content sr. title page no. f1(2).pdfplant pathogen introduction: trichoderma species is a most...
TRANSCRIPT
1
Content Sr. No.
Title Page No.
1 Phylogenetic classification systems. 2-3 2 Extraction of fungal genomic DNA. 4-6 3 Isolation and culture of zoosporic fungi
by baiting Technique. 7
4 Slide culture technique of fungi. 8-9 5 Biocontrol potential of Trichoderma
against plant pathogenic fungi. 10-11
6 Production and estimation of citric acid from Aspergillus niger.
12
7 Production of Penicillin from Penicillium sp.
13-14
8 Determination of AM fungal diversity from soil and staining of AM colonized roots.
15-19
9 Isolation and culture of fungi from rhizosphere.
20
10 Various Media for culturing of Fungi. 21-22 11 Practical: To prepare temporary mounts
of the fungal specimen and fungal culture.
23
11 Use full links 24-25 12 Bibliography 26-28
2
1. Classification of fungi:
A higher-level phylogenetic classification of the Fungi by Hibbett et al. (2007)
Fig.: Phylogeny and classification of Ascomycota and Basidiomycota.
3
Kirk et al. (2008)
Kingdom Fungi
Phylum Ascomycota
Phylum Basidiomycota
Phylum Chytridiomycota
Phylum Glomeromycota
Phylum Microsporidia
Phylum Zygomycota
Kingdom Chromista, fungal phyla
Phylum Hyphochytriomycota
Phylum Labyrinthulomycota
Phylum Oomycota
Kingdom Protozoa, lineages with fungal phyla
Ramicristates (incl. classes Protostelia, Myxogastria and
Dictyostelia)
Heterolobosea (incl. order Acrasida)
Copromyxida (Copromyxa)
Fonticulida (Fonticula)
Plasmodiophorida
4
Practical: 2 Extraction of fungal genomic DNA: (Amir et al. 2015)
Extract the fruiting body/fungal culture (200 mg) in liquid
nitrogen. Homogenize the powder by adding 1 ml of lysis buffer
(100mM Tris HCL (pH-8.00); 50mM EDTA; 3% SDS). Centrifuge at
13000 rpm for 10 min. To the supernatant add equal volume of
phenol:chloroform:Isoamyl alcohol (25:24:1) and shake well. Again
centrifuge at 13000 rpm for 10 min. Separate the upper aqueous
layer in another tube and add equal volume of ethanol and keep at
20°C for 20 min. Again centrifuge it at 10,000 rpm for 10 min.
Remove supernatant and wash the pellet with 200ul 70 % ethanol.
Again centrifuge it at 10,000 rpm for 10 min. Remove the
supernatant and dry the pellet. After complete removal of ethanol,
dissolve the pellet in 20μl of 1X TE buffer. Add 2μL of RNase and
incubate it at 37°C for 30 min on dry bath. 2μL DNA will be run on to
0.8% agarose gel electrophoresis. Observe the gel under UV trans
illuminator system.
PCR amplification:
PCR master mix 12.5μL
ITS1 1μL
ITS4 1μL
Sterile dH2O 7.5μL
DNA template 3 μL
Total 25μL
5
PCR cycle conditions (For ITS1-ITS4):
Initial denaturation 95°C 5 min
Denaturation 95°C 1 min
30 cycles Annealing 58°C 45 sec
Extension 72°C 1 min
Final Extension 72°C 7 min
Hold 4°C Hold
Primer sequences for the DNA amplification:
ITS 1 Forward: 5' TCCGTAGGTGAACCTGCGG 3'
ITS 4 Reverse: 5' TCCTCCGCTTATTGATATGC 3'
Purification of PCR product:
Add 2 volumes of DNA binding buffer NT1 to the PCR product and
transfer it to the provided column.
Centrifuge at 13,000rpm for 1 min.
Discard the flow-through and add 600μL of NT3 wash buffer to
the column.
Centrifuge at 13,000 rpm for 1 min.
Discard the flow through and centrifuge again for 1 min
Place the column in sterile 1.5mL Eppendorf tube.
Add EB buffer or warm MilliQ water (20-30 μL) to the column and
incubate for 2-3 min.
Centrifuge at 13,000 rpm for 1 min 30 sec.
6
Sequencing of PCR product:
Sequencing will be done by Sanger sequencing method.
Identification by using NCBI:
The sequence will be aligned and compared by BLAST search in NCBI
(National Centre for Biotechnology Information) nucleotide
database.
Consensus sequences:
Make a consensus sequences by using software’s: Reverse
complement and Clustal omega.
