cot 6930 hpc and bioinformatics introduction to molecular biology xingquan zhu dept. of computer...
TRANSCRIPT
![Page 1: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/1.jpg)
COT 6930HPC and Bioinformatics
Introduction to Molecular Biology
Xingquan ZhuDept. of Computer Science and Engineering
![Page 2: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/2.jpg)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
![Page 3: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/3.jpg)
Cells are fundamental working units of every living system. A cell is the smallest structural unit of an organism that is capable of
independent function Unicellular organism (Any living being consisting of a single cell): mainly bacteria Multicellular organism (Organisms consisting of more than one cell): Plant and animal
All cells have some common features Membrane, cytoplasm
Cell is able to survive and multiply independently in appropriate environment There are estimated about 6x1013 (60 trillions) cells in a human body, of
about 210 distinct cell types Cells may have different sizes: a human red blood cell may be 5 microns in
diameter while some neurons are about 1 m long (from spinal cord to leg) Name a cell visible with naked eyes..
Life begins with Cell
![Page 4: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/4.jpg)
Cell
Living organisms (on Earth) require ability to Separate inside from outside (lipids) Build 3D machinery to perform biological functions (proteins) Store information on how to build machinery (DNA)
The basic unit of life Every living thing is made of cells. Every cell comes from a pre-existing cell All of life’s functions are cellular
![Page 5: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/5.jpg)
Every organism is composed of one of two radically different types of cells: prokaryotic cells or eukaryotic cells.
Prokaryotic cells are simpler than eukaryotic cells
Prokaryotes are (mostly) single cellular organisms
Eukaryotic cell has a nucleus, separated from the rest of the cell by a membrane
Eukaryotes can be single cellular (Yeast) or multicellular (animals, plants)
Organisms – Eukaryotes and Prokaryotes
![Page 6: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/6.jpg)
Organisms – Eukaryotes and Prokaryotes
Prokaryotes Eukaryotes
Single cell Single or multi cell
No nucleus Nucleus
No organelles Organelles
One piece of circular DNA Chromosomes
No mRNA post transcriptional modification
Exons/Introns splicing
![Page 7: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/7.jpg)
Structure of a Eukaryotic Cell
• Nucleus contains chromosomes, which are the carrier of the genetic material
• Organelles like centrioles, lysosomes, golgi complexes are enclosed compartments within the cell and are responsible for particular biological processes
• Area of the cell outside the nucleus and the organelles is called the cytoplasm
![Page 8: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/8.jpg)
Composition of Cells
Cell membrane Boundary between cell and outside world Cell membranes consist of two layers of lipid
molecules with hydrophobic ends facing in (keeps water out)
Nucleus Contain genetic material Separated from the rest of the cell by a nuclear
membrane
![Page 9: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/9.jpg)
The nucleus1. nuclear envelope2. nucleolus3. chromosomes
chromosomes
![Page 10: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/10.jpg)
All Cells have common Cycles
Growth of a single cell and its subsequent division is called the cell cycleM: Mitosis
Prokaryotes, particularly bacteria, are extremely successful at multiplying.
Multicellular organisms typically begin life as a single cell. The single cell has to grow, divide and differentiate into different cell types to produce tissues and in higher eukaryotes, organs
![Page 11: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/11.jpg)
All cells come from pre-existing cells
![Page 12: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/12.jpg)
Molecular Biology: Studying life at the molecular level
DNA Protein RNA
mRNA rRNA tRNA
Protein synthesis Protein transcription Protein translation
![Page 13: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/13.jpg)
Molecules of Life All Life depends on 3 critical molecules –
DNA, RNA, and Protein All 3 are specified linearly
DNA and RNA are constructed from nucleic acids (nucleotides) Can be considered to be a string written in a four-letter
alphabet (A C G T/U) Proteins are constructed from amino acids
Strings in a twenty-letter alphabet of amino acids
![Page 14: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/14.jpg)
DNA RNA protein phenotype
Central dogma of molecular biology
![Page 15: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/15.jpg)
DNA, RNA, Protein
Self replication and genetic code
DNA DNA → DNA (Replication)RNA DNA → RNA (Transcription / Gene Expression)Protein RNA → Protein (Translation)
![Page 16: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/16.jpg)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
![Page 17: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/17.jpg)
DNA (Deoxyribonucleic Acid ) Structure Physical structure
Double (stranded) helix Sugar & phosphate groups form backbone Complementary bases (A-T, C-G) connected by hydrogen bond 5’ = end w/ free phosphate group 3’ = end w/ free oxygen group
![Page 18: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/18.jpg)
DNA
Composition Sequence of nucleotides Deoxyribonucleotide = deoxyribose sugar + phosphate group +
base
![Page 19: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/19.jpg)
Nucleotide Bases
![Page 20: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/20.jpg)
Nucleotides
The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom
(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA
![Page 21: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/21.jpg)
DNA structure
![Page 22: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/22.jpg)
Why 5’ and 3’
Deoxyribonucleotide = deoxyribose sugar + phosphate group + base
The deoxyribose sugar in DNA is a pentose, a five-carbon sugar. Four carbons and an oxygen make up the five-membered ring; the other carbon branches off the ring. The carbon constituents of the sugar ring are numbered 1'-4' (pronounced "one-prime carbon"), starting with the carbon to the right of the oxygen going clockwise. The fifth carbon (5') branches from the 4' carbon.
