corrected proof

8/11/2019 Corrected Proof

1/6

Comparison of (GTG)5-oligonucleotide and ribosomal intergenic transcribed spacer(ITS)-PCR for molecular typing ofKlebsiellaisolates

Anna Ryberg a, Crister Olsson c, Siv Ahrn d, Hans-Jrg Monstein a,b,a Division of Clinical Microbiology, University Hospital Linkping, Linkping University, S-581 85 Linkping, Swedenb Department of Clinical and Experimental Medicine, Faculty of Health Sciences, Linkping University, S-581 85 Linkping, Swedenc Department of Surgery, Malm University Hospital, Lund University, Malm, Swedend Department of Food Technology, Engineering and Nutrition, Lund University, Lund, Sweden

a b s t r a c ta r t i c l e i n f o

Article history:

Received 16 September 2010Received in revised form 16 November 2010Accepted 19 November 2010Available online xxxx

Keywords:

Klebsiellaspp.Molecular typing(GTG)5-PCRRibosomal intergenic transcribed spacer(ITS)-PCRFingerprint analysisMultiple displacement amplication

Molecular typing ofKlebsiella specieshasbecome important formonitoringdisseminationof-lactamase-producersin hospital environments. The present study was designed to evaluate poly-trinucleotide (GTG) 5- and rDNAintergenictranscribed spacer(ITS)-PCRngerprintanalysis fortyping ofKlebsiella pneumoniaeand Klebsiella oxytocaisolates. Multiple displacement amplied DNA derived from 19 K. pneumoniae(some with an ESBL-phenotype),35 K. oxytocaisolates, veK. pneumoniae, twoK. oxytoca, threeRaoultella, and oneEnterobacter aerogenestype andreference strains underwent (GTG)5and ITS-PCR analysis. Dendrograms were constructed using cosine coefcientand the Neighbour joining method. (GTG)5 and ITS-PCR analysisrevealed thatK. pneumoniaeand K. oxytoca isolates,reference and type strains formed distinct cluster groups, and tentative subclusters could be established. Weconclude that(GTG)5 and ITS-PCR analysiscombined withautomated capillary electrophoresis provides promisingtools for molecular typing ofKlebsiellaisolates.

2010 Published by Elsevier B.V.

1. Introduction

Bacteria of the genus Klebsiella are important Gram negativeopportunistic pathogens that can lead to severe diseases such assepsis, pneumonia, and urinary tract infections (Brisse and Verhoef,2001; Sardan et al., 2004).-lactamases from Gram-negative bacteriainactivate penicillins and cephalosporins by hydrolysis. So far, morethan 350 -lactamases have been identied and on the basis of theiramino-acid sequences, substrate and inhibitor proles, Gram-negative-lactamases are divided into four classes (A to D) (Ambler et al., 1991,Shah et al., 2004). Class A enzymes which include the plasmid-encodedbroad-spectrum blaTEM-and blaSHV-families, and class C enzymes, whichinclude chromosomally encoded cephalosporinases, are the mostfrequently occurring in enterobacterial species, including Klebsiella.Plasmid encoded blaCTX-M enzymes represent another importantsubgroup of class A -lactamases which hydrolyse broad-spectrum-lactam antibiotics causing an extended-spectrum-lactamase (ESBL)phenotype, which is increasingly found in enterobacterial species,including Klebsiella (Haeggman et al., 2004). Moreover, it has beenshownthat R. planticola andR. ornithinolytica(formerly K. planticola andK.ornithinolytica) colonise or infect human beings (Walckenaeret al.,2004).

Thus, molecular typing methods allowing for an unequivocal identica-tion and molecular epidemiological typing of Klebsiellaclinical isolateshave been developed (Vogel et al., 1999; Wang et al., 2008).

Klebsiella pneumoniaeand Klebsiella oxytocaexhibit a high degreeof genetic heterogeneity as demonstrated by phenotyping andgenotyping analysis (Brisse and Verhoef, 2001; Vogel et al., 1999).Methods routinely used for species identication are not able todifferentiateK. oxytoca from other indole-positive Klebsiellaspeciessuch as R. ornitholytica, R. planticola and R. terrigena (formerly K.ornitholytica, K. planticola and K. terrigena) (Monnet et al., 1991,Drancourt et al., 2001). However, on the basis of 16S rDNA and rpoBDNA sequence analyses, it has been shown that K. oxytoca isphylogenetically distant from other indole-positiveKlebsiellaspecies.Thus, the indole-positiveKlebsiellaspecies other thanK. oxytocahavebeen renamed as Raoultella species (Drancourtet al., 2001). Moleculartyping methods based on degenerated primers such as arbitrarilyprimed polymerase chain reaction (AP-PCR) and random ampliedpolymorphic DNA PCR (RAPD-PCR) are commonly used to establish aphylogenetic relationship between bacteria including Klebsiellastrains and to generate epidemiological ngerprint patterns (Vogelet al., 1999; Brisse and Verhoef, 2001; Sardan et al., 2004).

