crispr-cas9 strategy for activation of silent streptomyces ... · crispr-cas9 strategy for...
TRANSCRIPT
Supplementary Information
1
CRISPR-Cas9 strategy for activation of silent Streptomyces biosynthetic gene clusters
Mingzi M Zhang1,5
, Fong Tian Wong2,5
, Yajie Wang3, Shangwen Luo
3, Yee Hwee Lim
4, Elena Heng
2,
Wan Lin Yeo1, Ryan E Cobb
3, Behnam Enghiad
3, Ee Lui Ang
1 and Huimin Zhao
1,3,*
1Metabolic Engineering Research Laboratory, Science and Engineering Institutes, Agency for Science,
Technology, and Research (A*STAR), Singapore
2Molecular Engineering Lab, Biomedical Science Institutes, A*STAR, Singapore
3Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign,
Urbana, IL 61801
4Organic Chemistry, Institute of Chemical and Engineering Sciences, A*STAR, Singapore
5Authors contributed equally
*To whom correspondence should be addressed. Phone: (217) 333-2631. Fax: (217) 333-5052. E-mail:
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
2
SUPPLEMENTARY RESULTS
Supplementary Figure 1. CRISPR-Cas9 mediated promoter knock-in for activation of pigment BGCs.
Supplementary Figure 2. LCMS analysis of S. albus strain with activated indigoidine BGC.
Supplementary Figure 3. LCMS analysis of S. lividans strain with activated RED cluster.
Supplementary Figure 4. Production of pH-sensitive pigments by engineered S. lividans strain.
Supplementary Figure 5. LCMS analysis of S. lividans strain with activated ACT cluster.
Supplementary Figure 6. RT-qPCR analysis of S. roseosporus PTM cluster 24.
Supplementary Figure 7. LCMS analyses of PTM compounds produced by S. roseosporus.
Supplementary Figure 8. RT-qPCR analysis of S. roseosporus phosphonate cluster 10.
Supplementary Figure 9. Introduction of kasO*p-P8 promoter cassette for activation of the
phosphonate BGC in S. roseosporus.
Supplementary Figure 10. Locations of promoter knock-in for S. roseosporus clusters.
Supplementary Figure 11. Location of promoter knock-in for S. venezuelae cluster 16.
Supplementary Figure 12. LCMS analysis of S. roseosporus strain with an engineered cluster 3.
Supplementary Figure 13. LCMS analysis of S. roseosporus strain with an engineered cluster 18.
Supplementary Figure 14. LCMS analysis S. venezuelae strain with an engineered cluster 16.
Supplementary Figure 15. A distinct type II polyketide is produced by S. viridochromogenes with
promoter knock-in.
Supplementary Figure 16. Constitutive promoters used for cluster activation.
Supplementary Figure 17. Workflow for constructing genome editing plasmid for promoter knock-in.
Supplementary Table 1. Efficiencies of CRISPR-Cas9 mediated knock-in for streptomycetes.
Supplementary Table 2. AntiSMASH analyses of S. roseosporus NRRL15998.
Supplementary Table 3. Sequence homology of S. roseosporous cluster 24 to reported PTM clusters.
Supplementary Table 4. Sequence homology of S. roseosporous cluster 10 to FR-900098 BGC from
S. rubellomurinus.
Supplementary Table 5. AntiSMASH analyses of S. venezuelae ATCC10712.
Supplementary Table 6. AntiSMASH analyses of S. viridochromogenes DSM 40736.
Supplementary Table 7. Bacterial strains and plasmids used in this study.
Supplementary Table 8. Oligonucleotides used in this study.
Supplementary Note. Chemical characterization data for 1-4.
Supplementary References
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
3
SUPPLEMENTARY FIGURES
Supplementary Figure 1. CRISPR-Cas9 mediated promoter knock-in for activation of pigment
BGCs. (a) PCR product from genomic DNA isolated from wild type (wt) and exconjugants were
subjected to BstBI-digestion to determine tsr-kasO*p knock-in at the designated genomic locus within
the indigoidine cluster in S. albus. (b) Diagnostic PCR from genomic DNA isolated from wild type
(wt) and exconjugants using the indicated primers to determine kasO*p knock-in at the designated
genomic locus within the RED cluster in S. lividans. For control PCR of the left and right flanks,
primer pairs 1+2 and 3+4 were used respectively. For detection of kasO*p knock-in, primer pairs 1+5
and 3+6 were used. (c) PCR product from genomic DNA isolated from wild type (wt) and
exconjugants were subjected to BstBI-digestion to determine kasO*p knock-in at the designated
genomic locus within the ACT cluster in S. lividans. M refers to molecular weight ladder. Arrow heads
refer to location of primers used for PCR.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
4
Supplementary Figure 2. LCMS analysis of S. albus strain with activated indigoidine BGC. (a)
HPLC analysis (UV detection at 600 nm) of acidic methanol from wild type (WT) S. albus and the
indicated engineered strain (Indigoidine) in which kasO*p was introduced into indigoidine cluster in
front of the indC-like ORF.1 (b) The masses of the two new major metabolites at 5 min and 5.3 min,
indicated by (*), are consistent with indigoidine-related metabolites (m/z 249, 250) and their adducts
(m/z 308, 292).2
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
5
Supplementary Figure 3. LCMS analysis of S. lividans strain with activated RED cluster. (a)
HPLC analysis (UV detection at 500 nm) of methanol extracts from wild type (WT) S. lividans and the
indicated engineered strain (RED) in which kasO*p was introduced into RED cluster. The masses of
the two new major metabolites at 15.3 min and 15.8 min, indicated by (*), are consistent with that of
undecylprodigiosin (m/z 394).3 (b) MS/MS analysis of the major metabolites at 15.3 min and 15.8 min
with m/z 394 yielded fragmentation patterns that are consistent with undecylprodigiosin.3,4
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
6
Supplementary Figure 4. Production of pH-sensitive pigments by engineered S. lividans strain.
