department of economic development, jobs, transport & resources precise trait engineering in...

DEPARTMENT OF ECONOMIC DEVELOPMENT, JOBS, TRANSPORT & RESOURCES

Precise Trait Engineering in Wheat Using EXZACTTM Technology

Dr Matt Hayden24 September 2015

2DEPARTMENT OF ECONOMIC DEVELOPMENT,

JOBS, TRANSPORT & RESOURCES

How Wheat Is Genetically Modified

Mutagenesis

Exposing seeds to chemicals or radiation

Traditional Breeding

Crossing plants and selecting offspring

Number of Genes Affected

Many Difficult to assess Few

Desired gene(s) introduced with other

genetic material

Random changes in genome, usually

unpredictable

Desired gene(s) inserted into genome

Transgenics

Inserting or modifying genes using

recombinant DNA methods

*adapted from www.geneticliteracyproject.org



Random insertion of foreign DNA into the genome.

Applications

– Add new gene; transgenics or cisgenics

– Switch off / down regulate native (endogenous) gene expression; RNA silencing

Limitation

– Level of transgene expression dependent on site of integration; need to generate multiple plants to find the one with optimal transgene expression for variety development, or to determine “average” transgene effect for research purposes

Conventional Genetic Engineering

Random location

Random insertion



Precision Genome Editing

Targeted modification of a specific site in the genome.

Engineered nucleases are used to create a double stranded DNA break at a pre-determined position.

– Homing endonucleases / mega-nucleases

– ZFNs (zinc-finger nucleases)

– TALENs (transcription activator-like effector nucleases)

– CRISPR-Cas9 (clustered regularly interspaced short palindromic repeat-associated nuclease)



Precision Genome Editing

Engineered nuclease induction of a double stranded break stimulates native cellular DNA repair that can be used to precisely modify the target locus.

Mutagenesis DeletionChromosomal

deletion

Gene editing Gene conversion

Transgene insertion

Target sequence

Foreign DNA

*adapted from Tzfira et al. (2012) Plant Biotech. J.



Enabling EXZACT Technology in Wheat

Development of platform technology for implementation of EXZACTTM (ZFN-mediated) precision genome editing in bread wheat.

Triticum aestivum(AABBDD, 2n=42)

17 Gb genome

Approach1. Develop transient assay systems to investigate strategies and

explore construct designs for achieving precise integrative and non-integrative editing outcomes via EXZACT Delete, Edit and Add modes.

2. Establish a transformation system for generating wheat plants demonstrating EXZACT precision trait engineering.

Questions• Can sub-genome-specific ZFNs be designed for a polyploid species

that has 3 closely related but not identical sub-genomes? • Is there a design capability limit (i.e. minimum sequence window

size) for targeted ZFN design? • Is it possible to recover precision edited wheat plants with a

modified phenotype, or to modify a non-selectable trait locus?



AHAS (EC 2.2.1.6) catalyses key steps in the synthesis of branched-chain amino acids: leucine, valine and isoleucine.

Group B herbicides inhibit AHAS activity, leading to plant death by amino acid starvation.

5 mutations in AHAS confer tolerance to AHAS-inhibiting herbicides.

A122T (6D) and S653N (6A,6B,6D) mutations have been characterised in wheat.

Acetohydroxyacid Synthase (AHAS)

AHAS selected as model gene for EXZACT trait engineering, with S653N as target mutation

*position in reference to Arabidopsis thaliana



Approach To Implement EXZACT in Wheat

Transient Assays

Transformation System

Throughput High Low

Ability to regenerate plant

Low High

Comparison of steps

• Sequence AHAS genes• Design ZFNsZFN Design

• Assess ZFN efficacy • Optimise editing efficacyTransient Assays

• Generate wheat plants with precise genome modifications

Transformation System



Nucleotide variation between duplicated copies of AHAS gene in wheat genome.

