disruption of seven hypothetical aryl alcohol dehydrogenase genes fromsaccharomyces cerevisiae and...

Yeast 15, 1681–1689 (1999)

Disruption of Seven Hypothetical Aryl AlcoholDehydrogenase Genes from Saccharomyces cerevisiaeand Construction of a Multiple Knock-out Strain

DANIELA DELNERI1,2, DAVID C. J. GARDNER1, CARLO V. BRUSCHI2 AND STEPHEN G. OLIVER1*1Department of Biomolecular Sciences, UMIST, PO Box 88, Sackville Street, Manchester M60 1QD, U.K.2Microbiology Group, ICGEB, AREA Science Park, Padriciano 99, 34012 Trieste, Italy

By in silicio analysis, we have discovered that there are seven open reading frames (ORFs) in Saccharomycescerevisiae whose protein products show a high degree of amino acid sequence similarity to the aryl alcoholdehydrogenase (AAD) of the lignin-degrading fungus Phanerochaete chrysosporium. Yeast cultures grown tostationary phase display a significant aryl alcohol dehydrogenase activity by degrading aromatic aldehydes to thecorresponding alcohols. To study the biochemical and the biological role of each of the AAD genes, a series ofmutant strains carrying deletion of one or more of the AAD-coding sequences was constructed by PCR-mediatedgene replacement, using the readily selectable marker kanMX. The correct targeting of the PCR-generateddisruption cassette into the genomic locus was verified by analytical PCR and by pulse-field gel electrophoresis(PFGE) followed by Southern blot analysis. Double, triple and quadruple mutant strains were obtained by classicalgenetic methods, while the construction of the quintuple, sextuple and septuple mutants was achieved by using themarker URA3 from Kluyveromyces lactis, HIS3 from Schizosaccharomyces pombe and TRP1 from S. cerevisiae.None of the knock-out strains revealed any mutant phenotype when tested for the degradation of aromaticaldehydes using both spectrophotometry and high performance liquid chromatography (HPLC). Specific tests forchanges in the ergosterol and phospholipids profiles did not reveal any mutant phenotype and mating andsporulation efficiencies were not affected in the septuple deletant. Compared to the wild-type strain, the septupledeletant showed an increased resistance to the anisaldehyde, but there is a possibility that the nutritional markersused for gene replacement are causing this effect. Copyright � 1999 John Wiley & Sons, Ltd.

— Saccharomyces cerevisiae; aryl alcohol dehydrogenase; gene disruption; functional analysis

*Correspondence to: S. G. Oliver, School of BiologicalSciences, 2.205 Stopford Building, Oxford Road, ManchesterM13 9PT, UK. Tel.: +44-161-275-2000; fax: +44-161-275-5028; e-mail: [email protected]/grant sponsor: TMR Fellowship of the EC.

INTRODUCTION

The sequence of the Saccharomyces cerevisiaegenome was completed in April 1996 and revealedthe existence of 6000 potential ORFs (Goffeauet al., 1996). Some ORFs have been characterizedpreviously, some have structural homologueswhose function is known in other organisms, but a

Contract/grant sponsor: EUROFAN programme of the EC.

CCC 0749–503X/99/151681–09$17.50Copyright � 1999 John Wiley & Sons, Ltd.

significant number represent completely novelproteins whose function remains to be assigned(Dujon, 1996). An international project, desig-nated EUROFAN (European Functional AnalysisNetwork), was started to determine the biochemi-cal and biological role of the yeast ‘orphan’ genes(Oliver, 1996).

In the frame of the EUROFAN project weperformed informatic analyses to search for yeastORFs whose potential protein products show simi-larity to enzymes involved in secondary metab-olism in other organisms. We discovered seven
telomeric ORFs (YNL331c, YDL243c, YCR107w,
Received 23 April 1999Accepted 18 July 1999

