cultivation-independent, semiautomatic determination of ... · previous studies. second, manual...

APPLIED AND ENVIRONMENTAL MICROBIOLOGY,0099-2240/01/$04.00�0 DOI: 10.1128/AEM.67.12.5810–5818.2001

Dec. 2001, p. 5810–5818 Vol. 67, No. 12

Copyright © 2001, American Society for Microbiology. All Rights Reserved.

Cultivation-Independent, Semiautomatic Determination ofAbsolute Bacterial Cell Numbers in Environmental

Samples by Fluorescence In Situ HybridizationHOLGER DAIMS,1 NIELS B. RAMSING,2 KARL-HEINZ SCHLEIFER,1 AND MICHAEL WAGNER1*

Lehrstuhl fur Mikrobiologie, Technische Universitat Munchen, 85350 Freising, Germany,1 and Department ofMicrobial Ecology, Institute of Biological Sciences, University of Aarhus, 8000 Aarhus, Denmark2

Received 2 July 2001/Accepted 24 September 2001

Fluorescence in situ hybridization (FISH) with rRNA-targeted oligonucleotide probes has found widespreadapplication for analyzing the composition of microbial communities in complex environmental samples.Although bacteria can quickly be detected by FISH, a reliable method to determine absolute numbers ofFISH-stained cells in aggregates or biofilms has, to our knowledge, never been published. In this study wedeveloped a semiautomated protocol to measure the concentration of bacteria (in cells per volume) inenvironmental samples by a combination of FISH, confocal laser scanning microscopy, and digital imageanalysis. The quantification is based on an internal standard, which is introduced by spiking the samples withknown amounts of Escherichia coli cells. This method was initially tested with artificial mixtures of bacterialcultures and subsequently used to determine the concentration of ammonia-oxidizing bacteria in a municipalnitrifying activated sludge. The total number of ammonia oxidizers was found to be 9.8 � 107 � 1.9 � 107 cellsml�1. Based on this value, the average in situ activity was calculated to be 2.3 fmol of ammonia converted tonitrite per ammonia oxidizer cell per h. This activity is within the previously determined range of activitiesmeasured with ammonia oxidizer pure cultures, demonstrating the utility of this quantification method forenumerating bacteria in samples in which cells are not homogeneously distributed.

Fluorescence in situ hybridization (FISH) using rRNA-tar-geted oligonucleotide probes is frequently applied to quantifythe composition of microbial communities in different environ-ments (1, 17, 21, 23, 33, 35). In such studies cell numbers aregenerally obtained by manual counting in an epifluorescencemicroscope. Usually the relative abundance of a probe targetpopulation is determined by comparison of the obtained num-bers (i) with counts of all bacterial cells detectable by FISH viasimultaneous hybridization with a bacterial probe (10, 11, 30,34) or probe set (9), or (ii) with counts of all organisms con-taining DNA by simultaneous application of nucleic acid stain-ing dyes (16, 29, 35, 38).

Although quantitative FISH has provided novel insights intothe structure and dynamics of microbial communities, it suffersfrom tediousness and limited accuracy for samples containingdensely aggregated cells like activated sludge flocs or biofilms.The latter problem can in part be ameliorated by the use ofconfocal laser scanning microscopy (CLSM) for the detectionof probe-labeled cells (36). However, even if optical CLSMsections are recorded, it is not feasible to manually count asufficient number of cells in each hybridization experiment in areasonable time period to obtain statistically reliable results.This limitation has two reasons. First, manual counting itself isvery time-consuming, and thus generally not more than a fewthousand cells per hybridization experiment were counted inprevious studies. Second, manual counting requires high-mag-nification CLSM sections, which allow single-cell resolution

within clusters. However, such images contain relatively fewcells, and therefore many images need to be recorded, render-ing the procedure even more time-consuming. Therefore,more precise methods are required to quantify the composi-tion of the microflora in samples containing clustered cells.

In principle, flow cytometry is a more efficient and accuratealternative for quantification of fluorescently labeled bacterialcells (39). However, for the analysis of microbial flocs andbiofilms, flow cytometry is of limited use because it necessitatesefficient dispersion of clustered bacteria prior to the measure-ment, a requirement which frequently cannot be fulfilled (38,39).

To overcome the limitations of manual cell-counting proce-dures, semiautomated digital image analysis tools were re-cently developed which quantify fluorescently labeled bacteriain environmental samples (6, 29). But such solutions are notable to efficiently count cells in dense clusters or biofilms be-cause single-cell recognition within these structures cannot beautomated. This problem can be circumvented by measuringthe areas of specifically stained bacteria in randomly acquiredoptical CLSM sections. This approach only requires the soft-ware to differentiate between labeled biomass (including cellclusters) and unlabeled background but does not rely on sin-gle-cell recognition within clusters. The abundance of a par-ticular population is then expressed as fraction of the areaoccupied by all bacteria (8, 32).

For this purpose, an environmental sample is hybridizedsimultaneously with different rRNA-targeted oligonucleotideprobes: one specific probe that targets the population which isto be quantified, and one domain-specific probe set that de-tects most bacteria. The population-specific and the domain-specific probes are labeled with different fluorochromes. Fol-

* Corresponding author. Mailing address: Lehrstuhl fur Mikrobiolo-gie, Technische Universitat Munchen, Am Hochanger 4, 85350 Frei-sing, Germany. Phone: 49 8161 71 5444. Fax: 49 8161 71 5475. E-mail:[email protected].

5810

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

lowing FISH, the fluorescence conferred by the differentprobes is recorded in separate CLSM images. The areas of thelabeled cells in these images are measured by digital imageanalysis. Since this approach analyses low-magnification im-ages and can be partly automated, it allows rapid quantificationof large numbers of bacteria, thereby significantly improvingthe statistical accuracy of the measurement (8, 32).

Ecological studies of complex microbial communities mayattempt to determine not only relative abundances of probe-defined bacterial populations, but also the respective cell con-centrations in a sample. This is particularly important if differ-ent samples which differ in their prokaryotic biomass contentare to be compared. Furthermore, cell concentrations per vol-ume or weight unit of an environmental sample are needed tocalculate key functional attributes of bacterial populations, likein situ growth rates and in situ substrate turnover rates per cell.Despite their importance, cell concentrations of FISH-stainedbacterial populations have rarely been determined for biofilmsor activated sludge flocs by manual counting because thesemeasurements required additional time-consuming and bias-introducing homogenization and membrane filtration steps(17, 24, 26, 37). In addition, it is impossible to directly apply theabove-mentioned area-based quantification methods (8, 32) tosemiautomatically determine absolute cell numbers in a sam-ple after membrane filtration because these methods cannotaccurately measure the entire biovolume of all cells of a probe-labeled population in the filtered biomass on top of definedfilter areas.

