deaf1 & grh transcriptional factors function for early embryonic development in drosophila

7/29/2019 Deaf1 & Grh Transcriptional Factors Function for Early Embryonic Development in Drosophila

1/15

Deaf1 & Grh: Novel Transcription Activators forDrosophila Embryonic Epidermal Development

Datoya Brown

Fayetteville State University

BIOL 430-01: Special Problems

Dr. Christina Swanson

2012 December 04


2/15

INTRODUCTION

Transcriptional regulation

Normal development of an organism depends on precisely regulated spatial expression of

its genes. Conlon and Raff (1999) note that having an adequate balance between cell growth, cell

proliferation, and cell death ensures correct cell, tissue and animal size. The type of processes

required for this precise measurement is regulated by a process known as transcription.

Transcription results in the production of RNA to be translated into protein, thus engineering

genes and promoting gene expression in an organism. Gene expression is the process by which

information from a gene is used in the synthesis of a functional gene product. Cellular

differentiation and morphogenesis are controlled by expression of specific set of genes. Studying

the regulation of gene expression will help in understanding the functional role of that gene. It

can be studied at protein level, by using the antibodies specific to the gene product, and at RNA

levels by using anti-sense mRNA. For the purposes of this research paper, we used the latter

method to study regulation of a gene calledDacapo.

The fact that the epidermal cell proliferation is terminated with good synchrony at a

precise developmental stage, in combination with the genetic possibilities, provides a unique and

decisive advantage for the analysis of the regulatory mechanisms that stop cell proliferation in

vivo (Lane et al, 1996). The aim of this project was to investigate the role of Deformed

Epidermal Autoregulatory Factor 1 (Deaf1) and Grainyhead (Grh), in regulating expression of

theDacapo gene.The available information on the biochemical role of these TFs and their

expression profile as well as tissue and developmental stage specific regulation of expression is

not complete. Molecular genetic analysis of expression inDrosophila may provide valuable

insight into its regulation and function. Therefore, spatial distribution of DAP RNA transcript in


3/15

Drosophila embryos was studied by in situ hybridization and antibody staining respectively.Our

objective was to identify novel transcriptional regulators of the dap gene.

Basic Biology of Drosophila melanogaster

In the sciences the fruit flyDrosophila melanogasterhas shown to be a lasting model for

biological research. Adopted as a genetics research model well over a hundred years ago by

Thomas Hunt Morgan (Singh and Irvine, 2012) this species is still one of the most powerful

model organisms. In the modern era, D. melanogaster was the first major complex organism to

have its genome sequenced (Adams et al, 2000). The fruit fly may be considered multiple model

organisms, each with its own specific advantages, defined by developmental stage (Figure 1):

Figure 1. Life Cycle ofDrosophila melanogaster


4/15

the embryo, the larva, the pupa, and the adult. The embryo is often used in fundamental

developmental studies examining pattern formation, cell fate determination, organogenesis, and

neuronal development and axon pathfinding.

Dacapo

The gene dacapo (Dap) is a protein coding gene found in the specific speciesDrosophila

melanogaster. There is experimental evidence that it has the molecular function of cyclin-

dependent protein kinase inhibitor activity. Cyclin-dependent protein kinases (CKI) are proteins

used to arrest cell proliferation at appropriate stages of development. The proteinDap encodes a

CKI with an essential function during normal embryonic development (de Nooij et al, 1996)

Currently Known Information

Drosophila has long been at the forefront of studies of transcriptional regulation, and is

currently one of the most tractable models for animal transcriptional control. Many fundamental

concepts such as the regulation of development by categorized cascades of transcription factors

originated in research onDrosophila. With the dacapo gene, earlier studies have revealed that is

maintains a necessity to be expressed for embryonic survival.Drosophila should prove to be of

valuable interest in the general understanding of transcriptional regulation of cell fate

specification. One of the specific questions being addressed by researchers in the field is, How

is dap transcription regulated in theDrosophila embryo?

Role During Embryogenesis

One of the great challenges of biology is to understand how cell diversity is generated

during development. During embryogenesis the expression ofdap has an association with exit

from the cell cycle (de Nooij et al, 1996). This is a very important factor for higher organisms


5/15

that cannot function without control over cellular differentiation, and other developmental

decisions.

