differentiation of human dermal mesenchymal...

Hindawi Publishing CorporationISRN Stem CellsVolume 2013 Article ID 687282 9 pageshttpdxdoiorg1011552013687282

Research ArticleDifferentiation of Human Dermal Mesenchymal StemCells into Cardiomyocytes by Treatment with 5-AzacytidineConcept for Regenerative Therapy in Myocardial Infarction

Pravin D Potdar and Preeti Prasannan

Department of Molecular Medicine amp Biology Jaslok Hospital amp Research Centre 15 Dr G Deshmukh MargMumbai 400026 Maharashtra India

Correspondence should be addressed to Pravin D Potdar ppotdarjaslokhospitalnet

Received 31 January 2013 Accepted 7 March 2013

Academic Editors F Fagioli and I Rich

Copyright copy 2013 P D Potdar and P PrasannanThis is an open access article distributed under theCreative CommonsAttributionLicense which permits unrestricted use distribution and reproduction in anymedium provided the originalwork is properly cited

Myocardial infarction (MI) is the leading cause of death worldwide Stem cells regenerative medicine offers a promising approachto cure such degenerative disorders Mesenchymal stem cells are thought to be one of the important types of stem cells whichcan differentiate into various lineages such as neuron hepatocytes and cardiomyocytes In the present study human dermalmesenchymal stem cells (hDMSCs) have been developed from human scalp punch biopsy and characterized for their mesenchymalphenotype so that these cells can be useful for differentiating into cardiomyocytes 5-Azacytidine induces cardiomyocytedifferentiation in vitro and therefore it has been used to differentiate hDMSCs cells into cardiomyocytes It was observed thathDMSCs differentiated into cardiomyocyte within a period of 4 days to 15 days after treatment with 10120583M and 20 120583M of 5-azacytidine The cardiomyocyte phenotype was confirmed by studying expression of 120572-cardiac actin 120573-myosin heavy chain andcardiac troponin TThus this paper describes the differentiation of hDMSCs into cardiomyocytes which can be further be used fortreatment of MI This type of cell-based cardiac therapy will offer a new hope for millions of patients worldwide who are sufferingfrom heart disease

1 Introduction

Myocardial Infarction (MI) is most commonly known asheart attack It is one of the leading causes ofmortality all overthe world mainly due to constant change in lifestyle with everincreasing stress MI is not only seen among the 50ndash60-year-age group but presently has also become a common reasonfor death in the younger generation MI is caused due toshortage of blood supply to a part of the heart which reducesthe oxygen supply to the affected area leading to necrosis ofthe tissue (scar formation) and there is no complete recoveryafter such damage in adult humans [1] For several decadesheart transplantation has been an option for therapy but dueto complications arising from host-graft rejection reactionand shortage of healthy donors there is an immediate needto come up with other feasible options for the therapy of MI

Recent development in stem cell research therapy andcell transplantation delivers great promise for the treatmentof cardiovascular disorders [2 3] Stem cells show immensepromise for their application in medical field due to their

unique ability to self-renew along with the potential to differ-entiate into different cell types Such remarkable propertiesof stem cells show great promise in the field of regenerativemedicine [4]

Mesenchymal stem cells are a population of adult mul-tipotent unspecialized cells which can be isolated culturedexpanded in vitro and differentiated into various lineagesEarlier bonemarrowwas considered to be themajor source ofMSCs [5] Recent studies have investigated various parts fromthe human body such as umbilical cord cord blood dentalpulp adipose tissue and peripheral blood tumour and canbe used for development of MSCs [6ndash12]

In earlier days a general concept regarding MSCs wasthat their differentiation is restricted only to few cell typessuch as adipocytes chondrocytes and osteocytes [13ndash15]However recent studies have proven the ability of MSCsto differentiate into cell types of all three lineages includ-ing cardiomyocytes [16ndash19] The major advantage involvedin utilising these MSCs for therapeutic purpose is their

2 ISRN Stem Cells

Table 1 Primer sequence for cardiac specific genes

Gene Sequence Base pair

120572-cardiac actin F 51015840TCTATGAGGGCTACGCTTTG31015840 259R 51015840GCCAATAGTGATGACTTGGC31015840

Cardiac troponin T F 51015840AGAGCGGAAAAGTGGGAAGA31015840 234R 51015840CTGGTTATCGTTGATCCTGT31015840

120573-myosin heavy chain F 51015840CGAGGCAAGCTCACCTACAC31015840 318R 51015840CATTAACAGCCTCCACGGCC31015840

Experiment 1ndash48 hours of 5-azacytidine treatment (cultured for 15 days)

Experiment 2ndash4 days of 5-azacytidine treatment


Figure 1 It gives the complete outline of the different sets ofexperiments carried out In experiment set 1 hDMSCs were treatedwith 5-azacytidine at concentrations of 10120583M and 20120583M for 48hours followed by culture in normal growthmedia for 15 days In thesecond and third set of experiments the hDMSCs cells were providedwithmedia containing 5-azacytidine (10 120583Mand 20120583M) for a periodof 4 and 8 days respectively

remarkable immunosuppressive properties that can inhibitthe proliferation and function of major immune cells includ-ing T cells B cells and NK cells [20]

Researchers have shown the differentiation of MSCsderived from sources like bone marrow into cardiomyocytesafter treatment with 5-azacytidine a chemical analogue ofcytosine nucleoside [19 21ndash23]