Recently, CLSM-based methods to semiautomatically mea-sure the biovolume of fluorescently labeled bacteria (15, 19)were published. These methods could theoretically be appliedto determine absolute cell numbers of probe-defined bacterialpopulations on membrane filters. However, biovolume-basedquantification is only accurate if serial optical sections arerecorded using small vertical step intervals and subsequentlycombined to image stacks. This procedure is extremely time-consuming and leads to significant bleaching of FISH-labeledbacterial cells.

In this study we thus developed a semiautomated procedurefor determining cell concentrations of bacterial populations incomplex samples by FISH and CLSM using the area-basedquantification method (8, 32). Spiking of the samples withknown amounts of Escherichia coli cells, which were used asinternal standards for the subsequent FISH analysis, allowedus to infer the absolute cell numbers of probe-target bacteriafrom their measured areas by digital analysis of CLSM images.

MATERIALS AND METHODS

Test strains, culture conditions, cell fixation, and activated sludge sampling.Type strains of Comamonas testosteroni (DSM 1622) and Gluconobacter asaii(DSM 7148) were obtained from the Deutsche Sammlung von Mikroorganismenund Zellkulturen GmbH (DSMZ) (Braunschweig, Germany). Cells of C. testos-teroni and G. asaii were grown overnight under agitation at 30°C in mediumDSM M1 (0.5% [wt/vol] peptone, 0.3% [wt/vol] meat extract, pH 7.0) and DSMM626 (5% [wt/vol] D-sorbitol, 1% [wt/vol] yeast extract, 1% [wt/vol] peptone, pH6.0), respectively. Pure cultures of Nitrosomonas europaea were maintained asdescribed by Koops et al. (18). E. coli TOP10F� cells (Invitrogen, San Diego,Calif.) were grown overnight in Luria-Bertani (LB) medium (31) at 37°C underagitation. For fixation, cells of all species were washed in phosphate-bufferedsaline (PBS) and then incubated for 3 h in 3% paraformaldehyde (Sigma, Dei-senhofen, Germany) as described by Amann (3). Fixed cells were washed againin PBS and stored at 4°C in PBS until they were used (normally within 3 days

after fixation). For long-term storage, the cells were resuspended in a 1:1 mixtureof PBS and 96% (vol/vol) ethanol and kept at �20°C.

Activated sludge was obtained from the secondary aerated nitrification basin(27,144 m3) of the Munich II wastewater treatment plant (one million populationequivalents). Then 12.5 ml of activated sludge was fixed immediately after sam-pling by adding 37.5 ml of 4% paraformaldehyde. After 5 h of incubation at 4°C,the activated sludge was centrifuged for 5 min at 4,550 � g, and the supernatantcontaining the fixative was discarded. Subsequently, the sludge pellet was washedwith PBS and finally resuspended in 12.5 ml (the original sample volume) of a 1:1mixture of PBS and 96% (vol/vol) ethanol. Samples were stored at �20°C.

Cell concentration of pure cultures. The numbers of cells per milliliter in thefixed pure cultures of C. testosteroni, G. asaii, and N. europaea were determinedwith a Neubauer cell counting chamber (Paul Marienfeld GmbH, Bad Mergen-theim, Germany) following the instructions of the manufacturer.

The cell concentrations of E. coli cultures were inferred from the opticaldensity at 600 nm (OD600) using a DU 650 spectrophotometer (Beckman, Ful-lerton, Calif.). For calibration, an E. coli TOP10F� overnight culture was dilutedby factors of 10�5 to 10�7, the OD600 of these dilutions was measured, andaliquots were streaked onto petri dishes with solid LB medium. The numbers ofCFU were correlated with the OD600 for each dilution, and the resulting con-version factor (5.5 � 108 CFU ml�1 per OD600 unit) was used to calculate theconcentration of E. coli cultures based on their OD600 in all following experi-ments. It is important to note that E. coli LB overnight cultures contain insig-nificant numbers of nonviable cells (40). In addition, microscopic observation ofthe E. coli culture used showed that the vast majority of cells occurred as singlecells.

Spiking of pure culture mixtures and activated sludge with E. coli cells.Overnight cultures of C. testosteroni and G. asaii (100 ml) were harvested bycentrifugation for 10 min at 4,550 � g and fixed with paraformaldehyde asdescribed above. The cell densities in these concentrated stock solutions weredetermined using the Neubauer chamber. Cell densities of E. coli overnightcultures were determined photometrically, and E. coli cells were concentratedand fixed with paraformaldehyde as described above. Subsequently, different1-ml cell mixtures containing 6.3 � 107 C. testosteroni and 3.7 � 107 G. asaii cellsas well as 106, 107, 108, or 109 E. coli cells were prepared in 50% PBS–ethanol(EtOH) (vol/vol). In addition, a 1-ml cell mixture containing 6.3 � 107 C.testosteroni and 3.7 � 107 G. asaii cells but without E. coli cells was prepared in50% PBS–EtOH (vol/vol).

Nitrifying activated sludge was spiked with different amounts of E. coli usingthe following protocol. One milliliter of paraformaldehyde-fixed activated sludgesamples was centrifuged for 5 min at 10,000 � g. The supernatant was removed,and the activated sludge was resuspended in 1 ml of PBS containing either 106,107, 108, or 109 paraformaldehyde-fixed E. coli cells and mixed by vortexing (10s). In an additional experiment, 1.7 � 108 paraformaldehyde-fixed N. europaeacells were added to the paraformaldehyde-fixed sludge prior to the centrifugationstep. Finally, all spiked activated sludge samples were centrifuged for 5 min at10,000 � g. The supernatant was carefully removed, and the sludge was resus-pended in 1 ml of 50% PBS–EtOH (vol/vol).

FISH. The defined mixtures of pure cultures were spotted onto microscopeslides (Paul Marienfeld GmbH, Bad Mergentheim, Germany) and allowed to dryat 46°C. Afterwards, the slides were immersed for 2 to 3 s in molten 0.5% agarose(Gibco-BRL ultrapure agarose; Life Technologies, Paisley, Scotland) at 37°C.The slides were then placed on ice until the agarose had solidified. Excessagarose on the back side of the slides was removed, and the samples weredehydrated in 50, 80, and 96% (vol/vol) ethanol for 5 min each. The agarosecoating was applied to minimize cell loss during the following hybridization andwashing steps. After an additional drying step at room temperature, whole-cellhybridization was performed as described by Manz et al. (22).