Phylogenetic analysis by using MEGA 7 software:
Phylogenetic analysis will be carried out to establish the phylogenetic
placement of our collected isolates. Reference sequences will be
selected from the relevant literature and Genebank. Alignment will
be performed using CLUSTAL W and the phylogenetic analysis will be
performed by using the Neighbor-Joining method by Mega7 software
(Saitou and Nei 1987, Felsenstein 1985, Tamura and Nei 1993, Kumar
et al. 2016).
7
Practical 3: Isolation and culture of zoosporic fungi by baiting
Technique.
The members of Saprolegniaceae are most ubiquitous in water
bodies.
Requirements:
Water samples in sterile bottles.
Baits (hemp, mustard seeds, grass leaves, house or drosophila flies,
termite, wings, cellophate, pollen grain of conifer, snake skin, white
human hair).
Sterile petri dishes, sterile distilled water, potato dextrose agar
medium, forceps, sterile tissue paper etc.
Procedure:
Bring the water sample from pond in beaker.
Add some bait in the water sample.
Incubate the water sample at 27°C for 3-6 days.
Grow good colonies on the baits.
The colonies are transferred to sterile culture dish, each
containing 25 ml of sterile tap water and 25 ml of sterile
distilled water.
If no pond are nearby then some soil ½ inches below the
surface can be collected and poured in beaker containing
autoclaved distilled water.
8
Practical 4: Slide culture technique of fungi.
Requirements:
Petri dish, Slide, Coverglass, PDA medium, Glass rod, Glycerine etc.
Procedure:
Slide culture results in sporulation characteristics where
organism remains relatively unchanged.
Fungi growing on a block of agar are sandwiched between a
glass slide and a cover slip in a moist chamber (Figure 1).
Prepare Petri dish with agar suitable for organism to be grown;
use about 15 ml of agar per 100 mm dish. Cut solidified
medium rapidly into 1 cm squares using a sterile knife or
dissecting needle and a sterile glassrod.
Place a bent glass rod on a filter paper disc in the bottom of a
Petri dish, put a slide, cover and sterilize it.
Introduce sterile water sufficient enough to moisten the filter
paper (with 5% glycerine, if fogging occurs on slide).
Place agar block on slide, using aseptic condition throughout.
Inoculate the fungi on four sides of the agar block with spores
or mycelium.
Place a sterile cover slip centrally upon the agar block.
Incubate under temperature and light condition suitable to
sporulation of the organisms. (Add more sterile water if filter
paper dries).
Lift cover slip carefully and discard agar block.
Place drop of lactophenol on a clean slide and add the cover
slip with the fungus growth adhering to it.
9
Figure 1: Diagram of a slide culture in petri-plates as moist
chamber.
Precautions:
Incubate the petri dishes in dark to discourage algal blooms.
Change the water frequently to avoid anaerobic condition and for
avoiding the growth of bacteria and protozoans.
Baits in petri plates should be shallowly covered with sterile
water.
Several baits may be used at a time to have a great diversity of
fungi.
10
Practical 5: Study the Antagonistic effect of Trichoderma viride to
the Pathogenic Fungi by dual Culture Method. (Morton and
Straube, 1955).
Requirements:
PDA medium,
Trichoderma viride
Plant pathogen
Introduction:
Trichoderma species is a most common fungal biological control
agent that inhibits pathogens by cell wall degrading enzymes like
Chitinase and glucanase. They play major role in antagonistic
mechanism of Trichoderma sp. against wide range of fungal
pathogens.
Requirements:
PDA plates, Trichoderma culture, Fusarium oxysporum culture.
Procedure:
A mycelial disc (9mm diameter approx.) obtained from peripheral
region of 3-5 days old culture of tested fungi and T. viride will be
placed simultaneously on periphery, about 1 cm from the edges
of petri-plate (9mm dia.) at the opposite sides.
The petri-plate containing the PDA medium inoculated with
tested pathogen alone will serve as a control.
All plates are incubated at 28°C and measurement will be taken
after 5 days.
At the end of incubation period, radial growth will be measured.
11
Observation:
The % inhibition growth of tested pathogens in presence of T. viride
will be calculated over control.
Per cent inhibition of the pathogen over control was calculated by
the formula given by Nene and Thapliyal (1982).
I (%) = (C-T)/ C x 100
I = Percent growth inhibition
C= Growth in control (monoculture)
T= Growth in treatment (dual culture)
Fusarium oxysporum
Trichoderma viride
12
Practical 6: Production and estimation of citric acid from Aspergillus
niger (HailemariamFeleke, 2010).
