data mining techniques and applications, 1 st edition hongbo du isbn 978-1-84480-891-5 © 2010...
TRANSCRIPT
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Chapter Three
Data, pre-processing and exploration
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Chapter Overview
• Data, data types and operations• Properties of various data sets • Data source and data warehouse• Issues of data quality• Data pre-processing operations• Data summary and visualisation• Online analytic processing (OLAP) • Data exploration and visualisation in Weka
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data, Data Types and Operations
• Data object and attributes– Data object or instance: individual independent
recording of a real life object/event.– Characterised by its recorded values on a fixed set of
features or attributes– Feature or attribute: a specific property or
characteristic of the data object.– Measurement: assigning a valid value to an attribute
according to an appropriate measurement scale.– Collection: collecting measurement results or
recorded values
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data, Data Types and Operations
• Data object and attributes (cont’d)– An example
123, “John Smith”, “03/02/1990”, 20, “male”, 1.82, 78
ID number, collected
Namecollected
Birthday collected
Agecalculated
Gender collected
Body heightmeasured
Body weightmeasured
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data, Data Types and Operations• Data object and attributes (cont’d)
– Measurement and measurement errors• Precision: the closeness of measurements to one another,
represented by the standard deviation of the measurements, e.g. repeated measure of body temperature
• Bias: a systematic variation of measurements from the intended quantity measurement, only known when external reference available, e.g. bias in weight measure instrument
• Accuracy: the closeness of the measure to the true value, indicated by the number of significant digits used in the measurement, e.g. measure of money: pound vs. penny
– Collection errors• Incorrect data recording at the point of entry, e.g. “Hongpo
Do” as for “Hongbo Du”
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data, Data Types and Operations
• Attribute domain types and operations– Categorical/Qualitative types
• Nominal, e.g. Gender (M, F)– A set of names: no concept of order nor difference– Operators applicable: =, – 1:1 transformation permissible, e.g. ID: 11 e901
• Ordinal, e.g. Grade (A, B, C, D, E)– A set of names: with order but no concept of difference– Operator applicable: =, , <, >, , – Order-preserving transformation permitted,
e.g. Grade: A First, B Second, C Third, D Pass, E BarePass.
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data, Data Types and Operations
• Attribute domain types and operations– Numeric/Quantitative types
• Interval, e.g. Temperature in C– A set of numeric values: both order and difference exist– Operators applicable: =, , <, >, , , +, -– e.g. temperature (F and C), calendar year– Transformation new = a*old + b permitted, e.g. F C
• Ratio, e.g. Length– A set of numeric values: order, difference and ratio– The set has an absolute zero– Operator applicable: =, , <, >, , , +, -, , – Transformation new = a*old permitted, e.g. meter feet
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Sets
• Various forms– Table of records
• Relational table• Join of relational tables• Numerical spreadsheet (data matrix)• Boolean strings (document-term matrix)
– Ordered data• Time series and temporal sequence• Data sequence• Spatial data
– Graph-based data– Non record-based data
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Sets• Various forms (illustrated)
Age Group Own Car Income Band Classyoung yes low riskyyoung no low risky
middle aged yes middle riskymiddle aged no high safemiddle aged yes low risky
young yes high riskymiddle aged no low safe
retired yes middle saferetired no middle saferetired yes high safe
Age Group Own Car Income Band Classyoung yes low riskyyoung no low risky
middle aged yes middle riskymiddle aged no high safemiddle aged yes low risky
young yes high riskymiddle aged no low safe
retired yes middle saferetired no middle saferetired yes high safe
Relational Table
TID Items100 apple, beer, newspaper200 apple, beef, beer, newspaper, potato 300 beef, potato400 beef, noodles500 beef, potato
TID Items100 apple, beer, newspaper200 apple, beef, beer, newspaper, potato 300 beef, potato400 beef, noodles500 beef, potato
Transaction Database
Data Matrix
Page1 link1 link2
Page2 link3
Page4 www zzzz
Page3xxxxyyyy
Web Structure
GGTTCCGCCTTCAGCCCCGCGCCCGCAGGG…
Data Sequence Spatial Data
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Sets• Properties
– Type: file structure, e.g. ARFF for Weka, DAT for See5– Size: measured in terms of the total number of
records or total number of bytes, e.g. small (MB), medium (GB) and large (TB)
– Dimensionality: number of attributes– Sparsity:
• Values are skewed to some extreme or sub-ranges• Asymmetric values (some are more important than others)
– Resolution• Right level of data details• Related to the intended purpose
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Sets• Properties (example insurance data set)
Type: ARFF
Size: 14722 records
Dimensionality: 7
Asymmetric: Y/N Skewed?Resolution: detailed
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Source and Data Warehouse
• Sources of data– Local data source available– Local operational systems from different departments– Third-party external data source– Enterprise/Organisational data warehouse
• An organisational database for decision making• A central data repository separate from operational systems• Enforcing organisation-wide data consistency and integration• Providing data details as well as data summarisation• Providing data values as well as meta-data • Equipped with data analysis and reporting tools• As a data source for data mining
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Source and Data Warehouse
• Star schema for data warehouse– Central fact table– Dimension tables– Limited use of join operations
Part(p#, pname, weight, colour)
Su
pp
lier(s
#, s
na
me
, city
, sta
tus
)
Pro
jec
t(pj#
, jna
me
, sta
tus
, da
te)
Supply(s#, p#, pj#, qty)
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Issues of Data Quality• Main quality indicators
– Accuracy: data recorded with sufficient precision and little bias
– Correctness: data recorded without error and spurious objects
– Completeness: any parts of data records missing– Consistency: compliance with established rules and
constraints– Redundancy: unnecessary duplicates
Using the indicators to quantify quality of a data setImproving quality if possible
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Issues of Data Quality
• Some examples– Accuracy & correctness with the road accident reports in
Exercise 1.3(c).
