conservation strategies for jerangau merah … · bs93 f: tcagtcgttggtcgtgaaag r:...

International Journal of Agriculture, Forestry and Plantation, Vol. 1 (Sept.)

2015

89

CONSERVATION STRATEGIES FOR JERANGAU MERAH (BOESENBERGIA STENOPHYLLA) USING DNA

PROFILING AND MICROPROPAGATION

Aicher Joseph Toyat

Department of Crop Science,

Faculty of Agriculture and Food Science, Universiti Putra Malaysia Bintulu Campus,

Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia.

[email protected]

Nur Ashikin Psyquay Abdullah

Department of Crop Science



[email protected]

Rusea Go

Department of Biology

Faculty of Science, Universiti Putra Malaysia,

43400 UPM Serdang, Selangor, Malaysia.

[email protected]

Thohirah Lee Abdullah

Department of Crop Science

Faculty of Agriculture, Universiti Putra Malaysia,

43400 UPM Serdang, Selangor, Malaysia.

[email protected]

Ghizan Saleh

Deputy Vice-Chancellor,

Universiti College Agrosciences Malaysia,

Ayer Pa’ abas 78000 Alor Gajah, Melaka, Malaysia.

[email protected]

Make Jiwan




[email protected]

Franklin Ragai Kundat




[email protected]

Mohd. Maulana Magiman

Department of Social Science,


Jalan Nyabau, 97008, Bintulu, Sarawak, Malaysia

[email protected]

ABSTRACT

Jerangau merah (Boesenbergia stenophylla) is highly endemic to the highland of Borneo. Their medicinal value attracts many

plant collectors which raise up to the concern on their population size .A study was carried out to establish the conservation

approaches for this species. The objectives of this study are to determine the genetic variations among accession from Bario and

to develop the in vitro culturing protocolfor productions of seedlings. Genetic variation studies were done using simple sequence

repeats (SSR) and random amplified polymorphic DNA markers (RAPD). Micropropagation of shoot tips was carried out using

BAP and NAA plant growth regulator supplemented in MS media. The genetic variation studies using SSR and RAPD marker

show no variations among accession and three sub populations. Two steps protocol was recommended for the tissue culture of

B.stenophylla. But it start with culturing using shoot tips in MS media containing 0.2 mg/L NAA for shoot induction followed by

sub–culturing to MS media with 2 mg/L BAP +0.4 mg/L NAA for rapid shoot elongation. This study suggests that their

conservation should remain as in situ and seedling production under optimum nursery conditions should be carried out near to

their natural populations.

Key words: Boesenbergia, Jerangau, microsatellites


2015

90

Introduction

Boesenbergia stenophylla R.M. Sm. is a plant species from the family Zingiberaceae. It is known with various names depending

on in which village it was found. Typically it is known as jerangau merah (malay) and kaburo adak (Kelabit/Lun Bawang). This

species is considered as rare and highly endemic to Borneo highland (Poulsen, 2006). It is mainly found in the Tropical Heat

Forest of Sarawak at an altitude of above 3000 ft. (Ahmad & Jantan, 2003). Villagers from where this species are found used the

rhizomes to treat stomach-ache, food poisoning and alcohol intoxication (Christensen, 2002; Poulsen, 2006; Chai, 2006; Jing,

2010). The sales of its rhizome is slowly penetrating the local markets but at a high price. For the collectors, this was seen as

lucrative and due to this, harvesting of these plants from their natural habitat has become more widespread. To date, these plants

are not domesticated. They are found thriving under heavy shaded forest floor, preferring slopes nearby streams. It was never

found on altitude less than 3000 ft. and therefore may requires low temperature for optimum growth. Factors such as over

harvesting and climate change posed as possible threats on the existence of B. stenophyla and therefore conservation measures

are required to ensure that their populations are not heavily disturbed, but at the same time the needs of this plant to improve the

socio economic of the villagers is also important.