Wild type (wt) and engineered S. lividans strains with activated ACT cluster were streaked onto MGY
medium. The plate (left panel) was exposed to ammonia fumes (right panel) to confirm the production
of pH-sensitive pigments.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
7
Supplementary Figure 5. LCMS analysis of S. lividans strain with activated ACT cluster. (a)
HPLC analysis (UV detection at 500 nm) of acidic methanol extracts from wild type (WT) S. lividans
and the indicated engineered strain (ACT) in which kasO*p was introduced into ACT cluster. (b) The
masses of the two new major metabolites at 12.1 min and 12.5 min, indicated by (*), are consistent
with an actinorhodin-related metabolite (m/z 645) and gamma-actinorhodin (m/z 631) respectively.
The ACT cluster in S. coelicolor is known to produce different actinorhodin-related metabolites,
including gamma-actinorhodin.5,6
(c) MS/MS analysis of the major metabolites at 12.1 min and 12.5
min with m/z 645 and m/z 631 respectively yielded fragmentation patterns that are similar to that of
actinorhodin.4
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
8
Supplementary Figure 6. RT-qPCR analysis of S. roseosporus PTM cluster 24. (a) Relative gene
expression of each indicated gene after normalization to the housekeeping rpsL gene for both wild type
(red) and engineered (blue) strains. Error bars represent the standard deviation of biological triplicates.
n.d. indicates undetectable transcript levels. (b) Part of the PTM BGC (cluster 24) in S. roseosporus.
Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_ RS02310 is located within
the gene cluster and was used as a negative control (NC) for our RT-qPCR assay as an example of a
gene whose expression is unaffected by knock-in of the kasO*p promoter cassette. Site of kasO*p
knock-in is indicated by the blue arrowhead.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
9
Supplementary Figure 7. LCMS analyses of PTM compounds produced by S. roseosporus. (a)
HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type S. roseosporus and
the indicated engineered strain in which kasO*p is introduced into cluster 24. (b) Mass spectra of 1 and
2 at the indicated retention times.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
10
Supplementary Figure 8. RT-qPCR analysis of S. roseosporus phosphonate cluster 10. (a,
b) Relative gene expression of each indicated gene after normalization to the housekeeping rpsL gene
for both wild type (red) and engineered (blue) strains. SSGG_RS16990 and SSGG_RS16985 are
plotted separately due to differences in scale. Error bars represent the standard deviation of biological
triplicates. n.d. indicates undetectable transcript levels. (c) Phosphonate BGC (cluster 10) in S.
roseosporus. Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_RS16955 is
located near the FR-900098 cluster and was used as a negative control (NC) for our RT-qPCR assay as
an example of a gene whose expression is unaffected by knock-in of the kasO*p-P8 promoter cassette.
Site of kasO*p-P8 promoter cassette knock-in is indicated by the blue arrowhead.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
11
Supplementary Figure 9. Introduction of kasO*p-P8 promoter cassette for activation of the
phosphonate BGC in S. roseosporus. Shown from bottom to top are 1) the native genomic locus with
the location of chosen PAM and protospacer sequences indicated in blue, 2) the edited genome locus
with the inserted kasO*p-P8 promoter cassette indicated in green, and 3) the sequence traces of the two
junctions flanking the promoter cassette. Biosynthetic genes needed for FR-900009 are highlighted in
red and yellow.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
12
Supplementary Figure 10. Locations of promoter knock-in for S. roseosporus clusters. Red genes
are putative biosynthetic genes while blue and green genes are transport-related and regulation-related
genes, respectively. Sites of single or bidirectional promoter cassette knock-in are indicated by the blue
arrowheads.
Supplementary Figure 11. Location of promoter knock-in for S. venezuelae cluster 16. Indicated
in red are putative biosynthetic genes while blue and green genes are transport-related and regulation-
related genes, respectively. Site of bidirectional kasO*p-P8 cassette knock-in is indicated by the blue
arrowhead.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
13
Supplementary Figure 12. LCMS analysis of S. roseosporus strain with an engineered cluster 3.