Requirements:
PDA broth medium, Aspergillus niger strain, Spectrophotometer,
Unhydrous citric acid.
Procedure:
Citric acid estimation
The broth culture is filtered to separate mycelia, and the filtrate
will be used for estimation.
The citric acid estimation will be done by using
spectrophotometer at 420nm, after adding pyridine and acetic
anhydride.
For each 1ml of sample, 1.3 ml of pyridine and 5.7ml of acetic
anhydride will be added to develop color (Marrier and Boulet,
1958).
Citric acid standard will be prepared as follows: Anhydrous
citric will be used to prepare a stock solution (50mg/ml) which
is stable for at least one year at 0°C.
Standards prepared from the stock solution are stable for one
month at 00C. Using dilution rule, M1V1=M2V2.
To make 0.3mg/lm, 0.25mg/ml, 0.2gm/ml, 0.15gm/ml,
0.1mg/ml and 0.05gm/ml citrate solution, 60μl,50μl,
40μl,30μl,20μl and 10μl per 10ml distilled water will be used
respectively.
13
Practical 7: Production of Penicillin from Penicillium sp.
Requirements: Penicillium culture, PDA broth medium, Brown sugar,
Nutrient Agar medium etc.
Procedure:
Culture the Penicillium sp.on PDA medium.
Grow the Penicillium on PDA broth medium (50 ml medium in 250
ml flask) with and without brown sugar (3gm/100 ml).
Incubate the flask at 25-280 C for 7-14 days.
Observation: Observe the flask for development of golden yellow
colour in the medium or in droplets on the mycelium indicating the
production of Penicillin.
Antibiotic sensitivity test.
Antibiotic sensitivity performs by agar diffusion method which
design to determine the growth inhibition of microorganism by
antibiotic. The resulting value is called minimal inhibitory
concentration (MIC) which is determine by measuring diameter of
growth inhibition zone surrounding the antibiotic disc.
Requirements: 28 hr. Nutrient Broth cultures of bacteria, culture
filtrate of Penicillium sp., Nutrient Agar plate (N.A.), filter disc, sterile
cotton, and solutions of Penicillin of known concentration.
14
Procedure
Inoculate the Bacterial suspension culture on N.A. medium by
using sterile cotton.
Allow the agar surface to dry for 5 min.
Pick the sterile filter paper disc and dip it in the Penicillium
culture filtrate.
Place the disc on the agar surface in the plate.
Place the sterile disc on agar plate as a control.
Repeat the steps with other concentrations of Penicillin.
Incubate all the plate at 370C for 24-48 hrs.
Observations: Examine all the plates for zone of inhibition
surrounding the disc.
15
Practical 8: Determination of AM fungal diversity from soil and
staining of roots for AM colonization.
Osmolyteaccumulation
0
1
2
3
4
5
C AM
Ton
/Ha.
Bulb Yield22%
AM fungi
P uptake
Abiotic stress Biotic stress
Key Functions
Plant growth
and yield
(Borde et al 2009)
(Fig.: Evelin et al 2009)
(Fig: Roy-Borde et al 2011)
(Fig.: M.J Pozo et al 2009)
Isolation of AM fungal spore by wet sieving and Decanting
methods: (Gerdemannand Nicolson 1963).
Requirements:
Rhizospheric soil sample, 500 ml beaker, sieves 710 µm, 250/µm, 75
µm, 45 µm, water, funnel, whatman filter paper.
Procedure:
Take 200ml water in 500 ml beaker.
Add 50 gm of rhizospheric soil and mix well until all soil aggregate
disperses and leaves a uniform suspension.
Allow the heavier particles to settle down.
16
Decant most of the suspension through a 710µm sieve to remove
large organic matter.
Decant the suspension through 250µm, 75µm and 45µm sieves
consequently.
Collect all the residues on 45µm sieve.
Wash the residues with water and filter it by using whatman filter
paper to collect the spores.
Observation and results: Observe the AM fungal spore and identify
the genera based on color size, shape, shape of hyphae attachment
by referring Manual Schenck and Perez (1990).
Observations of intact spore
A: Spore colour; B: Spore diameter (for globose spore); C: Composite
spore wall thickness; D: Attachment present? Yes/No. If no, go to E,
E: Spore contents; F: Spore with mantle or other surface hyphae?
Yes/No. If no, go to G
1) Width of hyphae: 2) Colour of hyphae: 3) Hyphae sinous?