However not much research has been carried out ondifferentiation of skin-derived MSCs into cardiomyocytesusing 5-azacytidine Ourmain objective is to find aminimallyinvasive and feasible source of human MSCs which can bereadily available and utilized for treatment of various car-diovascular disorders Skin occupies almost 90 of humanbody and thus availability of skin tissue for developmentof MSCs is the most advantageous in view of regenerativetherapies Recently our laboratory has developed humandermal mesenchymal stem cells line (hDMSCs) derived fromhuman-scalp punch biopsy from androgenic alopecia patient[24]

We have therefore proposed to use established hDMSCsline to differentiate into cardiomyocytes by treatment with5-azacytidine The differentiation of skinMSCs cells intocardiomyocytes will be confirmed by using phase-contrastmicroscopy as well as by using cardiac specific markerssuch as 120572-cardiac actin 120573-myosin heavy chain and cardiacTroponin T The derived cells will be then beneficial forregenerative therapies in MI patients thereby giving hopes tomillions of patients suffering fromMI

2 Materials and Method21 Processing and Isolation of Mesenchymal Stem Cells fromHuman Scalp Biopsy Scalp tissue punch biopsy was received

from a female patient diagnosed with androgenic alopeciafrom Jaslok Hospital with consent from the patient as perguidelines of the Ethical Committee of Jaslok Hospital andResearch Centre The mesenchymal stem cell line was devel-oped from this tissue explant and designated as the humandermal mesenchymal stem cells (hDMSCs) [24] Presentlythis cell line is at passage 12 and is growing wellThe hDMSCswere maintained in Dulbeccorsquos modified medium (DMEMHiMedia India) supplemented with 10 fetal bovine serum(FBS Gibco Invitrogen) 1 penicillin-streptomycin (HiMe-dia India) 1 120583lmL insulin (Sigma USA) and 2 120583lmL glu-tamine (HiMedia India) as normal growth media CulturedhDMSCs were maintained at 37∘Cwith 5 carbon dioxide ina CO2incubator (Thermo Scientific) and fresh media were

fed every alternate day to these cells

22 Growth Rate Analysis of Human Dermal Mesenchy-mal Stem Cell Line The growth rate of hDMSCs wasdetermined by MTT (3-(43-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide) assay MTT is reduced toformazan crystals in the mitochondria and this reactionis catalysed by the enzyme mitochondrial dehydrogenaseThe formazan crystals absorb light at around 620 nm andthus provide a measurement of viable cells The rate ofcell proliferation was recorded by monitoring conversion ofMTT to formazan crystals The hDMSCs were counted usingNeuberrsquos haemocytometer and seeded at a density of 1 times 103cells per well in a 96-well plate This experiment was donein triplicates Cells at the same density were seeded everyday for the next 8 days Cells were given complete growthmedia and media change was given every alternate day Onthe 8th day media was removed and replaced with 90 120583l offresh media and 10 120583l of MTT (HiMedia India) without anyexposure to light and incubated for 4 hours at 37∘C in CO

2

incubator After 4 hours media was removed and replacedwith dimethyl sulfoxide (DMSOMerck) and absorbance wasmeasured at 620 nm on microplate reader model SUNRISE(Tecan India)

23 Morphological Analysis Using Phase-Contrast andLight Microscopy

231 Phase-Contrast Microscopy The morphology of cul-tured cells was observed using phase-contrast microscope(Carl Zeiss Co) which was attached to the computer havingTSView software for observing and capturing the images

ISRN Stem Cells 3

(a) (b) (c)

Figure 2 (a) shows the phase-contrast micrographs of confluent hDMSCs cell line at passage 12The cultures seem to be healthy and growingwell (b) represents the lightmicroscope image of Giemsa stained hDMSCsThe cells have a distinct and round nucleus with slight cytoplasmicgranules (c) shows the light microscope images of hDMSCs stained with Oil Red O stain wherein the red stain was taken up by the oilsecretions of the cell and not by the cell itself

08

06

04

02

01 2 3 4 5 6

Number of days

MTT assay

Abso

rban

ce

Figure 3 It shows bar graph indicating the growth rate of hDMSCscell line The standard deviation of MTT assay reading taken fromday 1 to day 6 was plotted on a graph which shows the steady rise inthe cell proliferation rate

The cells were observed under 20x and 40x magnificationCells were regularly monitored using phase-contrast micro-scope and images were captured for analysis

232 Light Microscopy For morphological analysis by lightmicroscopy hDMSCs were grown on sterile cover slips andmaintained in normal growth media for 2 days till cellsshowed partial confluence prior to staining

Giemsa staining was done to analyse the basic morphol-ogy of hDMSCs cell line Approximately 1 times 104 cells wereplated on sterile cover slips placed in 35mm dishes (nunc)and fixed with 50 methanol Cells were then treated withfiltered Giemsa Stain (Fisher Scientific) followed by washingwith distilled water and observation under light microscope

Oil Red O staining was performed to study the lipidnature of hDMSCs For staining approximately 1 times 104 cellswere plated on sterile cover slips placed in 35mm dishes

CD 105

CD 73

CD 34

CD 13

OCT-4

SOX-2

NANOG

LIF

Keratin-18

120573-actin

378 (BP)

1007 (BP)

195 (BP)

574 (BP)

310 (BP)

264 (BP)

256 (BP)

454 (BP)

356 (BP)

417 (BP)

100 B

P la

dder

+V

E co

ntro

l

Der

mal

MSC

s

Figure 4 Characterization of hDMSCs cell line using molecularmarkers showing positive expression of CD105 CD73 CD13 CD44Oct-4 SOX-2 NANOG LIF keratin-18 and 120573-actin

(nunc) and fixed with 50 methanol followed by washingwith distilled water and later these cells were treated with60 isopropanol before treating with the Oil Red O stain(Sigma Aldrich) and observed under light microscope