The poly-trinucleotide (GTG)5motif represents a class of conservedrepetitive sequences present in bacterial genomes (Versalovic et al.,1994). In some recent studies, (GTG)5-PCRngerprint analysis has beenused for molecular typing of Acinetobacter baumanii(Huys, et al., 2005),

Journal of Microbiological Methods xxx (2010) xxxxxx

Corresponding author. Clinical Microbiology, Molecular Biology Laboratory-DC,University Hospital, Lab 1, Floor 09, S-581 85 Linkping, Sweden.

E-mail address:[email protected](H.-J. Monstein).

MIMET-03528; No of Pages 6

0167-7012/$ see front matter 2010 Published by Elsevier B.V.

doi:10.1016/j.mimet.2010.11.019

Contents lists available at ScienceDirect

Journal of Microbiological Methods

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h

Please cite this article as: Ryberg, A., et al., Comparison of (GTG)5-oligonucleotide and ribosomal intergenic transcribed spacer (ITS)-PCR formolecular typing of Klebsiella isolates, J. Microbiol. Methods (2010), doi:10.1016/j.mimet.2010.11.019
http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019mailto:[email protected]://dx.doi.org/10.1016/j.mimet.2010.11.019http://www.sciencedirect.com/science/journal/01677012http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019http://www.sciencedirect.com/science/journal/01677012http://localhost/var/www/apps/conversion/tmp/scratch_6/Unlabelled%20imagehttp://dx.doi.org/10.1016/j.mimet.2010.11.019http://localhost/var/www/apps/conversion/tmp/scratch_6/Unlabelled%20imagemailto:[email protected]://dx.doi.org/10.1016/j.mimet.2010.11.019


2/6

Salmonella enterica (Rasschaert et al., 2005), Campylobacter concisus(Matsheka et al., 2006),Enterococcus faecium(Svec et al., 2005; Jurkovicet al., 2007),Escherichia coli (Mohapatra et al., 2007:Mohapatra et al.,2008), Streptococcusmutans(Svecetal.,2008),andfortheidenticationoflactic acid bacteria isolated fromhuman blood cultures (Svec et al., 2007).However, so far no data are available demonstrating the potential use of(GTG)5-ngerprint analysis as a molecular means to differentiateKlebsiella spp. and relatedRaoultellaspecies.

Due to the high conservation of primary and secondary structureswithin species, ribosomal RNA genes (16S, 23S and 5S) are commonlyused for bacterial identication and evolutionary studies (Gutell et al.,1994). Because of less selection pressure, the 16S23S rDNA intergenictranscribed spacer (ITS) sequence is more genetically variable andspecies-specic than that of 16S rDNA and 23S rDNA sequences (Gurtlerand Stanisich, 1996; Boyer et al., 2001). Automated ribosomal intergenicspacer analysis (ARISA) is a PCR-based technique suitable for theamplication of microbial ITS-regions. To reduce PCR biases (such asselective amplication of some templates in a mixture of DNA) duringARISA, a universal primer-set has shown to be powerful to exploremicrobial diversity and to create easy-to-analyse molecularngerprints(Cardinale et al., 2004). PCR-basedngerprint analysis methodsbased onITS-sequences have also been developed for the detection and identi-cation ofKlebsiella species (Lopes et al., 2007; Liu et al., 2008; Wang et al.,2008).

The goal of the present study was to evaluate the use of (GTG)5-PCRand ITS-PCR analysis in molecular typing ofKlebsiellaisolates. Moreover,thepossibility thatthe twoapproaches mayallow differentiation betweenbacterial strains with different ESBL genotypes was evaluated. Weconclude that (GTG)5 and ITS-PCR analysis combined with automatedcapillary electrophoresis provides a promising toolfor molecular typingofKlebsiella isolates. However, molecular typing and bacterial straindifferentiation based on ESBL genotypes was not possible.

