development of a toxr-based real-time pcr assay for v
TRANSCRIPT
Development of a toxR-based real-time PCR assay for V. parahaemolyticusA. Powell1, R. Griffin2, C. Baker-Austin1 and R. Hartnell1
1Centre for Environment, Fisheries and Aquaculture Science, Weymouth Laboratory, Weymouth, Dorset, England ([email protected]), 2University of Surrey, Guildford, Surrey, England
IntroductionVibrio parahaemolyticus is a Gram-negative bacterium found naturally in marine and estuarine waters. V. parahaemolyticus is halophillic, oxidase positive, and motile with a single polar flagellum. Globally, V. parahaemolyticus is a significant cause of foodborne disease, and is considered the leading agent of bacterial illness associated with seafood consumption (Joseph et al. 1983). An estimated 40,000 people contract V. parahaemolyticus infections each year in the USA (Scallan et al. 2011), highlighting the clinical burden associated with this pathogen. Several large outbreaks of V. parahaemolyticus have also emerged in Europe in the last decade (Baker-Austin et al. 2010), highlighting the need for improved global surveillance systems. Clinical characteristics of V. parahaemolyticus infections include abdominal cramps, diarrhoea, nausea, headaches, fever, and chills (Honda and Iida 1994, Hardy and Klontz 1996). V. parahaemolyticus symptoms typically resolve in less than 72 hours. A small number of cases have been reported that persist for up to 10 days, but the majority of these cases tend to involve immune-compromised individuals. Several studies have demonstrated that toxR represents the most reliable species-specific molecular target for the identification of V. parahaemolyticus (Croci et al. 2007). Although several conventional PCR assays have been developed and published that target toxR no real time PCR approaches have been published to date. We describe here a real-time PCR assay for toxR that is both specific, reliable, fully quantitative and rapid as well as easy to use.
Materials and methods
Primer and probe design and RT-PCR assayThe complete nucleotide sequences (open reading frame regions only) for all full length toxR nucleotide sequences were aligned using clustalW (Thompson et al. 1994). A segment of the toxR genes was analysed using primer express software from DNASTAR (Madison, WI, USA). The probe and primers were subsequently assessed for species as well as strain specificity using a BLAST search against publically available databases. The primer and probe sequences are listed in Table 1. Our PCR primers and TaqMan probe were designed to specifically target the toxR gene (Fig 1, Table 1). For real-time PCR experiments, the assay comprised of 25 µl, consisting of 12.5 µl TaqMan Universal PCR Master Mix (Applied Biosystems), 0.45 µl each of forward and reverse V. parahaemolyticus primers (100 nM), 5.6 µl nuclease-free water, and 1 µl of probe (500 nM) (Table 1). Five microliters of template (either extracted DNA, plasmids or boiled cell lysate) was then added, and each reaction was performed in triplicate. An ABI PRISM® 7500 Sequence Detection System (CGRB Core Laboratories), was used, and a thermal cycle performed with a two-step PCR protocol: 1 cycle at 95 °C for 10 min followed by 40 cycles at 95 °C for 15 s and 60 °C for 90 s. To test the efficacy of our RT-PCR assay, V. parahemolyticus strains, encompassing geographically diverse isolates, were grown at 28oC for 24 h in tryptone soy broth or on solid agar media, supplemented with 5 g/liter NaCl. Strains were cryogenically stored at -80oC prior to use, supplemented with 20% (vol/vol) glyerol. A total of 77 bacterial strains, including V. parahaemolyticus (n = 60), other Vibrio species (n = 11) and distantly related reference strains (n = 6) was also used to assess the specificity of the oligonucleotide probe and primer sets used (Table 2).
Shellfish bioaccumulation experimentsShellfish bioaccumulation experiments. In this study, two 50 litre-capacity marine tanks were filled with sterile seawater, and maintained at 15 oC (± 1 oC) with constant air sparging. Un-depurated live C. gigas (60) were obtained via a wholesaler, and were evenly distributed into tanks for 24 hours to acclimatize, prior to the addition of bacterial suspensions. For bioaccumulation experiments, a previously identified pathogenic strain of V. parahaemolyticus was grown overnight to late logarithmic stage and subsequently used in all experiments. For each sample, the digestive glands (stomach and digestive diverticula) were removed from each animal and weighed. The digestive glands were subsequently pooled together, and then finely chopped using a sterile razor blade. Homogenates were then prepared by treating the chopped digestive glands with 100 μg/ml Proteinase K solution (30U/mg; Promega) and DNA extracted, as previously described (Baker-Austin et al. 2010). Homogenates were stored at 4 ºC prior to testing using RT-PCR (Figure 1).
ResultsTable 2 summarizes the results of the analyses of the 77 strains examined by real-time PCR. The results demonstrated that the toxR RT-PCR was capable of correctly identifying V. parahaemolyticus on all tested strains (100% accuracy). No amplification of closely related Vibrio or non-Vibrio strains were observed, indicating specificity of the assay (Table 2). Real-time PCR assays were performed on DNA extracted from bioaccumulated shellfish samples. We were able to identify toxR directly from shellfish matrices (data not shown), whereas no signal was evident from control samples, or from extracted water. Using cloned toxR material we demonstrated that the assay could detect down to less than 10 genome copies of target per reaction volume. A serial dilution range of cloned toxR material demonstrated excellent expected dynamic range, with amplification curves approximately 3.3. ct values apart (Figure 2).
ConclusionsIn summary, this real-time PCR assay represents a rapid means of identifying V. parahaemolyticus strains. The assay demonstrated excellent discriminatory powers, as it was confirmed to be 100% accurate in identifying V. parahaemolyticus isolates in our strain library. The assay can be applied directly on isolated strains and bacterial DNA, but also on extracted shellfish matrices. Future work should include the use of this assay alongside pathogenicity markers in V. parahaemolyticus such as trh and tdh (Nordstrom et al. 2007) in a multiplex format. The use of this assay on naturally contaminated shellfish samples should also be a key focus of future work. This tool will enable early detection capability in a range of different applications, such as food processing, regulatory and clinical settings.
Figure 2. Serial dilution of cloned toxR target showing expected amplification curves across a series of 5 orders of magnitude dilution.
Table 1. Primers and probes used in this study
Name Sequence (5’-3’)toxR - F GAACCAGAAGCGCCAGTAGTtoxR - R AAACAGCAGTACGCAAATCGProbe (FAM)- TCACAGCAGAAGCCACAGGTGC-(TAMRA)
Table 2. Percentage accuracy of assay
V. parahaemolyticus strains 60/60 (100% accurate)
Other Vibrio spp.V. alginolyticus ND (8 strains, 0 positive)V. cholerae ND (2 strains, 0 positive)V. vulnificus ND (1 strain, 0 positive)
Other bacteriaS. paucimobilis (NCTC 11030) NDP. aeruginosa (NCTC 10332) NDP. mirabilis (NCTC 10975) NDE .coli (NCTC 12241) NDK. aerogenes (NCTC 9528) NDE. faecalis (NCTC 775) ND
Figure 1. Schematic of major steps used to extract nucleic acid from shellfish matrices
2. Glanding. Diges�ve glands from each shellfish (C. gigas) are cut away from shellfish meat and trimmed with a sterile scalpel.