1682 D. DELNERI ET AL.

YJR155w, YFL056c, YFL057c and YOL165c)and one non-telomeric ORF (YPL088w), the pro-tein products of which show high amino acidsequence similarity to the aryl alcohol dehydroge-nase (AAD) of the lignin-degrading fungus Phan-erochaete chrysosporium. AAD is an enzyme ableto convert aromatic aldehydes, such as veratralde-hyde and anisaldehyde, into their correspondingalcohols. These aromatic compounds arise fromthe oxidation of lignocellulose by fungal ligninperoxidases and need to be reconverted intoalcohols to allow the aromatic ring fission to occur(Haemmerli et al., 1987). We found that stationaryphase yeast cultures are able to convert veratralde-hyde into veratryl alcohol. Thus, although yeast isnot a lignin-degrader, it might contain a class ofenzymes involved in the last steps of the ligninbiodegradation pathway, which deal with singlemonomers produced by the catabolic process. Therecent discovery that S. cerevisiae produces adecarboxylase that converts two major ligninderivatives, trans-ferulic and p-coumaric acid, tovinylguaiacol and vinylphenol, respectively, is alsoconsistent with this hypothesis (Huang et al.,1993). Furthermore, our knowledge of yeast sec-ondary metabolism is very limited and, so, there isa good chance that a significant fraction of yeastgenes of unknown function may play a role in sucha process.

To uncover the function of each of the AADgenes, we deleted the seven ORFs in the isogenicstrains YPH499 (MATa) and YPH500 (MAT�) byshort flanking homology (SFH) method (Wachet al., 1994) and constructed a multiple knock-outstrain in which all seven AAD ORFs were dis-rupted. We performed basic functional analysistests on the deletants and a range of more specificphenotypic assays were employed to study theprofile of secondary metabolites such as ergosterol,phospholipids and aromatic aldehydes.

MATERIALS AND METHODS

Strains and mediaThe gene deletions were carried out in the iso-

genic strains YPH499 MATa and YPH500 MAT�(ura3-52, lys2-801amber, ade2-101ochre, trp1-�63,his3-�200, leu2-�1; Sikorski and Hieter, 1989).The S. cerevisiae strains were routinely grown onYPD medium (1% yeast extract, 2% peptone, 2%glucose) and/or minimal SD medium (0·67% yeastnitrogen base, 2% glucose) supplemented with the

Copyright � 1999 John Wiley & Sons, Ltd.

auxotrophic requirements. To test the growth onnon-fermentable carbon sources, the yeast wasgrown on YPG medium (1% yeast extract, 2%peptone, 2% glycerol). For the selection of thetransformants, cells were grown on YPD platescontaining 300 �g/ml of geneticin (G418, GibcoBRL). Escherichia coli cells were grown on LBmedium supplemented with 75 �g/ml ampicillinwhen necessary (Sambrook et al., 1989).

Construction of the KanMX cassettes for genedeletion

The single deletion mutants were generated byPCR-mediated gene replacement (Baudin et al.,1993; Wach et al., 1994) using, as a positivelyselectable marker, the kanamycin resistant gene oftransposon Tn903, coding for an aminoglycosidasephosphotransferase (Oka et al., 1989) which is ableto confer resistance to the drug geneticin in thehost yeast cell (Jimenez and Davies, 1980). Theother markers used for the gene deletion wereURA3 from Kluyveromyces lactis (Langle-Rouaultand Jacobs, 1995), HIS3 from the Schizosaccharo-myces pombe (Wach et al., 1997) and TRP1 fromS. cerevisiae. The chimeric oligonucleotides (Table1) used for the amplification of the deletion cas-settes and the replacements of ORFs YCR107w,YFL056c, YFL057c, YJR155w and YNL331cconsist in a part of 36–40 bp homologous either tothe upstream or downstream regions of the ORFsand a segment of 19–22 bp homologous to theflanking regions of the KanMX marker. ORFsYFL056c and YFL057c are contiguous and weredeleted in a single replacement step.

Plasmid pFA6a–kanMX4 (Wach et al., 1994),pFA6a-klURA3, pFA6a-HIS3MX6 (Wach et al.,1997) and pFL39 (Bonneaud et al., 1990) wereused as templates for the PCR reactions. PlasmidpFA6a–klURA3 was obtained by replacing theKanMX marker in the plasmid pFA6a–KanMX4(digested with SmaI and SacI) with URA3 markerof K. lactis derived from the plasmid pTG5756digested with PvuII and SacI (Langle-Rouault andJacobs, 1995). For all PCR reactions, 50 ng oftemplate and 50 pmoles of each oligonucleotidewere used.