– Completeness with the UK family expenditure surveys in Exercise 1.3(a).
– Incompleteness introduced by data integration using outer join operation
– Consistency in questionnaires, e.g. eating fruit & veg. Q1: “give the fruit&veg portion consumed yesterday”: 2Q2: “give the fruit&veg portion consumed today:” 3Q3: “do you eat more today than yesterday?” No.
– Redundancy in a local company’s database of 40,000 records about 15,000 client companies.
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Issues of Data Quality
• Why is quality important?– “Garbage in, garbage out!”– Total data quality control requires a cultural change
(comparing with total product quality control)– For data mining, tackling the quality issue at the data
source cannot be always expected• By cleaning the data as much as possible• By developing and using more tolerate mining solutions
– Data quality is relevant to the intended purpose of data mining, e.g. Do spelling errors in student names really matter when only the increase/decrease of student numbers in particular subject areas over the years is of interest?
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Overview
– Purpose: for speedy, cost-effective and high quality outcomes of data mining
– Pre-processing tasks (not all are independent from each other)
• Data aggregation • Data sampling• Dimension reduction• Feature selection• Feature creation• Discretisation/binarisation• Variable transformation• Dealing with missing values
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Data aggregation
– What: to summarise low level data details to higher level data abstraction
– Why: to reduce the time of mining, to rescale data values, and to discover more stable patterns
– How: • By generalisation using a
given concept hierarchy • By applying aggregate
functions (e.g. count, sum, average)
• Dropping some attributes
TI D Date I tem Store Pri ce Cl ubcard# ………… …… …… …… …… …… …… 32144 06/ 06/ 2006 mi l k Bucki ngham 1. 99 1111 ……11122 04/ 04/ 2006 watch Bucki ngham 25. 99 1011 ……11122 04/ 04/ 2006 bat tery Bucki ngham 3. 99 1011 ……11123 04/ 04/ 2006 beer Bucki ngham 9. 99 1022 ……22244 04/ 04/ 2006 beer MK 6. 99 1022 ……22244 04/ 04/ 2006 nappi es MK 10. 89 1022 ……23311 05/ 04/ 2006 beer MK 6. 99 1011 ………… …… …… …… …… …… ……
TI D Date I tem Store Pri ce Cl ubcard# ………… …… …… …… …… …… …… 32144 06/ 06/ 2006 mi l k Bucki ngham 1. 99 1111 ……11122 04/ 04/ 2006 watch Bucki ngham 25. 99 1011 ……11122 04/ 04/ 2006 bat tery Bucki ngham 3. 99 1011 ……11123 04/ 04/ 2006 beer Bucki ngham 9. 99 1022 ……22244 04/ 04/ 2006 beer MK 6. 99 1022 ……22244 04/ 04/ 2006 nappi es MK 10. 89 1022 ……23311 05/ 04/ 2006 beer MK 6. 99 1011 ………… …… …… …… …… …… ……
Date Store AveragePri ce ………… …… …… ……
06/ 06/ 2006 Bucki ngham 1. 99 ……04/ 04/ 2006 Bucki ngham 13. 32 ……04/ 04/ 2006 MK 8. 94 ……05/ 04/ 2006 MK 6. 99 ……
…… …… …… ……
Date Store AveragePri ce ………… …… …… ……
06/ 06/ 2006 Bucki ngham 1. 99 ……04/ 04/ 2006 Bucki ngham 13. 32 ……04/ 04/ 2006 MK 8. 94 ……05/ 04/ 2006 MK 6. 99 ……
…… …… …… ……
Number of I tems Total Pr i ce Cl ubcard# ………… …… …… ……
1 1. 99 1111 ……3 36. 97 1011 ……2 27. 87 1022 ……
…… …… …… ……
Number of I tems Total Pr i ce Cl ubcard# ………… …… …… ……
1 1. 99 1111 ……3 36. 97 1011 ……2 27. 87 1022 ……
…… …… …… ……
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Data sampling
– What: selecting a subset of the given data set
– Why: to make it possible to use sophisticated mining algorithms within a time limit.