3. Physical disrup�on. Diges�ve glands from all animals are combined in a sterile petri dish and weighed. Glands are mashed in the presence of equal (w/v)100 mg ml-1 Proteinase K solu�on (30 U mg-1.
5. Nucleic acid extrac�on. Each 500 µl aliquot is processed using a Biomerieux magne�c silica extrac�on procedure, using proprietary alkaline lysis coupled to magne�c silica purifica�on.
1. Shucking. 10 shellfish (C. gigas) are shucked, and the meat from each animal is removed.
4. Incuba�on. Samples are added to a sterile 50 ml falcon tube, and shaken gently at 37 ºC for 1 hour. Samples are then placed in a 65 ºC water bath for 15 min. Samples are subsequently centrifuged (5 min, 3K) and these homegenates are collected in 500 µl aliquots.
2-2.
5 ho
urs
Persistence of human pathogenic V. cholerae in cold water condi5ons and a6er temperature up-‐shi6
Aims
• Is a human pathogenic strain persistent in aqua5c environment?
• Is the culturability of a clinical and a marine strain in cold water comparable?
• How will the strains react on a temperature up-‐shi6 to 20°C a6er three weeks at 4°C?
• Is natural sediment a favourable reservoir for human pathogenic bacteria?
• May the ability to regain culturability be a more important pathogenic trait than the harbouring of virulence genes?
• The clinical strain lost culturability directly a6er inocula5on, but regained and peaked in number one week a6er temperature up-‐shi6.
• The marine strain lost were culturable un5l temperature shi6, when it lost the culturability completely.
• The total cell count, shown by real-‐5me qPCR, was quite stable throughout the experiment for both strains.
• The clinical strain was culturable for one more week at 4°C in the sediment than in the water microcosm. A6er temperature up-‐shi6, the strain regained culturability.
• The total cell count was lower than in the water microcosm, which may be due to compe55on from other microorganisms.
• The natural boLom sediment was a suitable reservoir for the clinical strain, despite compe55on.
Set-‐up: the experiments were performed in 50 ml microcosms. Filtered seawater microcosms and natural sediment microcosms collected from the Sound (Öresund) was added to the microcosms and then bacteria (OD 1.0) was added to the different microcosms. The flasks were incubated at 4°C for three weeks and then the temperature was increased to 20°C and kept at that temperature for another week. At 8 sampling points, the CFU/ml was determined on TCBS agar plates and Vibrio/ml by qPCR.
Conclusions • The ability of the clinical Vibrio strain to quickly adapt to temperature
changes and thereby regain culturability a6er a temperature increase may be more important for determining the pathogenicity to humans than the presence of the screened virulence genes.
• To inhabit sea sediment seems to be a successful strategy of clinical V. cholerae strains to survive low water temperatures.
Fig. 1. The mean cell abundance (±SD) of the clincal and marine V. cholerae strains cultured in sterile seawater, presented as the CFU ml-‐1 and total Vibrio ml-‐1 based on real-‐5me qPCR analysis. The temperature was increased from 4 to 20°C a6er 21 days. Clinical strain CFU▲, marine strain CFU●, clinical strain qPCR Δ, marine strain qPCR○.
Fig. 2. The mean (±SD) cell abundance of the clinical V. cholerae strain in natural sediment. The temperature was increased from 4 to 20°C a6er 21 days. CFU ml-‐1 ▲; total Vibrio ml-‐1 calculated from qPCR data Δ .
!
!
BeLy Collin, Bodil Hernroth and Ann-‐Sofi Rehnstam-‐Holm Kris5anstad University, University of Gothenburg and Sven Lovén Center for Marine Sciences
BeLy Collin
Kris5anstad University
Leibniz Institute for Baltic Sea Research Warnemünde
Bianca Schippmann | Gerald Schernewski Leibniz Institute for Baltic Sea Research Warnemuende, Germany
Introduction
Modelling Vibrio transport in a Baltic Sea Bay - A promising tool for coastal management?
Water quality measurements are often taken only on fixed stations and are hence spatially restricted. In a best case situation (no gradients) a good temporal distribution of the organisms under study can be achieved at one single spot. However, a conclusion of the situation in a larger area (several kilometers) is not possible since there is a high spatial variance of the organism distribution. Modelling particle pathways can fill this gap and has been shown to be a promising tool for coastal management (Schernewski et al. 20121, Schippmann et al. submitted2). Vibrio vulnificus has often occurred in the Bay of Greifswald and at the coast of Usedom during the last decade (3). It caused several wound infections and deaths. With the simulation of transport and spatial behaviour of the organisms, analyses of the risk and potential sources are possible which allow forecasts for the along coast bathing areas.
References | 1Schernewski, G., Fischer, E., Huttula, T., Jost, G., Ras, M., 2012. Model tools to support bathing water quality management: Escherichia coli bacteria in a Baltic lagoon. Journal of Costal conservation 2Schippmann, B., Schernewski, G and Graewe, U., submitted, Escherichia coli pollution in a Batic Sea lagoon: A model-based source and spatial risk assessment 3Landesamt fuer Gesundheit und Soziales Mecklenburg-Vorpommern
Acknowlegdements
Hans Burchard, Ulf Graewe
North-German Supercomputing
Alliance, Knut Klingbeil,
Richard Hofmeister
Methods
Tracks:
Figure 3: Tracks of 5000 salmonella bacteria emitted off the Wolin coast in Misdroy (Poland). T90 survival time of salmonella 142 h. Different colours indicate different particle tracks.
Concentrations:
Figure 4: Salmonella density according to the computed tracks in order of magnitude per m3 .
General Estuarin Transport Model (GETM): 3D free-surface primitive equation model based on Navier-Stokes equations computes physical state variables (temperature, salt, currents, diffusivity,..) and provides flow fields for the particle tracking model (Figure 2) model setup with a resolution of 100x100m (Figure 1)
information about Vibrio behaviour and properties at e.g. changing light, salinity and temperature conditions
infection dose to quantify the measurements and model
results (risk assessment)
Challenges: model vibrio :
• dependence on salt and temperature (model extension) • mortality and growth rate
find the correct number of start concentration
Possibilities
General Individuals Tracking Model (GITM): 3D Lagrangian particle tracking model computes particle movement according to dvection/diffusion forced with 3D flow fields contains a bio-module for particle properties (sinking speed, growth, …) for modelling algae, mussels, etc. following results from a salmonella simulation are shown exemplarily (Figure 3 & 4) Figure 2: Flow field in the Pomeranian Bight computed with GETM for salmonella particle tracking simulations.