2. Materials and methods

2.1. Susceptibility testing of K. pneumoniae clinical isolates

Phenotypic ESBL-screening and susceptibility testing was performedon all (approximately 800 isolates/year) K. pneumoniae and K. oxytoca

clinical isolates collected during 2001-and spring 2007 at the Departmentof Clinical Microbiology, University Hospital Linkping, Sweden withagardisk diffusion according to the Swedish Reference Group for Antibiotics(http://www.srga.org) as described previously (Monstein et al., 2007;Monstein et al., 2009; Trnberg et al., 2009). In brief, Cefadroxil was usedfor the screening of cephalosporin resistance, which was followed up bytesting of resistant isolates with cefotaxime and ceftazidime or directtesting with cefotaxime and ceftazidime with disk diffusion and Etest

(bioMerieux Sverige AB, Askim, Sweden). All cefotaxime and/or ceftazi-dime resistant isolates were phenotypically screened by Etest usingcefotaxime andceftazidime with andwithoutclavulanic acid(bioMerieuxSverige AB, Askim, Sweden). NineteenK. pneumoniaeand 35 K. oxytocaisolates were selected andstoredin glycerol containingNutrient-brothNo2 (Lab M, Bury, UK) at 70 C until analysis (Monstein et al., 2009;Trnberg et al., 2009).

In some cases,K. pneumoniae and K. oxytoca isolates originate fromthesame patient, collected at different occasions and showed an identicalphenotype and similar antibiotic susceptibility proles (Table 1).

2.2. Type and reference strains

Reference strainK. oxytocaK1980-K1 was kindly provided by Dr. D.Livermore, Health Protection Agency, Antibiotic Resistance Monitoringand Reference Laboratory, London, UK. Reference and type strains werepurchased from the American Type Culture Collection (ATCC; http://www.atcc.org) or theCultureCollectionUniversity of Gothenburg(CCUG;http://ccug.se); K. pneumoniae ATCC 700603 K. pneumoniae CCUG 54718,K. pneumoniaespp.pneumoniaeCCUG 225T,K. pneumoniaespp.ozaenaeCCUG 15938T,K. pneumoniaespp. rhinoscleromatisCCUG 417T,K. oxytocaCCUG15717T, Raoultella terrigena CCUG12372T, R. planticolaCCUG 15718,R. ornithinolytica CCUG 26769T and Enterobacter aerogenes CCUG1429T.A.baumanii clinical isolateNo 200was provided by theClinical MicrobiologyLaboratory, University Hospital, Linkping, Sweden.

2.3. Multiple displacement amplication of bacterial DNA

To performconcurrentgenotypinganalysis omitting multiple bacterial

culturing, sufcient amounts of bacterial DNA were produced by multipledisplacementamplication as describedelsewhere(Monstein etal., 2005;

Table 1

Klebsiellaclinical isolates taken at different time-points from the same patient.

Strain Patient ID Isolate No bla-genotype Origin Collection year (GTG)5cluster location (Fig. 2)

K. pneumoniae 1 33 SHV Urine 2004-March 12 I43 SHV Wound secrete 2004-May 28

K. pneumoniae 2 137 SHV Urine 2006-February 23 I138 SHV Rectum 2006-February 23143 SHV Rectum 2006-February 28

K. pneumoniae 3 179 CTX-M/SHV Urine 2006-October 5 I185 CTX-M/SHV Urine 2006-October 23

K. pneumoniae 4 184 LEN Wound secrete 2006-October 21 Outlier (III)

205 LEN Wound secrete 2007-February 8K. oxytoca 5 30 K1 Urine 2004-February 6 II-D63 K1 Urine 2004-October 18

K. oxytoca 6 59 K1 Nephrostomy right 2004-October 4 Outlier (III)60 K1 Nephrostomy left 2004-October 4

K. oxytoca 7 81 K1 Urine 2005-March 2 II-C84 K1 Urine 2005-March 10

K. oxytoca 8 140 K1 Urine 2006-February 23 II-B141 K1 Blood 2006-February 23

K. oxytoca 9 162 K1 Wound secrete 2006-July 27 II-B168 K1 Wound secrete 2006-August 15

K. oxytoca 10 177 K1 Wound secrete 2006-October 2 II-A178 K1 Wound secrete 2006-October 2

K. oxytoca 11 91 K1 Urine 2005-April 8 II-A142 K1 Urine 2006-February 27 II-A169 K1 Urine 2006-August 22 II-A190 K1 Urine 2006-November 22 II-A199 K1 Urine 2007-January 7 II-A

2 A. Ryberg et al. / Journal of Microbiological Methods xxx (2010) xxxxxx

http://www.srga.org/http://www.atcc.org/http://www.atcc.org/http://ccug.se/http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019http://ccug.se/http://www.atcc.org/http://www.atcc.org/http://www.srga.org/


3/6

Monstein et al., 2009; Trnberg et al., 2009). In brief, scrapings of frozenbacterial cultures (1 l) were added to Sample buffer from an IllustraGenomiPhi V2 DNA amplication kit as recommended by the manufac-turer (GE-Healthcare, Uppsala, Sweden). Uponcompletionof thereaction,80 l ultrapure water was added to each tube. The product was used astemplate-DNA in down-stream applications.