(a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type S. roseosporus
and the indicated engineered strain in which kasO*p is introduced into cluster 3. The major unique
product produced by the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and
wild type (bottom) strains at retention time 20 min. (c) Extraction ion chromatogram (m/z 405) of
engineered (top) and wild type (bottom) strains. It is common to observe multiple changes in metabolic
profiles with cluster activation. Regulatory crosstalk between clusters and competition for common
precursors can result in increased and decreased production of metabolites that are not products of the
target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by
genes encoded by the respective clusters, we cannot rule out that additional peaks observed for the
engineered strains are related products, shunt intermediates or simply a result of pleiotropic changes in
the host’s secondary metabolism as a result of activating the target cluster.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
14
Supplementary Figure 13. LCMS analysis of S. roseosporus strain with an engineered cluster 18.
(a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type S. roseosporus
and the indicated engineered strain in which kasO*p is introduced into cluster 18. The major unique
ion detected for the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and wild
type (bottom) strains at retention time 30.3 min. m/z 380 is the doubly charged species of m/z 780. (c)
Extracted ion chromatograms (m/z 780) of engineered (top) and wild type (bottom) strains. It is
common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk
between clusters and competition for common precursors can result in increased and decreased
production of metabolites that are not products of the target cluster. Until the compounds are isolated,
identified, and their biosynthesis accounted for by genes encoded by the respective clusters, we cannot
rule out that additional peaks observed for the engineered strains are related products, shunt
intermediates or simply a result of pleiotropic changes in the host’s secondary metabolism as a result of
activating the target cluster.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
15
Supplementary Figure 14. LCMS analysis of S. venezuelae strain with an engineered cluster 16.
(a) Wild type (WT) and engineered strain in which kasO*p is introduced into cluster 16 on MGY
plates. (b) HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type S.
venezuelae and the indicated engineered strain. The major unique ion detected for the engineered strain
is indicated by (*). (c) Mass spectra of engineered (red) and wild type (black) strains at retention times
31.2 min. (d) Extracted ion chromatograms (m/z 425) of engineered (top) and wild type (bottom)
strains. It is common to observe multiple changes in metabolic profiles with cluster activation.
Regulatory crosstalk between clusters and competition for common precursors can result in increased
and decreased production of metabolites that are not products of the target cluster. Until the compounds
are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective
clusters, we cannot rule out that additional peaks observed for the engineered strains are related
products, shunt intermediates or simply a result of pleiotropic changes in the host’s secondary
metabolism as a result of activating the target cluster.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
16
Supplementary Figure 15. A distinct type II polyketide is produced by S. viridochromogenes with
promoter knock-in. (a) Partial schematic of NZ_GG657757 containing majority of biosynthetic genes
(orange) and the position of kasO*p knock-in. This operon contains contained the minimal set of type
II PKS enzymes, including a ketosynthase (SSQG_RS26900), chain-length factor (SSQG_RS26905)
and an acyl carrier protein (SSQG_RS26910), together with a polyketide cyclase (SSQG_RS26915),
monooxygenase (SSQG_RS26930) and cytochrome P450 (SSQG_RS26935). Except for an additional
cytochrome P450, NZ_GG657757 has high homology and similar gene arrangement as a spore
pigment BGC in S. avermitilis (Accession number: AB070937.1). (b) HPLC analysis of extracts from
the engineered S. viridochromogenes strain harbouring a kasO*p in front of SSQG_RS26895 (bottom)
compared to that from the parent wild type strain (top). The major unique metabolite 4 is indicated. It is
common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk
between clusters and competition for common precursors can result in increased and decreased
production of metabolites that are not products of the target cluster. Until the compounds are isolated,
identified, and their biosynthesis accounted for by genes encoded by the respective clusters, we cannot
rule out that additional peaks observed for the engineered strains are related products, shunt
intermediates or simply a result of pleiotropic changes in the host’s secondary metabolism as a result of
activating the target cluster.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
17
Promoter Sequence
kasO*p tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaatacgacagcgtgcaggactgggggagttATG
P8
ggcgccgaccgcaccacactcacgagggcccgccccaccaacagggggcgggccctctgtgctggcctcaggcgccgaccgggctcggtgccctcaagcgccggccg
ggctccaagggtggcctcaagcgccggccgggctgagttgggccggtctgggcccgcacgcgcgcctcactgacggcctcaagcgccggccgggctatctatagcccgg
ccggcgcttgaggccgtctttggcgcgcgcctgtgagcggacggcccgtcaaagatcagcccggccggcgcttgaggccatctttcgagcccggccggcgtttgaggccac
cccacccccgccccggcaggggcggcctgacctccgcatccgccggcgcggacagggcacccccagtagacgggcgcggggccggaggcccctagcgccttgcactc
tcctaccccgagtgctaattattggcgttagcactctccgagtgagagtgacagaaggaccgggtcggtgaggcccgctggccacgcggggcaaggaaccgcgaggcagg
caggccgtccgtcgcgggcgccagcacggtccggagtatccaccctcccccagacagagtccggggggacccccagtcctgggaggaccacttcacaATG
b
c
Supplementary Figure 16. Constitutive promoters used for cluster activation. (a) Sequences of
constitutive promoters used in this study. ATG start codons of genes to be activated are underlined.