Needs & Challenges
Needs:
small -spatial monitoring program with high resolution (not
only fixed stations where temporal and spatial uncertainties
too high)
monitoring of boundary conditions:
• temperature and salinity
• wind conditions
• exact measure position and water depth
Figure 1: Model domain and bathymetry of the future vibrio setup in Bay of Greifswald. The background shows every 20-th grid.
steady state simulations to determine risk at region under different wind, river, etc. conditions realistic simulations to show spatial distribution at specific dates
DYNAMICS, DIVERSITY AND PATHOGENIC POTENTIAL OF VIBRIOS IN THE HEMOLYMPH OF PACIFIC OYSTERS
Wendling CC, Wegner KMHelmhotz Centre for Ocean Research Kiel, Düsternbrooker Weg 20, 24105 Kiel, Germany
Alfred Wegener Institute for Polar und Marine Research Sylt, Hafenstraße 43, 25992 List/ Sylt, Germany
Mass mortality events of Pacific oysters Crassostrea gigas triggered by microbs, such opportunis9c Vibrio in conjunc9on with high
temperatures and physical weakness a=er matura9on have been observed worldwide. However, studies addressing the naïve
community structure of oyster associated Vibrio, thereby evalua9ng the risk of mortality events, are rare. We aimed at characterizing
the dynamics, diversity and pathogenic poten9al of the Vibrio community structure isolated from the Pacific oyster around the island
of Sylt, North Sea, Germany, a coastal area where oyster mortality has not been observed, yet. A total of 78 Vibrio isolates were
obtained during a six months in situ study by repeated hemolymph sampling and the genomic diversity based on 16s rRNA was
analyzed. Dynamics and diversity of Vibrio varied significantly over 9me and were highest a=er matura9on. By means of controlled
infec9on experiments we provide first evidence that pathogenic Vibrio are indeed present around the island of Sylt and discuss the
risk of future oyster summer mortality in the context of predicted global warming.
SUMMARY
Hemolymph sampling from wild oysters
Isola9on of Vibrio spp. Iden9fica9on of Vibrio spp. based on 16s rRNA
Construc9on of a phylogene9c tree based on 16s rRNA including known virulent strains
Controlled infec9on experiments to estaimate pathogenic poten9al
Determine pathogenic poten9al by induced virulence
1 2 3 4 5 6
METHODS
Contact:Carolin C Wendling
Alfred Wegener Ins9tute for Polar and Marine ResearchHafenstraße 43 -‐ 25992 List
mail: [email protected]: +49 4651 952 4206
๏Characterize the dynamics and diversity of the naïve Vibrio community structure of healthy
Pacific Oysters
๏Estimate the pathogenic potential of oyster associated Vibrios
AIM Occurence of oyster mass m
ortalities
Sampling Site: Sylt
No observed oyster mass m
ortalities
This is a first survey aiming at the characteriza9on of the dynamics, diversity and pathogenic poten9al of oyster associated Vibrio in a coastal area that has not experienced oyster summer mortality, yet. High Vibrio abundance
a=er matura9on and the evidence, that pathogenic Vibrio strains naturally exist in apparently healthy oysters point to the risk of poten9al oyster mortality outbreaks when average summer water temperatures increase with
global climate change. As summer mortali9es of pacific oysters have been observed solely 200 km southward, ongoing research focusing on the study of the Vibrio ecology including methods to predict the pathogenic poten9al of
a strain are pivotal in this area, where oyster aquaculture is prominent. We intend to con9nuously monitor the dynamics and diversity of Vibrio in oyster hemolymph, thereby detect first signs of summer mortality indicated
through a change in the natural community structure. The ability to iden9fy epidemiological paaerns linked to bacterial community structure and specific dynamics of candidate pathogens is necessary, especially when infec9ous
diseases are predicted to increases with global warming.
CONCLUSION
0.1
Legend:
season
location
Color ranges:
V. splendidus
V. cyclitrophicus
V. crassostreae
Allivibrio fisherii
V. tubiashii
V. alginolyticus
V. bregonii
V. cholerae
Shewanella
Tx5.2
enuJ
b81
O
O46
bOct
D01
wJu
ne
O33
bJun
e
O33
wM
ay
D35
bJul
y
O02
wOct
D28b
July
D41b
June
O12
bJun
e
D12w
Oct
D07b
Sept
O33wS
ept
D06wSe
pt
O43bA
ug
O05bJ
une
O22wOctTx6.2D35wJuneD12bSeptO47bOctO33bMayO18bMayO18wMay
D35wMayD45bMay
O03wOct
Tx4wD27bMay
D10wSept
D19wOct
D35bJune
D10w
Oct
O07wJuly
Tx03w
Tx3O07wSept
O33wJuly
O02wSept
D15wJuly
D29w
Sept
D14w
June
O45wJulyD28wJuly
O44wSept
O45wMay
Tx5.1
D35wJuly
D30wJuly
D12wJuly
O07bJuly
O32wSept
O32bSept
D07wSept
D12bJulyO33wOct
D03wJulyO03wAug
D03bJulyD29bAugO20wAugD05bAugD46wAugD20wAugD17wOct
Vibrio splendidus biovar II AB038030
D10bAug
Tx3b
O05bJuly
O24bSept
D29wAug
Vibrio tubiashii X74725O44wAugD47wSept
Vibrio anguilla
rum X16895
Vibrio
aestu
arian
us X74
689
Vibrio
algino
lyticu
s X74
690
Vibrio
parah
aemoly
ticus
X7472
0
O46bJ
ulyTx2b
O05wJ
uly
O24
wSe
ptO
03bS
ept
D47b
Aug
D41w
June
O45
bJun
eO3
3wJu
neVibr
io c
hole
rae
X763
37
D15
bJul
y
O20
bAug
D28
bSep
t
D17
bOct
V. splendidus
V. cyclitrophicus
V. crassostreae
V. tubiashii
V. alginoly9cus
V. bregonii
V. cholerae
Shewanella
Allivibrio fisherii
Figure 3 Phylogene9c rela9onship based on Maximum likelihood method (TN 93 + G+ I subs9tu9on model) using par9al 16s rRNA sequences (1095 bp) of Vibrio isolates sampled from oyster hemolymph. Bootstrap percentages above 80% are represented by grey dots at the parent nodes. Sampling site is depicted by grey colours on the first outer ring for two different sampling sites on Sylt, i.e. Dietrichsenbank (DB) and Oddewaa (OW) and for a third sampling site on the island of Texel, Netherlands (Txl). Sampling month is depicted by blue and green colours on the second outer ring. Assignment to the different clades (see legend) based on 99% sequence similyrity by BLASTN analysis in depicted in colour on the inner ring.
Survival (%
)
0 2 4 6 8 10
0.0
0.2
0.4
0.6
0.8
1.0
Control
D14w_june
O7w_julyD29w_augTx3w
D45w_may
D47w_sept
Tx5.1D29w_sept
Tx2b
O43b_aug
Time post Infec9on (days)
Figure 1 Kaplan-‐Meier death censored survival by selected Vibrio strains B-‐L and control A (n=15). Colour codes correspond to those in Figure 3.
RESULTS
๏ Vibrio bacteria are constantly present in the hemolyph of Pacific Oysters in the North Sea
๏ Vibrio load is highest a=er matura9on
๏ V. splendidus is dominant when water temperatures are below 18°C -‐ V. crassostreae is dominant
when water temperatures are above 18°C
๏ Vibrio diversity is posi9vely correlated with water temperature
๏ Highly pathogenic strains are present in North Sea oysters
0
2
4
6
8
Index
Cel
ls/..
l
Month
tem
p$Te
mp
May Jun Jul Aug Sep Oct Nov
0
5
10
15
20
Colony fo
rming Units (cells/µl hem
olym
ph)
Temp (°C)
Figure 2 Seasonal varia9on in amount of Vibrio bacteria isolated from oyster hemolymph during monthly sampling trips. (A) Quan9fica9on of total Vibrio spp. (open squares and rectangles) isolated from oyster hemolymph, water temperature (full circle) and occurrence of spawning period (black arrows). (B) Rela9ve propor9on of Vibrio isolates by phylogene9c associa9on based on 99% similarity by BLASTN analysis. Colour codes correspond to those in Figure 3.