2.4. (GTG)5-PCR based analysis

Initially, a PCR annealing temperature gradient assay was performedusing 2 l MDA-amplied DNA derived fromK. pneumoniaeCCUG 225T

and K. oxytoca CCUG 15717T DNA, 50 pmol/reaction (GTG)5-primer(Mohapatra et al., 2007), a nal volume of 25 l HotStarTaq Master mix(Qiagen, Hilden, Germany), MicroAmp optical 96-well reaction plates(Applied Biosystems,Stockholm, Sweden) and an Eppendorf Mastercyclergradient (Eppendorf, VWR International, Stockholm, Sweden). PCRconditions were as follows: initial denaturation step at 95 C for 15 min;30 cycles of denaturation at 95 C for30 s, annealingtemperature gradientat40 Cto 60C for 30s; extension at72 Cfor 3 min, followedby a nalextension step at 72 C for 10 min.K. pneumoniaeandK. oxytocastrainswere PCR amplied and analysed as described above using an annealingtemperature of 51 C. Subsequently, PCR amplicons (2 l) were diluted in18 l QX DNA dilution buffer and analysed on a QIAxcel capillaryelectrophoresis system using a QIAxcel DNA High resolution kit (Qiagen,Hilden, Germany). The electropherograms were exported as virtual gelimages and saved as tif-les. Analysis was performed by the BioNumericssoftware version 5.0 (Applied Maths, Saint-Martens-Latem, Belgium)using cosine coefcient optimisation of 3% and Neighbour joining.

2.5. ITS-PCR based analysis

The 16S23S intergenic transcribed spacers were amplied in a nalvolume of 25 l using an Illustra Ready-To-Go Bead kit (GE Healthcare,Uppsala, Sweden), 10 pmol of each M13-sequence tagged (M13-ITS.SE:TGTAAAACGACGGCCAGTGTCGTAACAAGGTAGCCGTA) and T7-sequencetagged (T7-ITSReub.AS: TAATACGACTCACTATAGGGGCCAAGGCATCCACC)modied primer (Cardinale et al.,2004), 1 l MDA-DNA andan Eppendorf

Mastercycler Gradient Thermocycler (Eppendorf, VWR International,Stockholm, Sweden). PCR conditions were as follows: initialdenaturationstep at 94 C for 5 min; 30 cycles of denaturation at 94 C for 30 s,annealing temperature 55 C for 30 s; extension at 72 C for 2 min,followed by anal extensionstepat 72 Cfor 10 min.PCR amplicons(2 l)were diluted in 18 l QX DNA dilution buffer and analysed on an QIAxcel

capillary electrophoresis system using a QIAxcel large fragment kit(Qiagen, Hilden, Germany). The electropherograms were exported asvirtual gel images (saved as tif-les) and used to construct a curve-baseddendrogram by the Neighbour joining method (cosine coefcient,optimisation at 3%) using BioNumerics version 5.0 (Applied Maths,Saint-Martens-Latem, Belgium).

3. Results

3.1. (GTG)5-PCR based analysis

The PCR annealing temperature gradient assay revealed an optimalannealing temperature of 51 C at an extension time of 3 min at 72 Cin each cycle. K. pneumoniae DNA generates a more complexngerprint pattern as compared to K. oxytoca DNA, allowing formolecular typing discriminating between these two strains (Fig. 1).Computerised densitrometric (GTG)5-PCR analysis revealed that theclinical isolates and reference strains could be divided into cluster Iand II and outliers (cluster III) (Fig. 2) at a similarity level of 70%.

