RESEARCH POSTER PRESENTATION DESIGN © 2012

www.PosterPresentations.com

(—THIS SIDEBAR DOES NOT PRINT—) DES IGN GUIDE

This PowerPoint 2007 template produces an A0 presentation poster. You can use it to create your research poster and save valuable time placing titles, subtitles, text, and graphics. We provide a series of online tutorials that will guide you through the poster design process and answer your poster production questions. To view our template tutorials, go online to PosterPresentations.com and click on HELP DESK. When you are ready to print your poster, go online to PosterPresentations.com Need assistance? Call us at 1.510.649.3001

QUICK START

Zoom in and out As you work on your poster zoom in and out to the level that is more comfortable to you. Go to VIEW > ZOOM.

Title, Authors, and Affiliations

Start designing your poster by adding the title, the names of the authors, and the affiliated institutions. You can type or paste text into the provided boxes. The template will automatically adjust the size of your text to fit the title box. You can manually override this feature and change the size of your text. TIP: The font size of your title should be bigger than your name(s) and institution name(s).

Adding Logos / Seals Most often, logos are added on each side of the title. You can insert a logo by dragging and dropping it from your desktop, copy and paste or by going to INSERT > PICTURES. Logos taken from web sites are likely to be low quality when printed. Zoom it at 100% to see what the logo will look like on the final poster and make any necessary adjustments. TIP: See if your school’s logo is available on our free poster templates page.

Photographs / Graphics You can add images by dragging and dropping from your desktop, copy and paste, or by going to INSERT > PICTURES. Resize images proportionally by holding down the SHIFT key and dragging one of the corner handles. For a professional-looking poster, do not distort your images by enlarging them disproportionally.

Image Quality Check Zoom in and look at your images at 100% magnification. If they look good they will print well.

ORIGINAL   DISTORTED  

Corner  handles  

Good

 prin

/ng  qu

ality

 

Bad  prin/n

g  qu

ality

 

QUICK START (cont. )

How to change the template color theme You can easily change the color theme of your poster by going to the DESIGN menu, click on COLORS, and choose the color theme of your choice. You can also create your own color theme. You can also manually change the color of your background by going to VIEW > SLIDE MASTER. After you finish working on the master be sure to go to VIEW > NORMAL to continue working on your poster.

How to add Text The template comes with a number of pre-formatted placeholders for headers and text blocks. You can add more blocks by copying and pasting the existing ones or by adding a text box from the HOME menu.

Text size

Adjust the size of your text based on how much content you have to present. The default template text offers a good starting point. Follow the conference requirements.

How to add Tables

To add a table from scratch go to the INSERT menu and click on TABLE. A drop-down box will help you select rows and columns.

You can also copy and a paste a table from Word or another PowerPoint document. A pasted table may need to be re-formatted by RIGHT-CLICK > FORMAT SHAPE, TEXT BOX, Margins.

Graphs / Charts You can simply copy and paste charts and graphs from Excel or Word. Some reformatting may be required depending on how the original document has been created.

How to change the column configuration RIGHT-CLICK on the poster background and select LAYOUT to see the column options available for this template. The poster columns can also be customized on the Master. VIEW > MASTER.

How to remove the info bars

If you are working in PowerPoint for Windows and have finished your poster, save as PDF and the bars will not be included. You can also delete them by going to VIEW > MASTER. On the Mac adjust the Page-Setup to match the Page-Setup in PowerPoint before you create a PDF. You can also delete them from the Slide Master.

Save your work Save your template as a PowerPoint document. For printing, save as PowerPoint of “Print-quality” PDF.

Print your poster When you are ready to have your poster printed go online to PosterPresentations.com and click on the “Order Your Poster” button. Choose the poster type the best suits your needs and submit your order. If you submit a PowerPoint document you will be receiving a PDF proof for your approval prior to printing. If your order is placed and paid for before noon, Pacific, Monday through Friday, your order will ship out that same day. Next day, Second day, Third day, and Free Ground services are offered. Go to PosterPresentations.com for more information.

Student discounts are available on our Facebook page. Go to PosterPresentations.com and click on the FB icon.