(A)
(B)
CONCLUSION
1,00E+00
1,00E+02
1,00E+04
1,00E+06
1,00E+08
1,00E+10
0 1.5 3 4.5 6 24
CFU
/g
Time post inoculation [h]
MDD MR IVW CV
spiking
0 1 2 3 4 5 6 7 8 9 10 110 1 2 3 4 5 6 7 8 9 10 11
Time post inoculation [d]
MDD vacuum 3°C MDD gunnysack 3°C
MDD vacuum 15°C MDD gunnysack 15°C
1,00E+00
1,00E+02
1,00E+04
1,00E+06
1,00E+08
0 1 2 3 4 5 6 7 8 9 10 11
In vivo survey of Vibrio spp. in artificially contaminated Mytilus edulis
Doreen Herrfurth1, Keike Schwartz2, Ralph Pund2, Eckhard Strauch2, Thomas Alter1, Stephan Huehn1
1 Institute of Food Hygiene, Free University Berlin, Germany 2 Federal Institute for Risk Assessment, Berlin, Germany
Background All studies performed on the appearance of Vibrio spp. in mussels on pre-harvest and retail level in Germany so far showed high loads with these microorganisms. As far as food safety is concerned Vibrio (V.) parahaemolyticus, V. vulnificus and V. cholerae are the most important species within this genus. In a previous study, 106 retail mussel samples of different species and origin were investigated for the presence of Vibrio. 54.8 % of the samples were positive for Vibrio spp. (approx. 59 % V. alginolyticus, 12 % V. cholerae (non-O1, non-O139), 6 % V. parahaemolyticus). In addition, single V. metschnikovii, Photobacterium damselae and Listonella anguillarum were found. One of the most frequently consumed mussel species in Germany is the blue mussel, Mytilus edulis. This mussel species filtrates approx. 1.5 l of water per hour, thus the surrounding water is clarified effectively (Riisgard, 1988). Along with the water, pathogenic agents, e. g. bacteria (including Vibrio
spp.), viruses or toxic algae are affiliated. This potential accumulation of Vibrio spp. can cause food borne infections if mussels are not properly heated before consumption. The aim of this study was to determine the clearance kinetics of Mytilus edulis after artificial incubation with V. cholerae, V. parahaemolyticus or V. vulnificus. Additionally, the change of Vibrio loads in mussels during storage on ice and at 15 ºC was investigated.
Material and Methods
Clearance In clearance assays approx. 100 mussels were transferred after 24 h incubation with approx. 1011 CFU (5 x 106 CFU/ml) for each Vibrio spp. into the husbandry unit to cleanse the mussels from Vibrio. The accumulation of Vibrio spp. and clearance of mussels was observed over 7 days.
Storage For the storage test approx. 200 mussels were contaminated with 1010 CFU of Vibrio spp. which corresponds to 5 x 105 CFU/ml in the contamination unit. After 24 hours of incubation mussels were packed in vacuum bags and gunnysacks. A vacuum bag contained five mussels with artificial seawater, whereas each gunnysack contained five mussels only. Samples of both packing strategies were stored for ten days at 3 ºC on ice and at 15 ºC. Vibrio spp. load was investigated every day for storage at 3 ºC and subsequently every two days for storage at 15 ºC.
Results
Discussion Semi-quantitative methods were used to describe Vibrio concentrations within contamination ponds and clearance ponds as well as in mussel lumen water, digestive glands and the remaining mussel meats. The bioaccumulation assays in Mytilus edulis showed an enrichment of Vibrio especially within digestive glands. After 1.5 h the concentration in the digestive glands was approx. 2 log higher than the corresponding concentration in the tank water. This confirms the 200-fold enrichment described by DePaola et al. (2000). At the end of incubation the loads of Vibrio spp. were reduced by 1 - 2 log to approx. 104 – 106 CFU/g in all sample segments. During clearance a slow but continuous reduction of Vibrio concentrations was determined within a seven day period in all mussel segments. Vibrio loads started in digestive glands at 106 CFU/g and were reduced by 4 – 5 log to approx. 102 – 103 CFU/g in the husbandry unit for seven days. Based on the data, a general clearance rate of 0.023 log-CFU/g per h was calculated (Morisson et al. 2011). Once a mussel is contaminated with Vibrio, which can occur very likely, even a clearance over a seven day period seems to be insufficient to clear the mussel completely. Within ten days of storage at 3 ºC on ice or at 15 ºC almost no reduction of the Vibrio load occurred in Mytilus edulis for V. parahaemolyticus and V. cholerae, only variations in a 2 log interval. In contrast, in V. vulnificus a cell reduction can be seen, probably due to the fact that in the assay a human isolate and no mussel isolate was used. Therefore all Mytilus edulis should be thoroughly heated before consumption to avoid potential infection.
Clearance assay Storage assay
Fig. 4: Cell count of V. cholerae,
V. parahaemolyticus and V. vulnificus per g Mytilus edulis digestive glands (MDD) in husbandry unit at 15 ºC for seven days.
After 24 h of incubation the loads of V. cholerae and V. vulnificus were at 106 CFU/g, V. parahaemolyticus loads at 107 CFU/g. Vibrio cell counts were reduced by 4 - 5 log at 15 ºC to approx. 102 – 103 CFU/g after 7 days (Fig. 4). To mimic a natural water exchange, 50 % of the water was exchanged with fresh artificial sea water after 48, 96 and 144 h. However, at the end of the clearance period Vibrio was still detectable.
To prove that spiking strains and strains isolated from mussels after contamination are identical, fAFLP was performed with selected isolates. fAFLP results before and after storage showed no differences among V. parahaemolyticus clones (Fig. 6A) as well as among V. cholerae clones (Fig. 6B).
Fig. 5: Cell count of V. parahaemolyticus (A), V. cholerae (B) and V. vulnificus (C) per g Mytilus edulis digestive glands during storage for ten days.
A
Institute of Food Hygiene • FU Berlin • Königsweg 69 • 14163 Berlin • Tel. 0 30 - 838 - 62538 • Fax 0 30 - 838 - 62552 • [email protected] • www.vetmed.fu-berlin.de
Fig. 3: Cell count of V. parahaemolyticus per g Mytilus edulis during contamination at 15 ºC for 24 hours.
B
Starting loads of V. cholerae and V. parahaemolyticus were approx. 105 CFU/g at the beginning of storage (Fig. 5). The concentration was constant at around 106 CFU/g with a variance of 2 log during storage for ten days. The V. vulnificus load started at 104 CFU/g after 24 h of contamination and was reduced gradually from the first day of storage to approx. 102 – 104 CFU/g . Among the different storage techniques (vacuum packaging and gunnysacks at 3 ºC or 15 ºC) no differences in the concentrations of Vibrio spp. were observed. At the 4th day mussels in gunnysacks at 15 ºC started dying.