Most of the K. pneumoniaeisolates, including reference strains K.pneumoniaeCCUG 54718 and the three K. pneumoniae type strains,comprise cluster I. K. pneumoniae isolate Nos 184 and 205, whichoriginate from the same patient having a blaLEN-genotype, and K.pneumoniaeisolate No 92 having a blaOKP-genotype fell outside thetwo major clusters. A majority of the K. oxytocaisolates, the referencestrain K. oxytocaK1980-K1 and type strain K. oxytoca CCUG 15717T

comprise cluster II which could be divided into tentative subclustersAD.K. oxytoca isolate No 59, 60 (right and left nephrostomy), No 210andA. baumaniiisolate No 200, and the Raoultellatype strains also felloutside clusters I and II (Fig. 2).

K. pneumoniae and K. oxytoca isolates, which originate from thesame patient but taken at different time points and in some cases ofdifferent origin (Table 1), clustered closed together exceptK. oxytocaisolate Nos 59 and 60, and K. oxytoca isolate No 142 which wasexpected to form a group together with isolate Nos 91, 169, 190, and199 (Table 1;Fig. 2).

3.2. ITS-PCR based analysis

ITS-PCR based analysis allowed for molecular typing of Klebsiellastrains at the species level except for strain K. pneumoniaeisolate No 92having a blaOKP-genotype which clusters closer to K. oxytoca. TheK. pneumoniaeisolates and reference strains comprise cluster I including

Fig. 1.(GTG)5-primer annealing temperature gradient optimisation. M represents a virtual DNA size marker (bp) used in the QIAxcel capillary electrophoresis system. Upper panelrepresentsK. oxytocaCCUG 15717T and the lower panelK. pneumoniaeCCUG 225T. Arrows indicate the (GTG)5-primer annealing temperature chosen (51 C) generating K. oxytoca

andK. pneumoniae-specic ngerprints.

3A. Ryberg et al. / Journal of Microbiological Methods xxx (2010) xxxxxx

http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019http://localhost/var/www/apps/conversion/tmp/scratch_6/image%20of%20Fig.%E0%B1%80


4/6

K. pneumoniae isolate Nos 184 and 205 having a blaLEN-genotype (Fig. 3).Similarly, K. oxytoca isolates and reference strains comprise cluster II,

including K. pneumoniae isolate No 92 having a blaOKP-genotype.

Apparently, ITS-PCR generated ngerprint patterns do not allow for aseparation ofK. oxytocaisolates at thesubspecieslevelas shownfor isolate

Nos 91, 142, 169, 190 and 199 (Table 1; Fig. 3). In contrast, K. pneumoniae

Fig. 2.(GTG)5-PCR dendrogram derived from 19 K. pneumoniae, 35 K. oxytocaclinical isolates,Klebsiellaspp.,E. aerogenes,and Raoultellaspp. strains. Dashed line indicates 70%similarity level;IIIindicate twomajorcluster,and IIIan outliergroup. A to D representa tentativesubcluster at a similaritylevelof 70%. Bacterialphenotypes, ESBL genotypes(CTX-M, K1, SHV, LEN and OKP) of the clinical isolates were established in previous studies (Monstein et al., 2009; Trnberg et al., 2009). ESBL-genotypes in R. planticola(PLA) andR.ornithinolytica(ORN) type strains have been described earlier (Walckenaer et al., 2004). Patient ID 111: multiple samples taken from 11 patients at different occasions (Table 1).




5/6

isolate Nos 33 and 43, isolate Nos 137, 138 and 143, and isolate Nos 179and 185 clustered pair-wise within cluster I, respectively (Fig. 3).Raoultella species,A. baumanii, andE. aerogenesare outliers (cluster III),distinct from theK. pneumoniaeandK. oxytocacluster I and II (Fig. 3).

4. Discussion

Biochemical tests including API-20E may not always be adequatephenotypical methods for typing Klebsiella species in clinicalmicrobiology laboratories since several species share similar bio-

chemical proles (Brisse and Verhoef, 2001; Hansen, et al., 2004;

Alves et al., 2006). Although many of the currently used moleculartypingmethods are PCR-based assays, theamount of isolated bacterialDNA may be a limiting factor for multiple molecular typing assaysfrom the same DNA sample. Therefore, using MDA-amplied bacterialDNA derived from few bacterial cells may help to accomplish bacterialgenotyping at reasonable costs and time. This is in accordance withsimilar studies where it was shown that MDA-amplied DNA derivedfrom a few bacterial cells and human biopsy specimens provided areliable and representative source for multiple molecular typinganalysis (Monstein et al., 2005; Groathouse et al., 2006; Ryberg et al.,

2008; Trnberg et al., 2009).

