construction of hprna expression vector for silencing a...
TRANSCRIPT
![Page 1: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/1.jpg)
This thesis comprises 30 ECTS credits and is a compulsory part in the Master of Science
with a Major in Resource Recovery - Industrial Biotechnology, 120 ECTS credits
No. 2/2012
Construction of
hpRNA expression vector
for silencing a gene in
Rhizopus oryzae
Kiran Kumar Penmatsa
Bharat Balu
![Page 2: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/2.jpg)
ii
Construction of hpRNA expression vector for silencing LDHA gene in Rhizopus oryzae
Kiran Kumar Penmatsa, [email protected]
Bharat Balu, [email protected]
Master thesis
Subject Category: Technology
University of Borås
School of Engineering
SE-501 90 BORÅS
Telephone +46 033 435 4640
Examiner: Elisabeth Feuk Lagerstedt
Supervisor,name: Elisabeth Feuk Lagerstedt
Supervisor,address: School of Engineering, University of Borås
SE-50190, Borås
Date: 2012-08-28
Keywords: RNA interference, hpRNA, Silencing vector construction, Rhizopus
oryzae, Ethanol, Lactic acid
![Page 3: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/3.jpg)
iii
Acknowledgement
It’s a great privilege to express our deep gratitude to our supervisor Dr. Elisabeth Feuk-
Lagerstedt for her continuous guidance, enthusiastic encouragement and patience during the
project.
This project would not be completed on time without the support of the PhD students and
personal in the Department of Biotechnology, University of Borås. We would like to thank
Dr. Patrik Lennartsson for his valuable suggestions which have helped us in deciding the
alternative methods for solving technical problems encountered. We also want to thank Päivi
Ylitervo for her support in handling equipment in the laboratory and Johan Westman for his
supportive ideas. Kristina Laurila had been a great support for us by assisting in the lab during
the project, a hearty thanks to her.
We would also like to thank Dr. Peter Therning for all his support during thesis work.
![Page 4: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/4.jpg)
iv
![Page 5: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/5.jpg)
v
![Page 6: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/6.jpg)
vi
Abstract
Depending on the previous research on LDHA gene silencing in Rhizopus oryzae CCUG
28959 through introduction of siRNA, a integral vector was constructed by inserting two
copies of LDHA gene (by PCR cloning) in a fashion that it can express hpRNA in the
transformed fungi, which will trigger the post transcriptional degradation of targeted mRNA
through RNA degradation pathway which is known to be quelling in fungi.
The vector was successfully designed with the LDHA gene, transformed in to the host
organism, and also transferred to its progeny. This helps in maintaining stability of the
transformed cell lines. This created vector will be advantageous at this point when compared
to the use of siRNA for gene silencing, which is not a stable way. In the future, this vector can
be used for down regulating other genes of interest in R. oryzae and can also be used for
studying its effect on other metabolic pathways.
In this study, Hygromycin resistance to the R. oryzae CCUG 28959 was shown at levels up to
1000 µg/ml, which has not been reported previously.
Keywords: RNA interference, hpRNA, Silencing vector construction, Rhizopus oryzae,
Ethanol, Lactic acid
![Page 7: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/7.jpg)
vii
![Page 8: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/8.jpg)
viii
Abreviations:
adj hpRNA – adjacent hairpin RNA
AMT – agrobacterium mediated transformation
bp – base pairs
BT – Biolistic transformation
C.elegans – Caenorhabditis elegans
CBP – Consolidated bio processing
CCUG – Culture collection, University of Göteborg
cDNA – Complimentary DNA
CUT – cutinase
dsRNA – double stranded RNA
EDTA - EthyleneDiamineTetraAcetic acid
EP - electroporation
FMA – Fumaric Malic acid producing strain
GFP – Green fluoroscence protein
hpRNA – Hair pin RNA
kb – kilo base pairs
LA – Lactate producing strain
LB medium – Luria Bertani medium
LDHA – Lactate dehydrogenase gene A
miRNA – micro RNA
M.oryzae – Magnoparthy oryzae
ORF – open reading frame
PCR – Polymerase chain reaction
PEG – Polyethylene glycol
![Page 9: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/9.jpg)
vi
PMT – protoplast mediated transformation
pS1 – p silent 1
pSD1 – p silent dual 1
PtrpC – tryptophan gene promoter
qPCR – Quantitative PCR
R.oryzae – Rhizopus oryzae
RdRP – RNA dependent RNA polymerase
RISC – RNA induced silencing complex
RT PCR – Real time PCR
SDS – Sodium dodicyl sulphate
siRNA – Small interference RNA
SOC – Super optimal broth
Taq – thermus aquaticus
Tm – melting temperature
TtrpC – tryptophan gene terminator
UV – ultra violet
![Page 10: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/10.jpg)
vii
Contents
1. Introduction .................................................................................................................................. 1 2. Background ................................................................................................................................... 3
2.1 RNA interference and its application in Fungi: ....................................................................... 5 2.2 Silencing Mechanisms other than post transcriptional control: ............................................... 7 2.3 Uses and draw backs of RNA silencing: .................................................................................. 8 2.4 Studies in RNA silencing at the University of Borås ............................................................... 9
3. Aim of this study ........................................................................................................................... 9 4. Literature Review ......................................................................................................................... 9
4.1 RNA silencing vectors: ............................................................................................................ 9 4.1.1 pCAP59i and pCAP59/ADE2i: ................................................................................... 10 4.1.2 pHANNIBAL and pHELLSGATE (intron splices hpRNA expressing vectors) :....... 11 4.1.3 Vectors for finding better RNA species for triggering RNA interference: .................. 12 4.1.4 P-Silent1: ..................................................................................................................... 12 4.1.5 PSV-IRT (with inverted repeat transcription silencing constructs): ............................ 14 4.1.6 pFANTAi4 ................................................................................................................... 15 4.1.7 p Silent Dual (pSD1): .................................................................................................. 16 4.1.8 pTROYA: .................................................................................................................... 17
5. Rhizopus oryzae: .......................................................................................................................... 18 5.1 Classification: ........................................................................................................................ 18 5.2 Morphology: .......................................................................................................................... 19 5.3 Cell wall composition: ........................................................................................................... 21 5.4 Protoplast formation: ............................................................................................................. 21 5.5 Propagation: ........................................................................................................................... 22 5.6 Plasmids in Fungi:.................................................................................................................. 24 5.7 Transformation:...................................................................................................................... 25
5.7.1 Protoplast Mediated Transformation using PEG/CaCl2: ............................................. 26 6. Methods and Materials .............................................................................................................. 26
6.1 Genomic DNA extraction from R. oryzae: (Hoskins. L, 1998) ............................................. 26 6.2 Extraction of Plasmids from paper discs: .............................................................................. 27 6.3 Transformation of Competent E.coli cells using CaCl2 (Sambrook and Russell, 2001
modified) ........................................................................................................................................... 28 6.4 Vector construction: ............................................................................................................... 28
6.4.1 Primer designing: ......................................................................................................... 28 6.4.2 Gene sequence to be amplified: ................................................................................... 29
6.5 PCR: ....................................................................................................................................... 30 6.5.1 Reaction mixture concentrations used (Fisher, 2010): ................................................ 30 6.5.2 Thermal cycling parameters: ....................................................................................... 30
6.6 Agarose gel electrophoresis:(Lewis, 2001) ............................................................................ 31 6.7 Purification of PCR product: ................................................................................................. 31 6.8 Plasmid DNA Extraction from E.coli using Alkaline Lysis Method (Winstanley and Rapley,
2000) 31 6.9 Restriction digestion and Ligation: ........................................................................................ 33
6.9.1 Double digestion of PCR product and Plasmid: .......................................................... 33 6.9.2 Inactivation of Restriction enzymes that are not heat sensitive:(uregina) ................... 33 6.9.3 Ligation: ....................................................................................................................... 34
6.10 Protoplast Preparation of Rhizopus oryzae by Using Yatalase (Jahromi and Gheinani,
2011 modified) .................................................................................................................................. 34 6.11 Transformation of Rhizopus oryzae by the Calcium Chloride/Polyethylene .................... 35 6.12 Sub culturing of transformed R. oryzae ............................................................................ 36
![Page 11: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/11.jpg)
viii
6.13 Primer design for amplifying LDHA gene along with cutinase intron: ............................ 36 7. Results and Discussion ............................................................................................................... 38
7.1 LDHA gene amplification through PCR: ............................................................................... 38 7.2 Psilent 1 with one LDHA gene inserted in it: ........................................................................ 39 7.3 Complete vector after inserting second LDHA gene in to the vector: ................................... 40 7.4 Protoplast formation from R. oryzae: ..................................................................................... 41 7.5 Hygromycin resistance for Rhizopus oryzae: ........................................................................ 41 7.6 Confirmation of transformed R.oryzae and demonstration of the stability in the progeny: ... 42
8. Conclusion ................................................................................................................................... 43 8.1 Draw backs of present work: ................................................................................................. 44
9. Further research ......................................................................................................................... 44 9.1 Optimization and analysis of Fermentation with transformed Rhizopus oryzae: ................... 44 9.2 Changing the inserted LDHA gene sequence in the vector: .................................................. 44 9.3 Improving the silencing vector by inserting eGFP gene: ....................................................... 45
10. References ............................................................................................................................. 46 A1: Preparations ................................................................................................................................... 1
Preparation 1: LB (Luria-Bertani) medium (100 ml) (bioprotocols.info) ........................................... 1 Preparation 2: LB agar plates with ampicillin (bioprotocols.info) ...................................................... 1 Preparation 3: Salt solutions (100 ml each) ........................................................................................ 1 Preparation 4: Vitamin solution (Jahromi and Gheinani, 2011 modified) ......................................... 2 Preparation 5: Trace metal solution (Jahromi and Gheinani, 2011 modified) .................................... 2 Preparation 6: Semi synthetic medium for cultivation of Zygomycetes Fungi (1000 ml) .................. 3 Preparation 7: Potato Dextrose Agar plates ........................................................................................ 4 Preparation 8: Yatalase Digestion Buffer (Takara) ............................................................................. 4 Preparation 9: STC Buffer .................................................................................................................. 5 Preparation 10: PEG solution (25ml) .................................................................................................. 5 Preparation 11: 10X TBE Buffer (bioprotocols.info) ......................................................................... 5 Preparation 12: Spore solution (Jahromi and Gheinani, 2011 modified) ............................................ 6
Appendix:
A1. Preparations
Preparation 1: LB (Luria Bertani medium)
Preparation 2: LB agar plates with ampicillin
Preparation 3: Salt solutions
Preparation 4: Vitamin solution
Preparation 5: Trace metal solution
Preparation 6: Semin synthetic medium for cultivaion of Zygomycetes Fungi
Preparation 7: Potato Dextrose Agar plates
Preparation 8: Yatalase Digestion Buffer
Preparation 9: STC Buffer
Preparation 10: PEG solution
Preparation 11: 10x TBE Buffer
Preparation 12: Spore solution
A2. List of equipment used
A3. List of Chemicals used
![Page 12: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/12.jpg)
1
1. Introduction
The briskly growing demand for bio fuels is due to the realization that these are the only
substitutes for the present fossil fuels which covers more than 95% of the world’s
transportation energy requirement in the near future. Present Bio fuels, Ethanol and Bio diesel
have an advantage of being integrated in to the present established huge petroleum
infrastructure. This makes them a solution for the present as well as future generations for
national and global fuel insecurity (Suzzane and Flavin, 2007). First generation bio fuels can
be considered as those derived directly from sugars, starch and vegetable oils. Second
generation bio fuels are those derived from sustainable feed stocks (non food materials) such
as wheat straw and they mainly do not have impact on global food reserves. Second
generation Bio fuels have been developed due to the limitations of global food reserves being
diverted to fuels (Tye et al., 2011, Taylor et al., 2009, Hayes, 2009, Ueng and Gong, 1982,
Wu et al., 1986, Zhang et al., 1995). Third generation bio fuels are derived from algae which
are grown in natural water bodies or artificial environments. Third generation bio fuels
overcome the limitation of first and second generation bio fuels mainly the land, fresh water
and food security risks (Sergeeva et al., 2008). Much research has been done in developing
economical ways for this bio fuel production. In the second generation bio fuels, the carbon
source is not available for the microbes in the simplest form. Direct enzymatic hydrolysis of
streams from agricultural, industrial or house hold waste is not so efficient due to high
stability of the raw material and not easily accessible for enzymes and microbes. Waste
streams have complex mixtures of sugars. Many micro organisms that were used for ethanol
production from food based substrates are capable of using only hexose sugars. Different
methods are in practice for the pre-treatment process such as milling, acid hydrolysis,
irradiation, hot water treatment and alkaline hydrolysis (figure 2.1). Each method has its own
advantages and draw backs. Methods such as use of acids, hot water, ammonia, and lime for
pre-treatment are capital intensive. Whereas methods like biological pre-treatment are very
slow (Taherzadeh and Karimi, 2008). The choice of pre treatment method can be done
according to the available resources. Bio refinery is the possible way of using the Biomass
that is available abundantly in the global market as cheap substrate.
![Page 13: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/13.jpg)
2
Figure2.1: The various pre-treatment and subsequent conversion technologies possible for the
treatment of lignocellulosics (Hayes, 2009)
In a new approach, cellulase production, cellulose hydrolysis and fermentation combined in to
a single process known to be as Consolidated Bio Processing (CBP). This method seems to be
a better alternative than all existing methods for bio fuel production from biological wastes.
This approach is mainly done in two ways. Engineering naturally occurring cellulolytic
microorganisms to have high ethanol yield and productivity known to be CBPI organisms and
engineering non cellulolytic microbes to produce heterologous cellulase system known to be
CBPII organisms (Lynd et al., 2005, Amore and Faraco, 2012). Ethanologic bacteria like
Zymomonas mobilis, Escherichia coli and Klebsiella oxytoca, as well as the yeasts
Saccharomyces cerevisiae, Pachysolen tannophilus, Pichia stipitis, and Candida shehatae
were modified to express various genes for cellulolytic enzymes (Hasunuma and Kondo,
2011, la Grange et al., 2010, Elkins et al., 2010, Amore and Faraco, 2012). Most of the genes
coding for the heterologous cellulolytic enzymes were of eukaryotic origin and they have
many difficulties in being produced and secreted in active form in prokaryotic organisms.
Also the amount of enzymes produced by these organisms was not sufficient for complete
utilization of cellulose. This makes it difficult to work with CBPII organisms. The working
model for CBPI organisms was diagrammatically represented in figure 2.2.
The cellulolytic thermophilic bacteria Geobacillus thermoglucosidasius, Thermoaner-
obacterium saccharolyticum and Thermoanerobacter mathranii have been described as
potential microbes in the category of CBPI organisms (Taylor et al., 2009). When comparing
the best productive cellulolytic bacteria with the fungi like Trichoderma reesei that can
produce high amounts of cellulases (100g of cellulases / liter broth) for complete
saccharification of lignocelluloses, these bacteria seem to be less effecient (Schuster and
Schmoll, 2010). Some other filamentous fungi belonging to the genera Neurospora,
Aspergillus, Trichoderma, Monilia, Rhizopus, Paecilomyces and Fusarium have the
capability of directly converting celloloses to ethanol with other byproducts like acetic acid,
fumaric acid and lactic acid (Singh et al., 1992, Meussen et al., Stevenson and Weimer, 2002).
![Page 14: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/14.jpg)
3
Figure 2.2: A conceptual whole-cell biocatalyst for producing liquid transportation fuels (Elkins et al.,
2010).
To have more productivity of ethanol by using the fungal species that come under CBPI, the
metabolic pathways which are responsible for the reduction of Ethanol production are to be
controlled. It was reported in several studies that most of the organisms have the similar
pathways for the production of ethanol. Pyruvate was produced by glycolysis and it is the
main intermediate from which the metabolic pathways split to give different products
according to the microbe’s environment. Most of the time, there will be production of one or
more bi products varying in amounts. It was demonstrated that the carbon flux will be
distributed between the byproducts in varying levels and that determines the final yield of the
individual bi product. By controlling the enzymes responsible for the undesirable products,
the yield and productivity of desired ones can be increased. It was also demonstrated that
complete inactivation of genes responsible for undesirable products may cease the cell
growth. In Saccharomyces cerevisiae, by inserting Lactate Dehydrogenase (LDH) gene (for
lactic acid production) and disrupting Pyruvate decarboxylase gene (for ethanol production),
there was reduction in cell growth with little increase in Lactate production (Adachi et al.,
1998, Ishida et al., 2006).
2. Background
Among the fungi that were capable of producing ethanol from lignocelluloses, Rhizopus
oryzae (figure 2.1) has its own importance. It was reported of having the capability of
assimilating variety of sugars such as glucose, galactose, mannose and xylose (Edebo, 2000).
This zygomycetes species was extensively used for production of cellulolytic enzymes
(Amadioha, 1993, Archer and Wood, 1994), proteases (Tunga et al., 1999), lactic acid
(Skory, 2004b) and also ethanol (Abedinifar et al., 2009, Büyükkileci et al., 2006). Tolerance
to the inhibitors present in lingo cellulose acid hydrolyzates, ability to grow in high
temperatures, and valuable biomass content makes Rhizopus oryzae attractive (Karimi et al.,
2006, Taherzadeh et al., 2003, Millati et al., 2005, Ferreira. A.J et al., 2012).