Alizarin Red staining was performed to study the changesin the basic protein structure of cells following 5-azacytidinetreatment For staining with Alizarin Red and 1 times 104hDMSCs cells were plated and treated for a period of 4 dayswith 5-azacytidine (10120583M and 20120583M) along with untreatedcontrol hDMSCs On completion of 4 days cells were fixed

4 ISRN Stem Cells

(a) (b) (c)

Figure 5 (a) shows phase-contrast micrographs of untreated control hDMSCs which showed typical MSC-like phenotype (b) shows longelongated tube-like cells seen on day 14 after hDMSCs were treated with 10120583M of 5-azacytidine for 48 hours (c) shows day 14 of hDMSCstreated with 20 120583M-of 5-azacytidine for 48 hours These cells showed cardiomyocyte-like cell elongations and cytoplasmic granularity

Con

trol

Cardiac actin

Cardiac troponin

120573-myosin heavychain

120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M

Figure 6 Gel electrophoresis analysis of cardiac specific genes ofexperiment set 1 shows that 5-azacytidine treated (10120583Mand 20120583M)hDMSCs were positive for 120572-cardiac actin 120573-myosin heavy chainand cardiac troponin T whereas untreated cells were positive for 120572-cardiac actin and negative for 120573-myosin heavy chain and cardiactroponin T

with 70 ethanol for 1 hour and stained with Alizarin Red Sstain (Fisher Scientifics) and incubated at room temperaturefor 30 minutes

24 Cardiomyogenic Differentiation of Human Dermal Mes-enchymal Stem Cells To induce cardiac differentiation ofhDMSCs cells from passage 12 were treated with 10 120583M and20120583M with 5-azacytidine (Sigma-Aldrich Co) for differenttime intervals Three sets of experiments were carried out48 hours treatment 4 days treatment and 8 days treatmentas outlined in Figure 1 For each experiment around 1 times 104cells of hDMSCs were seeded in 65mm culture dishes (nunc)in three batches of which two were treated with 10 120583M and20120583Mof 5-azacytidine respectively (on the second day afterseeding) and the third batch was untreated and maintainedin normal growth media as control group

For the first experiment hDMSCs were exposed to 5-azacytidine in the growth medium for a short period of 48hours after which cells were maintained in normal growth

media (without 5-azacytidine) and the cells were allowedto differentiate over a period of 15 days These cells wereobserved every day for any morphological changes After15 days clear morphological changes were observed in thetreated cells which were therefore fixed for light microscopyand gene expression studies

Similarly the second and third set of experimentsinvolved treatment of hDMSCs for a period of 4 days and8 days respectively after which the cells were sacrificed formolecular studies

25 Characterization of hDMSCs Cells UsingMolecular Mark-ers Total RNA was extracted from treated and untreatedhDMSCs cells as described above RNA was extractedusing TRIzol Reagent (Invitrogen) and quantified by usingspectrophotometer (Eppendorf Germany) The cDNA wassynthesized using cDNA preparation kit using RandomHexamers as primers from Applied BiosystemsThe protocolconditions were at 25∘C for 10min 37∘C for 120min andterminated at 85∘C for 5 sThe synthesized cDNAwas used toperform reverse transcriptase PCR to evaluate the expressionof CD105 CD73 CD13 CD45 CD34 LIF Oct4 Sox2NANOG and keratin 18 and beta-actin gene was used as ahousekeeping gene to evaluate the efficiency of the reactionThe primer sequences and PCR conditions for the abovedescribed genes are referred from our previous studies [9 12]All primer sequences used for molecular marker study werechecked for their respective product size by using BioEditsoftware which aligned to their original sequences fromNCBI

To determine the differentiation of hDMSCs to cardiomy-ocytes expression of cardiac-specific genes like 120572-cardiacactin cardiac troponin-T and 120573-myosin heavy chain wereanalysed The primer sequence for cardiac-specific genes hasbeenmentioned in Table 1The thermal profile for PCRwas at95∘C for 5min with denaturation at 94∘C for 30 s annealingat 57∘C for 30 s followed by a 1min extension at 72∘C and anadditional 7minute final extension after the completion of thelast cycle The PCR products were analysed using 2 agarose

ISRN Stem Cells 5

(a) (b) (c)

Figure 7 (a) shows phase-contrast micrographs of untreated control hDMSCs which showed no change in morphology (b) shows stick-likeappearance on day 4 when hDMSCs were treated with 10120583M of 5-azacytidine for 4 days These cells became thinner and aligned parallel toeach other (c) shows cardiomyocyte-like appearance of hDMSCs treated with 20120583M-of 5-azacytidine on day 4These cells are seen in groupsof 6-7 cells

Cardiac actin

Cardiac troponin

120573-myosin heavy chain

120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M

Figure 8 Gel electrophoresis analysis of PCR products of cardiacspecific genes of experiment set 2 shows that 5-azacytidine treated(10120583M and 20 120583M ) hDMSCs were positive for 120572-cardiac actin 120573-myosin heavy chain and cardiac troponin T while untreated cellswere positive for 120572-cardiac actin and negative for 120573-myosin heavychain and cardiac troponin T

gels for electrophoresis and image was taken under UV light(Cell Biosciences)