Fig. 3.ITS-PCR dendrogram derived from 19K. pneumoniae, 35 K. oxytocaclinical isolates,Klebsiellaspp.,E. aerogenes,andRaoultellaspp. reference strains. III indicates two major

cluster representingK. pneumoniaeandK. oxytocastrains, and III represents outliers at a similarity level of 60%, respectively. Bacterial phenotypes, ESBL genotypes (CTX-M, K1, SHV,LEN and OKP) of the clinical isolates were established in previous studies (Monstein et al., 2009; Trnberg et al., 2009). ESBL-genotypes inR. planticola(PLA) andR. ornithinolytica(ORN) type strains have been described earlier (Walckenaer et al., 2004). Patient ID 111: multiple samples taken from 11 patients at different occasions (Table 1).

5A. Ryberg et al. / Journal of Microbiological Methods xxx (2010) xxxxxx



6/6

By means of (GTG)5and ITS-PCR analysis we were able to separateKlebsiella isolates and reference strains at the species level (Fig. 2).Moreover, these methods appear to have the potential to separate K.pneumoniae and K. oxytoca isolates into specic clusters. (GTG)5-PCRanalysis has not been evaluated previously for molecular typing ofKlebsiella species and, therefore, a comparison of the present results withtheliterature wasnot possible. While (GTG)5-PCR analysis appears tobe apromisingtoolfor molecular typing compared to ITS-PCRanalysis, neither

of the two approaches seem to be able to differentiate bacterial strainswith different ESBL genotypes within one bacterial species.Ourstudyshowsthat K. pneumoniae andK. oxytoca,whicharethemost

frequently isolated pathogenic Klebsiella species, can be discriminatedcondently by ITS-PCR analysis using universal ITS-primers (Cardinaleet al., 2004). However, molecular typing at the subspecies level appearsnot to be possible with this method (Fig. 3).

From a practical point of view, many laboratory workers areconcernedabout the use of ethidium-bromide stained agarose gels, which is a health-risk factor, andalso a time consuming method. In agreement with previousstudies from our laboratory (Ryberg et al., 2008; Monstein et al., 2010) weshow that the use of automated capillary electrophoresis (CE), which is arapid technique, successfully replaced ethidium-bromide stained agarosegelelectrophoresis in (GTG)5- andITS-PCR analysis. Theagarosegelscanbedirectly substituted since analysis of fragment-length variations using theautomated CE-system described does not require uorescently-labelledprimers in PCR amplication assays (www.qiagen.com).

In conclusion, (GTG)5 and ITS-PCR analysis combined withautomated capillary electrophoresis provides a promising tool formolecular typing ofKlebsiellaisolates. Further studies are required toassess the potential use of (GTG)5 and ITS-PCR analysis as a tool inepidemiological typing ofKlebsiellaisolates.

Acknowledgments

We are grateful to Drs. Jon Jonasson, Lennart Nilsson and MariaTrnberg for constructive discussions and critical reading of themanuscript. This study was supported by the Molecular BiologyProgram, County Medicine stergtland (DC), Sweden.

References

Alves,M.S.,Dias, R.C., de Castro, A.C., Riley,L.W., Moreira, B.M., 2006.Identication of clinicalisolates of Indole-positive and Indole-negative Klebsiella spp. J. Clin. Microbiol. 44,36403646.

Ambler, R.P., Coulson, A.F., Frere, J.M., Ghuysen, J.M., Joris, B., Forsman, M., Lvesque, R.C.,Tiraby, G.,Waley, S.G., 1991. A standardnumbering scheme forthe class A -lactamases.Biochem. J. 276 (Pt 1), 269270.

Boyer, S.L., Flechtner, V., Johansen, J.R., 2001. Is the 16S23S rRNA internal transcribedspacerregion a goodtoolfor usein molecularsystematicsand population genetics?A case study inCyanobacteria. Mol. Biol. Evol. 18, 10571069.

Brisse, S., Verhoef, J., 2001. Phylogenetic diversity ofKlebsiella pneumoniaeand Klebsiellaoxytoca clinicalisolates revealedby randomlyamplied polymorphicDNA,gyrAandparCgenes sequencing and automated ribotyping. Int. J. Syst. Evol. Microbiol. 51, 915924.