A different protocol was developed for the treatment of activated sludgesamples prior to FISH. The sludge was prepared on the same type of microscopeslides, but the spotting and drying procedures were repeated three times toobtain a thick layer of sludge flocs on the slide surface. The average samplethickness was about 50 �m and thus did not hamper laser penetration in thesubsequent CLSM analyses. Afterwards, the slides were immersed in agarose andhybridized as described above. The thick layer of sludge flocs was required (i) torecord as many target cells as possible in order to improve the accuracy of themeasurements and (ii) to avoid bias in the quantification of planktonic cellswhich otherwise would accumulate on the slide surface.

The rRNA-directed oligonucleotide probes used for FISH were 5� labeledwith the dye Fluos [5(6)-carboxyfluorescein-N-hydroxysuccinimide ester] or withone of the sulfoindocyanine dyes indocarbocyanine (Cy3) and indodicarbocya-nine (Cy5). Labeled probes and unlabeled competitor oligonucleotides wereobtained from MWG (Ebersberg, Germany) or Thermo Hybaid (Interactiva

VOL. 67, 2001 DETERMINING CELL NUMBERS IN ENVIRONMENTAL SAMPLES 5811


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

Division, Ulm, Germany). In all experiments, group-specific probes labeled withCy3 or Fluos were used together with the Cy5-labeled EUB338 probe mix(consisting of probes EUB338, EUB338-II, and EUB338-III) covering the do-main Bacteria (9). The probes used, their sequences, and their specificities arelisted in Table 1.

Microscopy and digital image analysis. After in situ hybridization, the micro-scope slides were embedded in Citifluor AF1 (Citifluor, Canterbury, UnitedKingdom). Pictures of fluorescent cells were recorded using a CLSM (LSM 510,Zeiss, Oberkochen, Germany). For detection of Cy3- and Cy5-labeled cells, twohelium-neon lasers (543 nm and 633 nm, respectively) and, for Fluos-labeledcells, an argon laser (450 to 514 nm) was used. For each microscope field,fluorescence conferred by the different probes was recorded in separate images.For each hybridization experiment, 30 microscope fields at random positions andin random focal planes were recorded using a Zeiss Plan-Neofluar 40�/1.3 oilobjective. This procedure (30 images at low magnification) allows us to record ahigh number of probe-target cells and thus to accurately determine the relativeabundance of heterogeneously distributed probe-target cells in activated sludgesamples (8). All pictures acquired corresponded to optical sections of 1-�mthickness obtained by adjusting the pinhole diameter of the CLSM accordingly.They were recorded as 8-bit images of 512 by 512 pixels with a resolution of 1.6by 1.6 pixels per �m.

For each sample analyzed, detector gain, amplification offset, and amplifica-tion gain settings were selected which allowed detection of all probe-labeled cellswith an intensity between 20 and 255. Special attention was paid to optimizemicroscopic parameter settings so that the images of those cells detected by thespecific probes were congruent with their counterparts in the picture with theEUB338 probe mix-stained cells (Fig. 1B, C, and E). The cell area quantification(see below) relies on this congruency, because it is assumed that for eachquantified cell the same area is measured with the specific and with the universalprobes.

It should be noted that cells of a population to be quantified will be recordedas longitudinal sections as well as transverse sections (and various intermediateforms). However, this fact has no significant influence on the quantificationaccuracy, because both the cells belonging to the indigenous bacterial populationwhich is to be quantified and the E. coli cells used as the internal standard areoptically sectioned in random directions. Moreover, the cell areas are deter-mined by analyzing large numbers of probe-stained cells, a procedure signifi-cantly lowering the impact of the spatial orientation of individual cells.

The images were then exported as TIFF files by the image acquisition softwaredelivered with the microscope (Zeiss LSM 5, version 2.01). These files wereanalyzed with the image-processing software (Zeiss Kontron KS400, version 3.0)to measure the combined areas of stained cells within each image as described bySchmid et al. (32). The area fraction of specifically stained cells was calculated asa percentage of the total area of bacteria stained by the EUB338 probe mix in thesame optical section.

Determination of cell density. The cell concentrations of probe-defined indig-enous bacterial populations in a sample were calculated using a seven-stepprocedure. First, aliquots of the sample (e.g., activated sludge, Fig. 1A) werespiked with E. coli (106 to 109 cells ml�1) as described above (Fig. 1, step 1), andthe spiked aliquots were stained by FISH using probe GAM42a and the EUB338probe mix (Fig. 1B and C). The area fraction of the E. coli cells in each spikedaliquot was determined by digital image analysis (Fig. 1, step 2). For activatedsludge samples, the area fraction of the inherent �-Proteobacteria was measuredin sludge aliquots without addition of E. coli cells. The area fraction of theseindigenous cells was subsequently subtracted from the area fraction measuredwith probe GAM42a in the spiked aliquots to obtain the area occupied by E. coli.Since spiking the samples with E. coli increased not only the area fraction of thecells stained by probe GAM42a but also the total area of all bacteria, themeasured E. coli cell area fraction must be corrected to remain directly propor-tional to the number of added E. coli cells. The corrected area fraction iscalculated by the formula

A*ec �100 � Aec

100 � Aec(1)

where Aec is the measured and Aec* is the corrected E. coli area fraction (inpercent). The corrected area fractions were then plotted in a double-logarithmicgraph against the E. coli concentration, and a regression line was calculatedbased on these data points (Fig. 1D). The double-logarithmic transformation wasnecessary to meet a requirement for linear regression, i.e., an equal variance forall measurements. The regression line was used to calculate the “equivalent E.coli concentrations” from the area fractions of specifically labeled bacterialpopulations (e.g., ammonia oxidizers stained within activated sludge by FISH;Fig. 1, step 3, and Fig. 1E) in unspiked aliquots of the samples by applying thefollowing equation (Fig. 1, step 4, and Fig. 1F):

Ceq � Am � 10b (2)

where Ceq is the equivalent E. coli concentration of the bacterial population (incells per milliliter), A is the measured area fraction of this population, m is theslope, and b is the ordinate intercept of the regression line.