Normal Expressions in the Embryo

In various tissues, expression of Dap occurs precisely during the last mitotic division that

cells undergo before they terminally differentiate. In the embryonic epidermis, a rapid

accumulation ofDap mRNA and Dap protein is detected just before these cells arrest. The

induction ofdap directly regulates the developmental cues that dictate cell cycle exit (de Nooij et

al, 2000). The regulation ofdap at the transcriptional level seems unlikely to account fully for

the dynamic expression pattern of Dap protein. In the embryonic epidermis, dacapo expression

starts during G2 of the final division cycle and is required for the arrest of cell cycle progression

in G1 after the final mitosis.

The onset ofdacapo transcription is the earliest event known to be required for the

epidermal cell proliferation arrest. To advance an understanding of the regulatory mechanisms

that terminate cell proliferation at the appropriate stage, the control ofdacapo transcription has

been analyzed. dacapo transcription is not coupled to cell cycle progression. It is not affected in

mutants where proliferation is arrested either too early or too late. Moreover, upregulation of

dacapo expression is not an obligatory event of the cell cycle exit process. The control of dacapo

expression varies in different stages and tissues. The dacapo regulatory region includes many

independent cis-regulatory elements. The elements that control epidermal expression integrate

developmental cues that time the arrest of cell proliferation (Meyer et al, 2002). In this paper we

collectively try to replicate previous experimentation to see if there a novel TFs.

Possible Transcription Factors


6/15

So far, no known possible transcription factor that have been identified bind directly to

the enhancer to activate expression of dap in the embryonic epidermis.

Localization of Enhancer

Embryonic transcription must be under the control of an enhancer that specifically

activates transcription of dap in the embryo. Figure 2 illustrates the specific region previous

research pointed towards for such TFs. Authors identified a DNA region that activates

transcription in the embryonic epidermis between -3.8 and -3.5 kb upstream of the dap promoter.

They successful did this by testing multiple pieces of DNA upstream of the dap gene for their

ability to activate expression of a reporter gene.

Figure 2. Analysis of thedap regulatory region (Meyer et al. 2002)The dap genomic regions ofD.

melanogasterandD. virilis were isolated, sequenced and compared. The coding

sequences are indicated by black boxes


7/15

Dap Embryonic Transcription Factor Regulatory Enhancers

After using candidate and bioinformatics approaches to identifytranscription factors thatbind and regulate an enhancer, two transcriptional activators that have potential binding sites

within the dap enhancer and are also expressed in the embryonic epidermis were accepted. The

two TFs were Grainyhead (Grh) and Deformed Epidermal Autoregulatory Factor 1 (Deaf1),

below are the known regions coding sequences respectively. Grainyhead sites are highlighted in

red andDeaf1 sites are blue.

{CAAAATCTGAGAAGGGTCACTGTTCCTTTTTTCCCCCCTGTTAATAAATTCGTCTTGT

GATTGAAAACCCCCAAATGACCGAGCGGTCTACCTGCATTTTATGGCCATCTTACTATATCGGACTCCCTTTTCCAACCTGTTTTGTGGATGATTTTCGAAAGGATTTCGGTTTTC

TGTATTTTCCTACGTTAAACGATCGCCGACGCCGATTGCCTCGCTGCTT}

Deformed Epidermal Autoregulatory Factor 1 (Deaf1) Protein

The transcription factor DEAF-1 is the mammalian homologue of a critical Drosophila

developmental gene and is essential for embryonic survival. Deformed epidermal autoregulatory

factor-1 (DEAF-1) is a transcription factor that was originally shown to bind the autoregulatory

enhancer of the Deformed (Dfd) Hox gene, which is activated in embryonic head segments of

Drosophila. DEAF-1 is maternally expressed, and the encoded protein is broadly distributedthroughout the early embryo. This aspect of Drosophila embryos was essential in studying gene

transcriptional regulation for this research project.