![Page 15: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/15.jpg)
4
Figure 2.1: Rhizopus oryzae CCUG 28958
It was reported that the lactic acid was the major by product formed along with ethanol during
fermentation (Taherzadeh et al., 2003). As previously discussed, lactate production was
increased by deleting the pyruvate dehydrogenase gene, The gene coding for lactate
dehydrogenase (LDH) (enzyme for converting pyruvate to lactate) can also be deleted or
down regulated to increase ethanol production (Cai et al., 2011). LDH gene can also be
knocked down using post transcriptional modification of mRNA through RNA interference
known to be quelling in fungi (Gheinani et al., 2011). It was found out that two distinct lactate
dehydrogenase enzymes were present in rhizopus oryzae. One is NAD+ independent and the
other is dependent. The dependent one can catalyze the conversion of pyruvate to l-lactic acid.
Independent one has the additional capability of catalyzing opposite reaction, that is from l-
lactate to pyruvate. It was also found out that the second enzyme could not utilize D-lactate
(Pritchard, 1971). The LDH gene from Rhizopus oryzae was cloned in E.coli. The RNA was
used to make cDNA which served as a template for amplification with PCR primers referred
to as universal ldh primers (5´-ACACGCCCATCCGAGCAGG-3´ and 5´-
GCACAGGCACCA ATTCCATAAAAC-3´). These universal primers were designed to
anneal to regions that are identical in both ldhA and ldhB genes. Comparisons between cDNA
and genomic sequence revealed that there were no introns present in this gene. Even ldhB
gene also has no introns in it. ldhb gene was amplified from the cultures grown on lactic acid
but not from the cultures grown on Glucose medium (Skory, 2000). The increase of ethanol or
decrease of lactate could be possible only by controlling the gene expression. This can be
done by transforming the organisms which will result in the diversion of metabolic pathways
towards desired ethanol production. Diagrammatic representation of Glucose metabolic
pathway that occurs in microorganisms was shown in figure 2-2.
![Page 16: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/16.jpg)
5
Figure 2-2: Simplified overview of the main fermentation routes with glucose as carbon source.
The numbers indicate key enzymes in this pathway: 1, pyruvate decarboxylase (PDC); 2, alcohol dehydrogenase
(ADH); 3, lactate dehydrogenase (LDH); 4, pyruvate carboxylase (PYC); 5, malate dehydrogenase (MDH); 6,
fumarase (FUM). (Meussen et al., 2012)
2.1 RNA interference and its application in Fungi:
Molecular biotechnology has been advanced since the time DNA sequencing of various
organisms was done from the simplest organisms like prokaryotes to fully fledged multi
cellular eukaryotes. The complete genome sequencing of S.cereviciae in the year 1996 made
it possible to explore more functional properties of molecular genetics of this species. Since
then a lot of genomes of various fungi were sequenced due to their compactness. These
known genes help in gaining much knowledge regarding the reverse genetic approaches for
genetic control (Nakayashiki and Nguyen, 2008). Much effort was laid by researchers for
getting the functional information of various genes in all organisms. There are few methods
by which the function of a particular gene can be determined. This identification of genetic
functions will be easier in prokaryotes where there are fewer complications when compared to
Eukaryotes. The old and mostly followed method for knowing the gene function is Gene
Knock out. This is very laborious work since and also there should be some phenotypic effect
that could be determined. Recently gene knock down mechanism was discovered in the
eukaryotic organism Caenorhabditis elegans by double stranded RNA and they were
awarded Nobel Prize in the year 2006 for their discovery (Fire et al., 1998, Nobelprize.org,
2006). It was found out that the silencing of gene can be done not only through the knockout
of specific DNA but also through some RNA related approaches. This approach seems to be
beneficial when gene targeting approaches fail, multiple copies of a gene of interest are
![Page 17: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/17.jpg)
6
present in the genome or iso genes might compensate for the knockout of the deleted gene
(Meyer, 2008).
Three RNA-based methods antisense RNA, hammerhead ribozymes and RNA interference
have been shown to be valuable tools for gene silencing in eukaryotes. Antisense RNA
constructs were used in silencing genes in different organisms like A. Oryzae (Zheng et al.,
1998) and A. awamori (Moralejo et al., 2002). Many other genes were silenced successfully in
various filamentous fungi using antisense RNA constructs (Kitamoto et al., 1999, Moralejo et
al., 2002, Lombraña et al., 2004). But complete silencing of a gene was not yet achieved using
this approach till date. Complete silencing of particular gene may be lethal to the organisms
and this tool will be beneficial for this type of problems (Bautista et al., 2000). Hammerhead
ribozyme mediated silencing was another approach where the substrate recognition arms of a
ribozyme can be altered such that they are complimentary to the target mRNA to be degraded.
(Akashi et al., 2005). This approach for repressing a gene in filamentous fungi was
demonstrated by Müller and coworkers (Müller et al., 2006). In the RNA interference
approach, small RNA molecules direct the complexes that can degrade targeted mRNA
molecules thereby blocking the translation in to polypeptides. This RNA silencing may also
occur through RNA directed DNA methylation or heterochromatin formation and
translational repression (Schumann et al., 2010). Many species of small RNA were reported
for having silencing effect in plants. Some of them are small interference RNA (siRNA)
(Gheinani et al., 2011), micro RNA (mi RNA) (Molnar et al., 2007), natural anti sense RNA
(Zheng et al., 1998). All these small RNA’s are derived from double stranded or hair pin
RNA precursors (Eamens et al., 2008). This knock down mechanism or gene silencing is
termed as RNA interference in animals, co suppression in plants and quelling in fungi
(Schumann et al., 2010). RNA interference in fungi also does not cause complete suppression
of targeted gene similar to antisense RNA mediated silencing.
The protein complex named Dicer was responsible for the production of siRNA’s from
precursor double stranded RNA’s (Zamore et al., 2000). One of the strands from 20-25 long
small RNA will be unwound to form a passenger strand and guiding strand. The guiding
strand guides the RNA induced silencing complex (RISC) along with an AGO protein
towards the targeted mRNA. This finally leads to the cleavage and results in silencing of the
specific gene (Paroo et al., 2007, Hammond et al., 2001, Schumann et al., 2010).
![Page 18: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/18.jpg)
7
Figure 4.1.1.1: The RNA interference pathway. Long double-stranded RNA (dsRNA) or small hairpin
RNA (shRNA) is processed by Dicer to form a small interfering RNA (siRNA), which associates with
RNA-induced silencing protein complex (RISC) and mediates target sequence specificity for subsequent
mRNA cleavage (Rutz and Scheffold, 2004).
When coming to the gene silencing mechanisms in fungi, it was identified in many organisms
like N .cassa (Romano and Macino, 1992), A. nidulans (Khatri and Rajam, 2007), M.oryzae
(Kadotani et al., 2003), R.oryzae (Skory, 2004a), A.oryzae (Yamada et al., 2007), A.
parasiticus (McDonald et al., 2005) A.niger (Barnes et al., 2008). A prerequisite for this
method is that the fungal strain comprises components of the RNAi silencing machinery, such
as RNA-dependent RNA polymerase (RdRP), dicer-like proteins and the RNA-induced
silencing complex (RISC). In most of the studies, RNA interference in fungi was done to
study and control the pathogenic pathways over plants and animals. Different strategies were
employed for inducing silencing of various types of genes in different fungi like direct
delivery of siRNA, dsRNA or through expression of hpRNA constructs. Each method has its
own advantages and disadvantages. The efficiency of gene silencing varied significantly for
different methods (Kadotani et al., 2003).
2.2 Silencing Mechanisms other than post transcriptional control:
The small RNA’s that were produced from precursor RNA molecules help in silencing the
targeted genes in various ways. One of them was as described above where the small RNA’s
bind to targeted mRNA and leads to degradation, there by silencing the gene. The other way
is by inducing chromatin modifications within the target gene and thereby silencing its
transcription. In both types of silencing the same machinery like RNA-induced silencing
complex (RISC), various Argonaute family proteins are involved. If the guiding RNA with
mature RISC complex exactly matches the target mRNA, it leads to the degradation known as
―Slicing‖ of the mRNA and this is accomplished by Argonaute family proteins known as
―Slicer‖. If the guiding RNA is not much complimentary to target mRNA, then the RISC can
be directed into the nucleus where it recruits other proteins that modify the chromatin around
the promoter of the gene complementary to the guide RNA as shown in the figure below. The
proposed mechanism was that the regions of centromere were transcribed to produce RNAs
![Page 19: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/19.jpg)
8
that hybridize with other RNAs from the same region. The resulting dsRNAs are recognized
by Dicer and cleaved to produce siRNAs which finally directs the machinery to the
centromeres. Very small amount of dsRNA is sufficient for the induction of near complete
shutdown of targeted gene expression. The main enzyme that was known to be responsible for
this efficiency was RNA-dependent RNA polymerase (RdRP). This protein helps in
amplifying the inhibitory signal by generating dsRNAs after recruiting the mRNA by the
original siRNA. This protein was not yet identified in mammalian cells. But the slicing
mechanism was catalytic and each RISC complex could slice many mRNA molecules. The
other way is by interfering with translation mechanism of the target mRNA. All this shows
that the silencing mechanism was completely different in simple organisms and higher
eukaryotes (figure 2.2.1) (James D. Watson, 2008).
Figure 2.2.1: RNAi switches off the expression
of a gene when dsRNA molecules that have
homology to that gene are introduced, or made, in
the cell. This effect involves processing of the
dsRNA to make siRNA and miRNAs by the
enzyme Dicer. The siRNA and miRNAs direct a
complex called RISC (RNA-induced silencing
complex) to repress genes in three ways. It attacks
and digests mRNA that has homology with
siRNA; it interferes with translation of those
mRNAs; or it directs chromatin modifying
enzymes to the promoter that direct expression of
those mRNAs (James D. Watson, 2008).
2.3 Uses and draw backs of RNA silencing:
When compared to gene knock out methods, gene knock down strategies require information
of only small stretches of sequence information. So this can be implemented even in the
organisms with less genetic information. As silencing occurs at post transcriptional level,
multiple copies of gene located at multiple loci can be silenced. Certain genes coding for
proteolytic enzymes that belong to a common family could be silenced simultaneously by
selecting the conserved region for constructing the vector. This gives a great benefit when
comparing to gene knock out methods where each gene needs to be treated separately. To
control the gene silencing, inducible promoters can be employed. In the similar fashion,
strong promoters help in increasing the efficiency of gene silencing (Weld et al., 2006,
![Page 20: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/20.jpg)
9
Schumann et al., 2010). There were also different levels of RNA interference observed in the
transformants. This can be employed in knowing the minimum drug dosage levels required to
change or inhibit a particular phenotypic effect. This cannot be known in knock out models.
Also the genes that are essential for a cell survival can be knocked down up to certain levels
without having lethal effect on cells growth (Liu et al., 2002, Kadotani et al., 2003).
The efficiency of gene silencing was not stable and constant in all the transformants. It is
difficult to select the transformants with high level of gene silencing or having similar levels
of silencing (Mouyna et al., 2004). This can be solved by co suppressing the gene that has
phenotypic effect. Reporter gene such as eGFP (coding for green fluorescence protein) comes
under this category. In this approach, the reporter gene expressing strain will be used for
studying silencing effect and can be transformed with silencing construct that can silence
gene of interest along with reporter gene (Fitzgerald et al., 2004, Krajaejun et al., 2007). Only
phenotypically distinct transformants can be selected after transformation and this is also not
very precise. An other major problem with this gene silencing approach is off targeting effect.
As only small sequence of RNA was being used, there may be undesired complementary
targets that have a chance to get silenced along with desired ones (Nguyen et al., 2008,
Gheinani et al., 2011).
2.4 Studies in RNA silencing at the University of Borås
Research at the University of Borås has earlier shown that it is possible to silence the LDHA
gene in Rhizopus oryzae CCUG 28959 by siRNA and thereby decreasing the ethanol
production (Gheinani et al., 2011). The drawback with this silencing method is that there will
be no permanent change to the organism and the silencing effect will not be inherited by its
progeny. For such a change the genome has to be altered for example by transforming an
integral silencing vector.
3. Aim of this study
The purpose of this study was to construct a stable integral hp RNA expression vector for
permanent silencing of genes in Rhizopus oryzae
4. Literature Review
4.1 RNA silencing vectors:
The first silencing construct used for silencing in pathogenic fungi Cryptococcus neoformans
was reported by Hong Liu et al. The plasmid constructs pCAP59i and pCAP59/ADE2i were
used to silence CAP59 and ADE2 genes (Liu et al., 2002). High through put versatile
silencing vectors pHANNIBAL and pHELLSGATE were created for inducing silencing in
plants (Wesley et al., 2001). Till date, many groups have used hpRNA with intron for RNA
interference. P-Silent1 vector was developed from pBSTRP-PT (Kadotani et al., 2003) which
was similar to pHANNIBAL and pHELLSGATE for silencing in ascomycete fungi
(Nakayashiki et al., 2005). Shafran et al have introduced the Gateway technology into pSilent-
1 and established the high-throughput RNAi vector, pTroya (Shafran et al., 2008). Similarly,
![Page 21: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/21.jpg)
10
pFANTAi4, which uses the Gateway technology and a green fluorescent protein (GFP)
sentinel system, has been developed for the human pathogenic fungus Blastomyces
dermatitidis (Krajaejun et al., 2007). Using eGFP gene as a marker to measure the efficiency
of silencing, P Silent Dual1was developed by modifying Psilent1 which has advantages of
both the vectors pFANTAi4 and P silent1(Nguyen et al., 2008).
Brief description of construction and application of silencing vectors mentioned above
follows:
4.1.1 pCAP59i and pCAP59/ADE2i:
The first gene CAP59 codes for a protein essential for synthesis of a capsule essential for
virulence and second one ADE2 for phosphoribosyl amino imidazole carboxylase. Silencing
of first gene gave colonies with different hydrophobicity than wild type and second gene
resulted in pink colored colonies due to accumulation of adenine biosynthetic intermediates
and this worked as a phenotypic marker for identifying the transformants having silencing
effect.
For construction of a vector that was capable of expressing hpRNA, Liu and coworkers used
two duplicate sequences of 500 bp CAP59 gene in opposite direction with a spacer sequence
of 250 bp from eGFP gene. This hair pin construct was preceded by cryptococcal actin
promoter and followed by GAL7 terminator (figure 4.1.1.1).
Figure 4.1.1.1: Plasmid design. pCAP59i was used to interfere with CAP59 expression, and
pCAP59/ADE2i was used for tandem interference with both CAP59 and ADE2 (Liu et al., 2002).
C.neoformans cells of serotype D were transformed by electroporation with linear pCAP59i
and grown on appropriate media for the synthesis of capsule. This transformants were
compared with wild type and knock out mutants of CAP59 gene. They also had closer
examination of transformants under light microscope. Closer clump formation was observed
in transformants which was similar in knock out mutants. India ink staining as well as
monoclonal antibody specific tests were performed for testing the presence of capsule. All
these tests resulted in common conclusion that the gene was silenced. The construct was
modified by deleting the promoter sequence and checked for interference effect. This showed
no modified phenotype which concludes that the expression of hairpin construct was essential
for RNA interference. Quantitative RT-PCR method was done to check the levels of CAP59
mRNA and the results were in accordance to expected levels. Similarly ADE2 gene was
silenced by inserting the gene along with CAP59. Simultaneous silencing of genes was
observed even though there was difference in their levels for individual genes. Several levels
of silencing were observed which hypothesizes that the efficiency of silencing was not similar
in all the transformants. This may depend on the variation in the level of transcription of the
hair pin construct. This variation may be due to modifications in the transformed construct
![Page 22: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/22.jpg)
11
inside the host. To improve the stability of construct and reduce modifications, cryptococcal
telomere sequences were incorporated in to pCAP59i (pCAP59i-tel) (Liu et al., 2002).
This proved that dsRNA have significant role in interference mechanisms in fungi.
4.1.2 pHANNIBAL and pHELLSGATE (intron splices hpRNA expressing vectors) :
Two types of constructs that can express adjacent hpRNA (adj-hpRNA) and hpRNA were
tested to compare the best construct for silencing. The results showed that hpRNA construct
was the best one which has more efficiency compared to siRNA and adj-hpRNA for
silencing. For constructing hpRNA expressing vectors, there is a need to have two copies of
target gene in an inverted repeat orientation and it involves more steps.
Intron spliced hp RNA constructs were designed by inserting functional intron in the place of
spacer gene in between the two arms to increase the stability of inverted repeat DNA in
E.coli. These construct with intron showed more efficiency than the constructs without intron.
pHANNIBAL was constructed with all the optimized properties and this gave a better
silencing in plants (figure 4.1.2.1) (Wesley et al., 2001).
Figure 4.1.2.1: PCR products from the target gene are cloned into the polylinkers of pHANNIBAL
conventionally; restriction sites added by the primers ensure the correct orientation of the resulting sense
and anti-sense arms (Wesley et al., 2001).
A high throughput vector pHELLSGATE was constructed which involves less number of
steps. It was designed such that single PCR product with appropriate primer pairs was
sufficient to incorporate the gene of target simultaneously to form two arms of hpRNA
construct. A gene sequence ccdB which is lethal for E. coli DH5α was included on either side
of the arms to ensure the correct formation of arms with the gene of interest (figure 4.1.2.2)
(Wesley et al., 2001).