Finally, Ceq was converted to the real concentration of the bacterial populationby taking into consideration differences in size between E. coli and the probe-target population. This conversion was accomplished by measuring the averagearea of single E. coli cells and of single cells belonging to the probe-targetpopulation of interest. For this purpose, images that contained single cells of E.coli and of the probe-target population were acquired at a high magnification(�5,000) with a resolution of 55.6 by 55.6 pixels per �m (Fig. 1, step 5, and Fig.1G and H). Then a conversion factor was calculated as the ratio of the averagecell areas (Fig. 1, step 6):

TABLE 1. Oligonucleotide probe sequences and target organisms

Probe Sequence (5�-3�) Target organisms Reference

EUB338 GCTGCCTCCCGTAGGAGT Most Bacteria 4EUB338-II GCAGCCACCCGTAGGTGT Planctomycetales and other Bacteria not detected by EUB338 9EUB338-III GCTGCCACCCGTAGGTGT Verrucomicrobiales and other Bacteria not detected by EUB338 9NEU CCCCTCTGCTGCACTCTA Most halophilic and halotolerant ammonia oxidizers in the beta-subclass of Proteobacteria 37CTE TTCCATCCCCCTCTGCCG Used as unlabeled competitor with probe NEU 37Nso1225 CGCCATTGTATTACGTGTGA All known ammonia oxidizers in the beta-subclass of Proteobacteria except N. mobilis 25ALF1b CGTTCG(C/T)TCTGAGCCAG Alpha-subclass of Proteobacteria 22BET42a GCCTTCCCACTTCGTTT Beta-subclass of Proteobacteria 22GAM42a GCCTTCCCACATCGTTT Gamma-subclass of Proteobacteria 22

FIG. 1. Principle of the cell quantification method developed in this study. See text for an explanation of steps 1 to 7. (A) Microscopic pictureof activated sludge from the Munich II wastewater treatment plant. (B and C) Aliquots of the same activated sludge after spiking with 108 (B) and109 (C) E. coli cells per ml. FISH was performed with probe GAM42a (red) and the EUB338 probe mix (green). The images containing thefluorescence conferred by the probes were superimposed, and E. coli cells appear yellow due to color blending. (D) Calibration curve generatedfrom corrected cell area fractions of E. coli in spiked sludge aliquots. (E) The same microscopic field as in A, showing simultaneous FISH usingprobes NEU and Nso1225 (red) and the EUB338 probe mix (green). Cells of ammonia oxidizers appear yellow due to color blending. (F) Graphshowing the use of the calibration curve (D) for converting the measured area fraction of an autochthonous population to the equivalent E. coliconcentration. (G) Highly magnified optical section through a cell aggregate of ammonia-oxidizing bacteria in activated sludge stained by FISHusing probes NEU and Nso1225 (red). (H) Highly magnified optical section through E. coli cells from a pure culture stained by FISH using probeGAM42a (red).

5812 DAIMS ET AL. APPL. ENVIRON. MICROBIOL.


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

f �A� ec

A�(3)

where f is the conversion factor, A� is the average single-cell area of the popula-tion whose concentration was to be determined, and A� ec is the average single-cellarea of E. coli. Eventually, Ceq was converted to the real concentration bymultiplication with the conversion factor (Fig. 1, step 7):

C � f � Ceq (4)

where C is the concentration of the bacterial population (in cells per milliliter).Estimation of in situ substrate turnover rates. Average substrate turnover

rates of ammonia-oxidizing bacteria were estimated based on the measured cellconcentrations. The total number of ammonia-oxidizing cells in the aeratednitrifying basin of the municipal Munich II wastewater treatment plant wascalculated by multiplying the number of ammonia-oxidizing cells per milliliter ofactivated sludge by the reactor volume. The amount of ammonia-nitrogen con-verted to nitrite (in milligrams per hour) was estimated according to the formula

NH4t

� � (NH4i

� � NH4e

�) � r � 0.9 (5)

where NH4�

tis the transformed ammonia-nitrogen (in milligrams per hour),

NH4i� is the ammonia-nitrogen concentration in the influent (in milligrams per

cubic meter), NH4e� is the ammonia-nitrogen concentration in the effluent (in

milligrams per cubic meter), r is the reactor influent rate (7,858 m3 h�1), and 0.9is a correction factor.

The estimated correction factor takes into account that ammonia is removedfrom the sewage via autotrophic nitrification but also via adsorption (27) andassimilation (activated sludge models 1 to 3 [12–14]). The estimated amount ofammonia oxidized autotrophically was converted from milligrams per hour tofemtomoles per hour and was divided by the total number of ammonia-oxidizercells in the reactor to obtain the substrate turnover rate in femtomoles ofammonia transformed to nitrite per hour and per cell.

RESULTS

Preparation of the samples and spiking with E. coli. A rel-atively homogeneous distribution of the added E. coli cellswithin a spiked sample is critical for obtaining an accuratecalibration curve. This is particularly important for the mea-surements of sludge samples which were amended with rela-tively small numbers of E. coli. Therefore, the area fractions ofE. coli cells added to activated sludge were compared aftervigorously vortexing the sludge for 1 min or after homogeniz-ing it with an Ultra-Turrax blender (IKA Labortechnik,Staufen, Germany) treatment (1 min). The sludge was spikedwith E. coli either before or after these pretreatments.

The area fraction of E. coli was determined for each sampleby FISH with probe GAM42a and the EUB338 probe mix anddigital image analysis using the method previously published bySchmid et al. (32). The area fractions were compared to thevalues measured with spiked sludge that had not been vortexedor homogenized. Neither the kind of pretreatment nor theorder of sludge preparation and spiking affected the measuredarea fractions and their standard deviations (Table 2). Conse-quently, E. coli cells were simply added to the fixed activatedsludge samples without additional pretreatments in all follow-ing experiments.

Evaluation of the quantification protocol using artificialmixtures of pure cultures. The developed quantification ap-proach was first tested with bacterial pure cultures. For thispurpose, cultures of G. asaii (�-subclass of Proteobacteria) andC. testosteroni (-subclass of Proteobacteria) were mixed aftertheir cell concentrations had been determined with a Neu-bauer cell counting chamber. The final cell concentrations inthe mixture were 3.7 � 107 0.5 � 107 cells ml�1 for G. asaii

and 6.3 � 107 0.2 � 107 cells ml�1 for C. testosteroni (all theconfidence limits indicate 95% confidence intervals).

Aliquots of this mixture were supplemented with increasingconcentrations of E. coli cells, and a regression line was gen-erated from a graph depicting the relative cell areas of E. coliin the spiked aliquots versus the amount of E. coli cells added(Fig. 2a). This regression line should have a slope of approxi-mately 1, as the corrected area fraction of E. coli cells isexpected to be directly proportional to the amount of E. colicells added. The slope in this and all other determined cali-bration curves (see also below) was slightly higher than 1 (e.g.,1.25 in Fig. 2a). This implies that small cell additions had alarge effect on the area fraction, whereas large additions onlyhad a more moderate effect. Subsequently, the unspiked mix-ture was hybridized with the EUB338 probe mix and withprobe ALF1b or BET42a. It should be noted that the intensi-ties of the fluorescent signals varied considerably among theindividual cells of either species, G. asaii and C. testosteroni.