Conservations can be done following two approaches. First is to put the plant species into cultivation and second is to mass

produce their seedlings. The first approach can be done through ex situ cultivation under nursery conditions where their

agronomic practices will be identified. In this case, the productions of rhizomes are of interest and the dependence of collectors

to harvest plants from the forest can be stop. The second approach is to produce the seedlings in mass number but conventional

method through vegetative propagation is time consuming. Micropropagation has an advantage over conventional propagation

where it provide optimum controlled culture environment. Also, through micropropagation the number of seedlings produced

over time is higher as compared to the conventional techniques. The approach using in vitro technique was seen used for the

conservation of the threatened Boesenbergia pulcherrima (Anish et al., 2008). It was also reported that Boesenbergia rotunda

cultures supplemented with 2.0mg/L BAP+ 0.5mg/L NAA resulted in four multiple shoot per explant whereas, 2.0 mg/L BAP

promotes shoot development from callus (Yusuf et al., 2011).

As part of the conservation strategy, genetic profiles of the species of interest are often obtained. A better understanding of

genetic diversity and its distribution is essential for its conservation and use (Rao & Hodgkin, 2002; Rodríguez-Bernal, 2013).

Molecular biology helps conservationist to explain the genetic structure of species by applying genetic marker for identifying

their status in their natural population. According to Srivatsava & Nidhi (2009) a genetic marker is “a gene or DNA sequence

with a known location on a chromosome and associated with a particular gene or a character. Variations in the marker may arise

due to mutation or alteration of nucleotide in the genomic loci. DNA markers are more reliable because the genetic information

is unique for each species and is independent of age, physiological conditions and environmental factors (Kalpana et al., 2004;

Kumar et al., 2009; Pourmohammad, A. 2013).

The usage of this co dominant marker in detecting genetic variations in the taxonomic and systematic analyses of plant have

proven to be valuable such as conservation of wild pear Pyrus praster (Condello et al., 2008). Simple Sequence Repeats (SSRs)

or microsatellite is a common co-dominant marker. It is a short tandem repeats with 1 to 6 nucleotides (Goldstein & Pollock,

1997; Tharachand et al., 2012). Microsatellites have become the genetic marker of choice in mammalian and many plant systems

(Weber and May, 1989; Tharachand et al., 2012). It has several advantages over other molecular markers such as they are co-

dominant, highly polymorphic, identification of many alleles at single locus, they are evenly distributed all over the genome, the

analysis can be semi-automated and performed without the need of radioactivity and very little DNA is require (Gupta et al.,

1994; Goldstein and Pollock, 1997; Zheng et al., 2008; Tharachand et al., 2012,). Furthermore, using molecular marker has

proven to be the most effectively tool in various studies fields such as taxonomy, plant breeding, genetic engineering etc.

(Tharachand et al., 2012). The most useable dominant marker for detection of genetic variations among populations is random

amplified polymorphic DNA (RAPD) which was first introduced by Williams et al., (1990). This dominant marker was

frequently used to distinguish a lot of the Zingiberaceae family species such as Curcuma spp. (Wangsomnuk et al., 2002),

confirmation of 11 species of Boesenbergia, six species of Kaempferia, and two species of Scaphochlamys from Southern

Thailand (Vanijajiva et al., 2004), Boesenbergia rotunda (Vanijajiva et al., 2005) and Zingiber spp. and Curcuma spp. from

eastern India (Mohanty et al., 2013).

This study was carried out for the purpose of establishing conservation strategies for Boesenbergia stenophylla by investigating

their genetic profiles and ways to mass propagate seedlings. The genetic profile of B.stenophylla population in Bario shall give

an insight of their mode of reproduction and diversity. Production of seedlings through micropropagation can contribute to the

reintroduction of seedling into their natural population and also providing seedlings for nurseries and sellers. The objectives of

this study are, to determine the genetic variations among Boesenbergia stenophylla from Bario population and to establish in

vitro propagation protocols.