Cardinale, M., Brusetti, L., Quatrini, P., Borin, S., Puglia, A.M., Rizzi, A., Zanardini, E.,Sorlini, C., Corselli, C., Daffonchio, D., 2004. Comparison of different primer sets foruse in automated ribosomal intergenic spacer analysis of complex bacterial

communities. Appl. Environ. Microbiol. 70, 61476156.Drancourt, M., Bollet, C., Carta, A., Rousselier, P., 2001. Phylogenetic analyses of

Klebsiellaspecies delineate Klebsiellaand Raoultellagen. nov., with description ofRaoultella ornithinolyticacomb. nov.,Raoultella terrigenacomb. nov. and Raoultella

planticolacomb. nov. Int. J. Syst. Evol. Microbiol. 51, 925932.Groathouse, N.A., Brown, S.E., Knudson, D.L., Brennan, P.J., Slayden, R.A., 2006. Isothermal

amplication andmolecular typing of the obligateintracellularpathogen Mycobacteriumlepraeisolated from tissues of unknown origins. J. Clin. Microbiol. 44, 15021508.

Gurtler, V., Stanisich, V.A., 1996. New approaches to typing and identication ofbacteria using the 16S23S rDNA spacer region. Microbiol 142 (Pt 1), 316.

Gutell, R.R., Larsen, N., Woese, C.R., 1994. Lessons from an evolving rRNA: 16S and 23SrRNA structures from a comparative perspective. Microbiol. Rev. 58, 1026.

Haeggman, S., Lfdahl, S., Paauw, A., Verhoef, J., Brisse, S., 2004. Diversity and evolutionof theclass A chromosomal-lactamase gene in Klebsiella pneumoniae. Antimicrob.Agents Chemother. 48, 24002408.

Hansen, D.S., Aucken, H.M., Abiola, T., Podschun, R., 2004. Recommended test panel fordifferentiation of Klebsiella species on the basis of a trilateral interlaboratoryevaluation of 18 biochemical tests. J. Clin. Microbiol. 42, 36653669.

Huys, G., Cnockaert, M., Vaneechoutte, M., Woodford, N., Nemec, A., Dijkshoorn, L.,Swings, J., 2005. Distribution of tetracycline resistance genes in genotypicallyrelated and unrelated multiresistant Acinetobacter baumaniistrains from differentEuropean hospitals. Res. Microbiol. 156, 348355.

Jurkovic, D., Krizkova, L., Sojka, M., Takacova, M., Dusinsky, R., Krajcovic, J., Vandamme,

P., Vancanneyt, M., 2007. Genetic diversity ofEnterococcus faecium isolated fromBryndza cheese. Int. J. Food Microbiol. 116, 8287.Liu, Y.,Liu, C.,Zheng,W., Zhang, X.,Yu, J.,Gao, Q.,Hou, Y.,Huang, X.,2008.PCR detection

ofKlebsiella pneumoniae in infant formula based on 16S-23S internal transcribedspacer. Int. J. Food Microbiol. 125, 230235.

Lopes, A.C., Rodrigues, J.F., Clementino, M.B., Miranda, C.A., Nascimento, A.P., de MoraisJunior, M.A., 2007. Application of PCR ribotyping and tDNA-PCR for Klebsiellapneumoniaeidentication. Mem. Inst. Oswaldo Cruz 102, 827832.

Matsheka, M.I., Lastovica, A.J., Zappe, H., Elisha, B.G., 2006. The use of (GTG)5oligonucleotide as an RAPD primer to type Campylobacter concisus. Lett. Appl.Microbiol. 42, 600605.

Mohapatra, B.R., Broersma, K., Mazumder, A., 2007. Comparison of ve rep-PCRgenomic ngerprinting methods for differentiation of fecal Escherichia coli fromhumans, poultry and wild birds. FEMS Microbiol. Lett. 277, 98106.

Mohapatra, B.R., Broersma, K., Mazumder, A., 2008. Differentiation of fecal Escherichiacolifrom poultry and free-living birds by (GTG)5-PCR genomic ngerprinting. Int. J.Med. Microbiol. 298, 245252.

Monnet, D., Freney, J., Brun, Y., Boeufgras, J.M., Fleurette, J., 1991. Difculties in typningKlebsiellastrains of clinical origin. Zentralbl. Bakteriol. 274, 456464.

Monstein, H.J., Olsson, C., Nilsson, I., Grahn, N., Benoni, C., Ahrn, S., 2005. Multipledisplacement amplication of DNA from human colon and rectum biopsies:bacterial proling and identication of Helicobacter pylori-DNA by means of 16SrDNA-based TTGE and pyrosequencing analysis. J. Microbiol. Meth. 63, 239427.