The cell area fractions of G. asaii and C. testosteroni weremeasured, and the calibration curve and area correction factorwere used to convert the areas to cell concentrations as de-scribed above. Table 3 shows the results of this experiment.The concentration determined for G. asaii deviates by 0.4 �107 cells ml�1 (or 10.8%) from the Neubauer cell chambercount, while the difference between the two quantificationmethods amounts to 0.8 � 107 cells ml�1 (or 12.7%) for C.testosteroni.

Quantification of ammonia-oxidizing bacteria in activatedsludge. The number of autochthonous ammonia-oxidizing bac-teria was determined in a nitrifying activated sludge from theMunich II wastewater treatment plant. An equimolar mixtureof probes Nso1225 and NEU was used for the in situ detectionof ammonia oxidizers of the -subclass of Proteobacteria. ProbeNso1225 targets all recognized ammonia oxidizers of the-subclass with the exception of Nitrosococcus mobilis (28).The single central mismatch of N. mobilis is discriminativeunder stringent conditions, so probe NEU was used in addi-tion. This probe targets N. mobilis and other not yet describedammonia oxidizers from activated sludge which are also notdetected by probe Nso1225 (unpublished results).

A first inspection of the analyzed nitrifying activated sludgeby FISH with probes NEU and Nso1225 confirmed the occur-rence of large amounts of ammonia-oxidizing bacteria of the-subclass of Proteobacteria. Most ammonia oxidizers were rel-atively small and formed spherical, tightly packed cell clusters,but others were slightly larger and formed looser aggregateswith narrow intercellular cavities.

The cell concentration of the ammonia oxidizers was deter-

TABLE 2. Effect of different activated sludge homogenizationprocedures on area fraction measurements of E. coli cellsa

Homogenizationprocedure

Time of celladdition

Measured cell area fractionof E. coli (%)

None 2.7 0.9Vortex (1 min) After homogenization 2.2 0.8Blender (1 min) Before homogenization 2.1 0.7Blender (1 min) After homogenization 2.5 0.8

a Cells were added (107 cells ml�1) artificially to activated sludge from theMunich II wastewater treatment plant. It should be noted that the E. coli areafractions depicted in this table were not corrected according to equation 1.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

mined and confirmed in two experiments. First, their areafraction was measured after FISH with both probes NEU andNso1225 and the EUB338 probe mix. The cell concentration ofthe autochthonous ammonia oxidizers was then calculated

based on a calibration curve that had been generated by spik-ing of the sludge with E. coli (Fig. 2b). In the second experi-ment, 1.7 � 108 0.3 � 108 N. europaea cells per ml wereadded to the activated sludge. The concentration of the am-monia oxidizers (consisting of the autochthonous and theadded ammonia oxidizers) in the modified sample was mea-sured by the same procedure as in the original sludge, but anew calibration curve was generated after aliquots of the mod-ified sludge had been spiked with E. coli (Fig. 2c). Finally, theconcentration of the autochthonous ammonia oxidizers in theoriginal sludge was subtracted from the concentration of theammonia oxidizers in the sludge supplemented with the addi-tional N. europaea cells.

For the autochthonous ammonia oxidizers, a cell area frac-tion of 8.4% 1.4% was measured, which corresponds to aconcentration of 9.8 � 107 1.9 � 107 cells per ml of activatedsludge. Following the addition of 1.7 � 108 0.3 � 108 N. eu-ropaea cells per ml, the area fraction of the ammonia oxidizersincreased slightly to 9.4% 1.4%. It should be noted thatdifferent image acquisition parameters were used in the twoexperiments, making it impossible to compare the area frac-tions directly. This was necessary because the added ammoniaoxidizers showed a weaker fluorescence after FISH than theautochthonous ammonia oxidizers. Furthermore, the addedN. europaea cells affect the calibration curve so that the smallchange in area fraction corresponds to a large difference in cellnumbers when using the appropriate new calibration curve.The resulting absolute cell concentrations, however, are com-parable.

The concentration of ammonia oxidizers after amendmentwas 2.3 � 108 0.3 � 108 cells ml�1. The difference betweenthis value and the concentration of the autochthonous ammo-nia oxidizers amounts to 1.3 � 108 cells ml�1 which should beequal to the 1.7 � 108 added N. europaea cells per ml. Thedeviation between the two values, 4 � 107 cells ml�1, is 22.4%of the cell addition and thus about twice as high as the differ-ences between the cell concentrations measured by the newlydeveloped quantification method and obtained by using theNeubauer chamber for the pure culture mixtures (see above).

Estimated activity of ammonia-oxidizing bacteria in acti-vated sludge. The average rate of ammonia oxidation per au-tochthonous ammonia-oxidizer cell within the activated sludgewas calculated based on the determined concentration of au-tochthonous ammonia oxidizers. As described above, 9.8 �107 1.9 � 107 ammonia-oxidizer cells ml�1 were found in theactivated sludge. Thus, with a total reactor volume of 27,144m3 the total amount of ammonia oxidizers in the reactor was2.7 � 1018 0.5 � 1018 cells.

During the last 2 weeks before sampling, the amount ofNH4

�-N was in the range of 10 to 16 mg liter�1 in the influentand in the range of 0.05 to 0.3 mg liter�1 in the effluent of theplant, respectively (Fig. 3). The average concentrations ofNH4

�-N in the influent (12.1 mg liter�1) and the effluent (0.08mg liter�1) of the plant during the last 6 days before samplingwere used for the activity estimation. Thus, with a flow rate of7,858 m3 h�1, 9.5 � 107 mg of NH4

�-N h�1 was transformedin the basin. Assuming that 10% of the ammonia was notremoved by autotrophic oxidation, the ammonia oxidizers ox-idized 8.5 � 107 mg of NH4

�-N h�1 which equals 6.1 � 1018

fmol of NH4� h�1. Consequently, each ammonia-oxidizer cell

FIG. 2. Calibration curves used to convert cell area fractions toequivalent E. coli concentrations for the determination of cell concen-trations in pure culture mixtures of C. testosteroni and G. asaii (A), inactivated sludge from the Munich II wastewater treatment plant (B),and in the same activated sludge after addition of 1.7 � 108 N. euro-paea cells per ml (C). The general linear equation of these curves is logCeq � m � log A � b, where Ceq is the equivalent E. coli concentration,A is the cell area fraction, m is the slope, and b is the ordinate interceptof the line. The values of m are 1.253317 (A), 1.105818 (B), and 1.004006(C). The values of b are 5.27404 (A), 6.429176 (B), and 6.83411 (C). Errorbars which are smaller than the marker symbols are not shown.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

converted 2.3 0.4 fmol of NH4� to NO2

� per hour if equalactivity of all ammonia-oxidizer cells is assumed.