Transformation of yeast cellsYeast cells were transformed with approxi-

mately 1 �g of PCR product according to thelithium acetate method (Gietz et al., 1995). Trans-formed cells were then grown for 2 h at 30�C

Yeast 15, 1681–1689 (1999)

1683HYPOTHETICAL ARYL ALCOHOL DEHYDROGENASE GENE-SET IN YEAST

before being plated onto YPD plates containing300 mg/l G418. Transformants appeared after 36–48 h and the larger colonies were streaked ontofresh YPD plates containing 500 mg/l G418 to getrid of the background.

Verification of the correct deletant by analyticalPCR

The verification of the correct disruption of thetarget gene was performed by analytical PCR onwhole yeast colonies (Huxley et al., 1990). Foreach ORF deleted, three oligonucleotides (anneal-ing, respectively, with the flanking region of theORF, a site within the wild-type gene and a siteinternal to KanMX) were designed (Table 2). Thecorrect transformants showed PCR products witha length corresponding to DNA amplification be-tween the primer annealing in the flanking regionof the ORF and the one inside the selectablemarker.

Table 1. Oligonucleotides used for the construction of the deletion cassettes.

Name Sequence Template

F1aad14 5�-cttgcaaaatttgcacacactcggtggataaggcacagctgaagcttcgtacgc-3� pFA6a–KanMX4R1aad14 5�-attcgctttcagcgctgtacaaaaccagtaagcagcataggccactagtggatctg-3�F1aad3 5�-tcgacaagacggaaagattcctcacatttcgcagtgcagctgaagcttcgtacgc-3� pFA6a–KanMX4R1aad3 5�-tacagaacacgcatttatgaactgcacatacgccgcataggccactagtggatctg-3�F1aad6 5�-tgtacttgcctccaagtatcgaaagtcttgcgttgccagctgaagcttcgtacgc-3� pFA6a–KanMX4R1aad6 5�-tcgaaggtatacaaccacgttcaccgttttcacgtgcataggccactagtggatctg-3�F1aad10 5�-ttcataacccaccgccccaaaatgtgctcttcgaaacagctgaagcttcgtacgc-3� pFA6a–KanMX4R1aad10 5�-gcctgcaaatgcatgagcggcaaagttttctctaagcataggccactagtggatctg-3�F1aad4 5�-tatttcttacacaaacgcaccaaaaaagaaatctgattaatcagctgaagcttcgtacgc-3� pFA6a–KanMX4

or pFA6a–klURA3R1aad4 5�-tgggaggagcttcaatcggcgatgcatggtcaggctttatgcataggccactagtggatctg-3�F1aad16 5�-tgtcttgccaactatgtaatttggctgttacggaagaccccagctgaagcttcgtacgc-3� pFA6a–HIS3MX6R1aad16 5�-tatgagccgaatggctacgatcagtaaaaatcagcaggtgcataggccactagtggatctg-3�F1aad15 5�-aatttcgagttcagcctggaacgtgttgaacagagattttgagcgagcatttaatagaacagcatcg pFL39R1aad15 5�-gtaagctacatgtcgttaagagcatagcatcattacctcaatacatgcgcaagtgcacaaacaatac

The sequences complementary to the plasmids used as PCR templates are underlined.


Table 2. Oligonucleotides used for the analytical PCR.

Name Sequence

F2aad14 5�-tagctgttgtttcctactcg-3�R2aad14 5�-tatctgatacacctgcttgg-3�F2aad3 5�-tatctgatacacctgcttgg -3�R2aad3 5�-tacgttaatatgtcttccgc-3�F2aad6 5�-ggttttttttcctccctg -3�R2aad6 5�-taagaaatacgacgttggtg-3�F2aad10 5�-acccaatatgattctcaccttc-3�R2aad10 5�-ttgcctacatcatacccctta-3�F2aad4 5�-tcctctacgacttgtttatgatt -3�R2aad4 5�-gaggaacggaagaagaatgg-3�F2aad16 5�-aagctaagctaacatctgcc-3�R2aad16 5�-cataatcaccaccgtttctc-3�F2aad15 5�-cactttgtgcttcgttgtac-3�R2aad15 5�-accttggctaatgcttcac-3�P1kan 5�-cgtttctgtaatgaaggaga-3�P2kan 5�-tctccttcattacagaaacg-3�P3kan 5�-aacgtgagtcttttccttacc-3�P1klURA3 5�-ctcatcagtcgaacgaacgt-3�P1TRP1 5�-attgggcacacatataatacc-3�

Pulse-field gel electrophoresis and Southernhybridization

Pulse-field gel electrophoresis (PFGE) was usedto separate yeast chromosomes (Carle and Olson,1985; Chu et al., 1986). Yeast cells were grown tostationary phase in YPD medium, and ‘slabs’ wereprepared according to the method developed byGardner et al. (1993). The samples were run onagarose gels (1%) at 180 V with switching intervalsof 80 s for 24 h. The gel was stained with ethidium

bromide, immersed for 20 min in 0·2 HCl, de-natured for 30 min in a solution containing 0·5 NaOH and 1·5 NaCl, and soaked for 30 min inthe neutralizing solution (1 Tris–HCl, 1·5 NaCl, pH 7·4). The gel was blotted overnight ontoHybond-N nylon membrane (Amersham, UK)and the DNA was fixed to the membrane

Yeast 15, 1681–1689 (1999)


Sporulation and tetrad dissectionYeast cells were grown overnight in liquid pre-

sporulation medium (yeast extract 0·8%, peptone0·3% and glucose 10%) and then harvested andplated onto sporulation plates (1% potassiumacetate, 0·1% yeast extract and 0·05% glucose)where they were allowed to sporulate for 5 days at22�C.

Spores were collected on a loop and mixed with60 �l of a 10% w/v sorbitol solution to create athick suspension. A 15 �l aliquot of this suspensionwas added to 85 �l 10% w/v sorbitol solution and7·5 �l 100 mg/ml Novozyme solution added. Thiswas then incubated at 37�C for 3 min, after whichthe spores were dissected on a micromanipulator.The tetrads were then incubated at 30�C untilcolonies developed.

The mating type of the spores was determinedusing two haploid tester strains, BR15-3D (MATa,his1, MAL4, CANs) and DC6 (MAT�, leu2-3,leu2-112, his4) (Sherman et al., 1986). Each sporewas crossed with both tester strains on YPD platesto allow the formation of diploids. The plates werethen replicated onto minimal medium (HIS�)containing the appropriate supplements to selectfor diploid cells. After 2 days at 30�C, the spores ofunknown mating type have formed viable diploidcolonies with only one of the two tester strains,thus identifying its mating type.

Phenotypic testsFor the growth assays, serial dilutions of each

different disruptant were plated onto YPD, YPGand minimal medium (supplemented with theappropriate requirements) and incubated at either15�C, 30�C or 37�C. The growth was checked aftervarious periods of time. The degradation of vera-traldehyde by S. cerevisiae was monitored using aspectrophotometer: supernatant samples of yeastculture grown on YPD medium supplemented with0·5 g/l veratraldehyde were diluted 20-fold and


directly analysed by following the disappearanceof the substrate at its maximum absorptionwavelength (310 nm).

The supernatant samples were also diluted intomethanol and analysed by reversed phase highperformance liquid chromatography (HPLC). Thesamples were run through a C18 column andeluted with 60% methanol containing 0·2% aceticacid at a flow rate of 0·5 ml/min. Analyteswere detected at a wavelength of 285 nm in anon-line spectrophotometer connected with a dataintegrator.

For the assay of the sphingolipid and phospho-lipid, serial dilutions of yeast cells were droppedonto a YPD plate containing 60 U/ml of nystatin(Sigma) or 15 �g/ml of amphotericin B (Sigma).Both drugs kill wild-type yeast strains butnot mutants defective in the sphingolipid andphospholipid metabolic pathways.

To test resistance to oxidative stress and toaromatic compounds (Clausen et al., 1994), yeastcells were plated onto YPD agar and a 5 mm diskcontaining 10 �l of the different inhibitors (anisal-dehyde or hydrogen peroxide 30%). Pure productswere applied and left to diffuse into the agar inorder to create a gradient.

The malonyl-CoA binding assay was performedin collaboration with M. Schweizer’s Group: thetotal protein extract from the multiple mutant andthe wild-type cells was added to a reaction mixturecontaining (2-14C) malonyl-CoA. The reactionproducts were then separated under nativeconditions on a 20% PAGE, electroblottedonto a PVDF membrane and exposed to thephosphoimager plate.