Monstein, H.J.,stholm-Balkhed,., Nilsson, M.V.,Nilsson, M., Dornbusch, K., Nilsson, L.E., 2007. Multiplex PCR amplication assay for the detection ofblaSHV, blaTEM andblaCTX-M genes inEnterobacteriaceae. APMIS 115, 14001408.

Monstein, H.J., Trnberg, M., Nilsson, L.E., 2009. Molecular identication of CTX-M andblaOXY/K1 -lactamase genes in Enterobacteriaceae by sequencing of universalM13-sequence tagged PCR-amplicons. BMC Infect. Dis. 9, 7.

Monstein, H.J., Karlsson, A., Ryberg, A., Borch, K., 2010. Application of PCR ampliconsequencing using a single primer pair in PCR amplication to assess variations inHelicobacter pyloriCagA EPIYA tyrosine phosphorylation motifs. BMC Res. Notes 3, 35.

Rasschaert, G., Houf, K., Imberechts, H., Grijspeerdt, K., De Zutter, L., Heyndrickx, M.,2005. Comparison of ve repetitive-sequence-based PCR typing methods formolecular typing ofSalmonella entericaisolates. J. Clin. Microbiol. 43, 36153623.

Ryberg, A., Borch, K., Sun, Y.Q., Monstein, H.J., 2008. Concurrent genotyping ofHelicobacter pylori virulence genes and human cytokine SNP sites using wholegenome amplied DNA derived from minute amounts of gastric biopsy specimenDNA. BMC Microbiol. 8, 175.

Sardan, Y.C., Zarakolu, P., Altun, B., Yildirim, A., Yildirim, G., Hascelik, G., Uzun, O., 2004.A cluster of nosocomial Klebsiella oxytoca bloodstream infections in a universityhospital. Infect. Contr. Hosp. Epidemiol. 25, 878882.

Shah, A.A., Hasan, F., Ahmed, S., Hameed, A., 2004. Extended-spectrum -lactamases (ESBLs):characterization, epidemiology and detection. Crit. Rev. Microbiol. 30, 2532.

Svec, P., Vancanneyt, M., Seman, M., Snauwaert, C., Lefebvre, K., Sedlacek, I., Swings, J.,2005. Evaluation of (GTG)5-PCR for identication of Enterococcus spp. FEMSMicrobiol. Lett. 247, 5963.

Svec, P., Sevcikova, A., Sedlacek, I., Bednarova, J., Snauwaert, C., Lefevre, K., Vandamme,P., Vancanneyt, M., 2007. Identication of lactic acid bacteria isolated from humanblood cultures. FEMS Immunol. Med. Microbiol. 49, 192196.

Svec,P., Novakova, D., Zackova,L., Kukletova, M., Sedlacek,I., 2008. Evaluation of (GTG)5-PCRfor rapid identication ofStreptococcus mutans. Antonie Leeuwenhoek 94, 573579.

Trnberg, M., Nilsson, L.E., Monstein, H.J., 2009. Molecular identication ofblaSHV, blaLENandblaOKP -lactamase genes in Klebsiella pneumoniae by bi-directional sequencing ofuniversal SP6 and T7-sequence tagged blaSHV-amplicons. Mol. Cell. Probes 23, 195200.

Versalovic,J., Schneider, M.,De Bruijn,F.J.,Lupski,J.R., 1994. Genomicngerprinting ofbacteria

using repetitive sequence based PCR (rep-PCR). Methods Mol. Cell. Biol. 5, 25

40.Vogel, L., Jones, G., Triep, S., Koek, A., Dijkshoorn, L., 1999. RAPD typing ofKlebsiellapneumoniae, Klebsiella oxytoca, Serratia marcescens and Pseudomonas aeruginosaisolates using standardized reagents. Clin. Microbiol. Infect. 5, 270276.

Walckenaer, E., Poirel, Leon-Guibout, L., Nordmann, P., Nicolas-Chanoine, M.H., 2004.Genetic and biochemical characterization of the chromosomal class A-lactamasesofRaoultella (formerly Klebsiella) planticola and Raoultella ornithinolytica. Anti-microb. Agents Chemother. 48, 305312.

Wang,M.,Cao,B.,Yu,L., Liu, Q., Gao,Q., Wang,L.,Feng, L., 2008. Analysisof the 16S23SrRNA gene internal transcribed spacer region in Klebsiellaspecies. J. Clin. Microbiol.46, 35553563.


http://www.qiagen.com/http://dx.doi.org/10.1016/j.mimet.2010.11.019http://dx.doi.org/10.1016/j.mimet.2010.11.019http://www.qiagen.com/

corrected proof

Documents