december 4, 2011 systems biology in allergy and asthma lanny j. rosenwasser, m.d. dee lyons/missouri...
TRANSCRIPT
December 4, 2011December 4, 2011Systems Biology in Allergy and Asthma Systems Biology in Allergy and Asthma
Lanny J. Rosenwasser, M.D.Dee Lyons/Missouri Endowed Chair in Immunology Research
Professor of Pediatrics Allergy-Immunology Division
Childrens Mercy Hospital Kansas City, Missouri
Professor of Pediatrics, Medicine and Basic ScienceUniversity of Missouri Kansas City School of Medicine
Disclosure StatementLanny J. Rosenwasser, MD
• RESEARCH STUDIES Alcon, A-Z, GlaxoSmithKline, Genentech, Novartis
MBBH/MacArthur Foundation, National Institutes of Health
• CONSULTANT Alcon, , A-Z, Genentech, GlaxoSmithKline,
Novartis, Regeneron, Sanofi-Aventis
• SPEAKERS’ BUREAU Alcon, A-Z, Genentech, Novartis
Learning Objectives
•Understand the nature of Systems Biology
•Examine the complex nature of Immune Response in Allergy and Asthma
•Understand the applications of Systems Biology to Allergic Responses
Definitions
Systems Biology – Integrated basis forfunctionality of an Organism
Immune Responses – Symphonies of Molecularand Cellular Mechanisms with each componentgenerating a coordinated effective response
Analogies - Multiple
Analogies of Complex Disease Process
•Symphony
•Airplane
•Junkyard
•Radio
Modeling and Simulation at Molecular Scale
• Informatics – Software driven
• Modeling of Signaling and Receptor Activity
• Modeling of Cellular Behavior and Interactions
Large Scale Data Acquisition Technologies
• Cell and Molecular Biology
• Proteomics, Genomics
• Immunology Wet Lab
Molecular Biological Tools
• Gene and MiRNA Expression
• Transcript Profiling
• Next Generation Sequencing
• RNA; Screening
• Assay Design
• Applications
Interactional Measures
• Network Models
• 2 Hybrid Screens
• Mass Spec
• Proteomics
• Array Protein Assays
• Flow Cytometry
Characteristics of Asthma
• Narrowing of the airways
• Airway obstruction
• Airway inflammation
• Increased airway responsiveness
NHLBI, NAEPP, 1997.
DRAFT www.nhlbi.nih.gov/guidelines/asthma/epr3/DRAFT www.nhlbi.nih.gov/guidelines/asthma/epr3/
Neutrophil
Mast cell
IL-3, IL-4,IL-13, IL-9
Eosinophil
IL-3, IL-5 GM-CSF
Dendritic cell
IgE
Infl
amm
atio
n
(myo) fibroblasts
Blood vessels
Environmental factors and Inflammatory products
mucus
Smooth muscle
Airw
ay micro
enviro
nm
ent
Proinflammatory mediators
Th-2/Th-1 cytokines – eg
IL-13, TNF
Initiation
Amplification
Propagation
TNF
B lymphocyte T lymphocyte
Acute Inflammation Persistent inflammation and development of remodeling
Environmental factors
Airway EffectsBronchospam
Acute InflammationPersistent Inflammation
Remodeling
Complexity of Asthma
• Several orders of magnitude more complex
• Microbiome, Proteome, Transcriptome, Genome
• Tissues, Organs, Whole Body, Brain
• Third and Fourth Dimensions
Stepwise Approach for Managing Asthma
in Patients Aged ≥12 Years
ICS = inhaled corticosteroids; LABA = long-acting β2-agonist; LTRA = leukotriene receptor antagonist.
Adapted from National Asthma Education and Prevention Program. Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma (EPR-3 2007). U.S. Department of Health and Human Services. Available at: http://www.nhlbi.nih.gov/guidelines/asthma/asthgdln.pdf. Accessed August 29, 2007.