– Caution: the sample must be representative of the original data set
– How:• Random sampling• Stratified sampling• Progressive sampling• With or without replacement
Data population
Selected subset
Sampling method
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Feature selection
– What: reducing dimensionality by selecting a subset of attributes
– Purposes: • To remove/reduce redundant features• To remove irrelevant features with no
useful information for the mining task
– How:• Manually with common sense and
domain knowledge• Letting the mining solution to select
suitable features (the embedded approach)
• Filter and wrapper approaches
attributes
Subset selection
One subset
evaluation
Stoppingcriterion
Selectedsubset
Validate withMining task
ok Not ok
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing
• Data dimension reduction– What: reduce redundancy implied among attributes
e.g. are all 9600 dimensions for a 120x80 pixel image necessary?
– Curse of dimensions: as dimensionality increases• Data become more diverse, and any patterns are getting
less significant and more peculiar.• The processing time may increase substantially.
– Why: to reduce redundancy and effects of the curse– How:
• Linear algebra techniques – Principal component analysis (PCA)– Independent component analysis (ICA)– Single value decomposition (SVD)
• Feature selection (as described before)
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Feature creation
– What: to create a new set of features from the original features
– Purpose: in the new feature space, meaningful and relevant patterns can be extracted more easily. The number of features may be reduced.
– How:• Using feature extraction methods to extract new features from the
existing ones, e.g. extracting colour, texture and shape from image of pixel values
• Mapping data to a new space, e.g. wavelet transformation of pixel values of images to a frequency domain
• Constructing new features from the existing ones using domain knowledge, e.g. using transaction dates to construct a new feature customer tenure that indicates the loyalty of the customer to the company
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing
• Data discretisation– What: to convert continuous
attribute values to discrete categorical values
– The purposes: • Requirement for some data mining
solutions• Better data mining results (not
always)
– How:1. Deciding how many categories to
have and where split points should be
2. Mapping values to categories
Determine the number & locations of the split points
Mapping values within each sub-range to a category label
t1 t2 t3 t4
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing
• Data discretisation (cont’d)– Discretisation methods:
• Unsupervised: without concern to the outcome of a specific attribute, normally used for clustering and association rule mining
e.g. equal width, equal depth, clustering
• Supervised: with respect to the outcome of the class attribute, normally used for classification
– Simple methods: sorting according to the class attribute, and then discretising the attribute values for each class.
– Sophisticated methods: the discretisation of the attribute values purifies the outcome of the class, e.g. using entropy to measure the degree of purity, and deciding the split points recursively, similar to decision tree induction
– Merging methods, merging small intervals into a larger one with a stop criterion
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Data binarisation
– What: to convert discrete categorical values to binary Boolean attribute values
– The purpose: the same as for discretisation– How:
• Convert m categorical values to values in [0, m-1]
• Convert each to binary number of n bits where n = log2m
• Use m asymmetric binary variables to represent each of m values
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing• Variable transformation
– What: transform all values of an attribute to other values
– The purposes:• Remove the effect of the outlier values• Make the result data visualisation more interpretable
• Make the values more comparable – How:
• Transformation using function
e.g. log(x)• Standardisation/normalisation
e.g. division-by-range
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Pre-processing Handling missing values
– What: to treat attributes with null values– The purposes:
• Improve data quality• Better mining results
– How:• Elimination (may not always be possible)• Using sensible default, e.g. Spending Amount is set to 0• By data imputation
– Average, median, or mode of the whole data population– Average, median or mode of the nearest neighbours
• Postponing the handling and making the mining methods adaptive to missing values
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Exploring data before mining
– Knowing data is essential for successful data mining– Purposes:
• Better understanding of the characteristics of data• Better decision over data pre-processing tasks• Even being able to discover some hidden patterns
– Categories of data exploration techniques• Summary statistics: using a small set of descriptors to
describe the characteristics of a large data set• Data visualisation: using graphical or tabular forms to reveal
hidden data patterns• Online Analytic Processing (OLAP)
– Data exploration and exploratory data analysis (EDA)
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Summary statistics
– Frequency and mode for categorical attributes:• Frequency of value• Mode: the most frequently occurred value
– Percentiles for ordinal or continuous attributes:• Given an attribute x and an integer p (0p100), the
percentile xp is a value of x such that p% observed values of x are less than xp.