AHAS Sequencing For ZFN Design

TCGCCCAAACCCTCGCCGCCGCCATGGCCGC[a/c]GCCACCTCCCCCGCCGTCGCATTCTCGGGCGCC[gccgccg/a]CCGCCGCCGCCAT[a/g]CCCAAACCCGCCCGCCA[g/t]CCTCTCCCGCGCCACCAGCCCG[c/t]CTCGCGCCGCGCGCTCCCCGCCCGC[a/g]TCGTCAGGTG[c/t]TGCGCCGCGTCCCCCGCCGCCACCTCCG[t/c]CGCGCC[t/c]CCCGC[c/a]ACCGCGCTCCGGCC[a/g/c]TGGGGCCC[c/g]TCCGAGCCCCGCAAGGGCGCCGACATCCTCGTCGAGGCGCT[g/c]GAGCGCTGCGGCATCGTCGACGT[c/a]TTCGCCTACCC[t/c]GGCGGCGC[g/c]TCCATGGAGATCCACCAGGCGCTGACGCGCTCGCC[a/c]GTCATCACCAACCACCTCTTCCGCCACGAGCAGGGGGAGGCGTTCGCGGCGTCCGG[g/c]TACGCCCGCGCGTCCGGCCGCGTCGGCGTCTGCGTCGCCACCTCCGGCCCGGGGGCCACCAACCTCGTCTCCGCGCTCGC[c/t]GACGC[t/c]CTCCTCGACTCCATCCCCATGGTCGCCATCACGGGCCAGGTCCCCCGCCGCATGATCGGCACGGA[t/c]GCGTTCCAGGAGACGCCCAT[a/c]GTGGAGGTCACGCGCTCCATCACCAAGCACAACTACCTGGTCCTTGACGTGGAGGATATCCCCCGCGTCATCCAGGAAGCCTTCTTCCT[c/t]GC[a/g]TCCTCTGGCCGCCCGGGGCCGGTGCT[g/a]GTTGATATCCCCAAGGA[c/t]ATCCAGCAGCAGATGGC[t/c]GTGCC[t/c][g/a]TCTGGGACAC[g/t]CC[g/a]ATGAGTTTGCCAGGGTACATCGCCCGCCTGCCCAAGCCACCATCTACTGAATCGCTTGAGCAGGTCCTGCGTCTGGTTGGCGAGTCACGGCGCCCAATTCTGTATGTTGGTGGTGGCTGCGCTGC[a/g]TC[t/c]GG[t/c]GAGGAGTTGCGCCGCTTTGTTGAGCT[c/t]ACTGGGATTCC[a/g]GTTACAACTACTCT[t/g]ATGGGCCTTGGCAACTTCCCCAG[c/t]GACGACCCACTGTCTCTGCGCATGCT[t/g]GGGATGCATGGCACTGTGTATGCAAATTATGCAGT[c/a]GATAAGGCTGACCTGTTGCT[c/t]GCATTTGGTGTGCGGTTTGATGATCG[t/c]GTGAC[t/c]GGGAAAATCGAGGC[t/c]TTTGCAAGCAGGTCCAAGATTGAGCACATTGACATTGACCCAGCTGAGATTGGCAGAACAAGCAGCCACATGTCTCCATTTGTGCAGATGTTAAGCTTGCTTTACAGGGGTTGAATG[a/c]TCTATTAAATGGGAGCAAAGCACAACAGGGTCTGGATTTTGGTCCATGGCACAAGGAGTTGGATCAGCAGAAGAGGGAGTTTCCTCTAGGATTCAAGACTTTTGG[c/t]GAGGCCATCCCGCCGCAATATGCTATCCAGGTACTGGATGAGCTGACAAAAGGGGAGGCGATCATTGC[c/t]AC[t/c]GGTGTTGGGCAGCA[c/t]CAGATGTGGGCGGCTCAGTATTACACTTACAAGCGGCCACGGCAGTGGCTGTCTTC[a/g]TC[t/c]GGTTTGGG[t/g]GCAATGGGATTTGGGTT[a/g]CCAGCTGCAGCTGGCGCTGCTGTGGCCAACCCAGGTGTTACAGTTGTTGACATTGATGG[a/g/t]GATGGTAGTTTCCTCATGAACATTCAGGAGTTGGC[a/g]TTGATCCG[c/t]ATTGAGAACCTCCC[a/t]GTGAAGGTGATGATATTGAACAACCAGCATCTGGGAATGGTGGTGCA[a/g]TGGGAGGATAGGTTTTACAAGGCCAA[t/c]CGGGCGCACACATACCTTGGCAACCCAGAAAATGAGAGTGAGATATATCCAGATTTTGTGACGATTGCTAAAGGATTCAACGTTCC[a/g]GCAGTTCG[a/t]GTGACGAAGAAGAGCGAAGTCACTGCAGCAATCAAGAAGATGCTTGAGACCCCAGGGCCATACTTGTTGGATATCAT[a/t/c]GTCCCGCATCAGGAGCACGTGCTGCCTATGATCCCAAGCGGTGGTGCTTT[c/t]AAGGACATGATCATGGAGGGTGATGGCAGGACCTCGTACTGAAATTTCGACCTACAAGACCTACAAGTGTGACATGCGCAATCAGCATG[a/g]T[g/a]CC[c/t]GCGTGTTGTATCAACTACT[a/g]GGGGTTCAACTGTGA[a/g]CCATGCGTTTTCTAGTTTGCTTGTTTCATTCATATAAGCTTGT[a/g]TTACTTAGTTCCGAACC[c/g]TGTAG[c/t]TTTGTAGTCT[a/c]TG[c/t]TCTCTTTTGTAGGGATGTGCTGTCATAAGAT[a/g]TCATGCAAGTTTCTTGTCCTACATATC

