december 4, 2011 systems biology in allergy and asthma lanny j. rosenwasser, m.d. dee lyons/missouri...

56
December 4, 2011 December 4, 2011 Systems Biology in Allergy and Systems Biology in Allergy and Asthma Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of Pediatrics Allergy-Immunology Division Childrens Mercy Hospital Kansas City, Missouri Professor of Pediatrics, Medicine and Basic Science University of Missouri Kansas City School of

Upload: sara-sheehan

Post on 26-Mar-2015

221 views

Category:

Documents


4 download

TRANSCRIPT

Page 1: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

December 4, 2011December 4, 2011Systems Biology in Allergy and Asthma Systems Biology in Allergy and Asthma

Lanny J. Rosenwasser, M.D.Dee Lyons/Missouri Endowed Chair in Immunology Research

Professor of Pediatrics Allergy-Immunology Division

Childrens Mercy Hospital Kansas City, Missouri

Professor of Pediatrics, Medicine and Basic ScienceUniversity of Missouri Kansas City School of Medicine

Page 2: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 3: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Disclosure StatementLanny J. Rosenwasser, MD

• RESEARCH STUDIES Alcon, A-Z, GlaxoSmithKline, Genentech, Novartis

MBBH/MacArthur Foundation, National Institutes of Health

• CONSULTANT Alcon, , A-Z, Genentech, GlaxoSmithKline,

Novartis, Regeneron, Sanofi-Aventis

• SPEAKERS’ BUREAU Alcon, A-Z, Genentech, Novartis

Page 4: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Learning Objectives

•Understand the nature of Systems Biology

•Examine the complex nature of Immune Response in Allergy and Asthma

•Understand the applications of Systems Biology to Allergic Responses

Page 5: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Definitions

Systems Biology – Integrated basis forfunctionality of an Organism

Immune Responses – Symphonies of Molecularand Cellular Mechanisms with each componentgenerating a coordinated effective response

Analogies - Multiple

Page 6: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 7: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 8: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 9: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 10: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Analogies of Complex Disease Process

•Symphony

•Airplane

•Junkyard

•Radio

Page 11: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 12: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 13: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Modeling and Simulation at Molecular Scale

• Informatics – Software driven

• Modeling of Signaling and Receptor Activity

• Modeling of Cellular Behavior and Interactions

Page 14: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Large Scale Data Acquisition Technologies

• Cell and Molecular Biology

• Proteomics, Genomics

• Immunology Wet Lab

Page 15: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Molecular Biological Tools

• Gene and MiRNA Expression

• Transcript Profiling

• Next Generation Sequencing

• RNA; Screening

• Assay Design

• Applications

Page 16: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Interactional Measures

• Network Models

• 2 Hybrid Screens

• Mass Spec

• Proteomics

• Array Protein Assays

• Flow Cytometry

Page 17: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Characteristics of Asthma

• Narrowing of the airways

• Airway obstruction

• Airway inflammation

• Increased airway responsiveness

NHLBI, NAEPP, 1997.

Page 18: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

DRAFT www.nhlbi.nih.gov/guidelines/asthma/epr3/DRAFT www.nhlbi.nih.gov/guidelines/asthma/epr3/

Neutrophil

Mast cell

IL-3, IL-4,IL-13, IL-9

Eosinophil

IL-3, IL-5 GM-CSF

Dendritic cell

IgE

Infl

amm

atio

n

(myo) fibroblasts

Blood vessels

Environmental factors and Inflammatory products

mucus

Smooth muscle

Airw

ay micro

enviro

nm

ent

Proinflammatory mediators

Th-2/Th-1 cytokines – eg

IL-13, TNF

Initiation

Amplification

Propagation

TNF

B lymphocyte T lymphocyte

Acute Inflammation Persistent inflammation and development of remodeling

Environmental factors

Airway EffectsBronchospam

Acute InflammationPersistent Inflammation

Remodeling

Page 19: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 20: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 21: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Complexity of Asthma

• Several orders of magnitude more complex

• Microbiome, Proteome, Transcriptome, Genome

• Tissues, Organs, Whole Body, Brain

• Third and Fourth Dimensions

Page 22: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Stepwise Approach for Managing Asthma

in Patients Aged ≥12 Years

ICS = inhaled corticosteroids; LABA = long-acting β2-agonist; LTRA = leukotriene receptor antagonist.

Adapted from National Asthma Education and Prevention Program. Expert Panel Report 3: Guidelines for the Diagnosis and Management of Asthma (EPR-3 2007). U.S. Department of Health and Human Services. Available at: http://www.nhlbi.nih.gov/guidelines/asthma/asthgdln.pdf. Accessed August 29, 2007.