(b, c) Scheme and sequences of adapters introduced into pCRISPomyces at the XbaI site for making (b)
monodirectional and (c) bidirectional promoter knock-in constructs. Restriction sites of selected
enzymes are indicated in the sequence maps.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
18
Supplementary Figure 17. Workflow for constructing genome editing plasmid for promoter
knock-in. Helper pCRISPomyces-2 plasmids (e.g. pCRISPomyces-2-kasO*p) for making promoter
knock-in constructs were made by ligating adapter sequences, containing restriction sites flanking the
promoter of choice to facilitate insertion of homology arms into pCRISPomyces-2.7 The protospacer of
a target cluster was first inserted via BbsI-mediated Golden Gate Assembly. The final editing plasmid
was achieved by sequential insertion of the first and second homology arms by Gibson assembly. Refer
to Online Methods section for more information.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
19
Supplementary Table 1. Efficiencies of CRISPR-Cas9 mediated knock-in for streptomycetes.
Organism Clustera
Promoter insertedb Editing efficiency
edited/total screened
S. albus
Indigoidine – 1kb
Indigoidine
No protospacer – 1kb
No protospacer
kasO*p
3/5 (60%)
7/7 (100%)
0/8 (0%)
4/9 (44%)
S. albus Indigoidine – 1kb
Indigoidine tsr-kasO*p
1/5 (20%)
7/9 (78%)
S. lividans RED
No protospacer kasO*p
8/8 (100%)
4/6 (66%)
S. lividans ACT kasO*p 3/3 (100%)
S. roseosporus Cluster 3 kasO*p 3/3 (100%)
S. roseosporus Cluster 10 P8-kasO*p 2/4 (50%)
S. roseosporus Cluster 18 kasO*p 2/3 (66%)
S. roseosporus Cluster 24
No protospacer kasO*p
3/6 (50%)
0/8 (0%)
S. venezuelae Cluster 16
No protospacer P8-kasO*p
9/14 (64%)
3/8 (38%)
S. viridochromogenes Cluster 22 kasO*p 6/6 (100%)
aUnless otherwise indicated, knock-ins were performed with editing templates containing the indicated
insert with 2 kb homology flanks. No protospacer refers to the same knock-in constructs for the
indicated cluster without a protospacer. bkasO*p and P8-kasO*p cassettes are 97 and 774 bp respectively. tsr refers to a ~1 kb thiostrepton-
resistance cassette.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
20
Supplementary Table 2. AntiSMASH analyses of S. roseosporus NRRL15998 (NCBI Reference
Sequence: NZ_DS999644.1).8 Previously observed compounds include daptomycin (clusters 1,2),
napsamycin (cluster 9), stenothricin (cluster 5) and arylomycin (cluster 20).9
Cluster Type From To Compound Study
Cluster 1 Nrps 294555 342186
Cluster 2 Nrps 327150 404865 Daptomycin Liu et al,
20149
Cluster 3 Nucleoside-t1pks 542942 610237 m/z 405 This study
Cluster 4 Terpene 749569 770645
Cluster 5 Nrps 867981 941249 Stenothricin Liu et al,
20149
Cluster 6 Ectoine 1254796 1265194
Cluster 7 Lantipeptide 2310568 2333055
Cluster 8 Siderophore 2417885 2429663
Cluster 9 Nrps 3338145 3408899 Napsamycin Liu et al,
20149
Cluster 10 Phosphonate 3538559 3564634 3 This study
Cluster 11 T2pks 4069279 4111773
Cluster 12 Siderophore-nrps 4243258 4290705
Cluster 13 Lantipeptide 4435763 4459002
Cluster 14 Nrps 5067958 5119039
Cluster 15 Terpene 5593701 5614678
Cluster 16 Nrps 5627322 5683180
Cluster 17 Siderophore 6039454 6054198
Cluster 18 T1pks 6088404 6152437 m/z 780 This study
Cluster 19 T1pks-
oligosaccharide 6137252 6204339
Cluster 20 Nrps 6206554 6271974 Arylomycin Liu et al,
20149
Cluster 21 Nrps-t1pks 6373968 6429540
Cluster 22 Bacteriocin 6529256 6540056
Cluster 23 Terpene 7116845 7143418
Cluster 24 Nrps-t1pks 7222916 7272356 1, 2 This study
Cluster 25 Bacteriocin 7309635 7320432
Cluster 26 T1pks-nrps 7435742 7486384
Cluster 27 Melanin 7520011 7530493
Cluster 28 T3pks 7565600 7606652
Cluster 29 Nrps-t1pks 7691684 7743884
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
21
Supplementary Table 3. Sequence homology of S. roseosporous cluster 24 to reported PTM
clusters.10,11
Frontalamide
biosynthetic (ftd)