Informatic analysisResearch for DNA and protein homology and

alignment was performed using BLASTn,BLASTp, FASTA and GCG bestfit programmes(Pearson and Lipman, 1988; Altschul et al., 1990).

RESULTS AND DISCUSSION

Reduction of veratraldehyde to veratryl alcohol inyeast stationary phase culture

In silicio analysis of the S. cerevisiae genomesequence (Goffeau et al., 1996) revealed thepresence of seven ORFs (YNL331c, YDL243c,YCR107w, YJR155w, YFL056c, YFL057c,YOL165c) which show about 67% amino acidsequence similarity to the aryl alcohol dehydro-

by exposure to UV irradiation into a CL-1000Ultraviolet Crosslinker (UVP).

The membrane was hybridized according thestandard procedure (Sambrook et al., 1989) using,as probes, the deletion cassettes with KanMXand/or the URA3, HIS3, and TRP1 markers. Theamount of radioactivity on the membrane wasread using a Phosphoimager (GS-363 MolecularImager System, Biorad, UK) after 12 h.

Yeast 15, 1681–1689 (1999)


Figure 1. HPLC determination of veratryl alcohol (retention time 6·53 min) in thesupernatant sample of yeast cultures grown on YPD supplemented with veratraldehyde(retention time 8·57 min). a, b, c and d are, respectively, the chromatograms forsupernatant samples taken 5, 15, 30 and 45 min after the introduction of veratraldehyde.

genase (AAD) of the lignin-degrading fungus,Phanerochaete chrysosporium (Muheim et al.,1991; Reiser et al., 1994). When the gene productsof these seven ORFs were compared, 80–90%amino acid sequence identity was found, onaverage. Furthermore, an eighth ORF, YPL088w,classified as a hypothetical aryl alcohol dehydro-genase, shows no apparent nucleotide sequencesimilarity with the AAD of P. chrysosporium orwith the other seven yeast AAD ORFs, while (atthe protein level) there was an amino acid sequenceidentity of ca. 25%. These data suggest that theseven ORFs, YNL331c, YDL243c, YCR107w,YJR155w, YFL056c, YFL057c and YOL165c,form a true gene family, whilst ORF YPL088w ismore distantly related.


We determined the aryl alcohol dehydrogenaseactivity of S. cerevisiae by measuring the capacityof the cells to reduce veratraldehyde by two inde-pendent techniques (see Materials and Methods).The reducing activity appeared about 6–7 h afterthe addition of veratraldehyde to early exponentialphase yeast cultures. When the substrate wasadded to yeast stationary phase cultures, the vera-traldehyde was completely converted into veratrylalcohol after 90 min (Figure 1). These data encour-aged us to investigate a possible role for S. cerevi-siae in the degradation of low molecular weightaromatic compounds arising from the degradationof natural biopolymers such as lignocellulose.Recently, it was discovered that yeast is able toproduce specific decarboxylases that are able toattack trans-ferulic and p-coumaric acid (the main

Yeast 15, 1681–1689 (1999)


constituents of the lignin macromolecule; Huanget al., 1993). In addition a gene, PAD1, able toconfer the resistance to the cinnamic acid, has beencloned (Clausen et al., 1994). Cinnamic acid is aubiquitous intermediate of the lignin catabolicpathway and displays wide antimicrobial activity.The ability of S. cerevisiae to convert cinnamicacid into styrene may provide a selective advantageduring growth on substrates rich in phenylacrylicacids, such as decaying fruits. It might, forinstance, allow S. cerevisiae to compete effectivelyagainst Sz. pombe, a yeast which does not presentany decarboxylase activity on substituted cinnamicacids (Doerner, 1987).