DISCUSSION

Cell quantification methods suitable for microbial ecologyshould provide precise results for environmental samples con-taining bacteria which are not homogeneously distributed. Fur-thermore, they should be independent of cultivation, as mostbacteria in natural or engineered systems have hitherto notbeen isolated (5, 34). A generally applicable method shouldallow specific enumeration of both single species and higherphylogenetic taxa (e.g., genera or subclasses). New protocolsmust be tested with regard to these requirements by use ofsuitable model systems.

In this study, mixtures of pure cultures and an activatedsludge sample were used, because these model systems havedifferent advantages when evaluating a new quantificationmethod. The selected pure cultures consisted of uniformlyshaped cells, which can easily be counted in a counting cham-ber to verify the results obtained with the new quantificationprotocol. On the contrary, activated sludge contains numerousdifferent cultivated and uncultivated prokaryotic species (2, 7,33) with different morphologies and abundance and thus rep-resents a challenge for any quantification method.

Applicability and accuracy of the newly developed quantifi-cation method. The new quantification method was success-fully applied to measure cell concentrations of specific popu-lations in bacterial pure culture mixtures as well as in activatedsludge. The results obtained were not expressed as relativeabundance based on a reference value such as total cell counts,but as absolute cell numbers per volumetric unit. Since thedeveloped quantification procedure is based on FISH withrRNA-directed oligonucleotide probes, it can be used in anyenvironment that is amenable to FISH analysis. It makes nodifference whether the quantified organisms grow as singlecells or in dense aggregates as long as individual cells can beresolved microscopically. However, the accuracy of the resultsobtained with this method depends on a uniform cell size ofthe target population (see below). Size variations within atarget population can be caused by polymorphism of a singlespecies or if probes with a broader specificity were applied fordetection of morphologically different bacterial taxa. It shouldalso be noted that the accuracy of this method depends on arelatively homogeneous distribution of reference cells (usedfor spiking) within the environmental sample. For the analyzedactivated sludge sample, this was easily achieved by adding theE. coli cells to the sample followed by a short mixing step. Sincecomposition and density of aggregates or flocs might varybetween different environments, special pretreatment (e.g., ho-

mogenization) of other samples may be necessary to ensureoptimal dispersal of the cells used for spiking.

The cell concentrations measured with the newly developedmethod deviated in the mixed pure culture experiments byapproximately 10 to 13% and in the experiments with acti-vated sludge by approximately 22% from the Neubauerchamber counts. In addition to the measurement error of theNeubauer chamber, several difficulties with the area measure-ment of FISH-stained cells could have caused these discrep-ancies. First of all, the intensity of the FISH signal is a functionof the ribosome content of the target cells. Although most cellsin actively growing pure cultures contain high ribosome num-bers, we observed that a fraction of the FISH-stained C. tes-tosteroni and G. asaii cells emitted less fluorescence than themajority of the labeled cells. Such differences in the fluorescentsignal intensity were even more pronounced between differentbacterial populations in the activated sludge sample. The pres-ence of very bright and relatively dark cells in the same samplemakes it difficult to find appropriate microscope parametersettings and intensity thresholds during image analysis to dif-ferentiate between cells and background. Under such condi-tions, either the areas of the bright cells are overestimatedwhen the threshold is too low, or the darker cells are notincluded in the analysis when the threshold is too high. Sucherrors may still be higher in samples from oligotrophic en-vironments, where the growth rates and ribosome contentof indigenous bacterial populations may differ more pro-nouncedly than in activated sludge.

Problems with fluorescence intensities are also responsible

FIG. 3. Concentrations of ammonia nitrogen in the influent (�)and the effluent (‚) of the nitrification basin of the Munich II waste-water treatment plant measured during the last 2 weeks before sam-pling.

TABLE 3. Quantification of C. testosteroni and G. asaiia

Tested species Area fraction(%)

Equivalent E. coli concn(cells ml�1)

Cell area ratio,E. coli: tested

Tested species (cells ml�1)

Cell concn (FISH) Neubauer chamber counts

C. testosteroni 50.7 3.3 2.6 � 107 0.2 � 107 2.13 5.5 � 107 0.5 � 107 6.3 � 107 0.2 � 107

G. asaii 51.6 3.5 2.6 � 107 0.3 � 107 1.55 4.1 � 107 0.4 � 107 3.7 � 107 0.5 � 107

a Confidence limits indicate 95% confidence intervals.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

for the upper limit of cell concentrations that can be quantifiedby the newly developed method. Very high concentrations ofprobe-target cells (e.g., 108 cells per ml) require that the sam-ple be spiked with E. coli concentrations of between 107 and109 cells per ml to obtain a calibration curve that spans at leastone order of magnitude above and below the cell concentra-tion to be measured. After addition of 109 E. coli cells per ml,however, the E. coli cells formed thick layers of stacked cells onthe microscope slides. Following FISH with the EUB338 probemix, the local fluorescence intensity within these layers of E.coli cells was far higher than the fluorescence intensities ob-served for most aggregates of autochthonous bacteria. As aconsequence, the CLSM detector collected too much light atthe locations of the E. coli layers, and the E. coli cells appearedtoo large in the images with the EUB338 probe mix-stainedcells. The sensitivity of the detector could not be reduced toovercome this problem, because then the darker autochtho-nous bacteria would not have been detected anymore. Thisproblem hampered the precise determination of area fractionsfor high E. coli cell densities and in consequence affected theprecision of the calibration curves. Thick E. coli cell layerswere not observed after spiking with smaller amounts of E. colithan 109 cells per ml. The quantification accuracy can thus beexpected to be higher for lower concentrations of probe-targetcells that do not require spiking of the sample with 109 E. colicells per ml to obtain a suitable calibration curve.

