosesynthesis. Curr. Biol. 17, 922-931.

Higashiyama, T., Kuroiwa, H., Kawano, S. and Kuroiwa, T. (1998). Guidancein vitro of the pollen tube to the naked embryo sac of Torenia fournieri. PlantCell 10, 2019-2032.

Higashiyama, T., Kuroiwa, H., Kawano, S. and Kuroiwa, T. (2000). Explosivedischarge of pollen tube contents in Torenia fournieri. Plant Physiol. 122, 11-14.

Higashiyama, T., Yabe, S., Sasaki, N., Nishimura, Y., Miyagishima, S.,Kuroiwa, H. and Kuroiwa, T. (2001). Pollen tube attraction by the synergidcell. Science 293, 1480-1483.

Hirohashi, N., Kamei, N., Kubo, H., Sawada, H., Matsumoto, M. and Hoshi,M. (2008). Egg and sperm recognition systems during fertilization. Dev. GrowthDiffer. 50 Suppl. 1, S221-S238.

Hiscock, S. J. and Allen, A. M. (2008). Diverse cell signalling pathways regulatepollen-stigma interactions: the search for consensus. New Phytol. 179, 286-317.

Honys, D. and Twell, D. (2004). Transcriptome analysis of haploid malegametophyte development in Arabidopsis. Genome Biol. 5, R85.

Howden, R., Park, S. K., Moore, J. M., Orme, J., Grossniklaus, U. and Twell,D. (1998). Selection of T-DNA-tagged male and female gametophytic mutantsby segregation distortion in Arabidopsis. Genetics 149, 621-631.

Huck, N., Moore, J. M., Federer, M. and Grossniklaus, U. (2003). TheArabidopsis mutant feronia disrupts the female gametophytic control of pollentube reception. Development 130, 2149-2159.

Jiang, L., Yang, S. L., Xie, L. F., Puah, C. S., Zhang, X. Q., Yang, W. C.,Sundaresan, V. and Ye, D. (2005). VANGUARD1 encodes a pectinmethylesterase that enhances pollen tube growth in the Arabidopsis style andtransmitting tract. Plant Cell 17, 584-596.

Johnson, M. A. and Lord, M. E. (2006). Extracellular guidance cues andintracellular signaling pathways that direct pollen tube growth. In The PollenTube: A Cellular and Molecular Perspective (ed. R. Malho), pp. 223-242.Heidelberg: Springer.

Juge, N. (2006). Plant protein inhibitors of cell wall degrading enzymes. TrendsPlant Sci. 11, 359-367.

Kägi, C. and Gross-Hardt, R. (2007). How females become complex: celldifferentiation in the gametophyte. Curr. Opin. Plant Biol. 10, 633-638.

Kothe, E. (2008). Sexual attraction: on the role of fungal pheromone/receptorsystems (A review). Acta Microbiol. Immunol. Hung. 55, 125-143.

Krichevsky, A., Kozlovsky, S. V., Tian, G. W., Chen, M. H., Zaltsman, A. andCitovsky, V. (2007). How pollen tubes grow. Dev. Biol. 303, 405-420.

3287RESEARCH ARTICLEANXUR-RLKs inhibit pollen tube discharge

DEVELO

PMENT

3288

Kubo, M., Udagawa, M., Nishikubo, N., Horiguchi, G., Yamaguchi, M., Ito, J.,Mimura, T., Fukuda, H. and Demura, T. (2005). Transcription switches forprotoxylem and metaxylem vessel formation. Genes Dev. 19, 1855-1860.

Li, Y. Q., Chen, F., Linskens, H. F. and Cresti, M. (1994). Distribution ofunesterified and esterified pectins in cell walls of pollen tubes of floweringplants. Sex. Plant Reprod. 7, 145-152.

Lord, E. M. and Russell, S. D. (2002). The mechanisms of pollination andfertilization in plants. Annu. Rev. Cell Dev. Biol. 18, 81-105.

Marton, M. L., Cordts, S., Broadhvest, J. and Dresselhaus, T. (2005). Micropylarpollen tube guidance by Egg Apparatus 1 of maize. Science 307, 573-576.

McCormick, S. (2004). Control of male gametophyte development. Plant Cell 16Suppl., S142-S153.

McCormick, S. (2007). Plant science: reproductive dialog. Science 317, 606-607.Micheli, F. (2001). Pectin methylesterases: cell wall enzymes with important roles

in plant physiology. Trends Plant Sci. 6, 414-419.Miyazaki, S., Murata,T., Sakurai-Ozato, N., Kubo, M., Demura, T., Fukuda, H.

and Hasebe, M. (2009). ANXUR1 and 2, sister genes to FERONIA/SIRENE, aremale factors for coordinated fertilization. Curr. Biol. 19, 1327-1331.

Moore, J. M., Vielle-Calzada, J. P., Gagliano, W. and Grossniklaus, U. (1997).Genetic characterization of hadad, a mutant disrupting megagametogenesis inArabidopsis thaliana. Cold Spring Harbor Symp. Quant. Biol. 62, 35-47.

Morillo, S. A. and Tax, F. E. (2006). Functional analysis of receptor-like kinases inmonocots and dicots. Curr. Opin. Plant Biol. 9, 460-469.