Thus, in spite of the fact that S. cerevisiae is nota lignin degrader, we have evidence for a possiblerole of this yeast in the last steps of lignocellulosedegradation. The AAD gene-set is not the onlyexample of unexpected biological context. Infor-matic analyses have shown matches between theORF encoding for the NifS protein of nitrogen-fixing bacteria and similar genes in S. cerevisiae,Lactobacillus, Bacillus, and E. coli. Neither yeastnor any of these other organisms fix molecularnitrogen (Leong-Morgenthaler et al., 1994). Touncover the real function of each of the yeast AADgenes, we have constructed a series of singly andmultiply deletant strains (including the total,septuple aad deletant) in order to uncover syn-thetic phenotypes. The two small consecutiveORFs,YFL056c and YFL057c, were replaced in asingle deletion step and this strain will be referredto as a unique deletant.

Figure 2. Strategy followed to construct a multiple deletant.The double mutant aad3/14 was crossed with either the singlemutant aad6 or aad10. The resulting two triple mutants,aad3/14/6 and aad3/14/10 (with two mutations in common),were crossed together to obtain the quadruple mutant aad3/14/6/10.

The AAD genes located on chromosomes XIV


Figure 3. Southern blot of yeast chromosomes separated byPFGE. DNA from kanr, KlURA3, SpHIS3 and TRP1 wereused as probes. WT, wild-type cell; 6X, sextuple aad mutant;7X, septuple aad mutant.

Construction of the multiple deletant strain

(YNL331c) and VI (YFL056c/YFL057c) havebeen deleted in strain YPH499 MATa, while thosepresent on chromosomes III (YCR107w), X(YJR155w) and IV (YDL243c) were disrupted inYPH500 MAT� (YPH499 and YPH500 are iso-genic; Sikorski and Hieter, 1989). For all thedeletions, the SFH method (Wach et al., 1994) wasused and the correct gene replacement was verifiedby both analytical PCR (using wild-type cells ascontrol) and by PFGE followed by Southernhybridization, using the disruption cassette
containing the marker KanMX as a probe.
Yeast 15, 1681–1689 (1999)


To construct double, triple and quadruplemutants, we followed the strategy showed in Fig-ure 2. The double mutant strains carrying the aaddeletion on chromosomes III and XIV, and thetwo triple mutant strains carrying the aad deletionon chromosomes III/VI/XIV and III/X/XIV, wereobtained by classical genetic methods. By crossingthe two triple mutants (which had in common twoout of three aad deletions) followed by sporulationand dissection of tetrads, we constructed thequadruple mutant carrying the AAD deletion onchromosome XIV/III/VI/X. The deletion, in thequadruple mutant strain, of the AAD homologueon chromosome IV was achieved by using theURA3 gene from K. lactis as a heterologousselectable marker in the gene replacement (Langle-Rouault and Jacobs, 1995). Similarly, to disrupt,in the quintuple mutant, ORF YPL088w, theheterologous marker HIS3 from S. pombe (Wachet al., 1997) was used. The last AAD homologue onchromosome XV (YOL165c) was deleted, in thesextuple mutant background, using the homolo-gous marker TRP1 of Saccharomyces cerevisiae(Figure 3).

Figure 4. Test for the resistance to anisaldehyde of wild-type (control negative) and septuple aad mutantstrain.

Phenotypic analysisWe carried out basic phenotypic analyses on all

the single mutants and the multiple mutants. Thesingle deletion of ORFs YNL331c, YDL243c,YCR107w, YJR155w, YFL056c/YFL057c,
YPL088w and YOL165c led to viable cells and

growth on YPD, YPG or YNB at 30�C, 37�C or15�C was not affected by these mutations. Similarresults were obtained for all the multiple deletantsgenerated in this work. Moreover, there were nodifferences in mating and sporulation efficienciesbetween the septuple mutant and the wild-typestrain. All mutants have been tested for veratral-dehyde degradation efficiency using spectrophoto-metric and HPLC analyses. Surprisingly, thedifferent multiple mutants did not show any sig-nificant reduction in veratraldehyde degradationefficiency as compared to the wild-type and thesingle mutants.

