discover why cytogeneticists are using ngs in tandem with fish · by fish or karyotype.1 detect...
TRANSCRIPT
Discover why cytogeneticists are using NGS in tandem with FISHLab directors are inundated with cases, so gaining efficiency is critical. Next-generation sequencing (NGS) can complement FISH, saving you time and money, while enabling you to meet practice recommendations for analyzing samples with unknown abnormalities.
Efficient. Fast. Extensive.
There is a median of 3 mutations per patient.2
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%
Detect many mutations simultaneously.
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%
50% of people with myeloid disorders are not identified by FISH or karyotype.1
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%
NGS panels are invaluable for subclassifications and risk stratification.
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%However, 70% of the patient population could still harbor at least one mutation.1
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%Reduce the risk of and time spent on inconclusive results.
Detect many mutations simultaneously.
Ef�cient. Fast. Extensive.
50% of people with myeloid disorders are cytogenetically normal.1
70% of the patient population could harbor at least one mutation.1
Reduce the risk of inconclusive results.
Median of 3 mutations per patient.2
NGS panels are invaluable for subclassifications and risk stratification.
?
TGCGATACAGCTAGTCAGCTCGATGCTAGTC
CTGATCGTAGCGCAGTAGCTACGTAGTAGTCGTGCTAGTCTAGCTAGCTACTAGTAGTCAGCTAC
TAGTCAGCTACTAGCTA
50%
70%
Applying NGS and FISH to: MDS
In these cases, NGS and FISH allow for a more comprehensive view.
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
Applying NGS and FISH to: sarcomasClose to 100 gene fusions have been found in soft tissue tumors.3
Applying NGS and FISH to: Sarcomas
Using FISH, you’d need many distinct probes to cover all fusions.
With NGS and FISH, one assay provides a broader perspective.
With NGS and FISH, one assay provides a broader perspective.
Using only FISH, you need many distinct probes to cover all fusions.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
Close to 100 gene fusions have been found in soft tissue tumors.3
Advance your breakthroughs using NGS and FISH
Rapid identification of fusions with NGS can be followed up with FISH for confirmation or analysis of variations over time.
Use FISH to test for high-probability targets in tandem with NGS to cover the possibility of negative FISH results.
Use reflexive testing for more comprehensive analysis.
Advance your breakthroughs using NGS and FISH
Rapid identification of fusions with NGS followed up with FISH for confirmation or analysis of variations over time.
Use FISH to test for high probability targets in tandem with NGS to cover the possibility of negative FISH results.
Use reflexive testing simultaneously if enough sample is available.
Advance your breakthroughs using NGS and FISH
Rapid identification of fusions with NGS followed up with FISH for confirmation or analysis of variations over time.
Use FISH to test for high probability targets in tandem with NGS to cover the possibility of negative FISH results.
Use reflexive testing simultaneously if enough sample is available.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
70% of MDS patients have a detectable mutation...
but no 1 specific mutation has been identified in more than 20% of cases.1
Applying NGS and FISH to: MDS
Some cases have characteristics that implicate specific disease classifications, or specific cytogenetic abnormalities that can be quickly assessed with FISH.
In these cases, NGS and FISH allows for a more comprehensive view.
Benefits of NGS
Cover dozens or hundreds of genes in a single assay.
Reduce the need for sequential testing.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Detect many aberrations at the same time.
Including small variants, gene fusions, and changes in expression.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Access user-friendly on-instrument and cloud-based data analysis.
Without the need for bioinformatics expert.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Low price point for any lab.
Cover multiple genes in single, low-cost assays.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Streamline your workflow.
Experience ease of use from start to finish.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Transition with ease.
Save time and frustration. Ramp up quickly.
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
Bene�ts of NGS
User-friendly on-instrument and cloud-based data analysis
No need for bioinformatics expert
Low price point for any lab
Lower cost per gene than other assays
Streamlined workflow
Ensures ease of use from start to finish
Easy to adopt
Saves time and frustration
Detect many aberrations at the same time
Including small mutations, fusions, and changes in gene expression
Cover dozens or hundreds of genes in a single assay
Reduces the need for sequential tests
321
Supplementing FISH with NGS can help advance breakthroughs with a more comprehensive solution.
What people are saying
“It is not cost effective and [is] also labor intensive to maintain a wide range of individual CLIA-approved diagnostic tests for the many mutations and translocations that occur in the various sarcoma subtypes. Application of next generation sequencing technology to this field opens possibilities for a more efficient and, ultimately, more cost-effective way to detect these genetic abnormalities.”4
–Histopathology, 2014
– Histopathology, 2014
References
1. Nybakken GE, Bagg A. The genetic basis and expanding role of molecular analysis in the diagnosis, prognosis, and therapeutic
design for myelodysplastic syndromes. J Mol Diagn. 2014;16(2):145-158.
2. Haferlach T, Nagata Y, Grossmann V, et al. Landscape of genetic lesions in 944 patients with myelodysplastic syndromes.
Leukemia. 2014;28(2):241-247.
3. Mertens F, Tayebwa J. Evolving techniques for gene fusion detection in soft tissue tumours. Histopathology. 2014;64(1):151-162.
4. van de Rijn M, Guo X, Sweeney RT, Beck AH, West RB. Molecular pathological analysis of sarcomas using paraffin-embedded
tissue: current limitations and future possibilities. Histopathology. 2014;64(1):163-170.
To find out more about why cytogeneticists are using NGS in tandem with FISH, visit www.illumina.com/cytogenetics.
© 2016 Illumina, Inc. All rights reserved. Illumina and the pumpkin orange color are trademarks of Illumina, Inc. and/or its affiliates in the US and/or other countries. Pub. No. 1170-2016-018 Current as of 28 July 2016