3 Results31 Morphological Analysis of Human Dermal MesenchymalStem Cell Line Figure 2(a) shows well-growing confluentcultures of hDMSCs cell line having spindle-like cells withdistinct round nucleus and nuclei with scanty cytoplasmicgranules giving it almost clear appearance These cells growlonger with more or less smooth edges Giemsa staining wasperformed to study the general morphology and cytoplasmicstructure of the cell lines The Giemsa stained cells showclearmorphology of these cells with nucleus positioned in thecentre as shown in Figure 2(b) Oil Red O staining showedthat these cells were negative for Oil Red O staining whereasthis stain was taken up by the oil droplets secreted by thesecells Thus it was indicated that there is no spontaneousdifferentiation of these cells into adipocytes (Figure 2(c))

32 Growth Rate Analysis of Human Dermal MesenchymalStem Cell Line The plot of MTT assay (Figure 3) specifically

shows the increase in cell proliferation with the progressionof days (up to day 6) The doubling rate of dermal cells wasobserved to be around 36 hours

33 Molecular Characterisation of Human Dermal Mesenchy-mal Stem Cell Line To confirm that hDMSCs line isolatedfrom explants maintained phenotype even at passage 12 theywere checked for expression of genes specific for mesenchy-mal stem cells hematopoietic stem cells and pluripotencyThe hDMSCs showed expression of mesenchymal stem cellsmarkers like CD105 CD73 and CD13 There was slightexpression of CD34 a haematopoietic marker HoweverCD45 was not expressed (data not shown)

Furthermore to study the pluripotency of these cellsexpressions of OCT-4 SOX-2 and NANOG were checkedThe cultured cells express OCT-4 SOX-2 and NANOGsuggesting that these cells have the potency to differentiateinto other cell types when induced These cells were alsostrongly positive for LIF expression thus indicating thatthese cells maintain themselves in an undifferentiated stateHowever keratin-18 expression confirmed their epithelialnature 120573-actin was used as a house-keeping gene

The characterization studies show that human dermalmesenchymal stemCell line developed from the human scalppunch biopsy is none other than mesenchymal stem cellswhich are multipotent and thus can be further utilised fordifferentiation studies

34 Differentiation of Human Dermal Mesenchymal Stem CellLine into Cardiomyocytes

341 Phase-Contrast Microscopy for hDMSCs after 48 Hoursof 5-Azacytidine Treatment In the first set of experimentinitially no changes in the morphology were observed Slightelongations of cells were seen around day 3 and as timeprogressed cells started thinning out It was only at the endof two weeks that very long and tube-like cells with densegranules in the cytoplasm and the nucleus slightly positioned

6 ISRN Stem Cells

(a) (b) (c)

Figure 9 (a) Shows-phase contrast micrographs of untreated control hDMSCs with no changes in morphology (b) shows cells on the 8thday showing stick-like morphology and cells were seen in groups (c) shows cardiomyocyte-like appearance of hDMSCs treated with 20 120583Mof 5-azacytidine on day 8 These cells were seen in groups of 6-7 cells

Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M

Figure 10 Gel electrophoresis analysis of cardiac-specific genesof experiment set 3 shows that 5-azacytidine treated (10120583M and20 120583M) hDMSCs were positive for 120572-cardiac actin 120573-myosin heavychain and cardiac troponin T while untreated cells were positive for120572-cardiac actin and negative for 120573-myosin heavy chain and cardiactroponin T

away from the centre were seen as shown in Figures 5(a) and5(b)

342 Molecular Characterization of 48 Hour 5-AzacytidineTreated hDMSCs The gene expression studies revealed that120572-cardiac actin was expressed by 10 120583M and 20120583M of 5-azacytidine treated hDMSCs and control cells The untreatedcells were negative for cardiac troponin T and 120573-myosinheavy chain whereas 10 120583M and 20120583M of 5-azacytidinetreated hDMSCs cells showed positive expression of boththese genes indicating that hDMSCs cells differentiated intocardiomyocytes

There was not much variation between the 10 120583M and20120583M 5-azacytidine treated hDMSCs in expression of thesemarkers

343 Phase-Contrast Microscopy for hDMSCs after 4 Days of5-Azacytidine Treatment These cells showed morphologicalchanges from the third day after treatment As comparedto control dermal cells treated cells became thinner andlonger By the third day clusters of 4-5 cells were seen These

cells aligned parallel to each other in these clusters By thefourth day the cells show a peculiar stick-like appearanceThis stick-like appearance and the parallel alignment givesthe plate an overall striated patternThese cells looked healthyand not much cell death was seen after treatment Treatedcells showed cardiomyocyte-like elongations as compared tocontrol cells (MSCs) The cytoplasm seemed denser withgranules as compared to untreated cell (Figure 7)

344 Molecular Characterization of 4 Days 5-AzacytidineTreated hDMSCs Cells The molecular characterisation of10 120583M and 20120583M 5-azacytidine treated hDMSCs revealedthat these cells showed positive expression of cardiac specificgenes 120572-cardiac actin cardiac troponin T and 120573-myosinheavy chainThe untreated hDMSCs showed positive expres-sion of 120572-cardiac actin but were negative for cardiac troponinT and 120573-myosin heavy chain The gene expression analysisof the second set of experiment showed similar pattern ofexpression as compared to the first set (Figure 8) howeverthe intensity of expression is not as high as that seen in the 48hours treated 5-azacytidine treated hDMSCs (Figure 6)

345 Phase-Contrast Microscopy for hDMSCs after 8 Days of5-Azacytidine Treatment Morphological changes were seenby the third day of induction in both 10 120583M and 20 120583M 5-azacytidine treated hDMSCs By the third and fourth day oftreatment the cells started becoming thinner as compared tothe untreated cells and formed clusters of 6-7 cells alignedparallel to each other as shown in Figure 9(b) At highermagnification the cytoplasm showed dense granules and alarge nucleus as shown in Figure 9(c)