ZFNs designed to cut AHAS wheat gene in one or more sub-genomes

High ZFN design potential for narrow target sequence window



Transient assays used to assess ZFN cleavage efficacy and specificity.

ZFN Cleavage Efficacy and Specificity

ZFNs cut wheat genome in sub-genome and target gene-specific manner

A-genome B-genome D-genome Specificity

pDAB109354 54,781 (1.0-fold) 75,916 (1.3-fold) 73,067 (1.3-fold) Similar cleavage efficiency for all sub-genomespDAB109358 607 (1.0-fold) 268 (3.7-fold) 34,852 (130-fold) D-genome specific cleavage

Deletion size (bp)

Fre

quen

cy (

%)

ZFN activity (ppm) = No. reads with NHEJ deletion x 10^6 No. wild-type reads



Transient assays demonstrate ZFN-mediated gene knock-out and excision.

Transfection with single ZFN revealed evidence for efficient gene knock-out (loss-of-function), while co-transfection with two ZFNs showed efficient gene excision, evidenced by prevalence of AHAS-derived reads lacking intervening sequence between ZFN cut sites.

Strategies For EXZACT Delete & Excise

Molecular evidence generated for EXZACT Delete and Excise modes

Delete: Gene knock-out(using single ZFN)

Excise: Gene excision(using paired ZFNs)



Transient assays used to investigate approaches for ZFN-mediated gene addition and gene editing via NHEJ- and HR-directed DNA repair pathways.

Strategies For EXZACT Add & Edit

Editing frequency (ppm) = No. reads with edits x 10^6 No. wild-type reads

NHEJ-directed DNA repair HR-directed DNA repair



Strategies For EXZACT Add

Number edits per million reads

Example of transient assay showing molecular evidence for EXZACT Add via NHEJ-directed DNA repair pathway.

Transfected with ZFN designed to cleave all AHAS gene copies and a linear double-stranded DNA donor



Strategies For EXZACT Edit

Number edits per million reads

Example of transient assay showing molecular evidence for EXZACT Edit via HR-directed DNA repair pathway.

Transfected scutella with ZFN designed to cleave all AHAS gene copies and plasmid DNA donor



Molecular evidence generated for EXZACT Add and Edit modes based on NHEJ- and HR-directed DNA repair

Strategies For EXZACT Add & Edit



Recovered AHAS edited wheat plants tolerant to Imazamox

Transformation system based on biolistics-mediated DNA delivery to scutella of immature zygotic wheat embyros.

Target mutation: S653N → Confers tolerance to Imidazolinone class herbicides

Generation of AHAS Edited Wheat Plants

DNA delivery comprised a ZFN-expressing plasmid construct (designed to cleave all AHAS gene copies) and a double-stranded linear donor (designed to utilise NHEJ-directed DNA repair pathway). AHAS edited plants were recovered using Imazamox selection.

Donor designed to maintain correct protein coding after integration at site of DSB



Sanger sequence characterisation of T0 AHAS edited events.


Allele 1 Allele 2 Allele 1 Allele 2 Allele 1 Allele 2Event 10 Perfect Edit Unedited Unedited n.d. Unedited n.d.

Status Functional S653N mutation . . . . .No. sequences* 10 19 37 0 29 0

Event 6 Unedited n.d. Perfect Edit Unedited Unedited n.d.Status . . Functional S653N mutation . . .

No. sequences 22 0 11 18 43 0Event 11 Unedited n.d. Unedited n.d. Perfect Edit Unedited

Status . . . . Functional S653N mutation .No. sequences 35 0 37 0 15 11

Event 9 Perfect Edit n.d. Imperfect Edit Unedited Unedited n.d.Status Functional S653N mutation . Non-sense frameshift . . .