Figure 4.1.2.2: The attB1 and attB2 sequences on a single PCR product facilitate the
recombination of one sense-orientated and one anti-sense orientated molecule into each
molecule of pHELLSGATE when incubated with BP clonase (Wesley et al., 2001).
![Page 23: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/23.jpg)
12
4.1.3 Vectors for finding better RNA species for triggering RNA interference:
Various constructs were employed to determine the efficient RNA species that can trigger
silencing mechanisms in filamentous fungi. Different constructs were designed to express
eGFP sense, anti sense, sense-antisense, sense-sense, anti sense- anti sense strands and these
were transformed into eGFP expressing transformants. Silencing efficiency was measured
according to the reduced fluorescence. It was found out that constructs with hpRNA
expressing cassette have highest silencing efficiency among them. This shows that hpRNA
expressing will be the better trigger for silencing.
For eGFP gene expression, a plasmid pEGFP75 was used for transformation. Later pEGFP-A,
pEGFP-SA, pEGFP-SS, pEGFP-AA (figure 4.1.3.1) were used to express various silencing
constructs to test the efficiency.
Figure 4.1.3.1: Figure: Diagram of
transformation plasmids used in this
study. Arrows indicate the orientation
of the enhanced green fluorescence
protein gene. Segments used as probes
in Southern Blot analysis are
indicated by thick bars. A HincII
fragment of the beta-glucuronidase
(GUS) gene was used as a spacer. All
the constructs were under the control
of the Aspergillus nidulans trpC
promoter (PtrpC) and terminator
(TtrpC) (Kadotani et al., 2003).
Lower mRNA levels of eGFP gene were detected in the transformants with less fluorescence.
Three different sizes of siRNA’s were detected ranging from 19-23 as reported in animals and
plants and this was correlated with the silencing efficiency. These results also give strong
evidence that RNA interference in fungi in many cases is similar to that in animals and plants
(Kadotani et al., 2003).
4.1.4 P-Silent1:
A silencing vector capable of expressing hpRNA with an intron in between the two arms in
fungi was constructed. The efficiency of this construct was tested in rice blast fungus M.
Oryzae by testing the silencing of eGFP gene. This vector was also used to silence two
endogenous genes which showed various levels of silencing.
For optimizing the length of intron sequence for better silencing effect, three different introns
of various lengths were tested using the vector pBSTRP-PT (Kadotani et al., 2003). trpC
promoter and terminator were used for the construction of vector. Two copies of eGFP gene
were inserted in the opposite orientation to form hpRNA. Among different constructs with
![Page 24: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/24.jpg)
13
introns used, construct having CUT gene of length 142 bp as spacer showed better efficiency
of silencing.
P-Silent1 vector was constructed by including multiple cloning sites with unique restriction
sites for inserting PCR amplified sense and antisense strands with appropriate set of primers
for gene of interest with CUT gene as intron in between (figure 4.1.4.1).
Figure 4.1.4.1: Schematic representation
of the silencing vector pSilent-1, and the
sequences of multi-cloning sites and
splice junctions in the vector.
(A) A map of pSilent-1. Ampr,
ampicillin-resistant gene; Hygr,
hygromycin- resistant gene; IT, intron 2
of the cutinase (CUT) gene from M.
oryzae; PtrpC, A. nidulans trpC
promoter; and TtrpC, A. nidulans trpC
terminator.
(B) Restriction sites are underlined.
Asterisks indicate
unique sites in the silencing vector. Italic
nucleotides indicate sequence from the
cutinase gene and bold letters represent
5_ and 3_ splice sites (Nakayashiki et al.,
2005)
Measurement of fluorescence, hydrophobicity test and RT PCR analysis showed significant
silencing effect with varied levels of silencing in the transformants. A study was done by
doing southern blotting analysis on the transformants that lost the silencing effect. This
showed that the loss of silencing effect was due to the loss of intact eGFP hpRNA expressing
construct and that was not due to epigenetic reversion. This epigenetic reversion was due to
rearrangements that occur after transformation in filamentous fungi. By maintaining required
growth conditions can help in reducing this effect. This was applicable to pSilent1 as it
contains hygromycin resistance gene. It was also showed that the conidiophores of strongly
silenced transformants also have the silencing effect. This shows that silencing initiated in the
stable transformants can be transferred to asexual progenies and also pSilent1 can be used as
an efficient vector for silencing gene of interest in ascomycete fungi (Nakayashiki et al.,
2005). The complete sequence of p Silent1 vector was also available with the accession
number AB303070.2.
![Page 25: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/25.jpg)
14
4.1.5 PSV-IRT (with inverted repeat transcription silencing constructs):
RNA interference was employed to down regulate a gene that was responsible for melanin
production in pathogenic fungi that belongs to Ophiostoma species that grows in trees. The
frequency of homologous recombination for this species was very low and this made the
determination of gene function very challenging. A silencing construct was made with
inverted repeat transcription sequence which can produce hpRNA and result in silencing of
targeted gene.
The plasmid pCAMIA-0380 was used for developing PSV binary vector. The promoter and
terminator used in the construction were of trpC origin and they were amplified from
pCB1004 and pAN7-1 (Kitpreechavanich et al., 2008) respectively through PCR
amplification. The spacer between sense and anti sense was from an oligonucleotide sequence
used in the amplification of antisense fragment. Hygromycin B and Ampicillin resistance
cassettes were also amplified and ligated into the vector by PCR reactions with appropriate
primers having restriction sites (figure 4.1.5.1).
Figure 4.1.5.1: IRT silencing constructs: (A) Schematic representation of pSV vector with IRT; shaded
box denotes the intron sequence, (B) RNAi targeted region of the PKS1 gene.
The NCBI GenBank accession numbers forPKS1 genes are: DQ372811 for O. piceae (AU55-3),
and AF411603 for O. floccosum (387 N). Op-PKS1-1 is located 1038–1336 bp from the start codon of the
AU55-3 PKS1 gene; Op-PKS1-2, 53–257 bp; Op-PKS1-3, 4076–4338 bp; Op-PKS1-4, 53–1336 bp; Op-
PKS1-5, 3669–4338 bp. White boxes indicate exon. B, BamHI; Bg, BglII; E, EcoRI; H, HindIII; P, PstI;
S, SacI; S2, SacII; Sa, SalI; Sp, SpeI (Tanguay et al., 2006).
Agrobactrium mediated transformation was used for transformation and the transformants
were selected by growing in medium having 300 μg/ml of hygromycin B.
Southern blotting and RT-PCR analysis were done to know the interference effect.
Transformants with high levels of silencing shown very low pigmentation and the mRNA
levels were also very low and this reveals the post transcriptional down regulation of target
gene. The silenced transformants had other physiological and morphological differences when
![Page 26: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/26.jpg)
15
compared to wild type like production of soluble pigmentation when grown on agar medium
and also no spore formation. This concludes that untargeted genes were silenced with the
silencing construct used. Copy number and the position of the coding sequence of the target
gene used for construction also affected the silencing efficiency and this was analyzed by
constructing various vectors with different gene lengths and sizes. The transformants were
grown for two months on sterile sapwood and tested for the reversion rate. The conidia
collected showed no reversion and this suggests a very stable method for silencing genes in
fungi.
The group also suggested that the same interference construct can be employed to silence the
gene between the closely related species having similar gene sequence (Tanguay et al., 2006).
4.1.6 pFANTAi4
Using Gateway® Cloning Technology from Invitrogen, a vector was designed where it
includes the target gene along with the eGFP gene. This helps in getting the system where
simultaneous silencing of both the genes was achieved and the green fluorescence acts as an
indicator for knowing the level of silencing. In the construction similar to pHELLSGATE,
two cassettes with two copies of ccdB genes each were inserted in either of the arms in
inverted orientation next to inverted copies of GFP gene. H. capsulatum H2AB promoter was
employed upstream to the hp RNA construct for expression (figure 4.1.6.1).
Figure 4.1.6.1: Map of the destination vector
(pFANTAi4) demonstrating two copies of GFP
(470 bp) that were cloned next to two copies of a
Gateway cassette, in convergent orientation. The
Gateway cassette will be replaced by an attB-
flanked target gene PCR product to construct a
GFP-target gene RNAi vector. Two enzymatic
recombination steps
(BP and LR clonase reactions) are required for
RNAi vector construction
(see Materials and Methods for details). kanR,
kanamycin resistance; hygR, hygromycin
resistance; Term, terminator; LB and RB, left
border and right border (Krajaejun et al., 2007)
For ensuring the transcription of complete
construct, GFP gene copies were placed at
the ends of intended RNAi construct. It was
also shown that the length and location of the target sequence should be optimized empirically
for the maximal RNAi effect. Agrobacterium mediated transformation was employed for
delivering the silencing construct in to dimorphic
fungus B. dermatitidis. Various genes were tested for silencing efficiency and LACZ was one
of them. Sequence from 3’ end that was used in the construction shown more silencing
efficiency than the sequence from 5’ end. Different lengths of genes and loops were used to
find the better combination for gene silencing. It was observed that shorter loop and longer
gene sequence showed more efficiency among all combinations. When several lengths (0.9
kb, 1.5 kb and 3 kb) of LACZ gene were employed, the shorter ones showed more efficiency
![Page 27: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/27.jpg)
16
of silencing. From these observations, it was suggested that for any gene to be silenced,
optimal length and position of target gene to be used should be found out for having better
silencing construct (Krajaejun et al., 2007).
4.1.7 p Silent Dual (pSD1):
The construction of hpRNA expressing vector was limited to small and moderate scale as it
involves two steps of oriented cloning. Gateway® technology proves to be an alternative way
for this limitation. The vector was developed with opposite dual promoters and targeted gene
silencing can be done by a single step cloning process. In this construction, sense and
antisense strands of the target gene will be transcribed by two opposing RNA polymerase II
promoters.
eGFP gene was introduced along with the cassette to know the level of silencing of the target
gene. The two promoters used were of different origin and they were trpC and gdp promoters
(figure 4.1.7.1).
This construct was used for functional analysis of calcium signaling proteins in the genome of
rice blast fungus M. oryzae. Three vectors were used simultaneously to test the efficiency
namely pSD1 with eGFP gene (pSD1-GFP), pS1-CUT (p silent 1 vector with cutinase intron
expressing eGFP gene hpRNA) and empty pSD1 as negative control.
Figure 4.1.7.1: Schematic diagram of the RNA-silencing vector, pSilent-Dual1 (A), and the nucleic acids
sequence in the multiple cloning sites (B). Asterisks indicate unique sites in the vector. PtrpC, Aspergillus
nidulans trpC promoter; Pgpd, A. nidulans gpd promoter; Ampr, ampicillin-resistant gene (Nguyen et al.,
2008).
It was observed that pS1 CUT had more silencing efficiency than pSD1-GFP. mRNA levels
were also in consistent to this result. Calcium signaling analysis was done efficiently using
![Page 28: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/28.jpg)
17
pSD1 in M. oryzae and this silencing construct can be employed in other similar fungi. This
vector works under promoter that found to be effective in many fungal species. Single step
non-oriented cloning also helps in constructing a vector for multiple genes in less time. The
working model of pSilent-Dual1 was shown in the figure 4.1.7.2.
Figure 4.1.7.2: Schematic diagram of the high-throughput RNA-silencing system by pSilent-Dual1 (pSD1).
A pool of DNA fragments were amplified by PCR using specific sets of primers and genomic DNA, and
inserted into pSD1G (pSD1 with a fragment of the eGFP gene). Resulting recombinant plasmids were
screened by colony PCR, and each of them was introduced into a GFP-expressing Magnaporthe oryzae
strain. The M. oryzae transformants were grown in a 96-well plate, and GFP fluorescence of the colonies
was measured using a fluorescent plate reader. Northern blot or qPCR analysis was performed with M.
oryzae transformants showing low or no GFP fluorescence, and ones with a reduced mRNA level were
further subjected to phenotypic analyses (Nguyen et al., 2008)
The lower efficiency of pSD1 when compare to pS1 may be due to that the synthesized RNA
complimentary RNA strands have to be combined physically to form dsRNA. When coming
to pS1 transcript, the sense and anti sense strands have an intron in between. This enables
them to self fold to form hpRNA. pSD1 was modified by replacing gdp promoter with trpC
promoter. This also did not improve the silencing efficiency (Nguyen et al., 2008).
4.1.8 pTROYA:
The vector P silent 1 was used as the basis for constructing the vector pTROYA. They have
employed Invitrogen Gateway technology for getting high through put silencing construct. A
Gateway cassette was inserted in to XhoI site in the multiple cloning site. This cassette has
recombination sites, chloramphenicol resistance gene and ccdB gene. Similar cassette was
inserted at StuI site in the opposite direction. The construct was verified by restriction
mapping and partial sequencing around the cloning sites (Shafran et al., 2008).
![Page 29: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/29.jpg)
18
5. Rhizopus oryzae:
Rhizopus oryzae comes under the order Mucorales in the phylum Zygomycota. The main
difference between Rhizopus genus and others (Aspergillus, Fusarium and Penicillium) is its
ability to produce fumaric acid (Kitpreechavanich et al., 2008). In few parts of Asia, Rhizopus
species was being used in foods such as tempeh, peka, ragi, and loog-pang (Kitpreechavanich
et al., 2008). Some strains of this species are regarded as opportunistic human pathogens and
mostly responsible for mucor mycosis infections (Ibrahim et al., 2010).
5.1 Classification:
Taxonomic classification of Rhizopus (Zamore et al., 2000) :
Kingdom ---- Fungi (Myceteae)
Phylum ---- Zygomycota
Class ---- Zygomycetes
Order ---- Mucorales
Family ---- Mucoraceae
Genus ---- Rhizopus
Recent reclassification was done according to the organic acid producing capabilities. Two
classes were divided as Lactic acid producing (LA) and Fumaric – Malic acid producing
(FMA) and these were in accordance to the phylogenetic classification as well when analysed
with their rDNA ITS, lactate dehydrogenase B, actin, translation elongation factor-1a and
genome wide AFLP. R. oryzae has two genes for lactic acid production ldhA and ldhB. It was
found that FMA lack ldhA gene and is responsible for lactic acid production in lactic acid
producers. Abe and coworkers proposed that FMA producers of Rhizopus species can be
called as R. delemar and LA producers comes under R. oryzae (figure 5.1.1) (Tanguay et al.,
2006).
![Page 30: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/30.jpg)
19
Figure 5.1.1: Classification of the organisms of biotechnological interest within the fungal kingdom, with a
focus on Zygomycetes, and specifically the microorganism studied in the current work (Lennartsson, 2012).
Different strains of this species are being used for production of various commercially
valuable products such as l-lactic acid, Ethanol and Fumaric acid (Table 5.1.1).
Table 5.1.1: Literature data on the main fermentation end product production by Rhizopus oryzae strains
(Kitpreechavanich et al., 2008). Strain used in this study was marked in the table.
Product R.Oryzae Strain Yield
(g product/g sugar)
L-Lactic Acid NRRL 395
ATCC 52311
GY 18
0.87
0.88
0.81
Ethanol CCUG 28958
CCUG 22420
CCUG 18663 NRRL1501
NRRL2625
NRRL395
0.42
0.44
0.38
0.50
0.50
0.38
Fumaric acid Rhizopus arrhizus 2582
ATCC 20344
R. arrhizus NRRL1526
0.79
0.86
0.82
5.2 Morphology:
Rhizopus species have rhizoids which are root like anchors. These are connected by hyphae
called stolons and they penetrate in to the medium. The length and location of their rhizoids,
the diameter of sporangia, the shape of columellae, and the size, shape and surface texture of
sporangiospores and the maximum growth temperature differentiate Rhizopus genera from
others (Absidia, Mucor, Apophysomyces, Rhizomucor, Saksenaea, and Cunninghamella)
(Zamore et al., 2000). The growth of R. oryzae was as shown in the picture (figure 5.2.1)
when grown on solid media and liquid medium.
Figure 5.2.1: R.oryzae grown on Potato dextrose agar plates for 1 day and 2 days. Right end picture showing
hyphae grown in liquid semi defined medium for 2 days.
![Page 31: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/31.jpg)
20
Different growth morphologies were observed when Rhizopus oryzae grown in the medium
with varying pH, metal ion concentrations, or change in carbon and nitrogen sources. It was
observed that big clump formation resulted at pH 5 and pellets formation at lower pH. Mg2+
ion concentration also affected the morphology from clump to pellet and mycelium form. It
was also observed that the fungi have different growth morphologies with different types of
sugars in the medium like arabinose favored growth of mycelia fragments, mannose and
glucose favored clump formation, xylose and galactose resulted in fluffy pellets (Punt et al.,
1987). Zhou, Y and coworkers also had similar growth morphologies with varying factors of
pH and trace metal ion concentration during the fermentation of R. oryzae (Meussen et al.,
2012). Filamentous morphology of the strain used in this study was clearly shown in the
picture (Figure 5.2.2) below.
Figure 5.2.2: Microscopic picture of R.oryzae CCUG 28958 under light microscope at 20X, 40X and 100X
magnifications.