©  2013  PosterPresenta/ons.com          2117  Fourth  Street  ,  Unit  C                            Berkeley  CA  94710          posterpresenter@gmail.com  

Human T-cell Lymphotropic Virus type-1 (HTLV-1) infects an estimated 20 million people worldwide causing a fatal T- cell leukaemia and inflammatory conditions, such as HTLV-1-associated myelopathy, resulting from a dysregulated inflammatory response to the virus. HTLV-1 is highly endemic to remote indigenous communities in Central Australia where infection contributes to racial disparities in morbidity and mortality. HTLV-1 related complications are associated with elevated numbers of T-cells in which the HTLV-1 provirus integrates (HTLV-1 proviral load, PVL). Digital-droplet PCR (ddPCR) is capable of absolute quantification of PVL, offering low variability between assays with few cell numbers. Using ddPCR, we measured HTLV-1 PVLs from buffy coat cells (BCCs) of infected individuals, and bronchoalveolar lavage (BAL) infiltrates from a bronchiectasis patient.

INTRODUCTION  

MATERIALS  &  METHODS  

LITERATURE  CITED  

1.  Einsiedel L et al., 2014. “High HTLV-1 subtype C proviral loads are associated with bronchiectasis in Indigenous Australians: Results of a case-control study.” Oxford Journal Open Forum Infect.

2.  Kamihira S et al., 2010. “Intra-and inter-laboratory variability in HTLV-1 PVL quantification using rtPCR assays: a multi-center study.” Cancer Sci. 101, 2361-67.

3.  Niederer H and Bangham C., 2014. “Integration site and clonal expansion in human chronic retroviral infection and gene therapy.” Viruses, 6, 4140-64.

Department of Microbiology, at the Peter Doherty Institute for Infection and Immunity, University of Melbourne1; Baker IDI Heart & Diabetes Institute2

Yurick  D1,  Pham  H2,  Einsiedel  L2,  Khoury  G1,  Purcell  DFJ1  

DIGITAL  DROPLET  PCR  QUANTIFICATION  OF  HUMAN  T-­‐LYMPHOTROPIC  VIRUS  TYPE-­‐1  CLADE  C  IN  PERIPHERAL  BLOOD  AND  LUNG  INFILTRATES  OF  INDIGENOUS  

AUSTRALIAN  BRONCHIECTASIS  PATIENTS    

CONCLUSION  The ddPCR assay demonstrates extremely high sensitivity, low assay-variability and the capability to reliably quantify HTLV-1 PVL. The power of ddPCR exhibits unparalleled precision enabling small fold differences in target DNA sourced from cell debris. This technique offers logistic advantages in studying relationships between PVL from HTLV-1 patient’s BCCs and BALs.

In this study, variation in PVL between patients was detected, which has been previously described as a result of mutations in target regions or multiple integrations of the proviral genome (Kamihira et al, 2010). PVL variations might be a result of differences between individual host immune response and viral genetics (Niederer and Bangham, 2014).

HTVL-1c PVL of all patient samples were well within the range of detectability of the ddPCR assay. Of the 30 BCCs, the PVL ranged from 143 – 297,800 proviral copies per 106 cells. The BAL sample PVL was 1,110 DNA copies per 106 cells. Using ddPCR to detect HTLV-1 viral targets, the LoD was determined at 3 copies of proviral DNA per 106 cells, which is 30-fold more sensitive than a qPCR LoD assay previously used to measure HTLV-1 from the same patient cohort (Einsiedel et al., 2014). The ddPCR assay is able to measure HTLV-1 PVL at sample amounts lower than the LoD for qPCR, allowing early detection of HTLV-1 seropositive patients.

ACKNOWLEDGMENTS  I would like to thank all the participants who volunteered biospecimens. I respectfully acknowledge the traditional custodians of this land, of elders past and present, on which this research study takes place. I would like to thank Prof. Damian Purcell (University of Melbourne at the Peter Doherty Institute for Infection and Immunity); Dr. Georges Khoury (Peter Doherty Institute); Dr. Lloyd Einsiedel (Baker IDI) for engaging discussions that motivate my postgraduate research. This study has received funding from the Australian Government’s International Research Scholarship program and University of Melbourne’s Fee Remission Scholarship program.