Furthermore, the conversion of the equivalent E. coli con-centration to the real concentration of the quantified popula-tion is a possible source of measurement error. The ratio of theaverage cell areas is used as the conversion factor, but even inpure cultures cell size, and therefore the cell area, may varyconsiderably. This problem could have contributed to the ob-served differences between Neubauer chamber counts and thecounts inferred from the novel quantification method. In com-plex systems like activated sludge, cell size variation of probe-target bacteria is frequently observed. Therefore, applicationof the developed quantification method is recommended forquantification of probe-defined groups of microorganisms thatdo not show pronounced differences in size, like the two pop-ulations of ammonia-oxidizing bacteria detected in this study.

Despite these possible sources of error, the novel FISH-based quantification method constitutes a straightforward andprecise method to determine the absolute numbers of micro-organisms in different environments and is especially useful forsamples containing biofilms or aggregates. The accuracy of themethod is demonstrated by the highly similar cell concentra-tions obtained using the well-established Neubauer chambercounts and the novel FISH-based quantification method forpure culture mixtures as well as for an activated sludge whichwas amended with a defined number of N. europaea cells.

The utility of the developed quantification method to enu-merate bacteria in samples where cells are not homogeneouslydistributed was illustrated by quantification of autochthonousammonia-oxidizing bacteria in a nitrifying activated sludge.Based on the absolute numbers of ammonia-oxidizing bacteriaobtained, their average activity in the municipal activatedsludge sample was estimated to be 2.3 0.4 fmol of NH4

�

cell�1 h�1, a value which is within the range of per cell activ-ities measured with pure cultures of N. europaea (1.24 to 23fmol of NH4

� cell�1 h�1) (20). Compared to manual counting

of probe-labeled cells by microscopy (21, 24, 34, 35), the newsemiautomatic method is less tedious and not negatively af-fected by aggregates or cell clusters, and its measured standarderror is lower.

ACKNOWLEDGMENTS

This study was supported by Sonderforschungsbereich 411 from theDeutsche Forschungsgemeinschaft (Research Center of FundamentalStudies of Aerobic Biological Wastewater Treatment). The Interna-tional Workshop on New Techniques in Microbial Ecology (INTIME),where the basic concept of this study was outlined, is acknowledged asa forum encouraging the realization of joint projects between theUniversity of Aarhus, the University of Aalborg, and the TechnischeUniversitat Munchen.

REFERENCES

1. Alfreider, A., J. Pernthaler, R. Amann, B. Sattler, F. O. Glockner, A. Wille,and R. Psenner. 1996. Community analysis of the bacterial assemblages inthe winter cover and pelagic layers of a high mountain lake by in situhybridization. Appl. Environ. Microbiol. 62:2138–2144.

2. Amann, R., J. Snaidr, M. Wagner, W. Ludwig, and K. H. Schleifer. 1996. Insitu visualization of high genetic diversity in a natural microbial community.J. Bacteriol. 178:3496–3500.

3. Amann, R. I. 1995. In situ identification of microorganisms by whole cellhybridization with rRNA-targeted nucleic acid probes, p. 1–15. In A. D. C.Akkeman, J. D. van Elsas, and F. J. de Bruigin (ed.), Molecular microbialecology manual, vol. 3.3.6. Kluwer Academic Publishers, Dordrecht, TheNetherlands.

4. Amann, R. I., B. J. Binder, R. J. Olson, S. W. Chisholm, R. Devereux, andD. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotideprobes with flow cytometry for analyzing mixed microbial populations. Appl.Environ. Microbiol. 56:1919–1925.

5. Amann, R. I., W. Ludwig, and K.-H. Schleifer. 1995. Phylogenetic identifi-cation and in situ detection of individual microbial cells without cultivation.Microbiol. Rev. 59:143–169.

6. Bloem, J., M. Veninga, and J. Shepherd. 1995. Fully automatic determina-tion of soil bacterium numbers, cell volumes, and frequencies of dividingcells by confocal laser scanning microscopy and image analysis. Appl. Envi-ron. Microbiol. 61:926–936.

7. Bond, P. L., P. Hugenholtz, J. Keller, and L. L. Blackall. 1995. Bacterialcommunity structures of phosphate-removing and nonphosphate-removingactivated sludges from sequencing batch reactors. Appl. Environ. Microbiol.61:1910–1916.

8. Bouchez, T., D. Patureau, P. Dabert, S. Juretschko, J. Dore, P. Delgenes, R.Moletta, and M. Wagner. 2000. Ecological study of a bioaugmentation fail-ure. Environ. Microbiol. 2:179–190.

9. Daims, H., A. Bruhl, R. Amann, K.-H. Schleifer, and M. Wagner. 1999. Thedomain-specific probe EUB338 is insufficient for the detection of all Bacte-ria: Development and evaluation of a more comprehensive probe set. Syst.Appl. Microbiol. 22:434–444.

10. DeLong, E. F., L. T. Taylor, T. L. Marsh, and C. M. Preston. 1999. Visual-ization and enumeration of marine planktonic archaea and bacteria by usingpolyribonucleotide probes and fluorescent in situ hybridization. Appl. Envi-ron. Microbiol. 65:5554–5563.

11. Glockner, F. O., R. Amann, A. Alfreider, J. Pernthaler, R. Psenner, K.-H.Trebesius, and K.-H. Schleifer. 1996. An in situ hybridization protocol fordetection and identification of planctonic bacteria. Syst. Appl. Microbiol.19:403–406.

12. Gujer, W., M. Henze, T. Mino, and M. van Loosdrecht. 1999. Activatedsludge model no. 3. Water Sci. Tech. 39:183–193.

13. Henze, M., C. P. L. Grady, W. Gujer, G. v. R. Marais, and T. Matsuo. 1987.A general model for single-sludge wastewater treatment systems. Water Res.21:505–515.

14. Henze, M., W. Gujer, T. Mino, T. Matsuo, M. C. Wentzel, and G. v. R.Marais. 1995. Activated sludge model no. 2. IAWQ Scientific and TechnicalReports No. 3. Pergamon Press, London, England.

15. Heydorn, A., A. T. Nielsen, M. Hentzer, C. Sternberg, M. Givskov, B. K.Ersboll, and S. Molin. 2000. Quantification of biofilm structures by the novelcomputer program COMSTAT. Microbiology 146:2395–2407.

16. Hicks, R. E., R. I. Amann, and D. A. Stahl. 1992. Dual staining of naturalbacterioplankton with 4�,6-diamidino-2-phenylindole and fluorescent oligo-nucleotide probes targeting kingdom-level 16S rRNA sequences. Appl. En-viron. Microbiol. 58:2158–2163.