The filamentous morphology of many fungal species during fermentation processes implies
many rheological problems in fermenters. In contrast, the filamentous form is the better
morphology for high ethanol production. So if the morphology could be adjusted according to
media components or other parameters, this could give more reliable way in industrial level of
ethanol productions. Such type of approach was developed by Wei Liao and co workers. By
using potato dextrose broth, soy bean peptone and calcium carbonate size at appropriate
concentrations gives pellet morphology of varied sizes. Growth in the medium with no metal
ions resulted in less biomass when compared to medium with metal ions. This showed that
metal ions favor the formation of clumps as spores grow faster and hyphae tangle up
themselves. Avoiding metal ions until regeneration of spores favor pellet formation.
Supplementation of metal ions is very essential for fungal metabolism and avoiding them
completely, may be lethal for product formation (Meussen et al., 2012). Similar type of
studies was conducted by Canan Tari and group on obtaining the pellet morphology in
relation with various media compositions (Canan. T et al., 2011). Even the growth rate and
shear stress in the reactor was shown to be having influence on the morphology of
filamentous fungi. This is due to that the mass transfer, mixing, and heat transfer processes
alter the microbial metabolic processes there by influencing the growth morphology. It was
shown that pH and oxygen tension in the range 12-300 mm Hg does not have any effect on
morphology. It was also noted that hyphal extension rate was proportional to growth rate
(Treskatis et al., 1997).
![Page 32: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/32.jpg)
21
5.3 Cell wall composition:
Wide ranges of fungal cell walls consist of 80 to 90 % polysaccharides and the remain is of
proteins and lipids. The cell wall is a fabric of interwoven micro fibrils embedded in or
cemented by amorphous matrix substances. Chitin and Cellulose are the mostly found micro
fibrillar or skeletal components of fungi (Garcia, 1968). The main function of cell wall is to
protect the organism mainly from environmental stress and help to survive in harsh
conditions. Also has its importance in cell-environmental interactions like attachment of fungi
to nutrient surfaces. The fugal kingdom comprises of eight different types of cell wall
compositions such as Cellulose, Mannan, Chitin and Polygalactosamine-galactine containing
groups. Chitin-Chitosan combination was only observed in Zygomycetes cell wall, but the
exact role of Chitosan is not yet understood completely. As Chitosan replaces the glucan, it
serves the role of glucans in the cell wall of Zygomycetes fungi (Zamani, 2010). Chitin has a
very huge market and industrially extracted from crab and shrimp shells. After the advances
in the knowledge of various fungal species, much attention was drawn towards the fungal
fermentation as a source for Chitosan production (Wu et al., 2005).
5.4 Protoplast formation:
Protoplast preparation was essential for transforming filamentous fungi irrespective of
transformation method as they have strong layer of cell wall which will be a main obstacle for
transforming DNA to enter the cytoplasm. In general, different enzymes that have the ability
to degrade the cell wall can be employed. As the Rhizopus oryzae cell wall composition was
mainly Chitin, different types of enzymes and their compositions were reported in the
literature for the degradation of cell wall (Michielse et al., 2004, Zhou. X et al., 2008, Linhui.
L et al., 2010, Huan. S. A et al., 2004). There was no specific enzyme that can be used for
particular cell wall type. Various factors such as age of mycelia used, time of exposure of
hyphae to the enzyme mixture, osmotic stabilizer used temperature have their effect on
protoplast formation as well as regeneration efficiency. It was shown that for Ozonium Sp.
optimum enzymatic exposure time was around 3 hours. Prolonged exposure resulted in lysed
protoplast due to the damage of plasma membrane. The enzymatic reactions were faster at
high temperatures and 30°C was observed to be optimal temperature for obtaining highest
concentrations of protoplasts. The regeneration of protoplast was very slow when one and two
days old mycelium was used for protoplast preparation when compared to three days old
mycelium. Complete regeneration was observed after 60 hours. As these factors completely
depend on particular species, they have to be adjusted according to the organism used and
enzymes being used. Use of osmolytic stabilizers help in protecting the protoplasts from
disruption. Inorganic salts, sugars and sugar alcohols could be used as osmolytic stabilizers.
Inorganic salts were shown to be appropriate for filamentous fungi as stabilizers (Zhou. X et
al., 2008, Ohmasa et al., 1999). Various lytic enzymes such as Chitinase, Pectinase,
Lysozyme, Cellulase, Yatalase, were employed individually as well as in combinations. There
are many manufacturers available in the market that has their specific catalogues for
degrading particular type of cell walls like Novozymes (Balasubramanian et al., 2003,
![Page 33: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/33.jpg)
22
Hébraud and Fèvre, 1988). The microscopic view of protoplasts from R. oryzae was as shown
in the picture (Figure 5.4.1) below.
Figure 5.4.1: Protoplasts of Rhizopus oryzae formed after 3 hour treatment with Yatalase digestion buffer
5.5 Propagation:
The reproduction in fungi is complicated and most of them involve both sexual and asexual
modes of replication. The nomenclature of fungi was also done according to the mode of
replication and it was not clearly elaborated (Hawksworth, 2011).
Similar to other members of Mucorales, Rhizopus Oryzae propagates rapidly through
dispersion of hydrophobic asexual sporangiospores after maturation. Some fungi can form
zygospores through mating between positive and negative strains and propagate sexually
(Figure 5.5.1). Most of the time, R.oryzae is haploid and their germination of zygospores was
long and rate of germination was unpredictable (Broadinstitute, 2012, Taylor et al., 2000).
![Page 34: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/34.jpg)
23
Figure 5.5.1: Diagrammatic representation of sexual and asexual cycles of propagation in Rhizopus species
(Mathes, 2001).
Rhizopus species can also produce asexual zygospores named to be azygospores which look
similar to sexually formed zygospores (microbiolocigalconcepts). Azygospores are produced
in the absence of a mating partner (Kesington, 2009). Genetic analysis of Rhizopus species
had revealed some regions in the genome responsible for developing mating characters which
regulates mating system. It was reported that the mating experiments produced zygospores
but not progeny. The location of zygospores produced was in the form of straight line
between the two compatible strains (Blakeslee et al., 1927), but the distribution was observed
around the inoculation points in the plates by the Gryganskyi and group. The colour of the
zygospores of various strains of Rhizopus species varied from reddish brown to dark brown
and large central vacuoles were observed inside them. An equal ratio (1:1) in the availability
of each mating type was observed and also sporangiospores sizes were indistinguishable in
the population of R.oryzae and R.delemar. Most of the sporangiospores were of binucleate
and of varying range of sizes (Gryganskyi et al., 2010). The microscopic and electron
microscopic pictures of conjugated hyphae were shown very clearly in the picture (Figure
5.5.2) below.
![Page 35: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/35.jpg)
24
Figure 5.5.2: Zygospores of Rhizopus oryzae. A cross between CBS346.36 (+) and CBS110.17 (−) was
analyzed with light microscopy (A) and scanning electron microscopy (B). Zygospores (white arrow heads) are
attached to an asymmetric suspensor (black arrow heads). Scale = 20 µm. Asterisks indicate conjugated hyphae
during early stage of zygospore formation (Gryganskyi et al., 2010).
5.6 Plasmids in Fungi:
Plasmids were first discovered in bacteria and later their occurrence was studied in higher
organisms such as yeast, very few in fungi, rarely in plants and also in animals. Discovery of
2µm plasmid in yeast lead to the advancements in molecular and genetic research in
eukaryotes (Broach et al., 1982). Plasmids in yeast were found in nuclei where as fungal
plasmids occur in cytoplasm mostly in mitochondria. Plasmids can be in linear or circular
form. Most of them are linear and they can be determined on gels after the treatment with
proteases. This is because the 5’ ends of the most linear plasmids were protected by a
covalently inked protein. It is difficult to find the circular plasmids as they could not be
determined by normal ethedium bromide staining unless probed with suitable compound.
Extra stronger bands appear in some cases when probes were not used in the restriction
digests of the mitochondrial extracts which represent high copy number of plasmids
(Arganoza et al., 1994). Most of the natural linear plasmids found in fungi have common
features such as terminal inverted repeat specific for each plasmid, 5’ terminus protected by a
protein covalently bound to it, dual non overlapping open reading frames present within the
terminal repeats and finally the presence of intergenic region between ORF’s. The 5’ end
binding proteins was assumed to be coded by a part of DNA polymerase sequence. When
coming to the inheritance of these plasmids, during sexual cycle of propagation, maternal
parent plasmids are transferred to the progeny but not from the paternal parent in most of the
cases observed (May and Taylor, 1989). Various findings show that natural plasmids in
fungal community can be randomly transmitted among them (Arganoza et al., 1994, Yang and
Griffiths, 1993, Griffiths et al., 1990) . There is also chance of losing the plasmids during
sexual cycle and there are several factors that affect the transmission of plasmids (Debets et
al., 1995). The replication of linear plasmids was not clearly understood but it was assumed to
be similar to viral DNA replication where it also contains protected 5’ end and inverted
terminal sequence (Salas, 1988, Sakaguchi, 1990). The replication of circular plasmids was
thought to be similar as rolling circle replication of circular elements in prokaryotes. But
analysis of ORF of Mauriceville plasmids revealed the presence of reverse transcriptase
coding region that revealed ―Reverse transcriptase‖ based replication (Griffiths, 1995).
Neurospora species was studied extensively for knowing the integration mechanisms of
plasmids in to mitochondrial DNA (mtDNA) in fungi. Senescence plasmids, kalilo (Bertrand
et al., 1985) and maranhar (Court et al., 1991) from N. intermedia and N. crassa respectively
were used for this studies and it was found that their integration process in to mtDNA was
completely different form generally observed plasmids integration mechanisms found in
prokaryotic and eukaryotic systems. These plasmids contain flanks of long inverted repeats of
mtDNA where the plasmid integrates. Replication intermediate of kalilo plasmid might
crossover with mtDNA resulting in mtDNA getting flanked to plasmid. This was different in
the case of maranhar plasmid where complete cross over occurs (Griffiths, 1995).
![Page 36: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/36.jpg)
25
5.7 Transformation:
Different methods have been developed for transforming fungi. The efficiency of
transformation of filamentous fungi depends on the type of method being used. First
transformation of yeast Saccharomyces cerevisiae was done by making protoplast mediated
transformation and it was extended to many filamentous fungi. But the frequency was much
lower when compared to S.cerevisiae. In order to improve transformation of filamentous
fungi, progress has been made over the last decade that has resulted in the establishment of
alternative methods for fungal transformation such as electroporation, biolistic transformation
and agro bacterium mediated transformation (Meyer, 2008). The method that could be used
depends on the fate of the DNA after transformation (Ruiz-Díez, 2002). That is, when the
transformation is for targeted integration or deletion of particular gene, then Agro bacterium
Mediated Transformation (AMT) would be preferable method (Michielse et al., 2005). When
multiple copies of a particular gene has to be integrated at several loci, then Protoplast
Mediated Transformation (PMT) is the best way (Fincham, 1989, Meyer et al., 2003).
Different experiments resulted in a common conclusion that recombinant mechanisms have
preferential affinity toward single stranded DNA. The table below (Table 5.7.1) shows the
main principle, advantages and disadvantages of commonly used transformation methods in
fungi.
Table 5.7.1: A brief summary of advantages and disadvantages of different approaches of
transformation and their respective applications. PMT: Protoplast-mediated transformation;
AMT: Agrobacterium-mediated transformation; EP: Electroporation; BT: Biolistic transformation;
TR: transformation rate; TE: transformation efficiency (Fincham, 1989, Ruiz-Díez, 2002, Michielse et
al., 2005).
Method Principle Advantage Disadvantage
PMT Preparation of protoplast using cell wall
degrading enzymes. Uptake of DNA is
achieved by PEG and CaCl2.
Different cell types can be
used (spores, Hypal tissue,
germlings)
Particular batch of
enzymes alter TE.
AMT DNA transfer is achieved during co-
cultivation of A. tumefaciens with the
fungus.
Copy number of DNA
insertions is low. Improves
targeted integration.
Various parameters
during co-
cultivation affect
TR. More time-
consuming than the
other methods.
EP Reversible membrane permeabilisation
induced by local application of electric
pulses mediated DNA uptake.
Different cell types can be
used. Cheap and simple
method.
Often requires
protoplast
formation to render
cells competent.
BT Particles (tungsten, gold) are coated with
DNA and become accelerated at high
velocity into cells.
Recipient cells can retain
their cell walls (no pre-
treatment necessary)
Requires special
equipment.
![Page 37: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/37.jpg)
26
These transformation procedures can be applied according to the requirement. As mentioned
in the above table, each method has its own advantages and disadvantages.
5.7.1 Protoplast Mediated Transformation using PEG/CaCl2:
Due to simplicity in operation and technical convenience, PEG/CaCl2 method was the mostly
followed procedure for transforming filamentous fungi since last 30 years (Hinnen et al.,
1978, Case et al., 1979) in spite of many disadvantages when compared to other methods. The
main disadvantage was, difficult in obtaining high concentrations of viable protoplasts, lower
transformation efficiency and unstable transformants. High molecular weight Polyethylene
Glycol (PEG) that is being used in this method helps in formation of clumps and fusion of
protoplasts. It was assumed that Polyethylene Glycol (PEG) allows the DNA to stick to the
protoplasts there by facilitates its uptake (Liu and Friesen, 2012). But recent study shows that
PEG does not cause DNA to stick to cell surface. Osmotic stabilizer and pH adjusting buffer
that were being used in this method helps in maintaining protoplast viability, whereas the role
of PEG and Ca2+
was unclear (Kuwano et al., 2008).
6. Methods and Materials
Rhizopus oryzae is a filamentous fungi and it grows very easily on various media both in
submerged form or on solid surface. In the fermentation process with this organism,
submerged fermentation is implemented. Due to its filamentous nature, the hyphae easily
tangle around the surfaces available for it inside the fermenter. This leads to great agitation
problem in large scale.
6.1 Genomic DNA extraction from R. oryzae: (Hoskins. L, 1998)
Materials required:
1-2 days old culture of R.oryzae grown in liquid semi defined glucose medium
(Appendix),
Acid washed glass beads (400-500 microns),
Sterile 10 ml microfuge tubes, Vortex machine, Heavy Phase Lock GelTM
tubes (1.5
ml), sterile eppendorf tubes (1.5 ml),
Phenol: Chloroform: Isoamyl alcohol (24:24:1), 95% Ethanol, 70% Ethanol, TE buffer
(10mM Tris HCL, 0.1 mM EDTA pH 8.0),
Distilled water, 5M NaCL,
Lysis buffer (0.1M Tris HCL pH8.0, 50 mM EDTA, 1% SDS, all the components
dissolved in distilled water).
![Page 38: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/38.jpg)
27
Procedure:
About 1 gram of grown Rhizopus oryzae was taken in to a 10ml microfuge tube using
sterile scalpel and centrifuged at high speed for 2 minutes to remove medium. The
mycelium was washed with distilled water later.
The washed mycelium was resuspended in 1 ml of lysis buffer (see that the mycelium
is completely suspended) and vortexed briefly.
The suspension was added with 300 µg of acid washed glass beads and vortexed again
to break the cells through mechanical shearing and centrifuged for 2 minutes to reduce
the foam.
The lysed cells (supernatant) were transferred to a pre spinned Heavy Phase Lock
GelTM
tubes.
Equal amount of Phenol: Chloroform: Isoamyl alcohol (24:24:1) mixture (around 500
µl) was added and mixed gently by inverting.
The tubes were centrifuged for 5 minutes at 13500 rpm and the upper phase was
transferred to a new pre spinned Heavy Phase Lock GelTM
tube.
The upper phase was again added with 500 µl of Phenol: Chloroform: Isoamyl alcohol
(24:24:1) mixture and vortexed to get uniform solution.
The mixture was centrifuged for 5 minutes and upper phase was transferred to a sterile
eppendorf tubes (1.5 ml).
1 ml of 95% ethanol was added to the tube and spinned for 6 minutes at high speed to
precipitate the DNA. Ethanol was discarded carefully without disturbing the pellet.
Again the pellet was washed with 70% ethanol by vortexing and finally centrifuged to
discard ethanol. The pellet was dried on bench for about 10 minutes and re suspended
in 50µl sterile TE buffer.
6.2 Extraction of Plasmids from paper discs:
The plasmid P silent 1 (Nakayashiki et al., 2005) was obtained from the FGSC (Kansas City,
Missouri USA) (Center). The plasmid was sent on paper discs and they were stored at 4°C in
fridge.
A paper disc was taken in to a sterile eppendorf tube and added with 100 µl of TE buffer to
dissolve the plasmid DNA present on the paper disc. The disc was crushed thorougly using a
sterile plastic tip for few seconds and the tube was centrifuged. The supernatant was used for
transforming the competent E.coli cells as described in the next section.
The DNA concentration obtained was very less and the amount of DNA for transformation
was adjusted according to the requirement for getting considerable number of transformants.
![Page 39: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/39.jpg)
28
6.3 Transformation of Competent E.coli cells using CaCl2 (Sambrook and Russell, 2001
modified)
Material required:
DH5α overnight culture,
LB medium (preparation 1), LB agar plates with ampicillin (60 µg/ml) (Appendix,
preparation 2)
0.1 M ice cold CaCl2, ice
Transforming plasmid DNA,
Procedure:
5 ml overnight grown DH5α was diluted with 95 ml of fresh LB medium in a 250 ml
flask and grown on shaking incubator at 37°C until the OD600 reaches 0.2-0.4
The cells were collected by centrifuging the broth at 4300 rpm at 4°C for 5 minutes.
Supernatant was discarded the cells were resuspended in 12.5 ml of 0.1 M ice cold
CaCl2.