346 Molecular Characterization of 8 Days 5-AzacytidineTreated hDMSCs As seen before the gene expression anal-ysis of the third set of experiment revealed an expressionpattern similar to the second set The 10 120583M and 20120583M of5-azacytidine treated hDMSCs showed positive expressionof 120572-cardiac actin cardiac troponin T and 120573-myosin heavychain whereas the untreated cells showed positive expression

ISRN Stem Cells 7

(a) (b) (c)

Figure 11 (a) shows light micrographs of Alizarin Red staining of control hDMSCs Nomorphological changes seen in this group of cells (b)shows light micrographs of Alizarin Red staining of 10120583M-5-azacytidine treated hDMSCs These cells showed distinct web-like extensionsin cytoplasm (c) shows light micrographs of Alizarin Red staining of 20 120583M 5-azacytidine treated hDMSCs These cells showed web-likeextensions in cytoplasm in greater frequencies as compared to 10120583M 5-azacytidine treated hDMSCs

of120572-cardiac actin andnegative expression of cardiac troponinT and 120573-myosin (Figure 10) however the intensities of bandswere low as compared to 48 hours treated hDMSCs as shownin the Figure 6

347 Calcium Deposition Analysis Alizarin red is used in abiochemical assay to determine calcium deposited quantita-tively by colorimetric analysis In our study we performedAlizarin Red staining to check for any change in mineraldeposition in hDMSCs after being treated with 5-azacytidineClear calcium deposits were stained in cells treated with 5-azacytidine as shown in Figure 11

4 Discussion

Myocardial infarction causes a permanent damage to theheart which cannot be repaired in the adult human Theconventional line of treatment only relieves the symptomsbut does not restore necrotic tissue [1 2] Thus stem cell-based regenerative therapy could be one of the best availablelifesaving options for patients suffering from MI Howevermany questions remain unanswered about the mechanismof cardiac differentiation of MSCs in in vivo conditions andfurther studies are needed in this area of research [25] Thuswe propose a safer and more appropriate line of treatmentwhich includes isolation of dermal MSCs stem cells frompatientrsquos skinwhich can be differentiated into cardiomyocytesin vitro for regenerative therapies for MI and thus providingpatient-specific cardiomyocytes for cure ofMI Recently LiorGepstein from the TechnionmdashIsrael Institute of Technologyhas reported the use of human skin cells of elderlyMI patientsto make healthy beating heart tissue which can be used totreat this condition in near future [26]

Several research groups have reported that 5-azacytidineinduces murine MSCs to differentiate into cardiomyocytesin vitro [25 27] Similar work has been done by Liu andcoworkers on rat bone marrow (BM) MSCs however thiswork has shown that only immortalized rat BMMSCs coulddifferentiated into cardiomyocytes [21] A recent study byAntonitsis et al has shown that the adult human BMMSCscan differentiate into cardiomyocytes in vitro when treatedwith 5-azacytidine (10120583M) [22] Similarly Xu et al have

shown that human BMMSCs could be isolated and used forrepairing damaged heart [23] Based on these studies we haveused our own developed hDMSCs cell line for differentiationof these cells into cardiomyocytes [24] Before differentiationwe have reconfirmed their MSCs phenotypes by using MSCsmolecular markers such as CD105 CD73 and CD13 and cellgrowth rate pluripotency and differentiation characteristicsof these cells which were prominently expressed even atpassage 12 are shown in Figures 3 and 4 Therefore we haveused this cell line to differentiate into cardiomyocytes by 5-azacytidine

Moreover isolation of MSCs from bone marrow is aninvasive procedure and therefore it is not a practical optionto obtain samples from a patient so easily On the otherhand human skin is one of the most abundant tissues whichcan be easily accessible anytime by a minimally invasivepunch biopsy procedureThus based on the present study werecommend skin as a potential source of human adult MSCswhich can differentiated into cardiomyocytes and can be usedfor regenerative therapeutic for MI

Morphological analysis studies carried out by Antonitsiset al have shown that the hMSCs showed multinucleationand cytoplasmic extensions after a week of treatment with5-azacytidine followed by aggregation of approximately 20ndash30 of cells forming characteristic stick-like appearance andat four weeks these cells enlarged in size and connectedwith adjoining cells forming myotube-like structures [22] Inthe present study hDMSCs showed similar morphologicalchanges within 3-4 days of induction when treated with 5-azacytidine (10 120583M and 20120583M) showing typical myotube-like structures confirming hDMSCs differentiation into car-diomyocytes These cells appeared thinner giving them typ-ical stick-like appearance and aligned parallel to each otherforming connections Small bunches of 4-5 parallel cellswere observed and grew larger in size Higher magnificationsrevealed that the cell cytoplasm became dense with granulesand the position of the nucleus shifted slightly away fromthe centre a typical feature also reported by the other studies[22 23]

Several studies have reported the expression of cardiacspecific markers like 120572-cardiac actin cardiac troponin T and120573-myosin Heavy Chain to confirm cardiomyocyte differenti-ation [19 21ndash23] The gene expression analysis in the present