No. sequences 24 0 13 21 33 0Event 1 Perfect Edit NHEJ deletion at ZFN Imperfect Edit Unedited Imperfect Edit Unedited

Status Functional S653N mutation Non-sense frameshift Non-sense frameshift . Non-sense frameshift .No. sequences 13 20 12 19 14 22

Event 4 Perfect Edit Unedited Imperfect Edit Unedited Perfect Edit Imperfect EditStatus Functional S653N mutation . Non-sense frameshift . Functional S653N mutation Non-sense frameshift

No. sequences 6 11 44 30 6 11

A-genome B-genome D-genome

*indicates number of independent PCR amplicon clones sequenced.

Of recovered events, 46% had single gene edits; remainder had editing ≥2 AHAS genes Stable Mendelian inheritance of AHAS edits and Imazamox herbicide tolerance

phenotype was confirmed in T1 and T2 generations

Representative AHAS editing outcomes in independent events.



Generated Imazamox tolerant wheat plants via EXZACT Add, with independent plants demonstrating

single perfect AHAS allele edits on A-genome, B-genome and D-genome

simultaneous AHAS editing in multiple sub-genomes

hemizygous and homozygous sub-genome-specific AHAS allele editing


Perfect AHAS allele-splicing in A-genome



Imperfect EXZACT Add outcomes typically had small deletions at the left- or right-border of the integrated donor.


Imperfect AHAS allele-splicing in B-genome



Extending the platform technology to generate wheat plants with precise genome modifications at non-selectable trait loci.

e.g. Gene editing at an endogenous trait locus for grain quality (non-selectable) by simultaneous co-editing at a second (selectable) locus.

EXZACT Modification of Non-Selectable Loci



Demonstrating EXZACT co-editing using AHAS as a non-selectable trait locus.


AHAS(S653)−

AHAS(N653)PAT

AHAS(N653)PAT

AHAS(N653)−

Imazamox® Susceptible Tolerant Tolerant Tolerant

Basta® Susceptible Tolerant Tolerant Susceptible

Non-Selectable LocusSelectable Locus

EXZACT co-editing simultaneously introduces precise AHAS edits and integrates selectable marker PAT at an independent locus. Wheat events are recovered using BASTA® selection. Wheat plants with precise AHAS edits and without exogenous selectable marker are recovered by screening segregating T1 plants.



Demonstrating EXZACT co-editing using AHAS as a non-selectable trait locus.

Target mutation: S653N → Confers tolerance to Imidazolinone class herbicides


DNA co-delivered:• ZFN-expressing plasmid

construct designed to cleave AHAS genes

• Double-stranded linear donor designed to utilise NHEJ-directed DNA repair pathway.

• PAT-expressing plasmid construct



• Implementation of EXZACT technology in wheat was achieved.

• World’s first EXZACT wheat plants were generated.

• Transient assay systems for generating molecular evidence for precision editing in wheat were used to demonstrate strategies for EXZACT implementation of Delete, Edit and Add modes using HR- and NHEJ-directed DNA repair.

• Multiple options exist for generating wheat plants with precise integrative and non-integrative editing at both selectable and non-selectable trait loci.

• EXZACT technology enables the efficient generation of wheat plants with

precise sub-genome-specific (or target gene-specific) edits simultaneous precise editing in multiple sub-genomes (or gene targets)

through ZFN design and/or donor construct design.

• A transformation system for routine generation of selectable marker-free wheat plants with precise genome modifications at non-selectable trait loci was established.

Summary



• For wheat crop improvement, EXZACT technology enables:

More efficient transgene screening – precision transformation at a pre-defined locus should reduce event-to-event variability, compared to random integration events, thereby allowing more genes and constructs designs to be tested with the same resource base.

Rapid generation of targeted mutations and loss-of-function alleles for conventional forward breeding – expected to be faster than other types of mutational breeding, e.g. TILLING.

Creation and use of new alleles for trait improvement.

Summary



Acknowledgements

DEPI

Yidong RanNicola PatronMargaret BuchananYi TiYu Hua WangYingying CaoQuoqing TaoYihan LinHeather AndersonJohn MasonPippa KayDebbie WongJoanna PetkowskiKaterina VikudaSami HakimLinh NguyenGerman Spangenberg

Dow AgroSciences

Terry WalshMike AinleySteve Webb

Project Funding Source

department of economic development, jobs, transport & resources precise trait engineering in...

Documents

variety development

transport resources1how

precision edited wheat

transport resourcesahas

bread wheat

double stranded dna

engineered nucleases

offspringnumber of genes