The cells were maintained on ice for 30 minutes and they were collected by spinning
at 4°C.
Again the cells were re suspended in 2.5 ml 0.1 M ice cold CaCl2.
100 µl of the competent cells were mixed with 0.5 µg DNA and left on ice for 30
minutes.
The cells were subjected to heat shock for 2 minutes at 42°C using preheated water
bath.
The cells were added with 900 µl of SOC medium and left undisturbed for gene
expression to take place for 30 minutes.
Finally the transformed cells were inoculated on to LB agar plate with ampicillin
(60µg/ml) and incubated at 37°C for overnight to get the colonies of transformants.
6.4 Vector construction:
The vector should express hpRNA construct containing LDHA gene sequence in the
organism.
6.4.1 Primer designing:
For solving the purpose described above, two sets of primers were designed where both of
them amplify the same part of LDHA gene but varying at flanking ends with different
restriction sites. These flanks serve the purpose of inserting the PCR product in to the p
Silent1 vector in right orientation.
![Page 40: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/40.jpg)
29
6.4.2 Gene sequence to be amplified:
From the previous studies on silencing LDHA gene in R. oryzae through siRNA delivery
(Gheinani et al., 2011), it was shown that a set of 25bp size siRNA that was homologous to a
portion of LDHA gene (shown in yellow) triggered silencing. Depending on their finding,
portion of LDHA gene was chosen to be amplified.
LDHA gene sequence of R. oryzae CCUG 28958 was taken and used for designing primers
that can amplify the region containing (198bp -222bp) represented in yellow.
1 atggtattac actcaaaggt cgccatcgtt ggagctggtg cagtaggagc ctccactgct
61 tatgcactta tgtttaaaaa catttgtaca gaaatcatta ttgtggatgt taatcctgac
121 atcgttcaag ctcaagtcct tgaccttgca gatgctgcca gtataagtca cacgcccatc
181 cgagcaggta gcgcagagga ggcagggcag gcagatattg ttgtcatcac ggccggtgcg
241 aaacaaaggg aaggtgagcc tcggacaaag ctcattgaac gaaacttcag agtgttgcaa
301 agtatcattg gtggcatgca acccattcga ccagacgcag tcatcttggt ggtagcaaat
361 ccagtcgata tcttgacaca cattgcaaag accctctctg gactgcctcc aaaccaggtc
421 attggctccg gtacctacct tgacacgacc cgtcttcgcg tccatcttgg cgatgtcttt
481 gatgtcaatc ctcaatcggt ccatgctttt gtcttgggtg aacatgggga ttcccagatg
541 atcgcttggg aggctgcttc gattggtggg cagccgttga caagtttccc ggaattcgca
601 aagctggata aaacagcaat ttcaaaagcg atatcaggta aagcgatgga gatcattcgt
661 ttgaaaggag ccacgtttta tggaattggt gcctgtgcag cggatttagt gcacactatc
721 atgttgaata ggaaatcagt acatccagtt tctgtttatg ttgaaaagta tggagccact
781 ttttctatgc ctgctaaact tggatggaga ggtgttgaac agatctatga agtaccactg
841 acggaagaag aagaagcgct gcttgtaaaa tctgtagaag cactgaaatc agttgaatat
901 tcatctacaa aagtcccaga aaaaaaagtt catgctactt ccttttctaa aagtagctgt
961 tga
The size of the PCR product should be in the range of 300 to 600 bp for better silencing effect
(Zhong et al., 2012).
PerlPrimer v1.1.21 (Marshall, 2011) was used for primer designing and the two primer sets
used were shown below (Table 6.4.2.1) along with their restriction sites at their 5’ ends. The
amplified product was around 400 bp and the region was indicated in green in the above
sequence.
Table 6.4.2.1: FP = Forward Primer, RP = Reverse Primer, 1=set1, 2 = Set2.
Label Sequence Restriction site present
FP1 5'-ATAA[CTCGAG]GGTATTACACTCAAAGG-3' xhoI
RP1 5’-AATT[AAGCTT]GACCTGGTTTGGAG-3’ hindIII
FP2 5'-AT[GGTACC]GGTATTACACTCAAAGG-3’ kpnI
RP2 5’-AATGT[AGATCT]GACCTGGTTTGGAG-3’ BglII
![Page 41: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/41.jpg)
30
6.5 PCR:
6.5.1 Reaction mixture concentrations used (Fisher, 2010):
Table 6.5.1.1: PCR reaction mixture composition
10 X Dream TaqTM
Green Buffer 5 µl
dNTP Mix, 2mM each 5 µl (final concentration 0.2mM of each)
Forward primer, 40 µM 1 µl (final concentration 0.8 µM)
Reverse primer, 40 µM 1 µl (final concentration 0.8 µM)
Template DNA 2 µl (10 pg -1 µg)
Dream TaqTM
Polymerase (1.25 u/ µl) 1 µl
DNase free water 35 µl
Total volume 50 µl
6.5.2 Thermal cycling parameters:
Table: 6.5.2.1: PCR conditions
Step Temperature Time
1 95°C (to make ssDNA) 2 minutes
2 95°C 30 seconds
3 Annealing temperature(<Tm)
47°C for set1, 48°C for set2, 43°C for set3 and 45°C for set4
45 seconds
4 72°C 1 minute
5 72°C (final elongation to fill in all nicks) 10 minutes
6 4°C (storage) 1-2 hours
Step 4 to 2 repeated for 35 times
![Page 42: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/42.jpg)
31
6.6 Agarose gel electrophoresis:(Lewis, 2001)
Materials required:
Agarose, 10X TBE buffer (Appencix, preparation 11), Ethedium bromide (EtBr),
Electrophoresis equipment, UV lamp
Procedure:
1 gram of agarose was mixed with 100 ml 1XTBE in a conical flask.
The agarose solution was heated in a microwave oven and added with 5 µl EtBr stock
solution (10mg/ml readymade). As EtBr was carcinogenic, it was handled carefully
using gloves and eye glasses.
The mixture was poured into a casting tray equipped with an appropriate comb and
left undisturbed until solidified.
The gel chamber was carefully turned such that the comb was near the negative
electrode so that DNA moves toward the positive electrode.
The chamber was filled with 1X TBE buffer after removing the comb (see note) until
it covers the gel.
The DNA was loaded in to the wells according to the well size and the electrodes were
connected to voltmeter (110V) for required duration.
After completion of the electrophoresis, the gel was looked under UV lamp and
photographed. The buffer was collected in to a separate container which was filtered
later using charcoal and filter paper.
Note: Care should be taken not to disturb the wells while taking out the comb. The gel may
deform if sufficient time was not provided.
6.7 Purification of PCR product:
Purification of PCR product was done to get rid of DNA polymerase present in the reaction
mixture. This was done using Wizard® SV Gel and PCR clean up System (bioprotocols.info)
and concentrated by distilled water and stored at -20°C for further use.
6.8 Plasmid DNA Extraction from E.coli using Alkaline Lysis Method (Winstanley and
Rapley, 2000)
Materials required:
LB- broth (Appendix, preparation 1)
Lysis solution : 200mM NaOH, 1%SDS, (should be prepared on the same day)
Resuspension solution: 50 mM Glucose, 50mM Tris-Hcl, pH8.0, 10mM EDTA, store
at 4°C
![Page 43: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/43.jpg)
32
Potassium acetate: 3 M potassium /5M acetate: for 100ml, 29.4g of potassium acetate
was dissolved in 88.5ml of distilled water and 11.5 ml of glacial acetic acid. (should
not be autoclaved)
70 % Ethanol
Isopropanol
Procedure:
3 ml of LB-broth was inoculated with E.coli carrying vector and incubated at 37°C
overnight with shaking.
The culture was transferred into two Eppendorf tubes and centrifuged at high speed
for 30 s in microfuge and the supernatant was discarded carefully without disturbing
the pellet using pipette
100 µl of re suspension solution was added to the tube and the pellet was resuspended
by shaking or vortexing.
200 µl of lysis solution was added and the tubes were inverted several times for
mixing. The tubes were left undisturbed for 2 minutes for the lysis to take place.
150 µl of neutralizing solution (potassium acetate) was added and mixed well by
inverting which gives a white precipitate (chromosomal DNA).
The tubes were centrifuged for 5 minutes in a microfuge at 13,500 rpm.
Two new sterile tubes were filled with 250µl isopropanol and labeled.
The tubes were carefully removed from the microfuge without disturbing the
precipitate and the supernatant was carefully transferred to isopropanol containing
tubes using 1 ml pipette.
The tubes were vortexed for 10 seconds and centrifuged in the microfuge for 30s at
high speed which precipitate the plasmid DNA as white pellet.
The supernatant was discarded and pellet was washed by adding 750 µl of 70%
ethanol and centrifuged at high speed for 30s.
The ethanol was discarded and centrifuged for 10 seconds to collect the remaining
ethanol at the bottom of the tubes. the remaining ethanol was carefully aspirated and
the tubes were allowed to air dry for 5min on the bench.
50 µl of TE buffer was added into the tubes to re suspend the pellets and left
undisturbed for few minutes and checked for concentration using Spectrophotometer
(Nano drop).
After the extraction of Plasmid Psilent1 from E.coli using the above procedure, PCR product
that was amplified using first set if primers was ligated in to the plasmid using restriction
digestion and ligation protocols described below.
![Page 44: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/44.jpg)
33
6.9 Restriction digestion and Ligation:
6.9.1 Double digestion of PCR product and Plasmid:
Double digestion of purified PCR product and plasmid were done in separate PCR tubes. This
enables them to acquire sticky ends for ligation. In the first cycle of construction, one LDHA
gene was inserted by double digestion with XhoI (Fisher, 2011a) and HindIII (Fischer, 2011).
The reaction mixture for double digestion was followed as given table below.
Table 6.9.1.1: Reaction concentrations
DNA (Plasmid or PCR product) 5µg
Enzyme 5µl
10X fast digest Buffer 5µl
Total volume (make up with distilled H2O) 50µl
The order of adding the contents was water, Digestion buffer, DNA and finally enzyme. The
reaction was carried out at 37°C in a thermal cycler for one hour. The enzymes were
inactivated by incubating at 80°C for 10 minutes.
6.9.2 Inactivation of Restriction enzymes that are not heat sensitive:(uregina)
Some of the restriction enzymes used in this study where not heat sensitive and so phenol
chloroform extraction was performed to separate them from the mixture.
Method:
Double the volume of Phenol: chloroform: Isoamyl alcohol (24: 24: 1) solution was
added to the digested mixture in a sterile eppendorf tube and vortexed briefly.
The solution was spinned at 10000 rpm for 5 minutes and the supernatant was
transferred to new eppendorf tube.
Double the volume of 100% isopropanol was added for precipitating the DNA and
spinned for 5 minutes at 10000 rpm.
The pellet was washed using 70% ethanol twice and finally dried for few minutes to
evaporate traces of ethanol and dissolved using sterile TE buffer (amount adjusted to
required concentration of DNA).
![Page 45: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/45.jpg)
34
6.9.3 Ligation:
Restricted products (Plasmid and PCR product) in separate tubes were ligated using T4 DNA
ligase enzyme using the following reaction conditions (Fisher, 2011b).
Table 6.9.3.1: Reaction concentrations
Linear plasmid 20-100 ng
PCR product 1:1 to 5:1 molar ratio over plasmid
10X T4 DNA ligase buffer 2 µl
T4 DNA ligase 1 unit
Final volume (make up with distilled H2O) 20 µl
The reaction was carried out at 22°C for 20 minutes in thermal cycler and the product was
stored at -20°C for transformation in to E.coli.
The ligated product was used for transforming the E.coli using the same protocol that was
mentioned previously.
Plasmid amplification was done by inoculating the transformants in the LB medium
containing 100 µg/ml ampicillin for overnight in a shaking incubator at 37°C.
The vector was extracted from the bacteria in the same way described previously and tested if
the LDHA gene was properly inserted by running in 1.7% Agarose gel electrophoresis. After
the conformation, insertion of second LDHA gene was done.
The second LDHA gene was amplified using second set of primers and inserted in to the
vector in the same way as inserting first LDHA gene and transformed in to competent E.coli
cells using CaCl2 method for transformation. The same procedure was repeated for extraction
of plasmid and the vector was tested for proper insertion of the second LDHA gene on
agarose gel.
Now the completely constructed vector was used for transforming the protoplast prepared
from wild Rhizopus oryzae as described below.
6.10 Protoplast Preparation of Rhizopus oryzae by Using Yatalase (Jahromi and
Gheinani, 2011 modified)
Materials Required:
Semi synthetic medium (Appendix, preparation 6)
Potato dextrose agar plate (Appendix, preparation 7)
Digestion buffer prepared by Yatalase (Appendix, preparation 8)
![Page 46: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/46.jpg)
35
Distilled water
Sterile metallic sieve and scalpels
Shaking incubator
Procedure:
Inoculation:
150 ml of semi-synthetic medium was transferred to a 500ml Erlenmeyer flask.
20 ml of water was added to a cultured potato dextrose agar plate (PDA) and 3ml of it
was added to the semi synthetic medium.
It was incubated at 30°C and 140rpm, for 3-4 days. (see note)
Protoplast preparation:
The mycelium was taken in to a sterilized sieve and around 1 gram of mycelium was
transferred to a 50 ml sterile plastic tube near flame using scalpel.
Yatalase digestion buffer was added to the tube with mycelium (10ml/g mycelium)
The tube was kept on a shaking incubator for 3hours at 30°C and 90rpm. Protoplast
formation was checked in between in a light microscope.
The digested mycelium was filtered through single layer of gauze cloth in to a new
tube near the flame and centrifuged in a swing bucket rotor at 4°C and 3500 rpm for 5
minutes.
The pellet was separated from supernatant with little solution left.
The pellet was vortexed and immediately used for transformation or can be stored at -
20°C for further use.
Note: The incubation time was very crucial which determines the frequency of protoplast
regeneration. Use of young cultures (1-2 days) for protoplast preparation may give less
frequency of protoplast regeneration which is not desirable.
6.11 Transformation of Rhizopus oryzae by the Calcium Chloride/Polyethylene
Glycol (CaCl2/PEG) method (Jahromi and Gheinani, 2011 modified)
Materials required:
Ice, PEG solution (from preparation 10), STC buffer (Appendix, preparation 9), PDA plates
(from preparation 7 *see note), linearized plasmid vector DNA by SpeI, Protoplasts
Procedure:
100 µl of protoplast solution of Rhizopus oryzae was transferred to 15ml sterile plastic
tube along with 100 µl plasmid DNA (conc. from 1 - 2 µg/ml) (silencing vector) and
mixed gently using pipette.
![Page 47: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/47.jpg)
36
The tube was incubated on ice for 15 minutes.
PEG solution was added to the tube in incremental order of 200 µl, 400 µl and 600 µl
and mixed gently by pipetting up and down each time.
The tube was left on ice for 10 minutes and then centrifuged for 3 minutes at 3700
rpm (or 2000 x g) at 4°C.
The supernatant was discarded and 1ml of STC buffer was added to re suspend the
protoplasts.
The whole protoplast solution was used for spreading on the prepared potato dextrose
agar plate incubated at 30°C.
The growth of transformed Rhizopus oryzae is visible only after 24 hours of
incubation.
*Note: Care should be taken to have the level of agar medium in the plates to be half of the
maximum volume.
6.12 Sub culturing of transformed R. oryzae
To test if the if a permanent change in the genome has been induced to R. oryzae the
transformed R. oryzae was sub cultured by letting them grow fully in 3 days and form spores
in about 6 days..
Materials required:
Distilled water, sterile plastic spreader, pipette, PDA plates (Appendix, preparation7), sterile
plastic tube, and cultured plates of transformed R.oryzae.
Procedure:
20 ml distilled water was used to dilute the formed spores in the culture plates and
they are slowly streaked using sterile plastic tube to suspend the spores.
The spore suspension was transferred carefully in to sterile plastic tube near the flame
and mixed well to get uniform solution.
100 µl of this spore suspension was inoculated on to new PDA plates and incubated
for 3 days at 30°C.nomic DNA was extracted from transformed Rhizopus oryzae
cultures as well as subculture and submitted for PCR analysis to find out if the vector
was present in the second generation compared with the first.
6.13 Primer design for amplifying LDHA gene along with cutinase intron:
Cutinase intron sequence was taken from P silent 1 vector and primers were designed that can
amplify LDHA gene along with cutinase intron. Two possible orientations for vector having
two copies of LDHA gene was LDHA- CUT and CUT-LDHA. Cutinase intron gene sequence
was as shown below:
![Page 48: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/48.jpg)
37
gtgagccttt cttcttgcct ctctttgttt tttttttgtt ctttttgccg aatagtgtac ccactggaga tttgttggcc
atgcaaataa atggaaggga ctgacaagat tgtgaaattg ttcaaaacac acag
Two primer sets designed for amplifying part of LDHA gene along with cutinase intron were
mentioned in table below:
Table 6.13.1: FP = Forward Primer, RP = Reverse Primer, 3=set3, 4 = Set4.
Label Sequence
FP3 5' TATTACACTCAAAGGTCGCCA 3'
RP3 5'TCACAATCTTGTCAGTCCCT 3'
FP4 5'AGCCTTTCTTCTTGCCTCTC 3'
RP4 5'GAGAGGGTCTTTGCAATGTG 3'
Both these primers can amplify DNA of length around 530 bp.