Grainyhead (Grh) Protein

Expression ofGrh is first seen in stage 11 in both the epidermis and central nervous

system (Bray et al, 1989).In contrast to its known role as a repressor, Venkatesan et al (2003)

prove that Grh is also a transcriptional activator. Grainyhead regulates genes involved in


8/15

epidermal development. An incredible amount of work has been expended in understanding the

mechanism by which GRH acts as a transcriptional activator. This work has aided in an

understanding of the basic apparatus for transcriptional activation. Studies of the role of GRH in

transcriptional activation have resulted in the isolation of coactivators associated with the TATA-

binding protein that mediates transcriptional activation (Dynlacht, 1991).

Hypothesis

We collectively hypothesized that the Grh andDeaf1 transcription factors (TFs) regulate

dap transcription in theDrosophila embryo.

MATERIALS AND METHODS

Drosophila Stock

Three strains of fruit flies of the speciesDrosophila melanogasterwere obtained. One

strain consisted of true-breeding wild-type flies and the other two consisted of flies with two

different mutations, the dominant Deformed epidermal autoregulatory factor 1 (Deaf1) mutation

and the other Grainyhead (Grh) mutation. Mutant embryos were generated from heterozygous

mutant parents. Maintenance of homozygous mutant stocks is nonexistent due to lethality

characteristics.

RNA Probe preparation

When making the probe, we used special nucleotides that are linked to a molecule that

can be visualized indirectly via a color-developing reaction. Probes used in this study consisted

of Digoxigenin-linked nucleotides. After applying the probe to our tissue (whole embryos), we

exposed the tissue to anti-Digoxigenin antibodies that were fused to an alkaline phosphatase
http://www.sdbonline.org/fly/aimorph/ectoderm.htmhttp://www.sdbonline.org/fly/aimorph/ectoderm.htm


9/15

molecule; these antibodies bind specifically to the Digoxigenin-labeled probe. The alkaline

phosphatase was visualized in a color-developing reaction as the final step of the ISH. This

color-developing reaction allowed us to see where our probe, and thus our mRNA, localized

within the tissue.

Whole-Mount In Situ Hybridization

ISH was 3-day process for the provisions of the course. Prior to the in situ hybridization,

Drosophila embryos of the desired genotype and age, which for experimentation purposes was 5-

7 hours old, were collected from private stock. These embryos were then fixed in formaldehyde

and stored at -20C until ready for use. All embryos were stored in 1.5 mL Eppendorf tubes.

RNA probe was also previously generated that includes the Digoxigenin-labeled nucleotidesand

was complementary to the dap mRNA.

ISH Day 1 (Pretreatment) Embryos were first washed to remove formaldehyde and transferred

into hybridization buffer. The probe was then diluted in the hybridization buffer before

application to embryos. Dilution was prepared by adding 0.5 l of probe to 250 l of

Hybridization Buffer. Probe was then heated to 85C for 5 minutes, thus removing any

secondary structure within the probe to ensure hybridization to mRNA. Afterwards, probe is

then transferred to ice for 2 minutes. For next 5 minutes probe is allowed to gain room

temperature.

The solution embryos were immersed in (hybridization buffer without probe added) was

removed, without removing the embryos ,by carefully and slowly pipetting up the liquid above

the embryos, without touching or disturbing the embryos. Small volume of residual liquid was


10/15

left behind to further prevent disturbance of embryos. 250 l of probe was then added to

embryos by transferring the probe into the tube with the embryos using a micropipette.

ISH Day 2 (Supplementary Washes) The second day consisted of a series of washes that

removed any excess probe not bound to mRNA from the embryos. These washes prevented any

background staining and thereby allowing real staining to be clear and obvious. These washes

were performed by Dr. Swanson subsequently to the pretreatment.

ISH Day 3 (Antibody Staining) Prior to experimentation, Dr. Swanson incubated the embryos in

the anti-Digoxigenin-Alkaline Phosphatase antibody, which will bind to labeled probe and will

drive the color-developing reaction. Solution from previous washes was removed from

embryos carefully, without disturbing the embryos. We then added 500 l of AP buffer to

embryos and incubated for 5 minutes on rocking/rotating platform. While embryos were

incubating in AP buffer, we prepared color developing solution by adding 1 ml of AP buffer to a

clean microfuge tube, then adding 2 l of BCIP and 2.5 l of NBT to the AP buffer in that tube.