Bioaccumulation assay
Bacterial strains and mussels The spiking strains V. cholerae non-O1/non-O139 (ctx-) and V. parahaemolyticus (tdh-/trh-) were isolated from wild Mytilus edulis while the V. vulnificus strain was a human isolate, Biotyp 1. For contamination Vibrio strains were cultured in alkaline peptone water. Mytilus edulis mussels used for the experiments originated from the Baltic sea (Kiel Fjord) and were held in artificial seawater at all times. For all assays the mussels were incubated with Vibrio spp. in the contamination unit of the experimental unit (Fig. 1).
Vibrio spp. accumulated in Mytilus edulis
shown by the example of V. parahaemolyticus (Fig. 3). Highest enrichment was found after 1.5 h in digestive glands (MDD). Therefore, in the following figures only Vibrio levels in digestive glands are shown. Assays with V. cholerae and V. vulnificus showed similar results (data not shown).
Fig. 1: Experimental unit
Sample preparation To quantify Vibrio spp. the mussels were prepared and subdivided into different sample segments: digestive gland (MDD), lumen water of mussel (IVW), mussel remnants (MR), water of the contamination unit (CV) and husbandry unit (HU) (Fig. 2). Sample processing to quantify Vibrio was performed according to ISO/TS 21872.
Fig. 2: Mytilus edulis segments
Musculus retractor bysso-pedalis
MR
MDD
Partitioning of samples: MDD digestive gland IVW lumen water of mussel MR mussel remnants HU husbandry unit CV contamination unit
MLW
fAFLP-Analysis The fluorescent Amplified Fragment Length Polymorphism (fAFLP) analysis was performed according to Duim et al. (1999) except using Taq1 instead of Hha1. This genotyping method was applied to analyse whether the isolated strains at the end of the assay correspond to the spiking strains.
Fig. 6: fAFLP of V. parahaemolyticus (A) and V. cholerae (B)
A B
Isolates of spiking strain
Isolates of the end of assay
C
1,00E+00
1,00E+02
1,00E+04
1,00E+06
1,00E+08
1,00E+10
0 1.5 3 4.5 6 12 24 48 72 96 120 144 168
CFU
/g
Time post inoculation [h]
MDD V. cholerae
Contamination / Bioaccumulation Overnight cultures of bacterial strains were pooled to 1012 CFU for V. parahaemolyticus and V. cholerae and 1010 CFU for V. vulnificus which corresponds to a final concentration in the contamination unit of 5 x 107 CFU/ml and 5 x 105 CFU/ml, respectively. For each experiment approx. 40 mussels were contaminated with Vibrio spp. and tested for 24 hours.
Genotyping assay
References: Duim et al., 1999, High-resolution genotyping of Campylobacter strains isolated from poultry and humans with Amplified Fragment Length Polymorphism fingerprinting DePaola et al., 2000, Environmental investigations of Vibrio parahaemolyticus in oysters after outbreaks in Washington, Texas, and New York (1997 and 1998) Riisgard, H. U., 1988, Efficiency of particle retention and filtration-rate in 6 species of northeast american bivalves Morrison et al., 2011, Survival of Salmonella Newport in oysters
CFU
/g
1,00E+00
1,00E+02
1,00E+04
1,00E+06
1,00E+08
1,00E+10
0 24 25.5 27 28.5 30 36 48 72 96 120 144 168 192
CFU
/g
Time post inoculation [h]
MDD V. cholerae MDD V. parahaemolyticus MDD V. vulnificus
spiking spiking spiking spiking
packaging packaging packaging transfer Water change
spiking dose: 5 x 107 CFU/ml
spiking dose: 5 x 105 CFU/ml
spiking dose: 5 x 106 CFU/ml
Integrated evaluation of environmental parameters influencing Vibrio occurrence in the coastal Northern Adriatic Sea (Italy)
Greta Caburlotto, Franco Bianchi, Giorgio Socal, Ilaria Trento* and Maria M. Lleo
Aim of the study Although temperature has been identified as a key factor, there is no general agreement on which parameters are truly determinant in influencing the bacterial concentration and persistence in the marine environment; different oceanic parameters could have determinant roles in the specific geographic areas. Most of the studies regarding the influence of environmental parameters on Vibrio occurrence report the effect of individual oceanographic variables not always taking into account the inter-relations existing among these parameters: an integrated approach was used to identify key parameters determining the abundance of Vibrio spp in marine samples from the Venetian Lagoon in Italy, which is an important area for fish farming and tourism. Permanent monitoring of environmental parameters is mandatory to predict and prevent climate-associated diseases and threats
Materials and Methods Samples: water, plankton and sediment. Sampling frequency: twice a month during the warm season (June to September) and once each month from October to May. Monitoring period: from June 2006 to November 2007 for six stations while for Foce, from May 2007 to November 2007. Data on temperature ( C), salinity (PSU), dissolved oxygen (% of saturation), pH, and turbidity (NTU) were acquired with a multiparametric probe. Vibrio spp concentration: aliquots of marine samples were inoculated in modified alkaline peptonate water (pH 8.5, added with 3.5% NaCl, m-APW) and incubated at 37 C for 7 h; growth was assessed by visual inspection and the number of Vibrio cells/ml calculated by the MPN method. Vibrio ID confirmation by culture and PCR: a loop from each of the tubes with visible growth was also inoculated on the selective medium TCBS to confirm Vibrio colonies. DNA was prepared from cell pellets using a standard protocol and PCR assays were carried out using primer pair designed on the 16S rDNA Vibrio sequence. Statistical analysis: A non-parametric multivariate multiple regression, done using the computer programs DISTLM® and STATISTICA®, was set up, with a previous log10 transformation of biological data because of their non-normal distribution. Individual variables were analyzed separately for their relation with the Vibrio concentration.
Conclusions Multivariate techniques have been adopted to analyze the dataset: using PCA, it was shown that a relatively high proportion of the total variance in this area was mainly due to two independent variables, namely salinity and temperature. by cluster analysis it was possible to categorize different groups with homogeneous features as regards space (“stations”) and time (“seasons”) distribution, as well as to quantify the values of environmental variables and the Vibrio abundances in each category. Integrating key environmental factors and bacterial concentration values, we identified levels of salinity and sea surface temperature which were optimal for Vibrio concentration in water, plankton, and sediment samples.
The identification of key environmental variables conditioning Vibrio occurrence should facilitate ocean monitoring making it possible to predict unexpected variations in marine microflora which could determine public health risks in coastal areas.