Step 1Step 1
Preferred:Preferred:SABA PRNSABA PRN
Step 2Step 2
Preferred:Preferred:Low-dose ICS Low-dose ICS (A)(A)
Alternative:Alternative: Cromolyn Cromolyn (A)(A),,
LTRA LTRA (A)(A), , Nedocromil Nedocromil (A(A)),,
ororTheophylline Theophylline (B)(B)
Step 3Step 3Preferred: Preferred:
Low-dose ICS + Low-dose ICS + LABA LABA (A)(A)
OR OR Medium-dose ICS Medium-dose ICS
(A)(A)
Alternative:Alternative:Low-dose ICS + Low-dose ICS + eithereither LTRA LTRA (A)(A), , Theophylline Theophylline (B)(B),,
or Zileuton or Zileuton (D)(D)
Step 5Step 5
Preferred:Preferred:High-dose ICS + High-dose ICS +
LABA LABA (B)(B)
ANDAND
Consider Consider OmalizumabOmalizumabfor Patientsfor PatientsWho HaveWho Have
Allergies Allergies (B)(B)
Step 4Step 4
Preferred:Preferred:Medium-doseMedium-dose
ICS + LABA ICS + LABA (B)(B)
Alternative:Alternative:Medium-dose Medium-dose
ICS + ICS + eithereither
LTRA LTRA (B)(B), , Theophylline Theophylline (B)(B),,or Zileuton or Zileuton (D)(D)
Step 6Step 6
Preferred:Preferred:High-dose ICS + High-dose ICS +
LABA + Oral LABA + Oral CorticosteroidCorticosteroid
ANDAND
Consider Consider Omalizumab for Omalizumab for Patients WhoPatients WhoHave AllergiesHave Allergies
IntermittentIntermittentAsthmaAsthma
Persistent Asthma: Daily MedicationPersistent Asthma: Daily MedicationConsult with asthma specialist if Step 4 care or higher is required. Consult with asthma specialist if Step 4 care or higher is required.
Consider consultation at Step 3.Consider consultation at Step 3.
Step Up IfStep Up If NeededNeeded
(first, check (first, check adherence, adherence,
environmental environmental control, and control, and
comorbid comorbid conditions)conditions)
Step Down If Step Down If PossiblePossible
(and asthma is (and asthma is well controlled at well controlled at least 3 months)least 3 months)
Assess Assess ControlControl
Quick-Relief Medication for All PatientsQuick-Relief Medication for All Patients• SABA as needed for symptoms. Intensity of treatment depends on severity of symptoms: up to 3 treatments SABA as needed for symptoms. Intensity of treatment depends on severity of symptoms: up to 3 treatments
at 20-minute intervals as needed. Short course of systemic oral corticosteroids may be neededat 20-minute intervals as needed. Short course of systemic oral corticosteroids may be needed• Use of SABA >2 days a week for symptom relief (not prevention of EIB) generally indicates inadequate control Use of SABA >2 days a week for symptom relief (not prevention of EIB) generally indicates inadequate control
and the need to step up treatmentand the need to step up treatment
Each Step: Patient education, environmental control, and management of comorbiditiesEach Step: Patient education, environmental control, and management of comorbiditiesSteps 2-4: Consider subcutaneous allergen immunotherapy for patients who have allergic asthmaSteps 2-4: Consider subcutaneous allergen immunotherapy for patients who have allergic asthma
Anti IgE
• Targets IgE, FCeRI• Rhu Mab - E25 - Omalizumab,
Xolair• Reduces Free IgE (allergen specific)• Reduces Eos (sputum, BAL, blood)• Reduces FCeRI and FCeRII
expression• Efficacy - Asthma, AR
Biotherapeutic Targets in Immune Allergic Disorders,
Anti-IgEInnate Immunity Targets
IL-1, TNF, IL-6TLR, Adhesion MoleculesIFN ModulationChemokines
Acquired ImmunityTargetsTh2, Th17 Cytokines IL-2, 4,5,9,13,17,25,33Cellular DC, T, B
Other TargetsTSLPAdipokinesGrowth and Differentiation Factors
IL-1 family members – Chr. 2q13
New Name Other Name Property