Once 5 minute incubation was over, we allowed embryos to gradually resettle at the bottom of

the tube (about 30 seconds), then removed AP buffer carefully, without removing embryos. 1 ml

of developing solution was added to the embryos. Embryos were incubated in developing

solution on rotating platform until color stain developed. This can take anywhere from 5 minutes

to 5 hours, but for this experiment we anticipated a 10-15 minute reaction.. Checking tube every

3-5 minutes, more frequently after 10 minutes has passed, to see if color has developed; embryos

turned blue as stain developed. We held the tubes against a white sheet of paper to allow easy

visualization of the stain. The embryos full incubation time for color developing reaction was

24 minutes, 37 seconds at room temperature.


11/15

To stop the color reaction (if you allow it to proceed too long, the stain will spread to

tissues that arent truly expressing specified mRNA), we removed color-developing solution

from embryos (once theyve were allowed to settle). Next, we added 1 ml of PBS-Tween to the

embryos, allow them to resettle, then removed solution.. this process was subsequently repeated

5 more times. After washing steps, 1 ml PBS-Tween was added to embryos and given to Dr.

Swanson for mounting onto slides for microscopic imagery. These methods were used for both

wild-type embryos,Deaf1 and Grh mutants.

RESULTS

Weve confirmed that dap is expressed in wild-type, 5-7 hour old embryos, and that our

reagents and protocol worked.

Statistical Analysis

The initial overall expected outcome of the experiment using wild-type was that majority

ofDrosophila embryos would stain during ISH, thus illustrating transcriptional activation of

dacapo gene.

Drosophila melanogaster Strain Total

Embryos

Expressdap

mRNA (%)

No dap mRNA

Expression (%)

WildType 464 (90%) (10%)Deaf1 Mutant 247 (61%) (39%)

Grh Mutant 151 (95%) (5%)

Total(s) 862 246% 54%

Table 1 Triple Strain Drosophila In Situ Hybridization Results (Source: Compiled data from the entire class, for

illustration purposes only)

Since we performed the ISH on wild-type embryos first, the standard for overall embryos

tested was taken. As noted in Table 1. the observed frequency ofdap expression differed

significantly between wild-type and Grh embryos (statistical analysis of p = 0.03). This value


12/15

was barely below the cut-off for statistical significance in which a significant value was either

0.05.

Previous data showed that dap transcription initiates in the embryonic epidermis in 5-7 hour old

embryos.

The images of wild-type embryos expressing dap mRNA is depicted in Figure 3. These images

were taken from a microscope and enlarged for better view. In this strain of Drosophila, there is

normal initiation of expression of the RNA and protein even at one of the earliest stages of

embryonic development (Figure 3A-B). No dap mRNA expression is observed in wild-type

embryos with sense probe included (Figure 3C).

Upon viewing other microscopic images for expression ofdap, significantly more Grh

embryos expressed dap mRNA than wild-type embryos. This difference was scarcely significant,

thereby suggesting that the difference could have been due simply to coincidence and might

never be observed again if experimentation were to be repeated. The observed frequency of dap

expression differed significantly between wild-type andDeaf1 embryos as well (p = 0.0001). In

this case the difference was noticeably significant. We observed that there were significantly

Wild-type embryo with sense probe (control)Wild-type EmbryoPublished ISH

Figure 3. Expression of dap mRNA in Drosophila embryos: Expression of Dap RNA in all wild type embryos.(A)Previous staining of dap mRNA (Lane et al, 1996) (B) Staining of dap mRNA in wild-type embryos (C)Dap RNA detectedin at embryonic stage (5-7 hour old) by whole-mount in-situ hybridization using a digoxygenin-labeled probe. In the cellularblastoderm stage, Dap is found in the whole embryo. Expression persists in differentiating mesodermal tissues and the

neuroctodermal region during gastrulation, germband elongation, and segmentation.

A B C


13/15

fewerDeaf1 embryos that expressed dap mRNA than wild-type embryos. In this case, the p-

value was so small that it is very unlikely that the difference was due to chance.