Since it was possible that this gene set plays arole in yeast lipid metabolism, the wild-type strainand the multiple mutant were checked for theproduction of sterols, in particular ergosterol, incollaboration with S. Kelly’s Group (Sheffield). Nodifferences were found in the sterol profile in themutant strains, and ergosterol production wasquantitatively identical in the wild-type and in themutants. To check the secondary metabolism ofphospholipids, the multiple mutants and the wild-type strain were grown on rich media containingeither nystatin or amphotericin B, both of whichkill wild-type yeast strains but not mutantsdefective in the sphingolipid and phospholipidmetabolic pathways. Neither the wild-type northe mutant strains were able to grow on mediacontaining these drugs. The yeast AAD gene family
is also homologous to norsolinic acid reductase (an
Yeast 15, 1681–1689 (1999)


enzyme involved in polyketide synthesis in A.parasitucus, Cary et al., 1996). Therefore, thepossibility that this gene-set might be involved inpolyketide formation in yeast was checked bytesting the quantity of malonyl-CoA binding toproteins (in collaboration with M. Schweizer’sgroup, Norwich). No differences were detectedin the pattern of binding in the mutant vs. thewild-type control.

Plate assays were performed using oxidizingagents, such as hydrogen peroxide and diethyl-maleic acid ester (DEME), and aromatic alde-hydes, such as anisaldehyde. The septuple mutantshowed a higher resistance when it was exposed toanisaldehyde. The latter result suggests a role forthe AAD gene-set in the metabolism of higheraromatic aldehydes. However, no difference wasseen between the quadruple mutant, aad3�/aad14�/aad6�/aad10� (in which only the markerKan was used) and the wild-type when exposed toanisaldehyde (Figure 4). Moreover, similar resultswere found when comparing to the wild-type thesingle mutants aad4�, aad16� and aad15�. Thesedata mean that we cannot exclude the possibilitythat a marker effect (Baganz et al., 1997) is at leastpartly responsible for the observed change inresistance to anisaldehyde. Given the fact thatfungal enzymes involved in the conversion ofaromatic aldehydes show extreme stereospecificity(B. Hahn-Hagerdal, personal communication), weintend to study a wider range of potentialsubstrates in order to uncover a more definitivephenotype for this gene-set.

ACKNOWLEDGEMENTS

We thank Steve Kelly, Michael Schweizer,Gunther Daum, Barbara Hahn-Hagerdahl, FrankBaganz, and Greg Tomlin for their help andadvice. This work was supported by a TMRFellowship from the European Commission toDD and by contracts under the EUROFANprogramme of the EC to SGO and CVB.

REFERENCES

Altschul, S. F., Gish, W., Miller, W., Myers, E. W. andLipman, D. J. (1990). Basic local alignment searchtool. J. Mol. Biol. 215, 403–410.

Baganz, F., Hayes, A., Marren, D., Gardner, D. C. J.and Oliver, S. G. (1997). Suitability of replacementmarkers for functional analysis studies in Saccharo-
myces cerevisiae. Yeast 13, 1563–1573.

Baudin, A., Ozier-Kalogeropoulos, O., Denouel, A.,Lacroute, F. and Cullin, C. (1993). A simple andefficient method for direct gene deletion in Saccharo-myces cerevisiae. Nucleic Acids Res. 21, 3329–3330.

Bonneaud, N., Ozier-Kalogeropoulos, O., Li, G.,Labouesse, M., Minvielle-Sebastia, L. and Lacroute,F. (1990). A family of low and high copy replicative,integrative and single-stranded S. cerevisiae/E. colishuttle vectors. Yeast 7, 609–615.

Carle, G. F. and Olson, M. V. (1985). An electro-phoretic karyotype for yeast. Proc. Natl Acad. Sci.U S A 82, 3756–3760.

Cary, J. W., Wright, M., Bhatnagar, D., Lee, R. andChu, F. S. (1996). Molecular characterization of anAspergillus parasiticus dehydrogenase gene, norA,located on the aflatoxin biosynthesis gene cluster.Appl. Environ. Microbiol. 62, 360–366.

Chu, G., Vollrath, D. and Davis, R. W. (1986). Separ-ation of large DNA molecules by contour-clampedhomogeneous electric fields. Science 234, 1582–1585.

Clausen, M., Lamb, C. J., Megnet, R. and Doerner,P. W. (1994). PAD1 encodes phenylacrylic acid decar-boxylase which confers resistance to cinnamic acid inSaccharomyces cerevisiae. Gene 142, 107–112.

Doerner, P. W. (1987). PhD Thesis, University ofOldenburg, Oldenburg, Germany.

Dujon, B. (1996). The yeast genome project: what did welearn? Trends Genet. 12, 263–270.