S. griseus.
PTM
cluster11
Cluster 24
equivalent
Predicted
Function
Sequence
identity of
cluster 24 to
S. griseus
equivalent
FtdA SGR 815 SSGG_RS0133915 Sterol desaturase 95%
FtdB SGR 814 SSGG_RS02305 polyketide
synthase 95%
FtdC SGR 813 SSGG_RS02300 FAD-dependent
oxidoreductase 98%
FtdD SGR 812 SSGG_RS02295 phytoene
dehydrogenase 96%
FtdE SGR 811 SSGG_RS02290 alcohol
dehydrogenase 97%
FtdF SGR 810 SSGG_RS02285
putative
cytochrome P450
hydroxylase
91%
Supplementary Table 4. Sequence homology of S. roseosporous cluster 10 to FR-900098 BGC from
S. rubellomurinus.12
FR-900098
cluster12
Cluster 10
equivalent Predicted Function
Sequence
Identity
FrbI SSGG_RS17015 NUDIX hydrolase 60%
FrbH SSGG_RS17010 L-threonine-O-3-phosphate decarboxylase
[Streptomyces] 74%
FrbG SSGG_RS17005 Hypothetical protein 60%
FrbF SSGG_RS17000 AAC(3) family N-acetyltransferase 73%
FrbE SSGG_RS16995 Isocitrate dehydrogenase 63%
FrbD SSGG_RS16990 Phosphoenolpyruvate synthase 76%
FrbC SSGG_RS16985 Hypothetical protein 87%
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
22
Supplementary Table 5. AntiSMASH analyses of S. venezuelae ATCC10712 (NCBI Reference
Sequence: NC_018750.1).8 Previously observed compounds from S. venezuelae include
chloramphenicol (cluster 7) and jadomycin (cluster 20).13,14
Cluster Type From To Compound Study
Cluster 1 Ectoine 237842 248258
Cluster 2 Terpene 274553 296739
Cluster 3 T1pks-T3pks-Nrps 504136 604067
Cluster 4 Lantipeptide-Terpene 614220 645285
Cluster 5 Lantipeptide 707463 730315
Cluster 6 Indole 867489 890695
Cluster 7 Other 1031023 1073914 Chloramphenicol He et al,
200114
Cluster 8 Other 2055965 2096690
Cluster 9 Siderophore 2794931 2806751
Cluster 10 Lassopeptide 3408328 3430687
Cluster 11 Other 4408196 4451900
Cluster 12 Butyrolactone 4522206 4533171
Cluster 13 Melanin 5003818 5014228
Cluster 14 Butyrolactone 5477370 5502716
Cluster 15 Thiopeptide 5531076 5557501
Cluster 16 T3pks 5785193 5826323 m/z 425 This study
Cluster 17 Siderophore 5869901 5883169
Cluster 18 Siderophore 5936046 5950407
Cluster 19 Bacteriocin 6350466 6361866
Cluster 20 Butyrolactone-T2pks 6494470 6531416 Jadomycin Doull et al,
199315
Cluster 21 Other 6672467 6716369
Cluster 22 Nrps-Ladderane 6720590 6814598
Cluster 23 Nrps 6800195 6855167
Cluster 24 Terpene 7021575 7048100
Cluster 25 Bacteriocin 7128838 7139692
Cluster 26 T2pks 7421589 7464101
Cluster 27 Melanin 7484949 7495338
Cluster 28 Nrps 7706602 7760938
Cluster 29 Terpene 7788497 7809951
Cluster 30 T3pks 7946146 7987237
Cluster 31 Terpene-Nrps 8189935 8226158
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
23
Supplementary Table 6. AntiSMASH analyses of S. viridochromogenes DSM 40736 (NCBI
Reference Sequence: NZ_ACEZ00000000.1)8 Previously observed product from S. viridochromogenes
include phosphinothricin.
Cluster Type From To Compound Study
Cluster 1 Terpene-nrps-t1pks 147228 209213
Cluster 2 Melanin-terpene 350984 374124
Cluster 3 Nrps 614938 667909 Coelichelina
Cluster 4 T1pks-butyrolactone 925309 1004775
Cluster 5 Lassopeptide 996947 1020529
Cluster 6 T1pks 1023099 1074657
Cluster 7 T1pks 1068135 1123254
Cluster 8 Nrps-t1pks 1124345 1179652
Cluster 9 Nrps-phosphonate 1172570 1240729 Phosphonothricin Metcalf et al,
200516
Cluster 10 Ectoine 1986466 1997781 Ectoineb
Cluster 11 NRPS-t1PKS 2482772 2542826
Cluster 12 Terpene 2721388 2743906
Cluster 13 Lassopeptide 3108492 3120837
Cluster 14 Melanin 3108492 3120837
Cluster 15 Siderophore 4468051 3223680
Cluster 16 Butyrolactone 5785193 4479215
Cluster 17 Lantipeptide 4691917 4720311
Cluster 18 T1pks 4852429 4915920
Cluster 19 Linaridin 4917000 4938204
Cluster 20 Lantipeptide-nrps 5099822 5150004
Cluster 21 Terpene 5973704 5895857
Cluster 22 T2pks 6046899 6089394 4 This study
Cluster 23 Siderophore 6516102 6529476
Cluster 24 T1pks 6568627 6618163
Cluster 25 Ectoine 6692399 6703527
Cluster 26 Bacteriocin 6914884 6926688
Cluster 27 Terpene 6959775 6982425
Cluster 28 Siderophore 7169194 7182469
Cluster 29 Terpene 7611221 7638254
Cluster 30 Terpene 8121206 8142742
Cluster 31 Bacteriocin-
lantipeptide 8164951 8193467
Cluster 32 T1pks 8282728 8326427
Cluster 33 Other 8476453 8521258 a 100% of genes show similarity with coelichelin BGC of S. coelicolor A3(2).