17. Kampfer, P., R. Erhart, C. Beimfohr, J. Bohringer, M. Wagner, and R.Amann. 1996. Characterization of bacterial communities from activatedsludge: culture-dependent numerical identification versus in situ identifica-tion using group- and genus-specific rRNA-targeted oligonucleotide probes.Microb. Ecol. 32:101–121.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

18. Koops, H.-P., B. Bottcher, U. C. Moller, A. Pommering-Roser, and G. Stehr.1991. Classification of eight new species of ammonia-oxidizing bacteria:Nitrosomonas communis sp. nov., Nitrosomonas ureae sp. nov., Nitrosomonasaestuarii sp. nov., Nitrosomonas marina sp. nov., Nitrosomonas nitrosa sp.nov., Nitrosomonas eutropha sp. nov., Nitrosomonas oligotropha sp. nov., andNitrosomonas halophila sp. nov. J. Gen. Microbiol. 137:1689–1699.

19. Kuehn, M., M. Hausner, H.-J. Bungartz, M. Wagner, P. A. Wilderer, and S.Wuertz. 1998. Automated confocal laser scanning microscopy and semiau-tomated image processing for analysis of biofilms. Appl. Environ. Microbiol.64:4115–4127.

20. Laanbroek, H. J., and S. Gerards. 1993. Competition for limiting amounts ofoxygen between Nitrosomonas europaea and Nitrobacter winogradskyi grownin mixed continuous cultures. Arch. Microbiol. 159:453–459.

21. Llobet-Brossa, E., R. Rossello-Mora, and R. Amann. 1998. Microbial com-munity composition of wadden sea sediments as revealed by fluorescence insitu hybridization. Appl. Environ. Microbiol. 64:2691–2696.

22. Manz, W., R. Amann, W. Ludwig, M. Wagner, and K.-H. Schleifer. 1992.Phylogenetic oligodeoxynucleotide probes for the major subclasses of pro-teobacteria: problems and solutions. Syst. Appl. Microbiol. 15:593–600.

23. Manz, W., U. Szewzyk, P. Ericsson, R. Amann, K.-H. Schleifer, and T.-A.Stenstrom. 1993. In situ identification of bacteria in drinking water andadjoining biofilms by hybridization with 16S and 23S rRNA-directed fluo-rescent oligonucleotide probes. Appl. Environ. Microbiol. 59:2293–2298.

24. Manz, W., M. Wagner, R. Amann, and K.-H. Schleifer. 1994. In situ char-acterization of the microbial consortia active in two wastewater treatmentplants. Water Res. 28:1715–1723.

25. Mobarry, B. K., M. Wagner, V. Urbain, B. E. Rittmann, and D. A. Stahl.1996. Phylogenetic probes for analyzing abundance and spatial organizationof nitrifying bacteria. Appl. Environ. Microbiol. 62:2156–2162.

26. Neef, A., A. Zaglauer, H. Meier, R. Amann, H. Lemmer, and K.-H. Schleifer.1996. Population analysis in a denitrifying sand filter: conventional and insitu identification of Paracoccus spp. in methanol-fed biofilms. Appl. Envi-ron. Microbiol. 62:4329–4339.

27. Nielsen, P. H. 1996. Adsorption of ammonium to activated sludge. WaterRes. 30:762–764.

28. Purkhold, U., A. Pommering-Roser, S. Juretschko, M. C. Schmid, H.-P.Koops, and M. Wagner. 2000. Phylogeny of all recognized species of ammo-nia oxidizers based on comparative 16S rRNA and amoA sequence analysis:implications for molecular diversity surveys. Appl. Environ. Microbiol. 66:5368–5382.

29. Ramsing, N. B., H. Fossing, T. G. Ferdelman, F. Andersen, and B. Tham-drup. 1996. Distribution of bacterial populations in a stratified fjord (Mar-

iager Fjord, Denmark) quantified by in situ hybridization and related tochemical gradients in the water column. Appl. Environ. Microbiol. 62:1391–1404.

30. Ravenschlag, K., K. Sahm, and R. Amann. 2001. Quantitative molecularanalysis of the microbial community in marine arctic sediments (Svalbard).Appl. Environ. Microbiol. 67:387–395.

31. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

32. Schmid, M., U. Twachtmann, M. Klein, M. Strous, S. Juretschko, M. Jetten,J. W. Metzger, K.-H. Schleifer, and M. Wagner. 2000. Molecular evidencefor a genus-level diversity of bacteria capable of catalyzing anaerobic am-monium oxidation. Syst. Appl. Microbiol. 23:93–106.

33. Snaidr, J., R. Amann, I. Huber, W. Ludwig, and K.-H. Schleifer. 1997.Phylogenetic analysis and in situ identification of bacteria in activated sludge.Appl. Environ. Microbiol. 63:2884–2896.

34. Wagner, M., R. Amann, H. Lemmer, and K.-H. Schleifer. 1993. Probingactivated sludge with oligonucleotides specific for Proteobacteria: inadequacyof culture-dependent methods for describing microbial community structure.Appl. Environ. Microbiol. 59:1520–1525.

35. Wagner, M., R. Erhart, W. Manz, R. Amann, H. Lemmer, D. Wedl, andK.-H. Schleifer. 1994. Development of an rRNA-targeted oligonucleotideprobe specific for the genus Acinetobacter and its application for in situmonitoring in activated sludge. Appl. Environ. Microbiol. 60:792–800.

36. Wagner, M., P. Hutzler, and R. Amann. 1998. 3-D analysis of complexmicrobial communities by combining confocal laser scanning microscopy andfluorescence in situ hybridization (FISH), p. 467–486. In M. H. F. Wilkinsonand F. Schut (ed.), Digital image analysis of microbes. John Wiley & Sons,Chichester, England.

37. Wagner, M., G. Rath, R. Amann, H.-P. Koops, and K.-H. Schleifer. 1995. Insitu identification of ammonia-oxidizing bacteria. Syst. Appl. Microbiol. 18:251–264.

38. Wallner, G., R. Erhart, and R. Amann. 1995. Flow cytometric analysis ofactivated sludge with rRNA-targeted probes. Appl. Environ. Microbiol. 61:1859–1866.

39. Wallner, G., B. Fuchs, S. Spring, W. Beisker, and R. Amann. 1997. Flowsorting of microorganisms for molecular analysis. Appl. Environ. Microbiol.63:4223–4231.

40. Zambrano, M. M., D. A. Siegele, M. Almiron, A. Tormo, and R. Kolter. 1993.Microbial competition: Escherichia coli mutants that take over stationaryphase cultures. Science 259:1757–1760.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org/

cultivation-independent, semiautomatic determination of ... · previous studies. second, manual...

Documents