Using the set of primers in table 6.13.1the genomic DNA from transformed cultures and sub
culture were amplified with PCR and the presence of the integrated vector was investigated
by DNA electrophoresis.
![Page 49: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/49.jpg)
38
7. Results and Discussion
7.1 LDHA gene amplification through PCR:
PCR amplification of selected portion of LDHA gene was performed using two sets of
primers having varying flanks at their respective 5’ ends. One set of primers have the flanks
containing restriction sites for KpnI and BglII. Second set of primers contain flanks with
recognition sites for XhoI and HindIII endonucleases. These flanks help in the insertion of
LDHA gene in to open Psilent-1 plasmid in a fashion that it can transcribe an hpRNA
structure after transforming in to host organism.
Figure 7.1.1: 1% Agarose gel electrophoresis showing bands of PCR product of R.Oryzae
genome with LDHA primers.
![Page 50: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/50.jpg)
39
From the gel picture shown above (figure 7.1.1), it can be confirmed that the region amplified
was of correct length (420bp) as expected.
7.2 Psilent 1 with one LDHA gene inserted in it:
The two sets of LDHA gene were inserted in to empty vector in a sequential order. First set of
LDHA gene was inserted by opening the plasmid using restriction enzymes XhoI and HindIII.
The size of the empty vector was around 6.9 kb and after inserting one copy of LDHA gene, it
was around 7.32 kb. This is shown in the picture below (figure 7.2.1). The difference between
the empty vector and vector with one copy of LDHA gene is small (420 bp). So there is only a
little difference observed in the gel picture.
Figure 7.2.1: 1.7% agarose gel electrophoresis showing bands of linear Psilent1 with LDHA
(left), Psilent 1 (middle) and 1kb+ ladder (right). Psilent 1 was 6.9 kb in length and LDHA
gene was 0.42 kp in length.
During the insertion of LDHA gene in to the empty vector, the plasmid was cut open using
double digestion. This reaction cuts the plasmid twice which will not help in self ligation of
the vector. All the transformants with ampicillin resistance were considered to be having the
plasmid with LDHA gene inserted in it. But the average transformed colonies obtained per µg
of DNA were very less. Each time of transformation, around 2 µg of DNA was used.
![Page 51: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/51.jpg)
40
After double digestion of the plasmid and the PCR product using different restriction
enzymes, XhoI and HindIII were deactivated by heating at 80°C for 10 minutes.
But when coming to the inactivation of second set of restriction enzymes, KpnI and BglII,
they are not sensitive to heat. So they were separated using common Phenol chloroform
extraction. Huge amount of DNA was lost during this step and to get the considerable amount
of DNA after purification, large amount of DNA has to be used. During this experiment,
restriction enzymes from different manufacturers were employed for double digestion and
there was no compatibility issues in the buffers used. All the enzymes worked well in Fast
digest buffer from Fermentas®.
Higher concentrations of plasmid were obtained by transforming it in to E.coli, amplifying it
and extracting plasmid DNA.
7.3 Complete vector after inserting second LDHA gene in to the vector:
After inserting the second copy of LDHA gene, the difference between the empty vector and
vector with two copies of LDHA gene was around 840 bp. This is clearly shown in the picture
below (figure 7.3.1). The vector was cut open using HindIII and loaded in to the gel for
analysis all the time.
Figure 7.3.1: 1.7% agarose gel electrophoresis picture showing bands of completely
constructed vector (right), vector with one copy of LDHA gene (in lane 2), empty vector (left)
and 1kb+ DNA ladder.
The final vector after inserting two copies of LDHA gene was around 7.74 Kb in length.
![Page 52: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/52.jpg)
41
7.4 Protoplast formation from R. oryzae:
The efficiency of protoplast formation depends on various factors such as the age of the
culture used, enzyme used for breaking cell wall and incubation time. The regeneration
capability was also affected by varying above mentioned factors. Lysozyme and Yatalase
were used for generating the protoplast. Among these enzymes, Lysozyme did not give better
yield when compared to Yatalase. The regeneration of protoplast was better and protoplast
formation took long time if the three days old culture was used. If two days old culture was
used, regeneration efficiency decreased and protoplast formation was faster when compared
to the previous case. This might be due to well developed cell wall formation in the organism
with age. The average regeneration time was around 2 days and spore formation was after 4
days.
Figure 7.6.1: Microscopic pictures showing the formation of protoplast from hyphae of
R.oryzae.
The number of protoplasts formed increases with time of incubation in Yatalase lysis solution.
The protoplasts were observed under the microscope after every hour.
The protoplasts prepared were subjected to transformation by PEG/CaCl2 method using the
new vector DNA cut opened by SpeI (linearized). Linearization of vector prior to
transformation is very important as that enhances the chance of getting the transformed vector
to integrate in to host genome through homologous recombination. This was clearly
demonstrated by previous researchers in various fungal species with regards to integration of
linear plasmids in to chromosomal DNA (Griffiths, 1995).
7.5 Hygromycin resistance for Rhizopus oryzae:
To find out if the strain used in this study has antibiotic resistance, spores of wild type were
inoculated in to semi defined media along with varying concentrations of Hygromycin. To
know the maximum level of tolerance, the range was set from 200µg/ml to 1000µg/ml.
![Page 53: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/53.jpg)
42
Figure 7.5.1: Flask fermenters showing growth of R.Oryzae wild type at various
concentrations (200 to 1000 µg/ml) of hygromycin.
It was seen that wild type Rhizopus oryzae had hygromycin resistance and it can tolerate the
concentrations as high as 1000 µg /ml which was common among fungal species. The growth
pattern was almost similar and there is no decrease in hyphal mass with increase in antibiotic
concentration. This demonstrates that Hygromycin does not have any lethal effect on the
mycelium.
Because of this a great problem came up when selecting the transformants having the vector
from wild type. Hygromycin couldnot be used as a selection marker in this organism
transformed with Psilent 1 vector.
7.6 Confirmation of transformed R.oryzae and demonstration of the stability in the
progeny:
As hygromycin resistance gene in the vector could not be used as a marker for knowing the
transformants the problem had to be solved in another way. DNA was extracted from wild
type and transformed R. oryzae, both first and second generation. PCR was performed using
the primers (see 6.13) that can amplify Cutinase gene along with LDHA sequence. The
different primers with varying annealing temperatures were tested to have the specific binding
to amplify the target sequence. The primers that were mentioned in the section 6.12 gave
bands that can be helpful to show the variation between transformants and wild type. The
picture below (figure 7.7.1) shows the bands of PCR products of genomic DNA from
transformants first generation, tranformants second generation, and wild type.
![Page 54: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/54.jpg)
43
Figure 7.7.1: Gel picture showing PCR products of DNA extracted from wild type (-ve control),
transformed, subculture of R.oryzae and P silent 1 (+ve control).
The expected length of the amplicon is 530 bp with the designed primers. From picture 7.7.1,
it can be confirmed that, transformed R.oryzae first generation and second generation of
transformed R.oryzae has the vector present in them. This clearly shows that the vector was
transferred to its progeny, and that a stable transformant of R. oryzae with an ingral vector for
hpRNA expression.
8. Conclusion
Many vectors are in use for gene silencing in plants and animal cell lines till date but,
considerably less when coming to fungal species. The present work shows the vector
construction (figure 8.1) and transformation of a Rhizopus oryzae species. It also shows that
this vector is stable in the progeny and thereby creates a permanent change to the genome of
the host cell mostly through homologous recombination. Finally, it is shown that there is a
Hygromycin resistance in the R. oryzae strain CCUG 28959 that in the literature never has
been reported before. In the future the constructed vector (figure 8.1) can be used as a model
for silencing various genes of interest in this species and thereby achieving a stable silencing
effect.
![Page 55: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/55.jpg)
44
Figure 8.1: Diagrammatic representation of vector construction, transformation and final synthesis of
hpRNA.
8.1 Draw backs of present work:
This vector cannot be selected directly in this strain as it processes Hygromycin resistance.
Hygromycin resistance was the only marker present in this vector for selection in fungi. The
only way of knowing the transformation is PCR analysis of genomic DNA using specific
primers that can amplify particular region in the transformed plasmid. This is very laborious
process when compared to direct selection.
9. Further research
9.1 Optimization and analysis of Fermentation with transformed Rhizopus oryzae:
The next step of interest would be to do fermentation using the transformed Rhizopus oryzae
with constructed vector and to optimize the process to increase ethanol production on the
behalf of lactate silencing in a R.oryzae strain with high lactate production.
9.2 Changing the inserted LDHA gene sequence in the vector:
The LDHA gene sequence that was used in the present study was 430 bp, only a part of the
total gene (ca 900 bp) and it was chosen according to the siRNA used in the previous
![Page 56: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/56.jpg)
45
research. Other part of the gene can be tried for constructing the vector followed by tests of
the silencing efficiency.
9.3 Improving the silencing vector by inserting eGFP gene:
This vector can be further improved by inserting eGFP gene which will have the property of
giving fluorescence in the transformers and thereby will help in differentiating the
transformants from wild type. This will solve the purpose of direct selection instead of PCR
analysis as done in the present work and thereby saves time in analyzing the transformants for
the presence of transformed vector.
![Page 57: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/57.jpg)
46
10. References
ABEDINIFAR, S., KARIMI, K., KHANAHMADI, M. & TAHERZADEH, M. J. 2009.
Ethanol production by Mucor indicus and Rhizopus oryzae from rice straw by separate
hydrolysis and fermentation. Biomass and Bioenergy, 33, 828-833.
ADACHI, E., TORIGOE, M., SUGIYAMA, M., NIKAWA, J.-I. & SHIMIZU, K. 1998.
Modification of metabolic pathways of Saccharomyces cerevisiae by the expression of
lactate dehydrogenase and deletion of pyruvate decarboxylase genes for the lactic acid
fermentation at low pH value. Journal of Fermentation and Bioengineering, 86, 284-
289.
AKASHI, H., MATSUMOTO, S. & TAIRA, K. 2005. Gene discovery by ribozyme and
siRNA libraries. Nature Reviews Molecular Cell Biology, 6, 413-422.
AMADIOHA, A. C. 1993. Production of Cellulolytic Enzymes by Rhizopus oryzae in Culture
and Rhizopus-Infected Tissues of Potato Tubers. Mycologia, 85, 574.
AMORE, A. & FARACO, V. 2012. Potential of fungi as category I Consolidated
BioProcessing organisms for cellulosic ethanol production. Renewable and
Sustainable Energy Reviews, 16, 3286-3301.
ARCHER, D. B. & WOOD, D. A. 1994. Fungal Exoenzymes The Growing Fungus. In:
GOW, N. & GADD, G. (eds.) The Growing Fungus. Springer Netherlands.
ARGANOZA, M. T., MIN, J., HU, Z. & AKINS, R. A. 1994. Distribution of seven homology
groups of mitochondrial plasmids in Neurospora: evidence for widespread mobility
between species in nature. Current Genetics, 26, 62-73.
BALASUBRAMANIAN, N., JULIET, A., SRIKALAIVANI, P. & LALITHAKUMARI, D.
2003. Release and regeneration of protoplasts from the fungus Trichothecium roseum.
Canadian Journal of Microbiology, 49, 263-268.
BARNES, S., ALCOCER, M. & ARCHER, D. 2008. siRNA as a molecular tool for use in
<i>Aspergillus niger</i>. Biotechnology Letters, 30, 885-890.
BAUTISTA, L. F., ALEKSENKO, A., HENTZER, M., SANTERRE-HENRIKSEN, A. &
NIELSEN, J. 2000. Antisense silencing of the creA gene in Aspergillus nidulans.
Applied and environmental microbiology, 66, 4579-4581.
BERTRAND, H., CHAN, B. S. & GRIFFITHS, A. J. 1985. Insertion of a foreign nucleotide
sequence into mitochondrial DNA causes senescence in Neurospora intermedia. Cell,
41, 877-884.
BIOPROTOCOLS.INFO. LB Medium and Agar Plate Recipe [Online]. Available:
http://www.bioprotocols.info/model_organisms/bacteria/lb_medium_and_plates.php
[Accessed 07-17 2012].
BIOPROTOCOLS.INFO. TBE Buffer Recipe (Tris-Borate-EDTA) [Online]. Available:
http://www.bioprotocols.info/reagent_and_buffer_recipes/10X-TBE.php [Accessed
07-26 2012].
BLAKESLEE, A. F., CARTEDGE, J. L., WELCH, D. S. & BERGNER, A. D. 1927. Sexual
dimorphism in Mucorales I. Intraspecific Reaction. Botanical Gazette, 84, 51-57.
BROACH, J. R., GUARASCIO, V. R. & JAYARAM, M. 1982. Recombination within the
yeast plasmid 2mu circle is site-specific. Cell, 29, 227-234.
BROADINSTITUTE. 2012. Rhizopus oryzae Project information [Online]. Available:
http://www.broadinstitute.org/annotation/genome/rhizopus_oryzae/Info.html
[Accessed 2012-07-03].
![Page 58: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/58.jpg)
47
BÜYÜKKILECI, A. O., HAMAMCI, H. & YUCEL, M. 2006. Lactate and ethanol
productions by Rhizopus oryzae ATCC 9363 and activities of related pyruvate branch
point enzymes. Journal of Bioscience and Bioengineering, 102, 464-466.
CAI, Y., LAI, C., LI, S., LIANG, Z., ZHU, M., LIANG, S. & WANG, J. 2011. Disruption of
lactate dehydrogenase through homologous recombination to improve bioethanol
production in Thermoanaerobacterium aotearoense. Enzyme and Microbial
Technology, 48, 155-161.
CANAN. T, KAMER ÖZKANÖ, SELALE ONCUÖ & TUBA AVCı 2011. The relationship
of pellet morphology tp Polygalactutonase production of Rhizopus oryzae in various
media compositions. GIDA, 36, 25-31.
CASE, M., SCHWEIZER, M., KUSHNER, S. & GILES, N. 1979. Efficient transformation of
Neurospora crassa by utilizing hybrid plasmid DNA. Proceedings of the National
Academy of Sciences, 76, 5259-5263.
CENTER, F. G. S. Available: http://www.fgsc.net/ [Accessed 08-03 2012].
COURT, D. A., GRIFFITHS, A. J., KRAUS, S. R., RUSSELL, P. J. & BERTRAND, H.
1991. A new senescence-inducing mitochondrial linear plasmid in field-isolated
Neurospora crassa strains from India. Current Genetics, 19, 129-137.
DEBETS, F., YANG, X. & GRIFFITHS, A. J. 1995. The dynamics of mitochondrial plasmids
in a Hawaiian population of Neurospora intermedia. Current Genetics, 29, 44-49.
EAMENS, A., WANG, M.-B., SMITH, N. & WATERHOUSE, P. 2008. RNA silencing in
plants: yesterday, today, and tomorrow. Plant physiology, 147, 456-468.
EDEBO, L. 2000. Cultivation of Zygomycetes from spent sulfite liquor World Patent
WO0063344
ELKINS, J., RAMAN, B. & KELLER, M. 2010. Engineered microbial systems for enhanced
conversion of lignocellulosic biomass. Current Opinion in Biotechnology, 21, 657-
662.
FERREIRA. A.J, PATRIK R. LENNARTSSON, CLAES NIKLASSON, MAGNUS
LUNDIN, LARS EDEBO & TAHERZADEH, M. J. 2012. "Production of Rhizopus
sp. from SSL" BioResources 7(1), 173-188. 173.
FINCHAM, J. R. S. 1989. Transformation in fungi. Microbiological Reviews, 53, 148-170.
FIRE, A., XU, S., MONTGOMERY, M., KOSTAS, S., DRIVER, S. & MELLO, C. 1998.
Potent and specific genetic interference by double-stranded RNA in Caenorhabditis
elegans. Nature, 391, 806-811.
FISCHER, T. S. 2011. FastDigest® HindIII [Online]. Available:
http://www.fermentas.com/en/products/all/fastdigest-restriction-enzymes/fd050-
hindiii [Accessed 2012-07-12].
FISHER, T. S. 2010. Fermentas, Dream TaqTM Green Polymerase [Online]. Available:
http://www.fermentas.de/product_info.php?info=p601 [Accessed 2012-07-11 2012].
FISHER, T. S. 2011a. FastDigest® XhoI [Online]. Available:
http://www.fermentas.com/en/products/all/fastdigest-restriction-enzymes/fd069-xhoi
[Accessed 2012-07012].
FISHER, T. S. 2011b. T4 DNA ligase [Online]. Available:
http://www.fermentas.com/en/products/all/molecular-cloning/enzymes/el001-t4-dna-
ligase [Accessed 2012-07-12 2012].
FITZGERALD, A., VAN KAN, J. & PLUMMER, K. 2004. Simultaneous silencing of
multiple genes in the apple scab fungus, Venturia inaequalis, by expression of RNA
with chimeric inverted repeats. Fungal genetics and biology : FG & B, 41, 963-971.
![Page 59: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/59.jpg)
48
GARCIA, B. 1968. Cell Wall Chemistry, Morphogenesis, and Taxonomy of Fungi. Annual
Review of Microbiology, 22, 87-108.
GHEINANI, A. H., JAHROMI, N. H., FEUK-LAGERSTEDT, E. & TAHERZADEH, M.