DISCUSSION

The final differentiated state of organs, tissues, and cells that make up adult organisms is

the end result of a developmental program of gene expression that is initiated at fertilization and

elaborated during embryogenesis. The Drosophila is being used as a model organism in

biological research for nearly a century due to its similarity with the human proteins, some of

which may serve as potential drug targets. It lends itself well to behavioral studies. Scientists

have discovered an identifiable match between the genetic code of fruit flies and over 60% of

known human disease genes. Moreover, about 50% of fly protein sequences are believed to have

mammalian analogues. The type of fly that is utilized in our research is the Drosophila

melanogaster, a common species used for scientific experiments [Roberts, 1986]. The benefit of

A

Grainyhead(Grh)

B

Deaf1 Embryo-No Staining

C

Deaf1 Embryo-With Staining

Figure 4. In Situ Hybridization of dap mutants Grainyhead (Grh) and Deaf1. (A) depiction of one of theGrh embryos showing staining in epidermis (B)No staining of one of the variousDeaf1 embryos (C) Moreepidermis staining showing localization of dap mRNA during ISH

The results obtained from ISH of both Grh andDeaf1 Drosophila embryos (Figure 4) show that

Grh is required for embryonic development (Figure 4A) It has localized mRNA expression directly in

the epidermis. For Deaf1 embryos various embryos did not obtain the stain during experimentation

(Figure 4B). However there was notable staining to document in Deaf1 (Figure 4C).


14/15

using Drosophila is that they are relatively easy to maintain and daily embryo collection can be

accomplished easily using an automated egg collection system.

Based on the in situ hybridization (ISH) experimental results the conclusion is that the

gene dacapo mRNA is localized within the tissue (Drosophila embryo) ofGrh embryos and

Deaf1 embryos. This is stated due to obvious staining in the localized region providing insight as

to the genes specific designation for activation in Drosophila species. In regards to antibody

staining, there is no visible staining of some of the Deaf1 embryos but the could be contributed

to the human error when conducting the experiment.

Our hypothesis can be supported partially by one of the transcription factors tested.

However, the other portion has to be rejected because satisfactory results were not obtained.

Possible errors could be ISH time lapse for color reactive staining. Preliminary results are yet to

be determined until further extensive duplications of the experiment.


15/15

Bibliography

Adams MD, Celniker SE, Holt RA, Evans CA, Gocayne JD, Amanatides PG, Scherer

SE, Li PW, Hoskins RA, Galle RF, et al. The genome sequence ofDrosophilamelanogaster. Science. 2000; (287):21852195.

Bray SJ, Burke B, Brown NH, Hirsh J.Embryonic expression pattern of a family ofDrosophila

proteins that interact with a central nervous system regulatory element. Genes & Development

1989;(3):1130-1145

Conlon I., and Raff M. Size control in animal development. Cell. 1999; (96):235-244.

De Nooij JC et al. A cyclin-dependent kinase inhibitor,Dacapo, is necessary for timely exit

from the cell cycle duringDrosophila embryogenesis. Cell .1996; (87):1237-1247.

Dynlacht BD, Hoey T, and Tjian R. Isolation of coactivators associated with the TATA-binding

protein that mediate transcriptional activation. Cell. 1991; 66(3): 563-576

Gross CT, McGinnis W. DEAF-1, a novel protein that binds an essential region in a Deformedresponse element. Embo J. 1996; (15):19611970.

Lane, ME; Sauer, K; Wallace, K; Jan, YN; Lehner, CF; Vaessin, H. Dacapo, a cyclin-dependent

kinase inhibitor, stops cell proliferation duringDrosophila development. Cell. 1996; (87):1225-1235.

Roberts DB.Drosophila: A Practical Approach. Oxford: IRL Press, 1986.

Singh A, Irvine KD.Drosophila as a Model for Understanding Development and Disease.

Developmental Dynamics. 2012; 241 (1):1-2.

Venkatesan K, McManus HR, Mello CC, Smith TF, Hansen U. Functional conservation between

members of an ancient duplicated transcription factor family, LSF/Grainyhead. Nucleic Acids

Research. 2003; 31(15): 4304-4316

deaf1 & grh transcriptional factors function for early embryonic development in drosophila

Documents