2015

91

Materials and Methods

Sampling Locations

Fresh leaves were collected from Bario Highland and are kept in silica gel before DNA extraction for preservation through rapid

drying of plant tissues. There were 3 sub populations in Bario with a total of 20 individual per sub population. The

subpopulations (Figure 1) are from Besar, Arur Dalan and Ramudu.

Figure 1: Map of Bario Highland with the location of the (x) three sub-populations.

DNA Extraction

Total genomic DNA was extracted from young leaves using GENEALL® Exgene™ Plant SV Mini Kit (Geneall, Korea)

following the manufacturer’s instructions. DNA was collected in 50µL 1X TE (10mMTris, pH8.0, 1 mM EDTA). Quantification

and the DNA quality were determined by using a spectrophotometer (NanoDrop™).

Screening and Developing of Population and Genetic Diversity Marker RAPD Marker

DNA amplification was performed in a thermo cycler (BioRad) using Simple Sequences Repeat (SSR) and Random Amplified

Polymorphic DNA (RAPD) primers DNA markers. Selected RAPDs primers were OPA 1-20 and OPB 1-20 were screened for

positive amplification and polymorphism. Since there are no specific SSR primers reported for Boesenbergia stenophylla,

available SSR primers developed from Boesenbergia siamensis was used.

Development of SSR Primers for Boesenbergia Stenophylla

Since cross-amplification could amplified the same genus, existing microsatellites DNA sequences of Boesenbergia siamensis

were obtained from Genbank http://www.ncbi.nlm.nih.gov/ submitted by (Tappiban & Triwitayakorn, 2012). A total of 58

Boesenbergia siamensis DNA sequences were used for synthesizing primers using Primer3 via online (Steve & Skaletsky, 2000)

to generate the forward and reverse oligonucleotides. From the 58 DNA sequences, 20 primers with high GC% and zero 3’ (Self

Complementarity) were selected and later screened with DNA template from B.stenophylla (Table 1).


2015

92

Table 1: Twenty primer pairs developed to determine the genetic variations of B. stenophylla. Selections were based on the high

GC and zero 3’ (Self Complementarity) content and their annealing temperature

Primer Primer Sequences (5’-3’) Annealing temperature

(°C)