avg std avg std avg std
Temperature °C 21.2 3.5 19.7 5.8 20.4 5.9
Salinity PSU 23.7 9.0 32.2 3.3 35.3 1.5
Dissolved Oxygen % 98 11 107 16 101 11
pH 8.15 0.12 8.20 0.07 8.19 0.06
Turbidity NTU 10.4 8.1 3.6 2.7 2.0 1.2
CPE μg/dm³ 3.6 2.4 3.0 2.1 2.1 1.5
Vibrio in water cells/cm³ 4170 8744 8648 19882 3769 16049
Vibrio in plankton cells/cm³ 419276 1123834 2455162 9938648 551750 1357550
Vibrio in sediment cells/cm³ 9565 26339 8011 27245 2430 5496
GROUP 1 (n = 8)
GROUP 2 (n = 84)
GROUP 3 (n = 46)Cluster among stations
avg std avg std avg std
Temperature °C 10.1 0.8 25.1 2.1 17.9 4.3
Salinity PSU 33.6 2.5 32.1 4.8 33.1 4.2
Dissolved Oxygen % 96 5 108 14 103 15
pH 8.24 0.02 8.19 0.08 8.19 0.07
Turbidity NTU 1.9 1.1 3.7 3.9 3.6 3.2
CPE μg/dm³ 1.1 0.4 3.1 2.2 2.7 1.8
Vibrio in water cells/cm³ 250 272 14657 26552 1926 6253
Vibrio in plankton cells/cm³ 101757 215722 3931604 12259455 312042 941213
Vibrio in sediment cells/cm³ 224 333 2229 4657 10705 30267
Cluster among seasonsGROUP A
(n = 12)GROUP B
(n = 54)GROUP C
(n = 72)
GROUP A: winter GROUP B: summer GROUP C: spring + autumn
GROUP 1: Foce GROUP 2: Caleri1, Caleri2, Fosson1, and Fosson2 GROUP 3: S.Pietro1 and S.Pietro2
Cluster Analysis, a method for grouping objects of similar kind into respective categories, was applied to the hydrological matrix in order to verify the way in which data grouped into two categories, respectively “homogeneous stations” and “homogeneous seasons”
Principal component analysis PCA analysis is a useful tool to quantify the contribution of each variable to describe the environmental variability of a region and to visualize them in the space of two or more dimensions, called factors. The results of this analysis, applied to our environmental dataset (SST, SSS, pH, DO%, turbidity and total pigments), showed that a high fraction of the total variance (> 54%) was explained by the first two factors: salinity and temperature are the most significant parameters, with a respective contribution of 19 and 15% to the variability of the whole system. Other variables contribute as well, but their influence acts mainly in a indirect way, i.e. by means of salinity or temperature. As shown in Figure 1, salinities around 30–35 PSU and maximal temperatures (27–29 C) seem to be the optimal range for vibrios concentration in plankton (Figure 1B), while the same salinity range but associated with lower temperatures (18–24 C) favored the presence of Vibrio in sediment (Figure 1C). Free vibrios in water are favored at lower salinity ranges (20–28 PSU) both at intermediate (17–23 C) and high temperatures (27–29 C) (Figure 1A).
Cluster analysis In the present study, we have considered globally a number of parameters to accurately characterize sampling sites in the study area and, in this context, be able to analyze the presence and abundance of the Vibrio population.
The study area The area extends from the Venetian Lagoon to the estuary of the Po river. This stretch of coast was chosen because of the presence of riverine inputs rich in pollutants, industrial wastes, and nutrients and because it is subject to anthropogenic disturbance. The area is an important recreational zone and is dedicated to fish farming. Three stations were chosen in the area: • San Pietro, a control site with “low-risk” environmental conditions • Fosson and Caleri, situated in areas considered to be at “high risk” on the basis of conditions that favour Vibrio persistence. For each station, two sites were chosen: one 500 m from the coast and the other 3000 m offshore. A seventh site (Foce, waters of low salinity) was included in the study since May 2007.
FIGURE 1: Combined effect of temperature and salinity on Vibrio abundance in water, plankton, and sediment
Federal Institute for Risk Assessment • Dept. Biological Safety • Max-Dohrn-Str. 8-10 • D-10589 Berlin • Tel. + 49 (0) 30 - 184 12 - 0 • Fax + 49 (0) 30 - 184 12 - 47 41 • www.bfr.bund.de
Phenotypic and genotypic
characterisation of environmental and
clinical Vibrio vulnificus isolates from
the Baltic sea
Background
The number of infections caused by pathogenic Vibrio spp. has increased in recent years.
Vibrio spp. are ubiquitous Gram-negative bacteria found naturally in marine and estuarine
waters, including aquaculture settings. They are a leading cause of seafood-borne bacterial
illness and can cause serious wound infections. Increasing incidence of vibrioses in marine
animals and humans has been linked to rising seawater temperature due to global warming.
V. vulnificus can be taken up by ingestion of contaminated seafood such as raw
oysters/mussels or through an open wound exposed to contaminated seawater. Both routes of
infections can lead to serious diseases, sometimes with lethal outcome. In the Baltic Sea
region a number of serious cases of wound infections have been reported, especially in years
with hot summers and periods of elevated sea water temperatures. Although V. vulnificus can
be frequently isolated from the sea water, the number of human infections is comparatvely low.
The aim of this study is to characterize V. vulnificus strains from the Baltic Sea region for
pathogenicity factors and to discriminate between potential pathogenic strains and
environmental strains without clinical relevance.
Nadja Bier1, Silke Bechlars1, Susanne Diescher1, Florian Klein1, Gerhard Hauk2, Oliver Duty2, Eckhard Strauch1, Ralf Dieckmann1
Determination of 16S rRNA typeBased on polymorphisms in the 16S rRNA-gene Vibrio vulnificus isolates can be assigned
to two types A & B (Aznar et al., 1994), which are described to correlate with the strain
origin (Nilsson et al., 2003). To assess the 16S rRNA type Real Time PCR assays were
performed according to Vickery et al., 2007. In regard to our Baltic sea isolates, we couldn`t
observe a clear correlation. The majority of isolates belonged to type A regardless of their
origin (Fig. 3).
Conclusions
• Phenotypic examination along with in-vitro and in-vivo assays are important to assess the pathogenic potential of Vibrio strains. Nearly all strains show
cytotoxicity to Caco-2 cells. Resistance to human serum was observed in most clinical Baltic sea strains, but was also found in some environmental strains.
• So far genotypic techniques do not suggest a clear discrimination between clinical strains and environmental strains as revealed by the analyses of the 16S rRNAtype, vcg type and pathogenicity region XII.
• Most environmental strains may be potentially dangerous to public health and
further studies for hazard identification and risk assessment are needed.
References
Aznar et al., 1994. Int. J. Syst. Bacteriol. 44: 330-337.Cohen et al., 2007. Appl. Environ. Microbiol. 73:5553-65.Nilsson et al., 2003. J. Clin. Microbiol. 41:442-46. Roig et al., 2010. Appl. Environ. Microbiol. 76:1328-33.
Rosche et al., 2005. Microbiol. Immunol. 49:381-89.
Vickery et al., 2007. J. Microbiol. Methods. 68: 376-384.
Acknowledgement: VibrioNet is funded by the Federal Ministry of Education and Research (Grant 01KI1015A)
Cytotoxicity assaysThe cytotoxicity to Caco-2 cells induced by supernatants of V. vulnificus liquid cultures was
measured using a CytoTox96 Non-Radioactive cytotoxicity assay kit (Promega, Madison,
WI). Except for VN-206, supernatants of all strains showed cytotoxic activity. Most strains
induce complete lysis of the host cells in a short time. However, few strains that were
negative for cell lysis in this assay showed cytopathic effects by inducing rounding of host
cells (Figure 1).
Phenotypic and genotypic assays associated to virulenceTo assess the virulence potential of Vibrio vulnificus isolates, phenotypic ad genotypic
assays were applied. Phenotypic assays may reveal valuable information on known and
putative virulence–associated traits such as expression of extracellular proteins (hemolysins,
proteases, chitinases), and on interaction with eukaryotic cells (serum resistance properties,
cytotoxicity). Genotypic methods combine high discriminatory power and high reproducibility.
These included vcgC/E typing (Rosche et al., 2005), 16S rRNA A/B typing (Nilsson et al.,
2003) and presence/absence of 33-kb genomic region XII (Cohen et al., 2007) by
established PCR assays.