2011. RNA silencing of lactate dehydrogenase gene in Rhizopus oryzae. Journal of
RNAi and gene silencing : an international journal of RNA and gene targeting
research, 7, 443-448.
GRIFFITHS, A. F., KRAUS, S., BARTON, R., COURT, D., MYERS, C. & BERTRAND, H.
1990. Heterokaryotic transmission of senescence plasmid DNA in Neurospora.
Current Genetics, 17, 139-145.
GRIFFITHS, A. J. 1995. Natural plasmids of filamentous fungi. Microbiological Reviews, 59,
673-685.
GRYGANSKYI, A., LEE, S., LITVINTSEVA, A., SMITH, M., BONITO, G., PORTER, T.,
ANISHCHENKO, I., HEITMAN, J. & VILGALYS, R. 2010. Structure, Function, and
Phylogeny of the Mating Locus in the Rhizopus oryzae Complex. PLoS ONE, 5,
e15273.
HAMMOND, S. M., BOETTCHER, S., CAUDY, A. A., KOBAYASHI, R. & HANNON, G.
J. 2001. Argonaute2, a Link Between Genetic and Biochemical Analyses of RNAi.
Science, 293, 1146-1150.
HASUNUMA, T. & KONDO, A. 2011. Development of yeast cell factories for consolidated
bioprocessing of lignocellulose to bioethanol through cell surface engineering.
Biotechnology Advances.
HAWKSWORTH, D. 2011. A new dawn for the naming of fungi: impacts of decisions made
in Melbourne in July 2011 on the future publication and regulation of fungal names. 1,
7-20.
HAYES, D. J. 2009. An examination of biorefining processes, catalysts and challenges.
Catalysis Today, 145, 138-151.
HÉBRAUD, M. & FÈVRE, M. 1988. Protoplast production and regeneration from
mycorrhizal fungi and their use for isolation of mutants. Canadian Journal of
Microbiology, 34, 157-161.
HINNEN, A., HICKS, J. B. & FINK, G. R. 1978. Transformation of yeast. Proceedings of the
National Academy of Sciences, 75, 1929-1933.
HOSKINS. L, M., HAHN LAB 1998. Quick Yeast DNA Prep: Isolation of Total DNA
(genomic and plasmid) [Online]. Available:
http://labs.fhcrc.org/hahn/Methods/mol_bio_meth/yeast_quick_dna.html [Accessed
08-03 2012].
HUAN. S. A, HONG-YE LI & LIU, X.-H. 2004. Isolation and regeneration of protoplasts
from Penicillium digitatum. Chinese Journal of Agricultural Biotechnology, 1.
IBRAHIM, A., GEBREMARIAM, T., LIN, L., LUO, G., HUSSEINY, M., SKORY, C., FU,
Y., FRENCH, S., EDWARDS, J. & SPELLBERG, B. 2010. The high affinity iron
permease is a key virulence factor required for Rhizopus oryzae pathogenesis.
Molecular Microbiology, 77, 587-604.
ISHIDA, N., SUZUKI, T., TOKUHIRO, K., NAGAMORI, E., ONISHI, T., SAITOH, S.,
KITAMOTO, K. & TAKAHASHI, H. 2006. d-Lactic acid production by
metabolically engineered Saccharomyces cerevisiae. Journal of Bioscience and
Bioengineering, 101, 172-177.
JAHROMI, N. & GHEINANI, A. 2011 modified. RNA Silencing of Lactate Dehydrogenase
Gene in Rhizopus oryzae [Online]. Borås: University of Borås. Available:
http://hdl.handle.net/2320/7991 [Accessed Master].
![Page 60: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/60.jpg)
49
JAMES D. WATSON, T. A. B., STEPHEN P. BELL, ALEXANDER GANN, MICHAEL
LEVINE, RICHARD LOSICK 2008. Molecular Biology Of The Gene, CSHL Press.
KADOTANI, N., NAKAYASHIKI, H., TOSA, Y. & MAYAMA, S. 2003. RNA silencing in
the phytopathogenic fungus Magnaporthe oryzae. Molecular plant-microbe
interactions : MPMI, 16, 769-776.
KARIMI, K., EMTIAZI, G. & TAHERZADEH, M. 2006. Ethanol production from dilute-
acid pretreated rice straw by simultaneous saccharification and fermentation with
Mucor indicus, Rhizopus oryzae, and Saccharomyces cerevisiae. Papers from the 1st
International Conference on Environmental, Industrial and Applied Microbiology
(BioMicroWorld-2005), 40, 138-144.
KESINGTON. 2009. Asexual reproduction of Fungi. Fungi infection [Online]. Available
from: http://fungi.health-tips-diseases.com/2009/09/asexual-reproduction-of-
fungi.html [Accessed 08-21 2012].
KHATRI, M. & RAJAM, M. V. 2007. Targeting polyamines of Aspergillus nidulans by
siRNA specific to fungal ornithine decarboxylase gene. Medical mycology, 45, 211-
220.
KITAMOTO, N., YOSHINO, S., OHMIYA, K. & TSUKAGOSHI, N. 1999. Sequence
analysis, overexpression, and antisense inhibition of a β- xylosidase gene, xylA, from
Aspergillus oryzae KBN616. Applied and environmental microbiology, 65, 20-24.
KITPREECHAVANICH, V., MANEEBOON, T., KAYANO, Y. & SAKAI, K. 2008.
Comparative Characterization of l-Lactic Acid-Producing Thermotolerant Rhizopus
Fungi. Journal of Bioscience and Bioengineering, 106, 541-546.
KRAJAEJUN, T., GAUTHIER, G. M., RAPPLEYE, C. A., SULLIVAN, T. D. & KLEIN, B.
S. 2007. Development and application of a green fluorescent protein sentinel system
for identification of RNA interference in Blastomyces dermatitidis illuminates the role
of septin in morphogenesis and sporulation. Eukaryotic Cell, 6, 1299-1309.
KUWANO, T., SHIRATAKI, C. & ITOH, Y. 2008. Comparison between polyethylene
glycol- and polyethylenimine-mediated transformation of Aspergillus nidulans.
Current Genetics, 54, 95-103.
LA GRANGE, D. C., DEN HAAN, R. & VAN ZYL, W. H. 2010. Engineering cellulolytic
ability into bioprocessing organisms. Applied Microbiology & Biotechnology, 87,
1195-1208.
LENNARTSSON, P. 2012. Zygomycetes and cellulose residuals: hydrolysis, cultivation and
applications.PhD Thesis, Chalmers University of Technology, Göteborg.
LEWIS, M. 2001. Agarose gel electrophoresis (basic method) modified [Online]. Department
of Pathology, University of Liverpool. Available:
http://www.methodbook.net/dna/agarogel.html [Accessed 07-26 2012].
LINHUI. L, QINGYU YIN, XIAOHONG LIU & YANG, H. 2010. An efficient protoplast
isolation and regeneration system in Coprinus comatus. African Journal of
Biotechnology.
LIU, H., COTTRELL, T., PIERINI, L., GOLDMAN, W. & DOERING, T. 2002. RNA
interference in the pathogenic fungus Cryptococcus neoformans. Genetics, 160, 463-
470.
LIU, Z. & FRIESEN, T. 2012. Polyethylene Glycol (PEG)-Mediated Transformation in
Filamentous Fungal Pathogens Plant Fungal Pathogens. In: BOLTON, M. &
THOMMA, B. (eds.). Humana Press.
LOMBRAÑA, M., MORALEJO, F. J., PINTO, R. & MARTÍN, J. F. 2004. Modulation of
Aspergillus awamori thaumatin secretion by modification of bipA gene expression.
Applied and environmental microbiology, 70, 5145-5152.
![Page 61: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/61.jpg)
50
LYND, L., ZYL, W., MCBRIDE, J. & LASER, M. 2005. Consolidated bioprocessing of
cellulosic biomass: an update. Current Opinion in Biotechnology, 16, 577-583.
MARSHALL, O. 2011. PerlPrimer open source PCR primer design [Online]. Available:
http://perlprimer.sourceforge.net/download.html [Accessed 2012-07-10 2012].
MATHES, M. 2001. Biology 205: General Botany, Spring 2001 [Online]. College of William
and Mary. Available: http://www.resnet.wm.edu/~mcmath/bio205/index.html
[Accessed 08-21 2012].
MAY, G. & TAYLOR, J. W. 1989. Independent transfer of mitochondrial plasmids in
Neurospora crassa. Nature, 339, 320-322.
MCDONALD, T., BROWN, D., KELLER, N. & HAMMOND, T. 2005. RNA silencing of
mycotoxin production in Aspergillus and Fusarium species. Molecular plant-microbe
interactions : MPMI, 18, 539-545.
MEUSSEN, B., DE GRAAFF, L., SANDERS, J. & WEUSTHUIS, R. Metabolic engineering
of <i>Rhizopus oryzae</i> for the production of platform chemicals.
Applied Microbiology and Biotechnology, 1-12.
MEUSSEN, B., GRAAFF, L., SANDERS, J. & WEUSTHUIS, R. 2012. Metabolic
engineering of Rhizopus oryzae for the production of platform chemicals. Applied
Microbiology and Biotechnology, 94, 875-886.
MEYER, V. 2008. Genetic engineering of filamentous fungi — Progress, obstacles and future
trends. Biotechnology Advances, 26, 177-185.
MEYER, V., MUELLER, D., STROWIG, T. & STAHL, U. 2003. Comparison of different
transformation methods for <i>Aspergillus giganteus</i>. Current
Genetics, 43, 371-377.
MICHIELSE, C. B., HOOYKAAS, P. J. J., VAN DEN HONDEL, C. A. M. J. J. & RAM, A.
F. J. 2005. Agrobacterium-mediated transformation as a tool for functional genomics
in fungi. Current Genetics, 48, 1-17.
MICHIELSE, C. B., SALIM, K., RAGAS, P., RAM, A. F., KUDLA, B., JARRY, B., PUNT,
P. J. & VAN DEN HONDEL, C. A. 2004. Development of a system for integrative
and stable transformation of the zygomycete Rhizopus oryzae by Agrobacterium-
mediated DNA transfer. Molecular genetics and genomics : MGG, 271, 499-510.
MICROBIOLOCIGALCONCEPTS. Reproduction: Fungi [Online]. Available:
http://bugs.bio.usyd.edu.au/learning/resources/CAL/Microconcepts/Reproduction/fung
iRepro.html [Accessed].
MILLATI, R., EDEBO, L. & TAHERZADEH, M. J. 2005. Performance of Rhizopus,
Rhizomucor, and Mucor in ethanol production from glucose, xylose, and wood
hydrolyzates. Enzyme and Microbial Technology, 36, 294-300.
MOLNAR, A., SCHWACH, F., STUDHOLME, D., THUENEMANN, E. & BAULCOMBE,
D. 2007. miRNAs control gene expression in the single-cell alga Chlamydomonas
reinhardtii. Nature, 447, 1126-1129.
MORALEJO, F. J., CARDOZA, R. E., GUTIERREZ, S., LOMBRAÑA, M., FIERRO, F. &
MARTÍNI, J. F. 2002. Silencing of the aspergillopepsin B (pepB) gene of Aspergillus
awamori by antisense RNA expression or protease removal by gene disruption results
in a large increase in thaumatin production. Applied and environmental microbiology,
68, 3550-3559.
MOUYNA, I., HENRY, C., DOERING, T. & LATGÉ, J.-P. 2004. Gene silencing with RNA
interference in the human pathogenic fungus Aspergillus fumigatus. FEMS
Microbiology Letters, 237, 317-324.
MÜLLER, D., TESCHE, M., EICHLER, H., ENGELMANN, R., ALTHAUSEN, D.,
ANSMANN, A., CHENG, Y. F., ZHANG, Y. H. & HU, M. 2006. Strong particle
![Page 62: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/62.jpg)
51
light absorption over the Pearl River Delta (south China) and Beijing (north China)
determined from combined Raman lidar and Sun photometer observations.
Geophysical Research Letters, 33.
NAKAYASHIKI, H., HANADA, S., QUOC, N. B., KADOTANI, N., TOSA, Y. &
MAYAMA, S. 2005. RNA silencing as a tool for exploring gene function in
ascomycete fungi. Fungal Genetics and Biology, 42, 275-283.
NAKAYASHIKI, H. & NGUYEN, Q. B. 2008. RNA interference: roles in fungal biology.
Current Opinion in Microbiology, 11, 494-502.
NGUYEN, Q. B., KADOTANI, N., KASAHARA, S., TOSA, Y., MAYAMA, S. &
NAKAYASHIKI, H. 2008. Systematic functional analysis of calcium-signalling
proteins in the genome of the rice-blast fungus, Magnaporthe oryzae, using a high-
throughput RNA-silencing system. Molecular Microbiology, 68, 1348-1365.
NOBELPRIZE.ORG. 2006. "Press Release: The 2006 Nobel Prize in Physiology or
Medicine" [Online]. Nobelprize.org. Available:
http://www.nobelprize.org/nobel_prizes/medicine/laureates/2006/press.html
[Accessed 18 Jan 2012 2012].
OHMASA, M., KIKUCHI, S. & KAWAKAMI, K. 1999. Preparation and regeneration of
protoplasts of three fungi of Boletaceae. Mycoscience, 40, 433-436.
PAROO, Z., LIU, Q. & WANG, X. 2007. Biochemical mechanisms of the RNA-induced
silencing complex. Cell Research, 17, 187-194.
PRITCHARD 1971. An NAD+-independent l-lactate dehydrogenase from Rhizopus oryzae.
Biochimica et Biophysica Acta (BBA) - Enzymology, 250, 25-34.
PUNT, P. J., OLIVER, R. P., DINGEMANSE, M. A., POUWELS, P. H. & VAN DEN
HONDEL, C. A. M. J. J. 1987. Transformation of Aspergillus based on the
hygromycin B resistance marker from Escherichia coli. Gene, 56, 117-124.
ROMANO, N. & MACINO, G. 1992. Quelling: transient inactivation of gene expression in
Neurospora crassa by transformation with homologous sequences. Molecular
Microbiology, 6, 3343-3353.
RUIZ-DÍEZ, B. 2002. A Review: Strategies for the transformation of filamentous fungi.
Journal of Applied Microbiology, 92, 189-195.
RUTZ, S. & SCHEFFOLD, A. 2004. Towards in vivo application of RNA interference - new
toys, old problems. Arthritis Res Ther, 6, 78-85.
SAKAGUCHI, K. 1990. Invertrons, a class of structurally and functionally related genetic
elements that includes linear DNA plasmids, transposable elements, and genomes of
adeno-type viruses. Microbiological Reviews, 54, 66-74.
SALAS, M. 1988. Initiation of DNA replication by primer proteins: bacteriophage phi 29 and
its relatives. Current topics in microbiology and immunology, 136, 71-88.
SAMBROOK & RUSSELL 2001 modified. Molecular cloning : A laboratory manual. 3rd.
SCHUMANN, U., AYLIFFE, M., KAZAN, K. & WANG, M.-B. 2010. RNA silencing in
fungi. Frontiers in Biology, 5, 478-494.
SCHUSTER, A. & SCHMOLL, M. 2010. Biology and biotechnology of
<i>Trichoderma</i>. Applied Microbiology and Biotechnology, 87, 787-
799.
SERGEEVA, Y., GALANINA, L. A., ANDRIANOVA, D. A. & FEOFILOVA, E. P. 2008.
Lipids of filamentous fungi as a material for producing biodiesel fuel. Applied
Biochemistry and Microbiology, 44, 523-527.
SHAFRAN, H., MIYARA, I., ESHED, R., PRUSKY, D. & SHERMAN, A. 2008.
Development of new tools for studying gene function in fungi based on the Gateway
system. Fungal Genetics and Biology, 45, 1147-1154.
![Page 63: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/63.jpg)
52
SINGH, A., KUMAR, P. & SCHÜGERL, K. 1992. Bioconversion of cellulosic materials to
ethanol by filamentous fungi
Enzymes and Products from Bacteria Fungi and Plant Cells. Springer Berlin / Heidelberg.
SKORY, C. 2004a. SILENCING OF LACTATE DEHYDROGENASE GENE OF
RHIZOPUS ORYZAE [abstract]. American Society for Microbiology. p. 79.
SKORY, C. D. 2000. Isolation and expression of lactate dehydrogenase genes from Rhizopus
oryzae. Applied and environmental microbiology, 66, 2343-2348.
SKORY, C. D. 2004b. Lactic acid production by <i>Rhizopus oryzae</i>
transformants with modified lactate dehydrogenase activity. Applied Microbiology
and Biotechnology, 64, 237-242.
STEVENSON, D. M. & WEIMER, P. J. 2002. Isolation and characterization of a
Trichoderma strain capable of fermenting cellulose to ethanol. Applied Microbiology
and Biotechnology, 59, 721-726.
SUZZANE, H. & FLAVIN, C. 2007. Biofuels for Transport: Global Potential and
Implications for Sustainable ... - Worldwatch Institute - Google Books, Earthscan.
TAHERZADEH, M. & KARIMI, K. 2008. Pretreatment of lignocellulosic wastes to improve
ethanol and biogas production: a review. International journal of molecular sciences,
9, 1621-1651.
TAHERZADEH, M. J., FOX, M., HJORTH, H. & EDEBO, L. 2003. Production of mycelium
biomass and ethanol from paper pulp sulfite liquor by Rhizopus oryzae. Bioresource
Technology, 88, 167-177.