GC %

BS45 F: AGGGAGAGAGAGGAAGAGGG

R: ACCTGCGAATCCACTACGAT

52.7

53.3

60

BS39 F: CACGCTAACATCACACGAGG

R: GCCTCCCTCTACCTCCATTC

53.3

53.7

55

BS35 F: GACTACCCCGATCTTCCGAG

R: TGCGATCTTAACCCCGATGA

54.8

57.5

60

BS7 F: CGCCCTGAATGTTTGATCCA

R: GGCTTCGAGAATCATCGTCG

57.8

56.8

50

BS62 F: TGTGTTGGTCATGAATGCGC

R: CAACCGTTGCGAGGTCATAC

57.4

55.1

50

BS43 F: CCCACAGACGATGCCAATTT

R: ACTTGATCGTCGGAGTGGTT

56.9

53.1

50

BS29 F: TAGGCAGCACTTGGGCTTTA

R: GCTTTGCTCCTTCCAACCTT

54.9

54.8

50

BS5 F: AGAGACCTTGGCAGACTGAC

R: ACAGCCATACCTTCACGAGT

50.3

50.8

55

BS26 F: CATCCTTCCTGTAAACCCGC

R: AGAAAGCCTGTGGAGAGCAT

55.7

52.7

55

BS64 F: TGGCATTGGGAGATGGAACT

R: CACGGCTGATGATTTGCGTA

56.4

56.7

50

BS86 F: GTGGGGCTTCAACGTTACTG

R: AACCCTGCAACAAATCGGTC

54.3

56.0

55

BS92 F: TATCCTGCACACTTTCCCGT

R: TTTCCTTCTTGTGTCCGTGC

54.2

54.8

50

BS100 F: GTTTCTCTTTCGGCAGCGTC

R: GCTCCTTCAACCGCTTCAAT

56.2

55.6

55

BS109 F: CGTTCCTTGTATGGCAGCTC

R: CGTATCCACCGTCCGTCTAA

54.5

54.7

55

BS27 F: ACGCTCAAGTCAGTCACCAA

R: CCTAGGTGGGAACTGGTCAA

52.7

53.6

50

BS30 F: GCTGCTAATCGGAAACTGCA

R: CGAAGGGCACAAAATCGGAT

55.3

58.3

50

BS61 F: ACGTCGCTAGATTCGCTGAT

R: AGAGTCGAGCAAAGGAACCA

53.8

53.6

50

BS89 F: TAGCCCCCTCTCTATCAGCA

R: CTGCAGTCCGCTACACAAAA

53.7

53.6

55

BS93 F: TCAGTCGTTGGTCGTGAAAG

R: GGTTCCCTTGATTCCTCTCC

53.2

53.7

50

BS108 F: CCAACGAAAAGTGGAAGGAA

R: GATCCCCATGAGTTCCAAAA

53.9

53.4

45

Note: GC% = Percentage of Guanine and Cytosine

DNA Amplification using SSR Primers

DNA amplification was carried out using the 20 primers through polymerase chain reaction (PCR) protocol. Each PCR was

perform in 20 µL mixture containing 10 µL 2X AmpMaster™ Taq2X AmpMaster™ Taq GENEALL® (each dNTP mixture

200µM contain each of dATP, dTTP, dGTP and dCTP), 2.5 mM MgCl2 reaction buffer 1X, 2.5 U Taq DNA polymerase and 1X

Loading dye & stabilizer, 1 μL DNA template 1~100ng/ μL, 1µL primer forward, 1µL primer reverse and add up with deionize

water to obtain a 20 µL volume reaction mix. Amplification was carried out in a thermo cycler (Bio Rad), as follows: one cycle

of 2 min at 95°C for initial denaturation, 30 cycles of 20 sec at 95°C for template denaturation; 10 sec annealing standardize to

all primer at 56 °C, and 50 sec at 72°C extension; one cycle of 5 min at 72°C for final extension. The PCR products were then

separated in 3% Metaphor agarose gels prepared using 100mL 1X TBE buffer and Atlas Clear Sight as DNA Stain. The allele

size of each fragment was obtained and scored as presence (1) or absence (0) for each loci and by using UVIDoc software to

generate the number of alleles.


2015

93

DNA Amplification using RAPD Primers

Forty primers were screened following their respected annealing temperature. Each PCR reaction volume was perform in 20 µL

mixture containing 10 µL 2X AmpMaster™ Taq2X AmpMaster™ Taq GENEALL® (each dNTP mixture 200µM contain each

of dATP, dTTP, dGTP and dCTP), 2.5 mM MgCl2 reaction buffer 1X, 2.5 U Taq DNA polymerase and 1X Loading dye &

stabilizer, 1 μL DNA template 1~100ng/μL, 1µL primer and add up with deionize water to 20 µL. PCR was carried out as

follows: one cycle of 3 min at 94°C for initial denaturation, 10 cycles of 1min at 95°C for template denaturation; 1 min annealing

at 57 °C with decrease increment - 1°C per cycles, and 2 min at 72°C extension; one cycle of 5 min at 72°C for final extension,

and then 25 subsequent cycles of 94°C for 1 min, 57°C, 72°C for 2 min, and the final elongation at 72°C for 10 min. The PCR

products were then separated in 1.5% agarose gels prepared using 100mL 1X TBE buffer and Atlas Clear Sight as DNA Stain.

The allele size of each fragment was obtained and scored as presence (1) or absence (0) for each loci and by using UVIDoc

software to generate the number of alleles.