Yes/No. If no, go to G
17
Observations on broken spores
A: Number of wall groups in the spore wall
B: Width of each wall group
C: Number of walls within each group
Diagrammatic representation of Isolation of AM fungal spore and
AM root colonization:
18
Determination of AM root colonization: (Phillips and Hayman1970)
Requirements:
Test tube, forceps, water bath, KOH 10%, HCL 1N, 0.05% Trypan blue
in lactophenol, 50% glycerol-water (v/v) solution for de-staining and
storage of stained roots.
Procedure:
Wash the root in sterile water.
Cut the root pieces in to 1cm length.
Wash with water and Macerate the root in 10% KOH in water-
bath for 1 hr.
Acidified the root with 1N HCL.
Wash with sterile water and stain with 0.05 % trypan-blue in
lactophenol for 1hr.
50% glycerol-water (v/v) solution for de-staining and mount with
glycerol on slide and cover with coverslip.
Observation and result: Observe the AM colonization in roots by
observing vesicles and arbuscule, also calculate Percentage of AM
root colonization.
Percentage of AM root colonization: Giovannetti and Mosse (1980).
19
Calculation of the percentage of the root length with mycorrhizal
colonization in a sample of 25 root segments (1 cm).
AM colonized roots
% AM colonization= ------------------------------------- X 100
Total No. of roots observed
20
Practical 9: Isolation and culture of fungi from rhizosphere.
Requirements:
Freshly collected roots, Czapek-Dox agar medium, petriplate, 250 ml
flask, sterile distilled water, scrap bottle, sterile polythene bag and
autoclave.
Procedure:
Collect the rhizospheric soil and roots in bag.
Add 10 gm soil in 100ml sterile water and shake it for 15 min. on
shaker.
Prepare serial dilution 10-2 to 10-6.
Transfer 1ml of dilutions 10-2 to 10-6 to sterile petriplates.
Pour the melted sterile Czapek-Dox medium in petriplates.
Incubate the plate for 7 days at 25°C in an inverted position.
Results: Microbial counts in rhizospheric soil per g of the soil are
calculated by formula.
No. of fungal sp./g of soil= No. of colonies/ plate x dilution factor
------------------------------------------------
Dry wt. of soil taken
21
Various Media for culturing of Fungi:
Potato Dextrose Agar
This media is used for cultivation of yeasts, fungi and moulds.
Potato (Peeled) - 200.0 gm
Dextrose - 20.0 gm
Agar - 15.0 gm
Distilled water - 1000.0 ml
pH - 5.6
Sabouraud Agar
Sabouraud agar is used for cultivation of yeasts and moulds.
Peptone - 10.0 gm
Dextrose - 40.0 gm
Agar - 15.0 gm
Distilled water - 1000 ml
pH - 5.6
Corn meal agar (CMA):
Agar - 15 gm
Corn-meal - 20gm
Distilled water - 1000ml
22
Malt extract agar:
Malt Extract : 20gm
Agar : 15gm
Glucose : 20gm
Distilled water : 1000ml
Sucrose : 200gm
Adjust pH to about 6.8 with 1M NaOH
Oatmeal agar:
Porridge oats : 30gm
Distilled water 1 litre (Simmer for 2 hours, filter out solids through
muslin, make up to 1 litre)
Agar 15gm
23
Practical: To prepare temporary mounts of the fungal specimen and
fungal culture.
Requirements:
Reagent: Lactophenol Cotton blue stain.
Equipments & Glassware: Clean glass slides, covers slips, ocular,
Bunsen-burner and transfer needles.
Theory/Principle:
Lactophenol cotton blue solution is used for fungal staining. It
contains lactic acid (20.0 ml), phenol (20 gm), glycerol (40 ml),
distilled water (20 ml) and aniline blue (0.05 gm). Glycerol gives
viscosity while phenol kills the fungal cells. Lactic acid is used for
viewing the colour. Cotton blue or aniline blue stains both the cell
wall and cytoplasm. Few drops of cotton blue stain are used for
staining purpose. After staining, the sample is observed at low, as
well as, at high power. Identifiable characteristics are noted and used
for identifying the fungal specimens.