Fig. 1 Change in morphology of Caco-2 cells after treatment with supernatants of V. vulnificus overnight cultures.
A: complete lysis (+ LDH), B: cell rounding (- LDH), C: control (- LDH).
A B C
1) Federal Institute for Risk Assessment, Berlin, 2) Landesamt für Gesundheit und Soziales Mecklenburg-Vorpommern, Rostock
Fig. 5 A) Pathogenicity Region XII of V. vulnificus (Cohen et al., 2007). B) Distribution of pathogenicity
region XII among clinical and environmental strains.
Clinical Environmental
Pathogenicity Region XII of V. vulnificus:
4 PCRs described by Cohen et al., 2007 were performed to investigate the presence of a
33 kb genomic island which could be associated with virulence (Fig. 5a). We could prove
the presence of this region XII in the majority of clinical isolates (Fig. 5b) which supports its
relevance for pathogenicity.
Nilsson et al., 2003 :
Type A ���� environmental origin
Type B ���� clinical origin
Clinical Environmental
Fig. 3 : Distribution of different 16S rRNA-types among clinical and environmental strains
type A
type B
type AB
Rosche et al., 2005 :
Type E ���� environmental origin
Type C ���� clinical origin
EnvironmentalClinical
Fig. 4: Distribution of different vcg types among clinical and environmental strains
vcg type C
vcg type E
Determination of vcg typeAnother method to predict virulence of V. vulnificus isolates takes advantage of a
polymorphism in the so-called virulence correlated gene (vcg) which discriminates two
types (C=clinical type, E=environmental type). To assess the vcg type we performed PCRs
as described by Rosche et al., 2005. Only 19 % of the clinical strains possessed the vcg
type C, which should correlate with clinical origin (Fig. 4).
Serum resistanceSurvival and growth in blood are characteristic traits of pathogenic V. vulnificus.
Examination of serum resistance as an important virulence factor could therefore serve to
predict the pathogenic potential of V. vulnificus isolates. 84 % of the clinical isolates
showed growth in the presence of 60-80% human serum and could be classified as serum
resistant (Fig. 2).
Fig. 2 Flow chart for serum resistance assay. Bacteria are grown in 96 well plates for 5 hours and transferred to new plates containing media with different concentrations of human
serum (0 – 80% serum). Growth is visible by colour change of bromothymolblue from blue to yellow.
24h, 37°Csensitive
resistant
control
80% 60% 40% 20% 10% 0% serum
80% 60% 40% 20% 10% 0% serum
A
B
Analyzing Vibrio populations by MALDI-TOF
Compared to DNA-based techniques, Matrix-Assisted Laser Desorption/Ionization Time-of-Flight (MALDI-TOF) used as a mass spectrometric profiling method provides rapid and cost-effective identification results. Creating a MALDI-TOF Vibrio reference database leads to a clear discrimination between vibrios. Hence, whole environmental Vibrio populations can easily be screened for potentially human pathogenic species.
MALDI-TOF Principle Colonies of Overnight-Cultures are getting picked. Transferring to target plates occurs either directly or by an ethanol / formic acid extraction. Covering with Matrix (cinnamic acid) yields to crystal structures. Therein embedded proteins getting desorpted by Laser shots. Simultaneously these molecules become ionized due to proton transfers. After electric field acceleration, protein ions passing a vaccum flight tube. The flight duration differs depending on masses and charges of these molecules (m/z). Thus, there is a time-dependent detection of ion impact intensities. The outcome are spectra with the m/z ratio (molecular masses) on the abscissa and measured intensities on the ordinate (Fig. 1). Fig. 1: Sample preparation approaches and measurement principle of MALDI-TOF.
Alfred Wegener Institute for Polar and Marine Research, Shelf Sea System Ecology, Helgoland René Erler
Vibrio Population Analyses
Species Identification
MALDI-TOF can be a powerful tool in Vibrio population analyses. The approach is currently tested on monitoring cruises to observe the relative proportion of Vibrio species in the German Bight. In addition to this quantitative application of MALDI-TOF, Cluster Analyses can be performed to detect interspecific, maybe pathogenic or sampling site associated groups. Our goal is to establish this mass spectrometric method in Vibrio research. This offers the opportunity for Vibrio population analyses on a larger scale.
In a pilot study, mass spectra of 61 Vibrio isolates from different sampling sites were acquired. They were all included in one correlation matrix (Fig.2). Matching scores over 0.66 are coloured red, partly matches (0,33 to 0,66) are yellow and matching scores lower than 0,33 are green coloured. The average correlation score between vibrios of the same species varies from 0,69 to 0,89 (CV: 0,14 to 0,21). Clustering results in a clear separation of single species (Fig.3). Mass spectra generated from one isolate correlate with a score of 0,97 and a standard deviation of 2 %.
Num
ber o
f iso
late
s
Vib
rio a
lgin
oly
ticus
Vib
rio c
hole
rae
Vib
rio p
ara
ha
em
oly
ticu
s
Vib
rio v
uln
ific
us
Vibrio alginolyticus 15 0,69 0,19 0,57 0,37
Vibrio cholerae 11 0,19 0,80 0,21 0,23
Vibrio parahaemolyticus 15 0,57 0,21 0,85 0,45
Vibrio vulnificus 15 0,37 0,23 0,45 0,89
Vibrio diazotrophicus 1 0,33 0,23 0,32 0,29
Vibrio fluvialis 1 0,32 0,20 0,23 0,23
Vibrio harveyi 1 0,55 0,23 0,44 0,34
Listonella anguillarum 1 0,22 0,16 0,21 0,20
Shewanella putrefaciens 1 0,11 0,08 0,12 0,07 Fig. 3: Cluster Analysis Dendogram according to data from Fig.2. Fig. 3: Average correlation scores of Vibrio isolates .
Summary & Outlook
V. parahaemolyticus
V. alginolyticus
V. vulnificus
V. navarrensis
V. diazotrophicus
Two dimensional principal component analysis
In August 2011, vibrios of the North and Baltic Sea were isolated during a cruise with the research vessel Heincke. Comparison of single spectra shows distinct species-specific Cluster, even in the case of closely related species like V. parahaemolyticus / V.
alginolyticus and V. vulnificus / V. navarrensis
(Fig.4). An even clearer differentiation of species cluster can be reached by multi-dimensional scaling of correlation data (Fig.5).
Fig. 4: Two dimensional component analysis of single spectra, acquired from environmental isolates.
V. parahaemolyticus
V. alginolyticus
V. diazotrophicus
V. vulnificus
V. navarrensis
Fig. 5: MDS Plot of selected Heincke isolates.
Bacterial-Strains In total 78 V. parahaemolyticus-isolates were analysed. Thereof, 30 strains derived from seawater, bivalves and shrimp of different geographic origin. Additionally, 46 strains were isolated from shrimp of farms located in three Sri Lankan regions (Fig. 1). One isolate per farm and per shrimp-pond was applied to MLST analysis, respectively. The Japanese clinical strains ATCC17802 and RIMD2210633CM29 served as reference strains. Multilocus Sequence Typing (MLST) In MLST analysis the nucleotide sequences of multiple reference genes are compared. Therefore, internal fragments of the genes dnaE, gyrB, recA, dtdS, pntA, pyrC and tnaA were amplified via PCR and sequenced (Fig. 2A; González-Escalona et al. 2008). The received sequence data were analysed with Bionumerics (Applied Maths, Version 6.01) and compared to already published sequences on the PubMLST web page (http://pubmlst.org/vparahaemolyticus; Jolley et al. 2004). Based upon the concatenated nucleotide sequences a dendrogram was created via UPGMA-Analysis. The resulting similarity matrix served as basis for the generation of Minimum Spanning Trees.