Micropropagation

Sterilization of explants followed the protocol reported by Afendia et al. (2013) without the use of mercury chloride, where

sprouted shoots were collected and washed under running water for 30 minutes and dipped into 95% of the ethanol solution for

2-3 seconds, 70 % ethanol for 2-3 seconds, 20 % NaClO + a drop of Tween 20 for 20 minutes, 70% ethanol for 2-3 seconds,

80% NaClO + a drop of Tween 20 for 10 minutes then finally rinse with dH2O 4 times duration per rinse in 1 minute. Clean and

aseptic explants were then inoculated on MS (Murashige and Skoog, 1962) media containing 30.0 g/l sucrose and 2.0 g/l gelrite

as solidifying agent supplemented with cytokinins (6-benzylaminopurine (BAP) ranging from 0.0, 1.0, 2.0, 3.0, 4.0 mg/l and

auxin (α-naphthaleneacetic acid (NAA) ranging from 0.0, 0.2, 0.4, 0.5 and 0.6 mg/l with different concentration of BAP and

NAA for shoot multiplication (Table 2). A single shoot was cultured into each test tube and replicated 3 times for each treatment.

Table 2: Treatments used for shoot induction B. stenophylla with different combinations of BAP and NAA concentrations

Note: All cultures were examined periodically, and parameters such as no. shoot, no. of roots and no. of leaves

were obtained.

Treatments BAP (mg/l) NAA(mg/l)

T0 0 0

T1 1 0

T2 2 0

T3 3 0

T4 4 0

T5 0 0.2

T6 1 0.2

T7 2 0.2

T8 3 0.2

T9 4 0.2

T10 0 0.4

T11 1 0.4

T12 2 0.4

T13 3 0.4

T14 4 0.4

T15 0 0.5

T16 1 0.5

T17 2 0.5

T18 3 0.5

T19 4 0.5

T20 0 0.6

T21 1 0.6

T22 2 0.6

T23 3 0.6

T24 4 0.6


2015

94

Results and Discussion

SSR Analysis

Twenty SSR primers developed from B. siamensis was used to amplify DNA from B. stenophylla. From the 20 primers, eight

primers were able to amplify the DNA of B. stenophylla showing the capability of cross species amplification (Figure 2). The

size of the eight polymorphic primers ranged from 170bp to 216bp (Table 3). However, seven primers were selected to determine

the genetic variations. Primer BS27 was omitted because it amplified heterozygous alleles.

Figure 2: DNA amplification of B. stenophylla on 3% Metaphor agarose gels compared wih 100bp DNA ladder

Table 3: Selected primer for population genetic variation with the scoring and alleles size

Primer Scored Alleles size (bp)

BS 39 1 209

BS 86 1 170

BS 35 1 175

BS 108 1 168

BS 30 1 163

BS 109 1 216

BS 45 1 197

Each primers were used to amplified the microsatellite DNA regions of B. stenophylla from (1) Bukit besar (2) Arur Dalan and

(3) Ramudu (Figure 3). A fourth plant (4) was included as control, a plant specimen of unknown origin that was raised under

glasshouse. All primers were polymorphic. However, five primers i.e. BS35, BS109, BS27, BS30 and BS108 showed the same

allele size for all B. stenophylla for different sub-populations. The differences in allele size as shown by BS45 and BS86 was

considered as ambiguous because the gel was distorted during electrophoresis.


2015

95

Figure 3: DNA amplification of the SSR regions using 8 primers on sub-population collected from (1) Bukit Besar, (2) Arur

Dalan (3) Ramudu and (4) Glasshouse

For further confirmation the primers were used to amplify DNA from the entire individual from each sub-population. The results

again showed no polymorphism in any of the sub-population for each primer. An example of the DNA amplification is shown in

figure 4.