8 ISRN Stem Cells

study confirms that 5-azacytidine (10120583M and 20120583M) treatedhDMSCs can differentiate into cardiomyocytes Cardiac actinmonomers are principle components of the thin filament ofcardiac muscle myofibrils and sarcomeres The sarcomere isthe basic structural element that mediates the contractionof cardiac muscle [28] Cardiac troponin T is known to bethe early marker of myogenic differentiation [23] It is aprotein essential for calcium-regulated myofibrillar ATPaseactivity and is expressed in the human heart and is requiredfor muscle contractile movement [29] In our study AlizarinRed staining has shown several calcium granules in thecytoplasm of differentiated cardiomyocytes thus indicatingthat the cells are active and may help to improve musclecontractile movement in MI patients Similarly by molecularstudies it was clearly shown that 5-azacytidine treated cellexpressed cardiac troponin T as shown in Figures 6 8 and10 120573-myosin heavy chain a member of the muscle myosinfamily is one of the subunit proteins encoded by the gene120573-myosin heavy chain is expressed predominantly in normalhuman ventricle [30] In the present study 120573-myosin heavychain expression was seen in differentiated cardiomyocytesindicating that these cells may be useful in repairing damageto heart ventricle

Differentiation of hDMSCs into cardiomyocytes mainlydepends on the treatment protocol followed In the presentstudy it was observed that the cells which were exposed to48 hr of treatment and allowed to differentiate over a periodof 15 days have shown better expression of 120572-cardiac actincardiac troponin T and120573-myosin heavy chain indicating thatthis protocol is more feasible for differentiation of functionalcardiomyocytes than treatment for an extended period of 4days and 8 days as shown in experiment 2 and 3 respectively

5 ConclusionsThis study suggests that as skin is the most abundant andeasily accessible tissue from a patient it will be easier todevelop hDMSCs cell line which can differentiated intocardiomyocytes for the treatment of MI patients in a spanof 2-3 months Thus our method puts forth a safer andminimally invasive technique to provide relief for patientssuffering from coronary disorders like MI However furtherstudies have to be carried out before they are clinically appliedto MI patients

Conflict of InterestsThe authors declare that they have no conflict of interests

AcknowledgmentsThe authors wish to thank themanagement of JaslokHospitaland Research Centre Mumbai India for sanctioning andproviding financial assistance for stem cell research projectno 491 Ac 27814

References

[1] Y S Yoon N Lee and H Scadova ldquoMyocardial regenerationwith bone-marrow-derived stem cellsrdquo Biology of the Cell vol97 no 4 pp 253ndash263 2005

[2] H M Nugent and E R Edelman ldquoTissue engineering therapyfor cardiovascular diseaserdquo Circulation Research vol 92 no 10pp 1068ndash1078 2003

[3] L Reinlib and L Field ldquoCell transplantation as future therapyfor cardiovascular disease a workshop of the National HeartLung and Blood InstituterdquoCirculation vol 101 no 18 pp e182ndashe187 2000

[4] J J Minguell A Erices and P Conget ldquoMesenchymal stemcellsrdquo Experimental Biology and Medicine vol 226 no 6 pp507ndash520 2001

[5] E A Jones S E Kinsey A English et al ldquoIsolation andcharacterization of bone marrow multipotential mesenchymalprogenitor cellsrdquo Arthritis and Rheumatism vol 46 no 12 pp3349ndash3360 2002

[6] L L Lu Y J Liu S G Yang et al ldquoIsolation and charac-terization of human umbilical cord mesenchymal stem cellswith hematopoiesis-supportive function and other potentialsrdquoHaematologica vol 91 no 8 pp 1017ndash1026 2006

[7] O K Lee T K Kuo W M Chen K D Lee S L Hsieh andT H Chen ldquoIsolation of multipotent mesenchymal stem cellsfrom umbilical cord bloodrdquo Blood vol 103 no 5 pp 1669ndash16752004

[8] J Suchanek T Soukup R Ivancakova et al ldquoHuman dentalpulp stem cellsmdashisolation and long term cultivationrdquo ActaMedica vol 50 no 3 pp 195ndash201 2007

[9] P D Potdar and J P Sutar ldquoEstablishment and molecularcharacterization of mesenchymal stem cell lines derived fromhumanvisceralamp subcutaneous adipose tissuesrdquo Journal of StemCells and Regenerative Medicine vol 6 no 1 pp 26ndash35 2010

[10] P D Potdar and R P Subedi ldquoDefining molecular phenotypesof mesenchymal and hematopoietic stem cells derived fromperipheral blood of acute lymphocytic leukemia patients forregenerative stem cell therapyrdquo Journal of Stem Cells amp Regener-ative Medicine vol 7 pp 1ndash10 2011

[11] P D Potdar and S B Drsquosouza ldquoIsolation of Oct4+ Nanog+ andSOX2minus mesenchymal cells from peripheral blood of a diabetesmellitus patientrdquo Human Cell vol 24 no 1 pp 51ndash55 2011

[12] P D Potdar and S Chougule ldquoEstablishment and molecularcharacterization of breast cancer mesenchymal stem cell linederived from human non-metastasis breast cancer tumorrdquo StemCell Discovery vol 1 no 2 pp 21ndash28 2011

[13] I Sekiya B L Larson J T Vuoristo J G Cui andD J ProckopldquoAdipogenic differentiation of human adult stem cells frombone marrow stroma (MSCs)rdquo Journal of Bone and MineralResearch vol 19 no 2 pp 256ndash264 2004

[14] B C Heng T Cao and E H Lee ldquoDirecting stem celldifferentiation into the chondrogenic lineage in vitrordquo StemCells vol 22 no 7 pp 1152ndash1167 2004

[15] K S Park Y S Lee and K S Kang ldquoIn vitro neuronaland osteogenic differentiation of mesenchymal stem cells fromhuman umbilical cord bloodrdquo Journal of Veterinary Science vol7 no 4 pp 343ndash348 2006

[16] J Oswald S Boxberger B Joslashrgensen et al ldquoMesenchymal stemcells can be differentiated into endothelial cells in vitrordquo StemCells vol 22 no 3 pp 377ndash384 2004