Literature: Chao 2011, Origin of Vibrio parahaemolyticus O3:K6 pandemic clone DePaola et al. 2000, Environmental investigations of Vibrio parahaemolyticus in Oysters after outbreakes in Washington, Texas and New York (1997 and 1998) Feil 2004, eBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from González-Escalona et al. 2008, Determination of Molecular Phylogenetics of Vibrio parahaemolyticus Strains by Multilocus Sequence Typing Jolley et al. 2004, mlstdbNet – distributed multi-locus sequence typing (MLST) databases; Vibrio parahaemolyticus MLST web page (http://pubmlst.org/ vparahaemolyticus) developed by Keith Jolley and sited at the University of Oxford
MULTILOCUS SEQUENCE TYPING FOR GENOTYPING OF VIBRIO PARAHAEMOLYTICUS
Background Vibrio (V.) parahaemolyticus, a naturally present potentially pathogenic bacteria, is isolated frequently from seawater, sediment and raw or insufficiently cooked seafood (e.g. shellfish and bivalves). Owing to the high filtrating activities of bivalves the level of V. parahaemolyticus was found to be 200-fold higher than in the surrounding seawater (DePaola et al. 2000). Consumption of or contact to raw or undercooked seafood, that contains Vibrio in appropriate numbers, can lead to infections (gastroenteritis, wound infections and septicaemia). Isolates with (A) different geographic origin were analysed via MLST concerning their genetic relatedness and possible distribution patterns. One focus was the genomic analysis of (B) isolates gained from shrimp samples of three Sri Lankan regions.
Material and Methods
Institute of Food Hygiene • FU Berlin • Königsweg 69 • 14163 Berlin • Germany • Tel. 030 - 838 - 62538 • Fax 030 - 838 - 62552 • [email protected] • www.vetmed.fu-berlin.de
Fig. 1: Map of Sri Lankan Sampling Areas (1 Chillaw, 3 Madurankuliya, 5 Puttalam)
Sara Urmersbach1, Madura Sanjeevani Gonsal Koralage2, Thomas Alter1, Ute Messelhäusser3, Duangporn Pichpol4, Stephan Huehn1 1Institute of Food Hygiene, Free University Berlin, Germany 2Government Veterinary Office, Walikanda, Polonnaruwa, Sri Lanka 3Bavarian Health and Food Safety Authority, Oberschleißheim, Germany 4Faculty of Veterinary Medicine, Chiang Mai University, Thailand
Often strains are not typable owing to missing sequences of recA and gyrB fragments (Chao 2011). With the application of newly designed primer gyrB and recA fragments of former non-typable isolates could be analysed via MLST. The distribution of sequence types is independent from the geographic origin of analysed isolates. Strains from Asia as well as from Europe and South-America were genetically diverse and no dominating ST was identified. Owing to the high fraction of Asian strains (88%) the distribution of European and South-American strains will be restudied after analysis of further non-Asian isolates. Sri Lankan strains from shrimp farms of three nearby localized regions possessed a high genetic
diversity and no local dominating ST was found. However, strains with the same ST were isolated in different regions. Owing to the lack of more published data of Sri Lankan isolates and the naturally high genetic diversity of environmental isolates, most of the strains isolated possessed new STs (94%). Close relatedness of environmental and clinical isolates was shown in Minimum Spanning Trees and also discovered by eBURST-analysis, thus emphasising the high pathogenic potential of environmental and food isolates of V. parahaemolyticus.
Discussion
Most of the analysed isolates originated from Asia (88%), especially West-Asia. Sequencing of 78 isolates led to identification of 65 new alleles: 7 for dnaE, 15 for gyrB, 9 for recA, 9 for dtdS, 6 for pntA, 10 for pyrC und 9 for tnaA. A complete allelic profile and thus an assignment of a ST was revealed for 69 isolates. Most of them (n= 52) belonged to new STs, consisting of either recombination of already published or combinations with new STs. The Minimum Spanning Tree reveals no clear clustering based on the geographic origin of the isolates (Fig. 3A). Strains from Sri Lanka formed two clusters, which are connected by strains of diverse origin (Japanese reference strains and food isolates).
Isolates from food samples could be assigned to 21 STs (8 already published, 13 new) and were distributed over the whole Minimum Spanning Tree. Isolates from South-America where located in both clusters, the two STs of European strains were located in one cluster but not nearby. The majority of West-Asian isolates (n= 43) originated from shrimp-samples out of three Sri Lankan regions (Fig. 3B). They belonged to 15 STs. Ten of these derived from isolates out of one region, two appeared in two, and three in all regions. Isolates with the same ST and region originated mostly from different farms but at least from different ponds.
Results
B – Distribution of MLST-Sequence Types within three regions of Sri Lanka
21%
35%
44%
Sri Lanka 5 Sri Lanka 3 Sri Lanka 1
Fig. 3B: Minimum Spanning Tree and pie chart of isolates from Sri Lanka; Colouring according to sampling area.
recA and gyrB Dividing the original fragments of gyrB and recA (Fig. 2B) into two fragments led to complete allelic profiles. Therefor two inner primer were designed, allowing PCR amplification (Fig. 2C) and sequencing with the conditions published by González-Escalona (2008). eBURST-Analysis The eBURST algorithm identifies groups of related genotypes on the basis of their allelic profiles, called sequence type (ST) and predicts the descent from the presumably founder to other genotypes in this group (http://eburst.mlst.net/).
www.weltkarte.com
C – eBURST-Analysis eBURST-Analysis of all published V. parahaemolyticus STs led to the detection of a new clonal complex (CC; Fig. 4). The founder, ST412 (trh+tdh-), was isolated from an Ecuadoran shrimp sample. All other strains of the CC were isolated in the USA. Single Locus Variants (SLV) were from environmental samples: ST313 (trh+tdh+), ST314 (trh+tdh+) and ST315 (trh-
tdh+).The Double Locus Variant (DLV) ST43 (trh+tdh+) was found in environmental and clinical samples. The Satellite ST44 (trh+tdh+) was only found in clinical samples.
Fig. 4: Graphical output of eBURST-analysis (http://pubmlst.org/)
A – Influence of geographic origin on the MLST-Sequence Types
Sri Lanka Bangladesh Ecuador Thailand Vietnam Pacific Ocean Baltic Sea Japan China Honduras India
66%
12% 10%
7%
5%
88%
Fig. 3A: Minimum Spanning Tree depending on sequence differences of STs. Pie chart of geographic origin. Colouring according to the region of origin.
West-Asia
South-America
Central-Asia
Europe
East-Asia
Asia
Fig. 2: Gelelectrophoretic illustration of amplified fragments before (A) and after (C) usage of additional primers (B).
A
B
C
Acknowledgement: The project was founded by BMBF (VibrioNet-Project).