17,18
b 100% of genes show similarity with ectoine BGCs of S. chrysomallus.
19
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
24
Supplementary Table 7. Bacterial strains and plasmids used in this study.
Strains and plasmids Description Source
pCRISPomyces-2 (pCm2) AprR, oriT, reppSG5(ts), oriColE1, sSpcas9, sgRNA
cassette Cobb et al.7
pCm2-adapter1-kasO*p-
adapter2
pCM2 with adapters to facilitate assembly of
editing flanks upstream and downstream of
kasO*p
This work
pCm2-adapter1-P8-kasO*p-
adapter2
pCM2 with adapters to facilitate assembly of
editing flanks upstream and downstream of
bidirectional P8-kasO*p
This work
pUC19-tsr-kasO*p
Thiostrepton-resistance cassette (tsr)-kasO*p
cloned into EcoRI/HindIII site of pUC19,
preserving the restriction sites
This work
Escherichia coli DH5α
F– Φ80lacZΔM15 Δ(lacZYA-argF) U169
recA1 endA1 hsdR17 (rK–, mK+) phoA supE44
λ– thi-1 gyrA96 relA1
Zhao laboratory stock
Escherichia coli OmniMAX™
F– proAB+ lacIq lacZΔM15 Tn10(TetR)
Δ(ccdAB) mcrA Δ(mrr-hsdRMS-mcrBC)
Φ80lacZΔM15 Δ(lacZYA-argF)
U169 endA1 recA1 supE44 thi-
1 gyrA96 relA1 tonA panD
Thermo Fisher
Escherichia coli WM6026 diaminopimelic acid auxotroph William Metcalf
laboratory
Escherichia coli WM3780 dam-dcm- William Metcalf
laboratory
Streptomyces albus J1074 wild type
Prof. Wenjun Zhang,
University of California,
Berkeley
Streptomyces lividans 66 wild type Zhao laboratory stock
Streptomyces roseosporus
NRRL15998 wild type Zhao laboratory stock
Streptomyces venezualae
ATCC10712 wild type NRRL
Streptomyces
viridochromogenes DSM 40736 wild type Zhao laboratory stock
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
25
Supplementary Table 8. Oligonucleotides used in this study.
Primers Sequence Comments
Complementary oligonucleotides for BsaI Golden Gate assembly of protospacers.
20 bp protospacer sequences are represented in lowercase letters.
npPP6 ACGCcccgagtgtgtgatctgcga Indigoidine protospacer, S. albus
npPP7 AAACtcgcagatcacacactcggg
npPP288 ACGCgcccgaatccgatcgttcgg RED protospacer, S. lividans
npPP289 AAACccgaacgatcggattcgggc
npPP20 ACGCatcccgcatcggtgattaca ACT protospacer, S. lividans
npPP21 AAACtgtaatcaccgatgcgggat
npPP207 ACGCaagcgttccacgaaaacagg Cluster 10 protospacer in S. roseosporus
npPP208 AAACcctgttttcgtggaacgctt
npPP255 ACGCaatgaatttcgccat Cluster 24 protospacer in S. roseosporus
npPP256 AAACatggcgaaattcatt
npPP261 ACGCggcctggtcaaggcatgtac Cluster 3 protospacer in S. roseosporus
npPP262 AAACgtacatgccttgaccaggcc
npPP786 ACGCcccgtacatgcattgaacga Cluster 18 protospacer in S. roseosporus
npPP787 AAACtcgttcaatgcatgtacggg
npPP624 ACGCgcgcgcccggacgcttacgc Cluster 16 protospacer in S. venezuelae
npPP625 AAACgcgtaagcgtccgggcgcgc
pCm2-
C22-for ACGCccatggtccgtctccaaggt
Cluster 22 protospacer in S. viridochromogenes pCm2-
C22-rev AAACaccttggagacggaccatgg
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
26
Diagnostic PCR and sequencing
npPP356 cccggcgagacccatacgctcgc PCR of target genomic locus for S. roseosporus cluster 24
npPP357 ggtgctcgatgctcagcacggtcttg
npPP300 ttccgtaaggcttccccggataaaagcgc Sequencing primers for edited genomic region (S. roseosporus
cluster 24) npPP301 cgatcaggaaaagcggactgacccacg
npPP283 ggacctgtccttgttccacgccga PCR of target genomic locus for S. roseosporus cluster 10
npPP284 gacgacacgcaccatcaggaacgcc
npPP246 cagtcagcgagcaccggcag Sequencing primers for edited genomic region (S. roseosporus
cluster 10) npPP247 cccatggcggggatgccgat
npPP802 agagcggtttcgagctcacgaccgatgtcg PCR of target genomic locus for S. roseosporus cluster 18
npPP803 tcgagctgctgtctcgccagatcacggg
npPP804 caccacagtgccagtaggtctggtacggta Sequencing primers for edited genomic region (S. roseosporus