[17] K D Lee T K C Kuo J Whang-Peng and Y F Chung ldquoInvitro hepatic differentiation of humanmesenchymal stem cellsrdquoHepatology vol 40 no 6 pp 1275ndash1284 2004

[18] D Woodbury E J Schwarz D J Prockopand and I B BlackldquoAdult rat and human bone marrow stromal cells differentiateinto neuronsrdquo Journal of Neuroscience Research vol 61 pp 364ndash370 2000

ISRN Stem Cells 9

[19] S Makino K Fukuda S Miyoshi et al ldquoCardiomyocytes canbe generated frommarrow stromal cells in vitrordquoThe Journal ofClinical Investigation vol 103 no 5 pp 697ndash705 1999

[20] M Shi Z W Liu and F S Wang ldquoImmunomodulatoryproperties and therapeutic application of mesenchymal stemcellsrdquo Clinical and Experimental Immunology vol 164 no 1 pp1ndash8 2011

[21] Y Liu J Song W Liu Y Wan X Chen and C Hu ldquoGrowthand differentiation of rat bone marrow stromal cells does5-azacytidine trigger their cardiomyogenic differentiationrdquoCardiovascular Research vol 58 no 2 pp 460ndash468 2003

[22] P Antonitsis E Ioannidou-Papagiannaki A Kaidoglou and CPapakonstantinou ldquoIn vitro cardiomyogenic differentiation ofadult human bone marrowmesenchymal stem cellsThe role of5-azacytidinerdquo Interactive Cardiovascular andThoracic Surgeryvol 6 no 5 pp 593ndash597 2007

[23] W Xu X Zhang H Qian et al ldquoMesenchymal stem cells fromadult human bone marrow differentiate into a cardiomyocytephenotype in vitrordquo Experimental Biology and Medicine vol229 no 7 pp 623ndash631 2004

[24] P Potdar and K Dand Kumar ldquoEstablishment and molecularcharacterisation of human dermal mesenchymal like stem cellsderived from human scalp biopsy of androgenetic alopeciapatientrdquo Stem cell Discovery In press

[25] D Orlic J Kajstura S Chimenti et al ldquoBone marrow cellsregenerate infarcted myocardiumrdquo Nature vol 410 no 6829pp 701ndash705 2001

[26] L Zwi-Dantsis I Huber M Habib et al ldquoDerivation andcardiomyocyte differentiation of induced pluripotent stem cellsfrom heart failure patientsrdquo European Heart Journal vol 10 p1093 2012

[27] F P Barry and J M Murphy ldquoMesenchymal stem cells clinicalapplications and biological characterizationrdquo The InternationalJournal of Biochemistry amp Cell Biology vol 36 no 4 pp 568ndash584 2004

[28] S Ebashi ldquoCa2+ and the contractile proteinsrdquo Journal of Molec-ular and Cellular Cardiology vol 16 no 2 pp 129ndash136 1984

[29] A S Zot and J D Potter ldquoStructural aspects of troponin-tropomyosin regulation of skeletal muscle contractionrdquo AnnualReview of Biophysics and Biophysical Chemistry vol 16 pp 535ndash559 1987

[30] A Matsakas ldquoMolecular advances shed light on cardiac myosinheavy chain expression in health and diseaserdquo ExperimentalPhysiology vol 94 no 12 pp 1161ndash1162 2009

Submit your manuscripts athttpwwwhindawicom

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014


MEDIATORSINFLAMMATION

of


Behavioural Neurology

EndocrinologyInternational Journal of



Disease Markers


BioMed Research International

OncologyJournal of



Oxidative Medicine and Cellular Longevity


PPAR Research

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Immunology ResearchHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Journal of

ObesityJournal of



Computational and Mathematical Methods in Medicine

OphthalmologyJournal of


Diabetes ResearchJournal of



Research and TreatmentAIDS


Gastroenterology Research and Practice


Parkinsonrsquos Disease

Evidence-Based Complementary and Alternative Medicine

Volume 2014Hindawi Publishing Corporationhttpwwwhindawicom

2 ISRN Stem Cells

Table 1 Primer sequence for cardiac specific genes

Gene Sequence Base pair

120572-cardiac actin F 51015840TCTATGAGGGCTACGCTTTG31015840 259R 51015840GCCAATAGTGATGACTTGGC31015840

Cardiac troponin T F 51015840AGAGCGGAAAAGTGGGAAGA31015840 234R 51015840CTGGTTATCGTTGATCCTGT31015840

120573-myosin heavy chain F 51015840CGAGGCAAGCTCACCTACAC31015840 318R 51015840CATTAACAGCCTCCACGGCC31015840

Experiment 1ndash48 hours of 5-azacytidine treatment (cultured for 15 days)



Figure 1 It gives the complete outline of the different sets ofexperiments carried out In experiment set 1 hDMSCs were treatedwith 5-azacytidine at concentrations of 10120583M and 20120583M for 48hours followed by culture in normal growthmedia for 15 days In thesecond and third set of experiments the hDMSCs cells were providedwithmedia containing 5-azacytidine (10 120583Mand 20120583M) for a periodof 4 and 8 days respectively

remarkable immunosuppressive properties that can inhibitthe proliferation and function of major immune cells includ-ing T cells B cells and NK cells [20]

Researchers have shown the differentiation of MSCsderived from sources like bone marrow into cardiomyocytesafter treatment with 5-azacytidine a chemical analogue ofcytosine nucleoside [19 21ndash23]