IL-1F1 IL-1α AgonistIL-1F2 IL-1β AgonistIL-1F3 IL-1Ra Receptor antagonistIL-1F4 IL-18 AgonistIL-1F5 FIL1δ Anti-inflammatoryIL-1F6 FIL-1ε AgonistIL-1F7 IL-37 Anti-inflammatoryIL-1F8 IL-1H2 AgonistIL-1F9 IL-1ε AgonistIL-1F10 IL1HУ2 Receptor antagonist IL-1F11 IL-33 Agonist
Extended IL-1 Family
(Caspase 1 Dependent)
• IL-18 – shared receptor and genetics (IL-18bp)
• IL-32 – TNF inducer
• IL-33 – Ligand for ST2 Induces TH2 Cytokines
• IL-37 – Downregulation of IL-1 family activities
IL-17 Family
• 20-30 кd
• IL-17A, IL-17F – profibrotic activate chemokines (IL-8) and IL-6
• IL-17E – IL-25
• IL-25 associated with eosinophilia, airways hyperresponsiveness
• Genetics of IL-17 family linked to asthma
Key Central Key Central Role of IL-5 in Role of IL-5 in AsthmaAsthma
J ALLERGY IMMUNOL 2010 APR
Anti-IL-5 in Human Asthma:Anti-IL-5 in Human Asthma:Reduction in ExacerbationsReduction in Exacerbations
Haldar P et al. New Engl J Med 2009;360:973Nair P et al. New Engl J Med 2009;360:985
• Severe (CCS-dependent) asthma
• Sputum eosinophilia required for enrollment
• No improvement in FEV1, control, symptoms
Anti-IL-5 in Human Asthma:Anti-IL-5 in Human Asthma:
Haldar P et al. New Engl J Med 2009;360:973Nair P et al. New Engl J Med 2009;360:985
Comparison of High Affinity vs. Low Affinity IgE Receptor
(Modified from Novak, et at. JACI 2003)
Effector Cells of Allergy/Asthma -Mast Cells -Basophils
Antigen Presenting Cells CD23a -B cellsCD23b -Antigen Presenting Cells
(One log difference in binding)
CD 23 as a Target for Therapy
• FCe RII
• 45 KD C-type Lectin
• Type 2 Protein
• Expressed - B-cells, APC, DC Airway Smooth Muscle
FCER2 – Pleiotropic EffectsFCER2 SNP Allele
G9782a12 [T/G]G9782a19 [T/C]G9782a26 [C/T]G9782a5 [C/T]G9782a8 [C/A]
ForestHaplotype Phenotype Frequency P-ValueTTCCC BD % Change 0.06 0.03TCTCA BD Extremes 0.05 0.05GTCTA Steroid Extremes 0.13 0.02
CAMPHaplotype Phenotype Frequency P-ValueGTCTA BD % Change 0.15 0.03GTCTA BD % Change 1 yr 0.08 0.01GTCTA BD % Change 4 yr 0.08 0.02TCTTA Steroid % Ch. 1 yr 0.04 0.04TTCCC Steroid % Ch. 4 yr 0.07 0.03
Global P value for Steroid % Change 1 yr = 0.001
FCER2 – GCTTA Haplotype
05
101520253035404550
% w
ith
Hap
loty
pe
Hospitalizations ER Visits
p = 0.0001 (Hosp) and 0.01 (ER)
YesNo
CD23 GENETIC POLYMORPHISM
AA seq Nucleotide Alleleposition Variant Frequency AA Change
62 C to T C 0.75 Arginine toT 0.25 Tryptophan
3771 Nci I | 3785 3800
aagagagggctgcccggaacggtatgaagg ttctctcccgacgggccttgccatacttcc Agr
3771 |3785 3800
aagagagggctgcctggaacggtatgaaggTtctctcccgacggaccttgccatacttcc trp
Genotype of CD23 R62W in Genomic DNA (NT_011145)
Homo Wild type Hetero
393bp
183bp210bp
Kijimoto-Ochiai S., 2002
R W
Tantisera et al JACI,120,1285,2007
Allergy - 2030
• Systems Biology Approach to Allergic Cascades
• Biotherapeutics
• Pharmacogenetic Profiling
• Early Intervention
Systems Medicine
• Predictive
• Preventive
• Pharmacologically Effective
• Personalized
Challenges for the Future in Complex Genetic Disease
Translational Research
• Robust Biomarkers
• Phenotype Analysis Phenotype/Genotype Association
• Diagnostic/Pathologic Visualization (Nanomedicine)
• Informatics Modeling
References
Ronald N. Germain et al. Systems Biology in Immunology – A Computational Modeling Perspective. Annu Rev Immunol. 2011 29: 537-585
David J. Weatherall . Systems Biology and Red Cells, N ENGL J MED. 2011 364; 375-77.
Sydney Brenner. Sequence and consequences. Phil. Trans. R. Soc. B 2010 365,207-212.
Children’s Mercy Hospital & ClinicsChildren’s Mercy Hospital & Clinics
Jianfeng Meng
Marcia A. Chan
Brianna May
Nicole Gigliotti
Sharrion Russell
Acknowledgments