cluster 18)
npPP674 ggacgggaagatcacaccggtctccgtgg PCR of target genomic locus for S. roseosporus cluster 3
npPP675 ctgcgaccgcttcgtcaggtcgcattcg
npPP676 gacagcggacttgagggagcgtcataggtc Sequencing primer for edited genomic region (S. roseosporus cluster
3)
npPP689 gtcaccatcggctcctacgacggggtgcac PCR of target genomic locus for S. venezuelae cluster 16
npPP699 ccttcggcatgatctcgcaggcgctgatgg
npPP700 ccggtcatcttggtgacctgctggtcgagc Sequencing primers for edited genomic region (S. venezuelae cluster
16) npPP701 gcttcagggtctcctcgatgggctgcacg
npPP200 gcctccgccgcgacctgtgaacggta PCR of target genomic locus for S. lividans ACT cluster
npPP201 cggcgagtcagcaggactccgaacggac
npPP164 cgtgatcgacgacgaaccgcaga PCR of target genomic locus for S. lividans RED cluster – control
primer pair for left flank npPP178 gcgcctggagggcgttgaggacg
npPP355 cataactcccccagtcctgcacg PCR of target genomic locus for S. lividans RED cluster – kasO*p-
specific primer for left flank, used with npPP164
npPP176 cggcaccccatccgctcatgggag PCR of target genomic locus for S. lividans RED cluster – control
primer pair for right flank npPP227 tggtagaggtcccggtcgaacaactcggccgg
npPP196 agtcgtggccaggagaatacgacagcgtgc PCR of target genomic locus for S. lividans RED cluster – kasO*p-
specific primer for right flank, used with npPP227
npPP183 ggcctcgaactccagcacctcgacg PCR of target genomic locus for S. albus indigoidine cluster
npPP186 cacgcgttcatggtgcccggcatc
C22_Up-
2kbL-for cggtttgtcacaatgggcgg
PCR of target genomic locus for S. viridochromogenes cluster 22
C22-Seq-rev tggacgacgaacacgaact
C22-Seq-for agcaccgtcttccaccggg Sequencing primers for edited genomic region (S. viridochromogenes
cluster 22) C22-Seq-rev tggacgacgaacacgaact
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
27
Gene-specific primers for RT-qPCR
atcgaggtcacggcctacatc rpsL
cgcggatgatcttgtaacgaac
ttggaggcactggaagagag SSGG_RS107025
atcctggccaacaaggaatcc
aactggtcgacgacaacatc SSGG_RS107020
cgttctcgacattgatccacag
gctcgacaaagacgaaattcgc SSGG_RS107010
atttgcggagagttgtgtgc
cgaatgagttctgcggatgc SSGG_RS107000
tattcgacccagcgctgac
agttggaaaacgtcgctcac SSGG_RS106990
atcaccgccatgcagaaaag
tgggattcaaggccgtacac SSGG_RS106985
tccttggccatcttgatcagc
tgtggtcgatgatcagactctc SSGG_RS0132525
caaatacaccgatgggctgttc
tcgaggacaagtgtcagcatc SSGG_RS16955
gcaatcgccggtctatttgc
aagaacttgtacggggagcag SSGG_RS02310
gcgttgctgtacgtggac
tcggagtgatcgcctatttgg SSGG_RS0133915
agcaggaagtagatgccgtac
aacgcatcaaggacgaactg SSGG_RS02305
tccttcgacacctgtgagatac
actgcacctacttcagcgac SSGG_RS02300
gaagtcccggacgaaatcgg
actcgatcatggaggtggtg SSGG_RS02290
tcgagatcacatgcgtacgc
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
28
SUPPLEMENTARY NOTE
Chemical characterization data for compounds 1–4.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
29
NMR analyses of 1. (a) 1H NMR (CD3OD). (b) COSY (CD3OD) (c) HSQC (CD3OD). (d) HMBC
(CD3OD).
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
30
NMR analyses of 2 (a) 1H NMR of 2 (CD3OD). (b) COSY of 2 (CD3OD).
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
31
31
P HMBC for FR-900098
31
P HMBC for methanol extract from engineered S. roseosporus strain (cluster 10)
31
P HMBC of authentic FR-900098 sample and 3 produced by the engineered S. roseosporus strain
upon activation of phosphonate BGC (cluster 10).
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
32
1H NMR of 4 (DMSO-d6)
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
33
13C NMR of 4 (DMSO-d6)
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
35
TOCSY of 4 (DMSO-d6)
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
38
NMR peak assignment for 4.
No.