However not much research has been carried out ondifferentiation of skin-derived MSCs into cardiomyocytesusing 5-azacytidine Ourmain objective is to find aminimallyinvasive and feasible source of human MSCs which can bereadily available and utilized for treatment of various car-diovascular disorders Skin occupies almost 90 of humanbody and thus availability of skin tissue for developmentof MSCs is the most advantageous in view of regenerativetherapies Recently our laboratory has developed humandermal mesenchymal stem cells line (hDMSCs) derived fromhuman-scalp punch biopsy from androgenic alopecia patient[24]

We have therefore proposed to use established hDMSCsline to differentiate into cardiomyocytes by treatment with5-azacytidine The differentiation of skinMSCs cells intocardiomyocytes will be confirmed by using phase-contrastmicroscopy as well as by using cardiac specific markerssuch as 120572-cardiac actin 120573-myosin heavy chain and cardiacTroponin T The derived cells will be then beneficial forregenerative therapies in MI patients thereby giving hopes tomillions of patients suffering fromMI

2 Materials and Method21 Processing and Isolation of Mesenchymal Stem Cells fromHuman Scalp Biopsy Scalp tissue punch biopsy was received

from a female patient diagnosed with androgenic alopeciafrom Jaslok Hospital with consent from the patient as perguidelines of the Ethical Committee of Jaslok Hospital andResearch Centre The mesenchymal stem cell line was devel-oped from this tissue explant and designated as the humandermal mesenchymal stem cells (hDMSCs) [24] Presentlythis cell line is at passage 12 and is growing wellThe hDMSCswere maintained in Dulbeccorsquos modified medium (DMEMHiMedia India) supplemented with 10 fetal bovine serum(FBS Gibco Invitrogen) 1 penicillin-streptomycin (HiMe-dia India) 1 120583lmL insulin (Sigma USA) and 2 120583lmL glu-tamine (HiMedia India) as normal growth media CulturedhDMSCs were maintained at 37∘Cwith 5 carbon dioxide ina CO2incubator (Thermo Scientific) and fresh media were

fed every alternate day to these cells

22 Growth Rate Analysis of Human Dermal Mesenchy-mal Stem Cell Line The growth rate of hDMSCs wasdetermined by MTT (3-(43-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide) assay MTT is reduced toformazan crystals in the mitochondria and this reactionis catalysed by the enzyme mitochondrial dehydrogenaseThe formazan crystals absorb light at around 620 nm andthus provide a measurement of viable cells The rate ofcell proliferation was recorded by monitoring conversion ofMTT to formazan crystals The hDMSCs were counted usingNeuberrsquos haemocytometer and seeded at a density of 1 times 103cells per well in a 96-well plate This experiment was donein triplicates Cells at the same density were seeded everyday for the next 8 days Cells were given complete growthmedia and media change was given every alternate day Onthe 8th day media was removed and replaced with 90 120583l offresh media and 10 120583l of MTT (HiMedia India) without anyexposure to light and incubated for 4 hours at 37∘C in CO

2

incubator After 4 hours media was removed and replacedwith dimethyl sulfoxide (DMSOMerck) and absorbance wasmeasured at 620 nm on microplate reader model SUNRISE(Tecan India)

23 Morphological Analysis Using Phase-Contrast andLight Microscopy

231 Phase-Contrast Microscopy The morphology of cul-tured cells was observed using phase-contrast microscope(Carl Zeiss Co) which was attached to the computer havingTSView software for observing and capturing the images

ISRN Stem Cells 3

(a) (b) (c)


08

06

04

02

01 2 3 4 5 6

Number of days

MTT assay

Abso

rban

ce






CD 105

CD 73

CD 34

CD 13

OCT-4

SOX-2

NANOG

LIF

Keratin-18

120573-actin

378 (BP)

1007 (BP)

195 (BP)

574 (BP)

310 (BP)

264 (BP)

256 (BP)

454 (BP)

356 (BP)

417 (BP)

100 B

P la

dder

+V

E co

ntro

l

Der

mal

MSC

s




4 ISRN Stem Cells

(a) (b) (c)


Con

trol

Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M









ISRN Stem Cells 5

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M











6 ISRN Stem Cells

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M










ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















ISRN Stem Cells 3

(a) (b) (c)


08

06

04

02

01 2 3 4 5 6

Number of days

MTT assay

Abso

rban

ce






CD 105

CD 73

CD 34

CD 13

OCT-4

SOX-2

NANOG

LIF

Keratin-18

120573-actin

378 (BP)

1007 (BP)

195 (BP)

574 (BP)

310 (BP)

264 (BP)

256 (BP)

454 (BP)

356 (BP)

417 (BP)

100 B

P la

dder

+V

E co

ntro

l

Der

mal

MSC

s




4 ISRN Stem Cells

(a) (b) (c)


Con

trol

Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M









ISRN Stem Cells 5

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M











6 ISRN Stem Cells

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M










ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















4 ISRN Stem Cells

(a) (b) (c)


Con

trol

Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M









ISRN Stem Cells 5

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M











6 ISRN Stem Cells

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M










ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















ISRN Stem Cells 5

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M











6 ISRN Stem Cells

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M










ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















6 ISRN Stem Cells

(a) (b) (c)


Cardiac actin

Cardiac troponin


120573-actin

260 (BP)

235 (BP)

319 (BP)

417 (BP)

Con

trol

+V

E co

ntro

l

100 B

P la

dder

10 120583M

20 120583M










ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















ISRN Stem Cells 7

(a) (b) (c)




4 Discussion







8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















8 ISRN Stem Cells






References



















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















ISRN Stem Cells 9


















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of





















of






Disease Markers



OncologyJournal of





PPAR Research



Journal of

ObesityJournal of
















differentiation of human dermal mesenchymal...

Documents