Step 1Step 1

Preferred:Preferred:SABA PRNSABA PRN

Step 2Step 2

Preferred:Preferred:Low-dose ICS Low-dose ICS (A)(A)

Alternative:Alternative: Cromolyn Cromolyn (A)(A),,

LTRA LTRA (A)(A), , Nedocromil Nedocromil (A(A)),,

ororTheophylline Theophylline (B)(B)

Step 3Step 3Preferred: Preferred:

Low-dose ICS + Low-dose ICS + LABA LABA (A)(A)

OR OR Medium-dose ICS Medium-dose ICS

(A)(A)

Alternative:Alternative:Low-dose ICS + Low-dose ICS + eithereither LTRA LTRA (A)(A), , Theophylline Theophylline (B)(B),,

or Zileuton or Zileuton (D)(D)

Step 5Step 5

Preferred:Preferred:High-dose ICS + High-dose ICS +

LABA LABA (B)(B)

ANDAND

Consider Consider OmalizumabOmalizumabfor Patientsfor PatientsWho HaveWho Have

Allergies Allergies (B)(B)

Step 4Step 4

Preferred:Preferred:Medium-doseMedium-dose

ICS + LABA ICS + LABA (B)(B)

Alternative:Alternative:Medium-dose Medium-dose

ICS + ICS + eithereither

LTRA LTRA (B)(B), , Theophylline Theophylline (B)(B),,or Zileuton or Zileuton (D)(D)

Step 6Step 6

Preferred:Preferred:High-dose ICS + High-dose ICS +

LABA + Oral LABA + Oral CorticosteroidCorticosteroid

ANDAND

Consider Consider Omalizumab for Omalizumab for Patients WhoPatients WhoHave AllergiesHave Allergies

IntermittentIntermittentAsthmaAsthma

Persistent Asthma: Daily MedicationPersistent Asthma: Daily MedicationConsult with asthma specialist if Step 4 care or higher is required. Consult with asthma specialist if Step 4 care or higher is required.

Consider consultation at Step 3.Consider consultation at Step 3.

Step Up IfStep Up If NeededNeeded

(first, check (first, check adherence, adherence,

environmental environmental control, and control, and

comorbid comorbid conditions)conditions)

Step Down If Step Down If PossiblePossible

(and asthma is (and asthma is well controlled at well controlled at least 3 months)least 3 months)

Assess Assess ControlControl

Quick-Relief Medication for All PatientsQuick-Relief Medication for All Patients• SABA as needed for symptoms. Intensity of treatment depends on severity of symptoms: up to 3 treatments SABA as needed for symptoms. Intensity of treatment depends on severity of symptoms: up to 3 treatments

at 20-minute intervals as needed. Short course of systemic oral corticosteroids may be neededat 20-minute intervals as needed. Short course of systemic oral corticosteroids may be needed• Use of SABA >2 days a week for symptom relief (not prevention of EIB) generally indicates inadequate control Use of SABA >2 days a week for symptom relief (not prevention of EIB) generally indicates inadequate control

and the need to step up treatmentand the need to step up treatment

Each Step: Patient education, environmental control, and management of comorbiditiesEach Step: Patient education, environmental control, and management of comorbiditiesSteps 2-4: Consider subcutaneous allergen immunotherapy for patients who have allergic asthmaSteps 2-4: Consider subcutaneous allergen immunotherapy for patients who have allergic asthma

Page 23: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Anti IgE

• Targets IgE, FCeRI• Rhu Mab - E25 - Omalizumab,

Xolair• Reduces Free IgE (allergen specific)• Reduces Eos (sputum, BAL, blood)• Reduces FCeRI and FCeRII

expression• Efficacy - Asthma, AR

Page 24: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Biotherapeutic Targets in Immune Allergic Disorders,

Anti-IgEInnate Immunity Targets

IL-1, TNF, IL-6TLR, Adhesion MoleculesIFN ModulationChemokines

Acquired ImmunityTargetsTh2, Th17 Cytokines IL-2, 4,5,9,13,17,25,33Cellular DC, T, B

Other TargetsTSLPAdipokinesGrowth and Differentiation Factors

Page 25: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

IL-1 family members – Chr. 2q13

New Name Other Name Property

IL-1F1 IL-1α AgonistIL-1F2 IL-1β AgonistIL-1F3 IL-1Ra Receptor antagonistIL-1F4 IL-18 AgonistIL-1F5 FIL1δ Anti-inflammatoryIL-1F6 FIL-1ε AgonistIL-1F7 IL-37 Anti-inflammatoryIL-1F8 IL-1H2 AgonistIL-1F9 IL-1ε AgonistIL-1F10 IL1HУ2 Receptor antagonist IL-1F11 IL-33 Agonist

Page 26: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Extended IL-1 Family

(Caspase 1 Dependent)

• IL-18 – shared receptor and genetics (IL-18bp)

• IL-32 – TNF inducer

• IL-33 – Ligand for ST2 Induces TH2 Cytokines

• IL-37 – Downregulation of IL-1 family activities

Page 27: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 28: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 29: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