– Mean and median for continuous attributes:• Mean and median• Median is a better indication of “average” when data
distribution is skewed or outliers are present
– Trimmed mean and median (after trimming top and bottom p%)
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Summary statistics (cont’d)
– Measures of spread:• Range
• Variance (2)
• Standard Deviation ()
• Absolute average deviation (AAD)
– Multivariate summary statistics• Mean vector
• Matrix of covariance
• Correlation
2
1
2 )(1
1xx
m
m
ii
)min()max()( xxxrange
2
1
)(1
1xx
m
m
ii
||1
)(1
xxm
xAADm
ii
),...,,( 21 nxxxx
))((1
1),(covariance
1
yyxxm
yx i
m
ii
yx
yxyx
),(covariance
),(ncorrelatio
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Data visualisation
– Rationale: human eyes are good at spotting patterns, particularly visual patterns.
– Major ways of visualising data• Tabular form• Graphical form• Points and links
– Visual representation must be related to the data types of the attributes
– Visualising data as well as all its implicit relationships– The visualisation must be comprehensible– The visualisation of data must tell the truth
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Data visualisation techniques
Pie Chart
Bar Chart
Stem & Leaf Plot
Scatter Plot
Parallel Dimension Chart
Star Dimension Chart
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• Online analytic processing (OLAP)
– Interactive reporting tool – Treating a data set as a multidimensional hypercube– Fast operation and fast result delivery– A typical OLAP query:
“For each product, find its market share in its category today minus its market share in its category in 1994”
– Result of the OLAP query:Products Market Share Today Market Share in 1994 Difference
Dell 17" 17% 10% 7%HP 15" 83% 90% -7%Intel MotherB 56% 93% -37%
… … … …
Products Market Share Today Market Share in 1994 DifferenceDell 17" 17% 10% 7%HP 15" 83% 90% -7%Intel MotherB 56% 93% -37%
… … … …
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• OLAP: Multidimensional hypercube
Jan Feb DecMarchBuckingham
Milton Keynes
Northampton
1998
20001999
• Total Customer = 5• Customer Names
March
Milton Keynes1999
Branch Name Customer Name Month YearBuckingham Helen Miles April 2000Buckingham Mary Laughton April 1999
…… …… …. ….Milton Keynes Alen Young Feb 2000Milton Keynes Susan Young April 2000
…… …… …. ….Northampton Frank Sinatra April 1998
………… …. …. ….
Branch Name Customer Name Month YearBuckingham Helen Miles April 2000Buckingham Mary Laughton April 1999
…… …… …. ….Milton Keynes Alen Young Feb 2000Milton Keynes Susan Young April 2000
…… …… …. ….Northampton Frank Sinatra April 1998
………… …. …. ….
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
• OLAP: Hierarchies
winter spring summerBuckingham
Milton Keynes
Northampton
1998
20001999
autumn
Data Exploration
January February March
winter
April May June
spring
July August September
summer
October November December
autumn
Jan Feb DecMarchBuckingham
Milton Keynes
Northampton
1998
20001999
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration• OLAP: Operations
– Pivoting • Selecting attributes to define the cube• Visually rotating the cube to show a face
– Slicing and dicing • Selecting a part of a cube• Visually slicing a segment of a cube along a dimension
– Rolling-up• Moving up along a hierarchy
– Drilling-down • Moving down along a hierarchy
– Performing aggregate functions while rolling-up or drilling-down
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration in Weka Explorer• ARFF file format
Schema section
Data section
Data set name
Categorical attribute name and values
Numeric attribute names and types
One data record per line;Values separated by “,”;“?” represents unknown.
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration in Weka Explorer• Glance of an opened data set
Summary statistics
Visualisation of value distribution
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration in Weka Explorer• Visualisation in Weka (limited)
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Data Exploration in Weka Explorer• Filters for pre-processing
– Many filters– Supervised/unsupervised– Attribute/instance– Choose followed by
parameter setting in command line
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
Chapter Summary• The domain types determine the validity of operations applied.
• Transformation from one domain to another must preserve the domain characteristics.
• Data sets can be of various forms and from different sources.
• Data warehouse serves as a data source for data mining.
• Data quality is relevant to the intended application purpose.
• Data pre-processing operations are essential for good mining.
• Knowing the data is important for good data mining.
• Understanding of data is achieved via exploring, summarising and visualising data.
• OLAP serves as a data exploration and summarisation tool.
Data Mining Techniques and Applications, 1st editionHongbo Du
ISBN 978-1-84480-891-5 © 2010 Cengage Learning
References
Read Chapter 3 of Data Mining Techniques and Application
Useful further references• Tan, P-N., Steinbach, M. and Kumar, V. (2006),
Introduction to Data Mining, Addison-Wesley, Chapters 2 and 3