All samples were from Alice Springs Hospital HTLV-1 cohort (30 BCCs, 1 BAL) and obtained following ethics approval (HREC-14-249) and patient consent in first language. Genomic DNA was extracted from BCC and BAL samples using DNA extraction kit (Qiagen) and used for ddPCR PVL quantification. This assay was performed in 40 µl PCR mixture volume consisting of Supermix no dUTPs (Bio-Rad) containing DNA polymerase, 900nM/250nM of each oligonucleotide primer/probe, and 50ng of DNA extracted from peripheral blood or lung infiltrate. Details of HTLV-1 gene amplification were: 10min/95°C followed by 40 cycles of (95°C/30s, 58°C/30s, 72°C/30s). HTLV-1c gag/tax primer sequences and FAM/MGB probes were optimized using temperature gradient amplification. The sequence of these primers and probes were; Gag-for: 5’CAAATGAAGGACCTACAGGC3’; 3’ Gag-rev: 5’TATCTAGCTGCTGGTGATGG3’; Gag-Probe: 5’FAM-ACCATCCGGCTTGCAGT-MGBNFQ3’; Tax-for: 5’TCCAGGCCTTATTTGGACAT3’; Tax-rev: 5’CGTGTGAGAGTAGGACTGAG3’; Tax-Probe: 5’FAM-CATGATTTCCGGGCCTTGC-MGBNFQ3’.

Samples were tested in duplicate relative to an internal reference gene standard, ribonuclease protein 30kDa subunit (RPP30) and negative template controls (NTC). QuantaSoft software was used for data analysis. Plasmid constructs with HTLV-1-specific viral sequences were diluted to characterize the distribution of measured droplet events at the upper and lower limits of detection. The sensitivity of the method used is 3 copies of proviral DNA per 106 cells.

Contact:    dyurick@student.unimelb.edu.au  

Generation of individual droplets using microfluidics

Fluorescence readings per droplet measures in FAM/HEX channels

DNA Primers/Probes

MasterMix

Apply Thresholds and Calculate Concentrations

Tax    primer/probe  

Gag    primer/probe  

Prepare sample and Partition into droplets

Thermal cycle to endpoint and read droplets

40-50 cycles in 96 well plate

Single PCR sample partitions into 20,000 droplets

Generated droplets transferred to 96 well PCR plate

Automated droplet reader singulates droplets prior to detection

Modeling as Poisson Distribution Copies per droplet = -ln(1-p)

Where p = fraction of + droplets

ddPCR Limit of Detection (LoD) targeting HTLV-1c gag and tax

A 1:5 series dilution of plasmid containing HTLV-1c viral targets (pCRII-gag and pCR-II-tax) were used to determine the number of HTLV copies. Comparison of the observed number of copies from each target (y-axis) with the expected number of copies (x-axis) provides an estimation of the assay accuracy.

The dilution series show linearity from 3.2 to 1x105 copies/well. Where the data points stray from linearity represents the lower LoD (3.24 copies per well), and the machine fails to provide accurate sample measurement.

Proviral Load (PVL) is defined as the number of HTLV-1 copies per 106 cells. Gag and tax-specific viral sequences were measured in duplicate for each patient (except #3,9,15), with RPP30 used as an internal reference gene. LoD using ddPCR was previously determined as 3 copies per 106 cells, and the ddPCR assay is well within the range of detecting the presence of HTLV-1 targets gag and tax. There are several points just at or below the LoD using qPCR to detect regions of HTLV-1c. Targeting both HTLV-1-gag and tax resulted in similar mean HTLV-1c PVL (~1000 HTLV+ per 106 cells).

ddPCR analysis of HTLV-1c seropositive patients #9-31 displays excellent separation between positive droplets (blue) and negative droplets (black). Two channels were used simultaneously to detect a fluorescent 5’ reporter (FAM-HTLV1, Ch1) or (HEX-RPP30, Ch2). Unlike qPCR, measurement of target DNA does not require a standard curve. The non-template control (NTC) displays an entirely negative droplet population which determines threshold set point. RPP30 is a ubiquitous housekeeping gene found in humans that has been used as an internal reference gene to calculate the PVL.

RESULTS  

ddPCR analysis of HTLV-1c seropositive patients

PVL of HTLV-1c seropositive patients

HTLV-1

Gag+ Gag+ RPP30+

RPP30+ Gag- RPP30-