Myers, C., Romanowsky, S. M., Barron, Y. D., Garg, S., Azuse, C. L., Curran,A., Davis, R. M., Hatton, J., Harmon, A. C. and Harper, J. F. (2009). Calcium-dependent protein kinases regulate polarized tip growth in pollen tubes. Plant J.59, 528-539.

Okuda, S., Tsutsui, H., Shiina, K., Sprunck, S., Takeuchi, H., Yui, R., Kasahara,R. D., Hamamura, Y., Mizukami, A., Susaki, D. et al. (2009). Defensin-likepolypeptide LUREs are pollen tube attractants secreted from synergid cells.Nature 458, 357-361.

Palanivelu, R. and Preuss, D. (2006). Distinct short-range ovule signals attract orrepel Arabidopsis thaliana pollen tubes in vitro. BMC. Plant Biol. 6, 7.

Palanivelu, R., Brass, L., Edlund, A. F. and Preuss, D. (2003). Pollen tubegrowth and guidance is regulated by POP2, an Arabidopsis gene that controlsGABA levels. Cell 114, 47-59.

Parre, E. and Geitmann, A. (2005). Pectin and the role of the physical propertiesof the cell wall in pollen tube growth of Solanum chacoense. Planta 220, 582-592.

Pelloux, J., Rusterucci, C. and Mellerowicz, E. J. (2007). New insights intopectin methylesterase structure and function. Trends Plant Sci. 12, 267-277.

Pina, C., Pinto, F., Feijo, J. A. and Becker, J. D. (2005). Gene family analysis ofthe Arabidopsis pollen transcriptome reveals biological implications for cellgrowth, division control, and gene expression regulation. Plant Physiol. 138,744-756.

Robatzek, S., Chinchilla, D. and Boller, T. (2006). Ligand-induced endocytosisof the pattern recognition receptor FLS2 in Arabidopsis. Genes Dev. 20, 537-542.

Röckel, N., Wolf, S., Kost, B., Rausch, T. and Greiner, S. (2008). Elaboratespatial patterning of cell-wall PME and PMEI at the pollen tube tip involves PMEIendocytosis, and reflects the distribution of esterified and de-esterified pectins.Plant J. 53, 133-143.

Rotman, N., Rozier, F., Boavida, L., Dumas, C., Berger, F. and Faure, J. E.(2003). Female control of male gamete delivery during fertilization inArabidopsis thaliana. Curr. Biol. 13, 432-436.

Rotman, N., Gourgues, M., Guitton, A. E., Faure, J. E. and Berger, F. (2008). Adialogue between the sirène pathway in synergids and the fertilizationindependent seed pathway in the central cell controls male gamete releaseduring double fertilization in Arabidopsis. Mol. Plant 1, 659-666.

Sandaklie-Nikolova, L., Palanivelu, R., King, E. J., Copenhaver, G. P. andDrews, G. N. (2007). Synergid cell death in Arabidopsis is triggered followingdirect interaction with the pollen tube. Plant Physiol. 144, 1753-1762.

Schiott, M., Romanowsky, S. M., Baekgaard, L., Jakobsen, M. K., Palmgren,M. G. and Harper, J. F. (2004). A plant plasma membrane Ca2+ pump isrequired for normal pollen tube growth and fertilization. Proc. Natl. Acad. Sci.USA 101, 9502-9507.

Shiu, S. H., Karlowski, W. M., Pan, R., Tzeng, Y. H., Mayer, K. F. and Li, W. H.(2004). Comparative analysis of the receptor-like kinase family in Arabidopsisand rice. Plant Cell 16, 1220-1234.

von Malek, B., van der, G. E., Schneitz, K. and Keller, B. (2002). TheArabidopsis male-sterile mutant dde2-2 is defective in the ALLENE OXIDESYNTHASE gene encoding one of the key enzymes of the jasmonic acidbiosynthesis pathway. Planta 216, 187-192.

Walter, M., Chaban, C., Schutze, K., Batistic, O., Weckermann, K., Nake, C.,Blazevic, D., Grefen, C., Schumacher, K., Oecking, C. et al. (2004).Visualization of protein interactions in living plant cells using bimolecularfluorescence complementation. Plant J. 40, 428-438.

Weterings, K. and Russell, S. D. (2004). Experimental analysis of the fertilizationprocess. Plant Cell 16 Suppl., S107-S118.

Willats, W. G., McCartney, L., Mackie, W. and Knox, J. P. (2001). Pectin: cellbiology and prospects for functional analysis. Plant Mol. Biol. 47, 9-27.

Wolters-Arts, M., Lush, W. M. and Mariani, C. (1998). Lipids are required fordirectional pollen-tube growth. Nature 392, 818-821.

Yadegari, R. and Drews, G. N. (2004). Female gametophyte development. PlantCell 16 Suppl., S133-S141.

Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004).GENEVESTIGATOR: Arabidopsis microarray database and analysis toolbox. PlantPhysiol. 136, 2621-2632.

Zonia, L. and Munnik, T. (2009). Uncovering hidden treasures in pollen tubegrowth mechanics. Trends Plant Sci. 14, 318-327.

RESEARCH ARTICLE Development 136 (19)

DEVELO

PMENT