Compound 4
δC δH (J in Hz)
COSY/
TOCSY HMBC
1 54.2 2.73, d (15.3) 2, 21, 22, 23
2.61, d (15.3)
2 196.8
3 150.7
4 137.0
5 115.2 9.30, s 7, 15, 17
6 135.5
7 183.5
8 133.0
9 105.8 7.07, s 11 7, 11, 13
10 162.8
11 108.1 6.52, s 9 9, 10, 12, 13
12 164.4
13 111.4
14 184.1
15 108.7
16 169.2
17 119.0
18 175.2
19 113.2 6.43, s 21 17, 20, 21
20 117.1
21 44.9 3.07, d (15.6) 19 1, 3, 19, 20, 22, 23
2.95, d (15.6)
22 69.6
23 28.9 1.26, s 1, 21, 22
10-OH 10.70, s 9, 10, 11
12-OH nd
16-OH nd
18-OH nd
22-OH 4.77, s 1, 21, 22, 23
.
Nature Chemical Biology: doi:10.1038/nchembio.2341
Supplementary Information
39
SUPPLEMENTARY REFERENCES
1. Olano, C. et al. Activation and identification of five clusters for secondary metabolites in
Streptomyces albus J1074. Microbial biotechnology 7, 242-256 (2014).
2. Kuhn, R., Starr, M.P., Kuhn, D.A., Bauer, H. & Knackmuss, H.J. Indigoidine and other
bacterial pigments related to 3,3'-bipyridyl. Arch Mikrobiol 51, 71-84 (1965).
3. Meschke, H., Walter, S. & Schrempf, H. Characterization and localization of prodiginines
from Streptomyces lividans suppressing Verticillium dahliae in the absence or presence of
Arabidopsis thaliana. Environ Microbiol 14, 940-52 (2012).
4. Watrous, J. et al. Mass spectral molecular networking of living microbial colonies. Proc Natl
Acad Sci U S A 109, E1743-52 (2012).
5. Bystrykh, L.V. et al. Production of actinorhodin-related "blue pigments" by Streptomyces
coelicolor A3(2). J Bacteriol 178, 2238-44 (1996).
6. Tanaka, Y. et al. Activation and products of the cryptic secondary metabolite biosynthetic
gene clusters by rifampin resistance (rpoB) mutations in actinomycetes. J Bacteriol 195,
2959-70 (2013).
7. Cobb, R.E., Wang, Y. & Zhao, H. High-efficiency multiplex genome editing of Streptomyces
species using an engineered CRISPR/Cas system. ACS Synth Biol 4, 723-8 (2015).
8. Weber, T. et al. antiSMASH 3.0-a comprehensive resource for the genome mining of
biosynthetic gene clusters. Nucleic Acids Res 43, 237-43 (2015).
9. Moree, W.J. et al. Microbiota of healthy corals are active against fungi in a light-dependent
manner. ACS Chem Biol 9, 2300-8 (2014).
10. Blodgett, J.A. et al. Common biosynthetic origins for polycyclic tetramate macrolactams from
phylogenetically diverse bacteria. Proc Natl Acad Sci U S A 107, 11692-7 (2010).
11. Luo, Y. et al. Activation and characterization of a cryptic polycyclic tetramate macrolactam
biosynthetic gene cluster. Nat Commun 4, 2894 (2013).
12. Johannes, T.W. et al. Deciphering the late biosynthetic steps of antimalarial compound FR-
900098. Chem Biol 17, 57-64 (2010).
13. Doull, J.L., Ayer, S.W., Singh, A.K. & Thibault, P. Production of a novel polyketide
antibiotic, jadomycin B, by Streptomyces venezuelae following heat shock. J Antibiot (Tokyo)
46, 869-71 (1993).
14. He, J., Magarvey, N., Piraee, M. & Vining, L.C. The gene cluster for chloramphenicol
biosynthesis in Streptomyces venezuelae ISP5230 includes novel shikimate pathway
homologues and a monomodular non-ribosomal peptide synthetase gene. Microbiology 147,
2817-29 (2001).
15. Bruheim, P., Sletta, H., Bibb, M.J., White, J. & Levine, D.W. High-yield actinorhodin
production in fed-batch culture by a Streptomyces lividans strain overexpressing the pathway-
specific activator gene actll-ORF4. J Ind Microbiol Biotechnol 28, 103-11 (2002).
16. Blodgett, J.A., Zhang, J.K. & Metcalf, W.W. Molecular cloning, sequence analysis, and
heterologous expression of the phosphinothricin tripeptide biosynthetic gene cluster from
Streptomyces viridochromogenes DSM 40736. Antimicrob Agents Chemother 49, 230-40
(2005).
17. Bentley, S.D. et al. Complete genome sequence of the model actinomycete Streptomyces
coelicolor A3(2). Nature 417, 141-7 (2002).
18. Redenbach, M. et al. A set of ordered cosmids and a detailed genetic and physical map for the
8 Mb Streptomyces coelicolor A3(2) chromosome. Mol Microbiol 21, 77-96 (1996).
19. Prabhu, J., Schauwecker, F., Grammel, N., Keller, U. & Bernhard, M. Functional expression
of the ectoine hydroxylase gene (thpD) from Streptomyces chrysomallus in Halomonas
elongata. Appl Environ Microbiol 70, 3130-2 (2004).
Nature Chemical Biology: doi:10.1038/nchembio.2341