24
Useful links:
Clustal Omega
https://www.ebi.ac.uk/Tools/msa/clustalo/
Reverse complement
https://www.bioinformatics.org/sms/rev_comp.html
Finch TV
https://softfamous.com/finchtv/
Mycobank
http://www.mycobank.org/
indexfungorum
http://www.indexfungorum.org/names/names.asp
AFTOL classification project
http://www2.clarku.edu/faculty/dhibbett/AFTOL/AFTOL.htm
NCBI
https://www.ncbi.nlm.nih.gov/
American Type Culture Collection
https://www.atcc.org/
NFCCI-Agharkar Research Institute
http://nfcci.aripune.org/service.php
MTCC
https://mtccindia.res.in/
25
NBAIM
http://nbaim.org.in/default.aspx
MCC-NCCS
Microbial Culture Collection, National Centre for Cell Science (NCCS) -
pune, India
NCIM
National Collection of Industrial Microorganisms (NCIM) - Pune, India
26
Bibliogrpahy:
Aamir S, Sutar S, Singh SK and Baghela A. 2015. A rapid and efficient
method of fungal genomic DNA extraction, suitable for PCR
based molecular methods. Plant Pathology and Quarantine. 5:
74–81.
Felsenstein J. 1985. Confidence limits on phylogenies: An approach
using the bootstrap. Evolution. 39: 783–791.
Gerdemann JW and Nicolson TH. 1963. Spores of mycorrhizal
endogone species extracted from soil by wet-sieving and
decanting. Transactions of the British Mycological Society,
p.235-244.
Giovannetti M and Mosse B. 1980.An evaluation of techniques for
measuring vesicular arbuscular mycorrhizal infection in roots.
New Phytol. 84: 489–500.
Hibbett DS, Bindera M, Bischoff JF, Blackwell M, Cannon PF, Eriksson,
OE, Huhndorf S, James T, Kirk PM, Lücking R, Thorsten Lumbsch
H, Lutzonig F, Matheny PB, McLaughlin DJ, Powell MJ, Redhead
S, Schoch CL, Spatafora JW, Stalpers JL, Vilgalys R, Aime MC,
Aptroot A, Bauer R, Begerow D, Benny GL, Castlebury LA, Crous
PW, Dai YC, Gams W, Geiser DM, Griffith GW, Gueidan C,
Hawksworth DL, Hestmark G, Hosaka K, Humber RA, Hyde KD,
Ironside JE, Kõljalg U, Kurtzman CP, Larsson KH, Lichtwardt R,
Longcore J, Miądlikowska J, Miller A, Moncalvo JM, Mozley-
Standridge S, Oberwinkler F, Parmasto E, Reeb V, Rogers JD,
Roux C, Ryvarden L, Sampaio JP, Schüssler A, Sugiyama J, Thorn
RG, Tibell L, Untereiner WA, Walker C, Wang Z, Weir A, Weiss
M, White MM, Winka K, Yao YJ and Zhang N. 2007. A higher-
27
level phylogenetic classification of the Fungi. Mycological
Research. 111: 509–547.
Kirk P, Cannon PF, Minter DW and Stalpers JA. 2008. Ainsworth and
Bisby’s “Dictionary of the Fungi” (10th edition) CAB
International, Wallingford, UK, pp 771.
Kumar S, Stecher G and Tamura K. 2016. MEGA7: Molecular
Evolutionary Genetics Analysis version 7.0 for bigger datasets.
Mol Biol and Evol. 33: 1870–1874.
Morton DJ and Straube W. 1955. Antagonistic and stimulatory effect
of microorganism upon Sclerotium rolffsii. Phytopathology. 45:
417–420.
Nene YL and Thaplial PN. 1982. Fungicides in Plant Disease Control.
Oxford and IBH Publishing House, New Delhi, pp.163.
Phillips JM and Hayman, D.S. 1970. Improved procedure for cleaning
roots and staining parasitic and vesicular arbuscular
mycorrhizal fungi for rapid assessment of infection. Trans. Brit.
Mycol. Soc. 55, 158-160.
Saitou N and Nei M. 1987. The neighbor-joining method: A new
method for reconstructing phylogenetic trees. MolBiol and
Evol. 4: 406-425.
Schenck, N.C. and Perez, Y. (1990) Manual for Identification of
Vesicular Arbuscular Mycorrhizal Fungi. (INVAM). University of
Florida, Gainesville.
Stevens and Russell B. 1974. Mycology Guidebook. INSTITUTICN
Mycological Society of America, San Francisco, Calif. National
Science Foundation, Washington, D.C. pp. 719.
28
Tamura K and Nei M. 1993. Estimation of the number of nucleotide
substitutions in the control region of mitochondrial DNA in
humans and chimpanzees. Mol Biol and Evol. 10: 512–526.
White TJ, Bruns T, Lee S and Taylor J. 1990. Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics.
In: Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T.J. (Eds.)
PCR Protocols: a guide to method and applications. Academic
Press, San Diego, pp. 315–322.