TAKARA. Yatalase [Online]. Available:
http://www.clontech.com/takara/US/Products/Molecular_Biology/Modifying_Enzyme
s/Nucleases/Yatalase [Accessed 2012-07018 2012].
TANGUAY, P., BOZZA, S. & BREUIL, C. 2006. Assessing RNAi frequency and efficiency
in Ophiostoma floccosum and O. piceae. Fungal Genetics and Biology, 43, 804-812.
TAYLOR, J., JACOBSON, D., KROKEN, S., KASUGA, T., GEISER, D., HIBBETT, D. &
FISHER, M. 2000. Phylogenetic Species Recognition and Species Concepts in Fungi.
Fungal Genetics and Biology, 31, 21-32.
TAYLOR, M., ELEY, K., MARTIN, S., TUFFIN, M., BURTON, S. & COWAN, D. 2009.
Thermophilic ethanologenesis: future prospects for second-generation bioethanol
production. Trends in Biotechnology, 27, 398-405.
TRESKATIS, S. K., ORGELDINGER, V., WOLF, H. & GILLES, E. D. 1997.
Morphological characterization of filamentous microorganisms in submerged cultures
by on-line digital image analysis and pattern recognition. Biotechnol. Bioeng., 53,
191-201.
TUNGA, R., BANERJEE, R. & BHATTACHARYA, B. C. 1999. Some studies on
optimization of extraction process for protease production in SSF. Bioprocess and
Biosystems Engineering, 20, 485-489.
TYE, Y., LEE, K., WAN ABDULLAH, W. & LEH, C. 2011. Second-generation bioethanol
as a sustainable energy source in Malaysia transportation sector: Status, potential and
future prospects. Renewable and Sustainable Energy Reviews, 15, 4521-4536.
UENG, P. P. & GONG, C.-S. 1982. Ethanol production from pentoses and sugar-cane
bagasse hemicellulose hydrolysate by Mucor and Fusarium species. Enzyme and
Microbial Technology, 4, 169-171.
UREGINA. Phenol/Chloroform Extraction and Ethanol Precipitation [Online]. Available:
http://uregina.ca/~ngdann/Bioc422/proj1.htm [Accessed 08-03 2012].
![Page 64: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/64.jpg)
53
WELD, R., PLUMMER, K., CARPENTER, M. & RIDGWAY, H. 2006. Approaches to
functional genomics in filamentous fungi. Cell Research, 16, 31-44.
WESLEY, S. V., HELLIWELL, C. A., SMITH, N. A., WANG, M. B., ROUSE, D. T., LIU,
Q., GOODING, P. S., SINGH, S. P., ABBOTT, D., STOUTJESDIJK, P. A.,
ROBINSON, S. P., GLEAVE, A. P., GREEN, A. G. & WATERHOUSE, P. M. 2001.
Construct design for efficient, effective and high-throughput gene silencing in plants.
The Plant journal : for cell and molecular biology, 27, 581-590.
WINSTANLEY, C. & RAPLEY, R. 2000. The Nucleic Acid Protocols Handbook: Extraction
and Purification of Plasmid DNA. Humana Press Inc.,Totowa, NJ.
WU, J. F., LASTICK, S. M. & UPDEGRAFF, D. M. 1986. Ethanol production from sugars
derived from plant biomass by a novel fungus. Nature, 321, 887-888.
WU, T., ZIVANOVIC, S., DRAUGHON, A., CONWAY, W. & SAMS, C. 2005.
Physicochemical properties and bioactivity of fungal chitin and chitosan. Journal of
agricultural and food chemistry, 53, 3888-3894.
YAMADA, O., IKEDA, R., OHKITA, Y., HAYASHI, R., SAKAMOTO, K. & AKITA, O.
2007. Gene silencing by RNA interference in the koji mold Aspergillus oryzae.
Bioscience, biotechnology, and biochemistry, 71, 138-144.
YANG, X. & GRIFFITHS, A. J. 1993. Plasmid diversity in senescent and nonsenescent
strains of Neurospora. Molecular & general genetics : MGG, 237, 177-186.
ZAMANI, A. 2010. Superabsorbent Polymers from the Cell Wall of Zygomycetes Fungi. PhD
Tesis, Chalmers University of Technology, Göteborg.
ZAMORE, P. D., TUSCHL, T., SHARP, P. A. & BARTEL, D. P. 2000. RNAi: Double-
Stranded RNA Directs the ATP-Dependent Cleavage of mRNA at 21 to 23 Nucleotide
Intervals. Cell, 101, 25-33.
ZHANG, M., EDDY, C., DEANDA, K., FINKELSTEIN, M. & PICATAGGIO, S. 1995.
Metabolic Engineering of a Pentose Metabolism Pathway in Ethanologenic
Zymomonas mobilis. Science, 267, 240-243.
ZHENG, X. F., KOBAYASHI. Y & M, T. 1998. Construction of a low-serine-type-
carboxypeptidase-producing mutant of Aspergillus oryzae by the expression of
antisense RNA and its use as a host for heterologous protein secretion. Applied
Microbiology and Biotechnology, 49, 39-44.
ZHONG, S., LENG, Y. & BOLTON, M. 2012. Construction of hairpin RNA-expressing
vectors for RNA-mediated gene silencing in fungi. Methods in molecular biology
(Clifton, N.J.), 835, 623-633.
ZHOU. X , YAMIN WEI, HUIFANG ZHU, ZINAN WANG, JUAN LIN, LU LIU & TANG,
K. 2008. Protoplast formation, regeneration and transformation from the taxol-
producing fungus Ozonium sp. African Journal of Biotechnology, 7, 2017-2024.
![Page 65: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/65.jpg)
Appendix:
A1: Preparations
Preparation 1: LB (Luria-Bertani) medium (100 ml) (bioprotocols.info)
Materials required:
Tryptone, Yeast extract, NaCL, Distilled water, autoclave
Procedure:
1 gram Tryptone, 0.5 gram Yeast extract and 0.5 gram NaCL were weighed and added to 100
ml distilled water in conical flask or bottle. The medium is then autoclaved at 121°C for 20
minutes and can be used for cultivation of organism or can be stored for further use without
opening the container.
Preparation 2: LB agar plates with ampicillin (bioprotocols.info)
Material required:
Tryptone, Yeast extract, NaCL, Agar, Distilled water, ampicillin stock solution, autoclave
Procedure:
LB medium (from preparation 1) was prepared and 15g/l agar was added.
Finally the volume was adjusted to 500 ml using distilled water and autoclaved at
121°C for 20 minutes.
The medium was cooled to 55°C and added with required amount ampicillin stock
solution and poured in to Petri dishes near the flame.
These petri dishes were undisturbed until the agar solidifies and sealed with parafilm
for preventing contamination. These were stored in fridge for 2-3 days for use.
Preparation 3: Salt solutions (100 ml each)
Materials Required:
(NH4)2SO4, KH2PO4, CaCl22H2O, MgSO47H2O, distilled water, Volumetric flasks, magnetic
stirrer, weighing balance, autoclave.
Procedure:
(NH4)2SO4: 37.5 g of (NH4)2SO4 dissolved in 50 ml distilled water using magnetic
stirrer and then made up to final volume of 100 ml using volumetric flask.
KH2PO4: 17.5 g of KH2PO4 dissolved in 50 ml distilled water made up to 100 ml as
before.
CaCl22H2O: 20 g of CaCl22H2O dissolved in distilled water and made up to 100 ml.
![Page 66: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/66.jpg)
MgSO47H2O: 15 g of MgSO47H2O dissolved in distilled water and made up to 100
ml.
All these salt solutions are prepared separate bottles and autoclaved at 121°C for 20 min and
stored at room temperature.
Preparation 4: Vitamin solution (Jahromi and Gheinani, 2011 modified)
Materials required:
D-Biotin, 0.1M NaOH, 0.1M HCL, p-amino benzoic acid (PABA), Nicotinic acid, Ca-
Panthothenate, Pyroxidine HCL, Thiamine HCL, 2 M NaOH, m-Inositol, Distilled water, 1.5
ml eppendorf tubes, 0.45 µm filters, syringes
Procedure:
25 mg of D-Biotin dissolved in 10 ml of 0.1M NaOH and then the dissolved biotin
solution was diluted using 300 ml distilled water.
pH was adjusted to 6.5 using 0.1M HCL and the remaining vitamins were added as
given below.
Table A1.4.1: Vitamin solution composition
PABA 100 mg
Nicotinic acid 500 mg
Ca-Panthothenate 500 mg
Pyroxidine HCL 500 mg
Thiamine HCL 500 mg
pH was adjusted to 6.5 after adding all the vitamins using 2M NaOH and 12.5 g of m
Inositol was added. pH was adjusted to 6.5 using 2M NaOH.
Finally the volume was made up to 500 ml using distilled water.
The solution was filled in to sterile 1.5 ml eppendorf tubes using 0.45 µm filters and
store at -20°C.
Preparation 5: Trace metal solution (Jahromi and Gheinani, 2011 modified)
Procedure:
The following components as given in table below were dissolved in 600 ml distilled water
and the pH was adjusted to 4 using NaOH. Finally volume was made up to 1 liter.
![Page 67: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/67.jpg)
Table: A1.5.1: Trace metal solution composition
Component Amount (in grams)
EDTA 3
CaCl2.2H2O 0.9
ZnSO4.7H2O 0.9
FeSO4.7H2O 0.6
H3BO3 0.2
MnCl2.4H2O 0.19
Na2MoO4.2H2O 0.08
CoCl2.2H2O 0.06
CuSO4.5H2O 0.06
KI 0.02
The solution prepared was autoclaved at 121°C for 20 minutes and store at 4°C for further
use.
Preparation 6: Semi synthetic medium for cultivation of Zygomycetes Fungi (1000 ml)
Materials Required:
Glucose, Yeast extract, Salt solutions (from preparation 3), Vitamin solution (from
preparation 4), Trace metal solution (from preparation 5), 2M NaOH
Procedure:
Glucose solution was prepared by dissolving 30 g glucose, 5 g yeast extract in 500 ml
distilled water in a Erlenmeyer flask, sealed with a cotton plug, aluminum foil and
autoclaved at 121°C for 20 minutes.
Salt solutions were prepared and autoclaved in separate blue capped bottles as
described in preparation 2 and each of them was added in to the flask containing
autoclaved glucose solution in the order shown below near the flame after cooling.
![Page 68: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/68.jpg)
Table A1.6.1: Salt solutions composition
Salt solution Amount (ml)
(NH4)2SO4 20
KH2PO4 20
CaCl22H2O 5
MgSO47H2O 5
Distilled water 439
10 ml trace metal solution and 1 ml vitamin solution was added to the above mixture
in sterile conditions.
Care should be taken to prevent contamination while adding the components and this
medium can be used for inoculation with spores or mycelium of filamentous fungi.
Preparation 7: Potato Dextrose Agar plates
Material required:
Potato extract, Glucose, Agar, distilled water
Procedure:
2 g potato extract, 10 g glucose and 7.5 g agar was added to 500 ml distilled water and
autoclaved for 20 minutes at 121°C.
After cooling down to 55°C, media was poured in to petri plates near the flame and
undisturbed until solidified. The plates were sealed with parafilm and stored at room
temperature or fridge for longer storage.
Preparation 8: Yatalase Digestion Buffer (Takara)
Materials required:
0.2 M Maleate Buffer [5.8 g Maleic acid+1NaOH(50 ml)+250 ml distilled water]
MgSO4, Yatalase Enzyme from (Takara), distilled water.
Procedure:
Yatalase enzyme was in the form of powder and1 g was dissolved in 10 ml distilled
water in a 15 ml sterile plastic tube using vortex machine to get uniform solution.
![Page 69: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/69.jpg)
3.611 g of MgSO4 was dissolved in12.5 ml of 0.2M Maleate Buffer and 5 ml distilled
water.
Both the solutions were mixed and the pH was adjusted to 5.5 using 0.2N NaOH.
Final volume was adjusted to 50 ml using distilled water and can be used immediately
for effectiveness or can be stored at 4°C for 2-3 days.
Note: It was difficult to filter sterilize the solution as the solution was very thick and it can be
centrifuged and upper solution was used for protoplast preparation.
Preparation 9: STC Buffer
Material required:
Sorbitol, CaCl2, 1M Tris HCL (pH 8.0), distilled water
Procedure:
91.09 g Sorbitol and 2.774 g CaCl2 were dissolved in distilled water separately and
mixed.
25ml of 1m Tris HCL was added to the mixture and final volume was adjusted to 500
ml using distilled water.
The solution was autoclaved for 20 minutes at 121°C and stored at room temperature.
Preparation 10: PEG solution (25ml)
Materials required:
PEG 4000, CaCl2, 1M Tris HCl (pH 8), distilled water
Procedure:
15 g of PEG 4000 and 130 mg of CaCl2 were dissolved in 15 ml of 50mM Tris HCL
in 25ml volumetric flask
Finally volume was adjusted to 25 ml using distilled water and autoclaved at 121°C
for 20 minutes and stored at room temperature.
Preparation 11: 10X TBE Buffer (bioprotocols.info)
Materials Required:
Tris base, 0.5M EDTA, Boric acid, distilled water.
Procedure:
The following compounds were mixed in a500 ml blue capped bottle using 200 ml distilled
water.
Tris base – 54 gram
![Page 70: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/70.jpg)
Boric acid – 27.5 gram
0.5 M EDTA – 20 ml
Finally the volume of the buffer was made up to 500 ml using a measuring cylinder and was
stored at room temperatures for further use.
Preparation 12: Spore solution (Jahromi and Gheinani, 2011 modified)
Materials Required:
Distilled water, PDA agar plate (from preparation 7), Spreaders, disposable pipettes
Procedure:
The PDA plates were inoculated with Rhizopus Oryzae and incubated for 3 days at
30°C for formation of spores.
The procedure was performed near flame to avoid contamination by wearing gloves.
20ml of distilled water was added on the surface of agar plate containing the spores.
The disposable sterile microbiological spreader was used to scrub the surface of agar plate to
get spores and hyphae suspended in water. (as shown in figure below)
The disposable sterile pipette (5ml) was used for transferring the spore suspension as
inoculum. The spore suspension was used immediately.
Viability of frozen spore suspension was not yet accessed
Figure A1.12.1: Spores being suspended using a sterile spreader
![Page 71: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/71.jpg)
A2: List of Material used:
10X Dream TaqTM
Green buffer –
Fermentas
2 propanol - Scharlau
Agar bacterialogical - Scharlau
Agarose - Sigma life sciences
Ammonium sulphate - Sigma Aldrich
Ampicillin - Scharlau
BglII – Fermentas
Boric acid - Sigma life sciences
Calcium chloride - J: T Baker chemical
co..phillipsburg
D- Sorbitol - Sigma life sciences
D-Glucose (anhydrous reagent grade) -
Scharlau
Dream TaqTM
Polymerase (5u/µl) –
Fermentas
EDTA - Sigma Aldrich
Ethanol 96%, v/v (analytical grade,ACS,
reagent , USP - Scharlau
Glass beads, acid washed -Sigma life
sciences
HindIII – Invitrogen
KpnI – Invitrogen
Lysozyme - Fisher scientific
Magnesium sulphate -Merck
PCR purification kit – Wizard SV Gel and
PCR clean up system, Prime
Phenol/chloroform /isomyl alchol(25:24:1)
ratio - Fisher scientific
Polyethylene glycol l(PEG 4000) - Fluka
biochemika
Potassium iodide - Scharlau
Potassium phosphate - Scharlau
Potato extract - Fluka
Primers - Invitrogen
SDS (Sodium dodecyl sulphate) - Merck
Sodium chloride - Scharlau
Sodium hydroxide - Scharlau
Sodium phosphate - Sigma life sciences
T4 DNA ligase – Fermentas
Trizma base - Sigma life sciences
Tryptone - Fluka analytical
XhoI – Fermentas
Yatalase (Takara) – Fisher Scientific
Yeast extract – Scharlau
![Page 72: Construction of hpRNA expression vector for silencing a ...bada.hb.se/bitstream/2320/11676/1/Penmatsa Balu.pdf · ii Construction of hpRNA expression vector for silencing LDHA gene](https://reader034.vdocuments.us/reader034/viewer/2022051720/5a78a1cd7f8b9a273b8c50e6/html5/thumbnails/72.jpg)
A3: List of Equipments used:
Autoclave – SHP Steri Hechnik AB
Centrifuge – mini Scan speed (2010)
Electrophoresis equipment – Easy cast electrophoresis system, model #B2, Owl Scientific Inc.
Glass beads (5mm) – Scientific Industries, inc
Heavy Phase Lock gelTM
tubes – 5 prime
Mega fuge 1.0 R – Heraeus sepatech
Microfuge tubes (10ml, 50 ml) – TPP (ISO certified 9001), Switzerland
Microscope – Zeiss, Axio cam MRC
Petri plates – NUNCTM
, made in Denmark
Pipette (sterile) - TPP
Shaking incubator – New Brunswick Scientific Excella E24 Incubator Shaker Series
Spectrophotometer – Nano drop 2000, Thermo scientific
Thermal cycler – Biometra Trio ThermoblockTM
, Biometra Trio Heated lid
UV lamp – UVP Cambridge, U. K
Voltmeter – Concort E443, Microcomputer electrophoresis power supply
Vortex machine – SI vortex-2 gene®