IL-17 Family

• 20-30 кd

• IL-17A, IL-17F – profibrotic activate chemokines (IL-8) and IL-6

• IL-17E – IL-25

• IL-25 associated with eosinophilia, airways hyperresponsiveness

• Genetics of IL-17 family linked to asthma

Page 30: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Key Central Key Central Role of IL-5 in Role of IL-5 in AsthmaAsthma

Page 31: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

J ALLERGY IMMUNOL 2010 APR

Page 32: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Anti-IL-5 in Human Asthma:Anti-IL-5 in Human Asthma:Reduction in ExacerbationsReduction in Exacerbations

Haldar P et al. New Engl J Med 2009;360:973Nair P et al. New Engl J Med 2009;360:985

• Severe (CCS-dependent) asthma

• Sputum eosinophilia required for enrollment

• No improvement in FEV1, control, symptoms

Page 33: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Anti-IL-5 in Human Asthma:Anti-IL-5 in Human Asthma:

Haldar P et al. New Engl J Med 2009;360:973Nair P et al. New Engl J Med 2009;360:985

Page 34: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 35: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 36: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Comparison of High Affinity vs. Low Affinity IgE Receptor

(Modified from Novak, et at. JACI 2003)

Effector Cells of Allergy/Asthma -Mast Cells -Basophils

Antigen Presenting Cells CD23a -B cellsCD23b -Antigen Presenting Cells

(One log difference in binding)

Page 37: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

CD 23 as a Target for Therapy

• FCe RII

• 45 KD C-type Lectin

• Type 2 Protein

• Expressed - B-cells, APC, DC Airway Smooth Muscle

Page 38: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 39: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

FCER2 – Pleiotropic EffectsFCER2 SNP Allele

G9782a12 [T/G]G9782a19 [T/C]G9782a26 [C/T]G9782a5 [C/T]G9782a8 [C/A]

ForestHaplotype Phenotype Frequency P-ValueTTCCC BD % Change 0.06 0.03TCTCA BD Extremes 0.05 0.05GTCTA Steroid Extremes 0.13 0.02

CAMPHaplotype Phenotype Frequency P-ValueGTCTA BD % Change 0.15 0.03GTCTA BD % Change 1 yr 0.08 0.01GTCTA BD % Change 4 yr 0.08 0.02TCTTA Steroid % Ch. 1 yr 0.04 0.04TTCCC Steroid % Ch. 4 yr 0.07 0.03

Global P value for Steroid % Change 1 yr = 0.001

Page 40: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

FCER2 – GCTTA Haplotype

05

101520253035404550

% w

ith

Hap

loty

pe

Hospitalizations ER Visits

p = 0.0001 (Hosp) and 0.01 (ER)

YesNo

Page 41: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

CD23 GENETIC POLYMORPHISM

AA seq Nucleotide Alleleposition Variant Frequency AA Change

62 C to T C 0.75 Arginine toT 0.25 Tryptophan

Page 42: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

3771 Nci I | 3785 3800

aagagagggctgcccggaacggtatgaagg ttctctcccgacgggccttgccatacttcc Agr

3771 |3785 3800

aagagagggctgcctggaacggtatgaaggTtctctcccgacggaccttgccatacttcc trp

Genotype of CD23 R62W in Genomic DNA (NT_011145)

Homo Wild type Hetero

393bp

183bp210bp

Kijimoto-Ochiai S., 2002

R W

Page 43: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Tantisera et al JACI,120,1285,2007

Page 44: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 45: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 46: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 47: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 48: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Allergy - 2030

• Systems Biology Approach to Allergic Cascades

• Biotherapeutics

• Pharmacogenetic Profiling

• Early Intervention

Page 49: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Systems Medicine

• Predictive

• Preventive

• Pharmacologically Effective

• Personalized

Page 50: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Challenges for the Future in Complex Genetic Disease

Translational Research

• Robust Biomarkers

• Phenotype Analysis Phenotype/Genotype Association

• Diagnostic/Pathologic Visualization (Nanomedicine)

• Informatics Modeling

Page 51: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

References

Ronald N. Germain et al. Systems Biology in Immunology – A Computational Modeling Perspective. Annu Rev Immunol. 2011 29: 537-585

David J. Weatherall . Systems Biology and Red Cells, N ENGL J MED. 2011 364; 375-77.

Sydney Brenner. Sequence and consequences. Phil. Trans. R. Soc. B 2010 365,207-212.

Page 52: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 53: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 54: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of

Children’s Mercy Hospital & ClinicsChildren’s Mercy Hospital & Clinics

Jianfeng Meng

Marcia A. Chan

Brianna May

Nicole Gigliotti

Sharrion Russell

Acknowledgments

Page 55: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of
Page 56: December 4, 2011 Systems Biology in Allergy and Asthma Lanny J. Rosenwasser, M.D. Dee Lyons/Missouri Endowed Chair in Immunology Research Professor of