![Page 23: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/23.jpg)
DNA - Denaturation, Hybridization
![Page 24: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/24.jpg)
DNA For bioinformatics
DNA can be represented as a sequence of letters (A,C,G,T)
5’ A T A C G T A 3’ 3’ T A T G C A T 5’ (matching strand, redundant)
Terms Base pair (bp) – one pair of DNA bases (1 letter) Gene – section of DNA that produces a functional product Chromosome – physical linear sequence of DNA Genome – entire collection of DNA for an organism
E Coli 1 chromosome 5 x 106 bases (5 Mbps) Drosophila 8 chromosomes 2 x 108 bases (200 Mbps) Human 48 chromosomes 3 x 109 bases (3 Bbps)
![Page 25: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/25.jpg)
DNA Replication
DNA can be replicated DNA strands are split DNA polymerase (enzyme) reads one strand (template) Builds new (complementary) strand to form duplicate DNA
![Page 26: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/26.jpg)
DNA fascinating factEach cell has 2m of DNA
Average person has 75 trillion cells = 75 * 1012
Length of DNA in a person = 150 * 1012 m
Each person has enough DNA to go to the sun and back 500 times
![Page 27: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/27.jpg)
Organization of DNA in chromosomes
homologous
3 bases/ amino acid
27,000 bases/ protein (1 gene)
3,000,000,000 base pairs/ genome
20,000 genes/ genome
Histone proteins
Human Genome Project
![Page 28: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/28.jpg)
Genome
Gene: Contiguous subparts of single strand DNA that are templates for producing proteins. Chromosomes: compact chain
s of coiled DNA
Genome: The set of all genes in a given organism.
Noncoding part: The function of DNA material between genes is largely unknown.
Source: www.mtsinai.on.ca/pdmg/Genetics/basic.htm
![Page 29: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/29.jpg)
More Terminology
The genome is an organism’s complete set of DNA. A bacteria contains about 600,000 DNA base pairs Human and mouse genomes have some 3 billion.
Human genome has 23 pairs of chromosomes. Each chromosome contains many genes.
Gene Basic physical and functional units of heredity. Specific sequences of DNA bases that encode
instructions on how to make proteins.
![Page 30: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/30.jpg)
DNA sequences in the human genome
![Page 31: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/31.jpg)
DNA homologies98.7%
![Page 32: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/32.jpg)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
![Page 33: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/33.jpg)
DNA Sequencing (Sanger’s Dideoxy Method) Method for identifying short DNA sequences Algorithm
Replicate DNA with (color-labeled) dideoxy-nucleotides Creates fragments of DNA
Apply gel electrophoresis Separates fragments based on size
Machine scans gel Records level of color found at each position
Software calls bases Predicts base at each position
Limitations Upper bound of 700-800 bases on sequence length Larger DNA sequences will need to be assembled
![Page 34: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/34.jpg)
DNA Sequencing Dideoxynucleotides
Similar to normal nucleotide base Missing 3’ hydroxyl group terminates DNA sequence May be chemically modified to fluoresce under UV light
![Page 35: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/35.jpg)
DNA Sequencing
Example for GCGAATGTCCACAACGCTACAGGTG Replicate DNA in the presence of dideoxy-Cytidine (ddC) Replication terminates when ddC is used instead of C Produces the following DNA fragments
GC GCGAATGTC GCGAATGTCC GCGAATGTCCAC GCGAATGTCCACAAC GCGAATGTCCACAACGC GCGAATGTCCACAACGCTAC
![Page 36: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/36.jpg)
DNA Sequencing
Gel electrophoresis Place DNA fragments in gel Apply electric field Speed of fragment is determined
by size Smaller = faster Larger = slower
After given time Fragments are separated in gel Fragments are sorted by size
(number of bases)
![Page 37: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/37.jpg)
Gel electrophoresis
![Page 38: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/38.jpg)
DNA Sequencing
![Page 39: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/39.jpg)
DNA Sequencing
![Page 40: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/40.jpg)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein
![Page 41: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/41.jpg)
Central Dogma of Biology: DNA, RNA, and the Flow of Information
TranslationTranscription
Replication
![Page 42: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/42.jpg)
Ribonucleic acid (RNA)
Composition Sequence of nucleotides Ribonucleotide = ribose sugar + phosphate group + base
Major difference between DNA and RNA RNA: usually single stranded RNA: ribose sugar, DNA: Deoxyribose sugar RNA: Uracil (U) instead of Thymine (T)
DNA → RNA (Transcription / Gene Expression) RNA polymerase (enzyme)
Finds gene initiation marker (codon) on DNA strand Reads DNA strand containing marker Builds (complementary) strand of messenger RNA (mRNA) Stops when gene end marker (codon) found
Resulting RNA sequence = transcript
![Page 43: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/43.jpg)
Ribonucleotides
The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom
(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA
![Page 44: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/44.jpg)
Transcription Example (1)
![Page 45: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/45.jpg)
Transcription Example (2)
![Page 46: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/46.jpg)
Transcription Example (3)
![Page 47: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/47.jpg)
Transcription Example (4)
![Page 48: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/48.jpg)
Transcription Example
![Page 49: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/49.jpg)
What is Enzyme?
Proteins that catalyze (i.e. accelerate) chemical reactions They are not living things Two types of Enzyme
Join specific molecules together to form new molecules Break specific molecules apart into separate molecules
Things about Enzyme Enzymes are specific: Performing only one specific job, about
3000 types enzymes identified so far Enzymes are catalysts: Can perform that same job over and over
again, millions of times, without being consumed in the process. Enzymes are efficient: Enzymes are natural: Once they have done their job, enzymes
break down swiftly and can be absorbed back into nature
![Page 50: COT 6930 HPC and Bioinformatics Introduction to Molecular Biology Xingquan Zhu Dept. of Computer Science and Engineering](https://reader035.vdocuments.us/reader035/viewer/2022070403/56649f295503460f94c41af4/html5/thumbnails/50.jpg)
Outline
Cell DNA
DNA Structure DNA Sequencing
RNA (DNA-> RNA) Protein