Gardner, D. C. J., Heale, S. M., Stateva, L. I. andOliver, S. G. (1993). Treatment of yeast cells with walllytic enzymes is not required to prepare chromosomesfor pulsed-field gel analysis. Yeast 9, 1053–1055.

Gietz, R., Schiestl, R., Willems, A. and Woods, R.(1995). Studies on the transformation of intact yeastcells by the LiAc/SS–DNA/PEG procedure. Yeast 11,355–360.

Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W.,Dujon, B., Feldmann, H., Galibert, F., Hoheisel,J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes,H. W., Murakami, Y., Philippsen, P., Tettelin, H. andOliver, S. G. (1996). Life with 6000 genes. Science 274,546.

Haemmerli, S. D., Leisola, M. S., Sanglard, D. andFiechter, A. (1987). Oxidation of benzo(a)pyrene byextracellular ligninases of Phanerochaete chryso-sporium veratryl alcohol and stability of ligninase.J. Biol. Chem. 261, 6900–6903.

Huang, Z., Dostal, L. and Rosazza, J. P. (1993). Micro-bial transformations of ferulic acid by Saccharomycescerevisiae and Pseudomonas fluorescens. Appl. Environ.Microbiol. 59, 2244–2250.

Huxley, C., Green, E. D. and Dunham, I. (1990). Rapidassessment of S. cerevisiae mating type by PCR.Trends Genet. 6, 236.

Jimenez, A. and Davies, J. (1980). Expression of trans-posable antibiotic resistance elements in Saccharomy-
ces. Nature 287, 869–871.
Yeast 15, 1681–1689 (1999)


Langle-Rouault, F. and Jacobs, E. (1995). A method forperforming precise alterations in the yeast genomeusing a recycable selectable marker. Nucleic AcidsRes. 23, 3079–3081.

Leong-Morgenthaler, P., Oliver, S. G., Hottinger, H.and Soll, D. (1994). A Lactobacillus nifS-like genesuppresses an Escherichia coli transaminase B muta-tion. Biochimie 76, 45–49.

Muheim, A., Waldner, R., Sanglard, D., Reiser, J.,Schoemaker, H. E. and Leisola, M. S. A. (1991).Purification and properties of an aryl-alcohol dehy-drogenase from the white-rot fungus Phanerochaetechrysosporium. Eur. J. Biochem. 195, 369–375.

Oka, A., Sugisaki, H. and Takanami, M. (1989).Nucleotide sequence of the kanamycin resistancetransposon Tn903. J. Mol. Biol. 147, 217–226.

Oliver, S. G. (1996). From DNA sequence to biologicalfunction. Nature 379, 597–600.

Pearson, W. R. and Lipman, D. J. (1988). Improvedtools for biological sequence comparison. Proc. NatlAcad. Sci. U S A 85, 2444–2448.

Reiser, J., Muheim, A., Hardagger, M., Frank, G. andFiechter, A. (1994). Aryl-alcohol dehydrogenase from


the white-rot fungus Phanerochaete chrysosporium.Gene cloning, sequence analysis, expression, andpurification of the recombinant enzyme. J. Biol.Chem. 269, 28 152–28 159.

Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989).Molecular Cloning. A Laboratory Manual, 2nd edn.Cold Spring Harbour Laboratory Press, New York.

Sherman, F., Fink, G. R. and Hicks, J. B. (1986).Methods in Yeast Genetics. Cold Spring HarbourLaboratory Press, New York.

Sikorski, R. S. and Hieter, P. (1989). A system of shuttlevectors and yeast host strains designed for efficientmanipulation of DNA in Saccharomyces cerevisiae.Genetics 122, 19–27.

Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P.(1994). PCR-synthesis of marker cassettes with longflanking homology regions for gene disruptions in S.cerevisiae. Yeast 10, 1793–1808.

Wach A., Brachat, A., Alberti-Segui, C., Rebischung, C.and Philippsen, P. (1997). Heterologous HIS3 markerand GFP reporter modules for PCR-targeting inSaccharomyces cerevisiae. Yeast 13, 1065–1075.

Yeast 15, 1681–1689 (1999)

disruption of seven hypothetical aryl alcohol dehydrogenase genes fromsaccharomyces cerevisiae and...

Documents