Figure 4: An example of SSR DNA amplification using primer BS109 on 20 individuals from Arur Dalan showing no variations

among accessions

SSR marker is a powerful DNA marker to differentiate the possible genetic variation among populations. In this study, using

seven polymorphic SSR primers showed no variations among sub-populations. This indicates that the population in Bario is

genetically similar as the entire individual shared the same allele weight. However, homoplasy which showed similar allele

length but different in DNA sequences could occur. To determine this, DNA sequencing of each individual are usually used and

variations are determine by identifying changes in nucleotides. However, DNA sequencing is costly therefore RAPDs markers

are used to identify possible genetic variations.

RAPD Analysis

A total of 40 primers were randomly selected to determine their effectiveness in RAPD analysis. 20 OPA and 20 OPB primers

were screened and those primers that generated clear bands were identified. Eighteen primers produced 105 reproducible

fragments, with an average of 5.8 fragments per primer. The allele length ranged from 191 - 2500 bp with polymorphic bands

(Figure 5).


2015

96

Figure 5: Amplified of screening primer (M) 100bp ladder (A) OPA 1-20, (B) OPB 1-20

Initial test was done using two polymorphic OPA3 and OPA15. No polymorphic band was found within each sub-population.

We did not carry on further with the other eight primers with an assumption that it will produced results similar to OPA3 and

OPA15. This test was repeated for three OPA and OPB primers (Figure 6, 7 and 8) and by randomly selecting one individual

from each population which also resulted in no variations in allele size.

A

B


2015

97

Figure 6: RAPD primer OPA 1 amplified on 3 sub population with no variation among sub populations. (M) 100bp ladder,

(1-20) individual DNA from each subpopulations

Figure 7: RAPD primer OPA 15 amplified on 3 sub population with no variation among sub populations (M) 100bp ladder, (1-

20) individual DNA from each subpopulations

ARUR

DALAN

BUKIT

BESAR

RAMUDU

ARUR

DALAN

BUKIT

BESAR

RAMUDU


2015

98

Figure 8: Selected primer for screening population show no variation between population (M) 100bp ladder, (1) Arur Dalan, (2)

Bukit Besar, (3) Ramudu

The molecular analysis using SSR and RAPD markers in this study showed no genetic variations found among accessions in

Bario populations even when sub populations was far apart. During the sampling period from July 2013 to October 2014, only

one plant was found flowering bearing single white flower. No accounts were found on the phenology of this species. Other

species B. hirta, B. ischnosiphon, B. lambirensis, observed in Lambir, Sarawak are pollinated by halictid bees. Most species of

the genus seem to flower with little seasonality or synchrony (Sakai & Nagamasu, 2006). The reproduction of B. stenophylla is

successful through vegetative rhizomes. It is still early to conclude that genetic variations were not detected in this population is

due to their mode of vegetative reproduction. Further determination such as DNA sequencing of SSR alleles and their breeding

system holds vital information for future cultivation and horticultural improvement strategies.

Micropropagation

Shoot tip cultures showed physiological responses when expose to BAP and NAA. Growth was observed after 16 weeks of

inoculation on MS media. Figure 4 showed that explants in treatment T12 (0.2 mg/L NAA) and T5 (2 mg/L BAP + 0.4 mg/L

NAA) has better growth in term of number of shoots and shoot height. Single treatment of 0.2 mg/L NAA induced more number

of shoots.Supplement of 2 mg/L BAP + 0.4 mg/L NAA causes shoots to elongate faster than the rest of the treatment but the

number of shoot induced was less than treatment 5. Therefore, it is recommended that for in vitro culture of B. stenophylla, the

initial culture should begin with shoot induction in MS media containing 0.2 mg/L NAA in order to obtain high number of

shoots. Subsequent sub-culture should be followed with sub-culturing into MS media containing 2 mg/L BAP + 0.4 mg/L NAA.


2015

99

Figure 4: Respond of explant after 16 week inoculation on MS media

B. stenophylla is highly endemic to the highland region and when the plants that were kept in the nursery under 70% shade with

the range of temperature between 26°C to 30ºC they remained small, with slow leaf development and leaf colour turning

yellowish. Due to this and the limited number of plants found from their natural populations, in vitro propagation was used for

their multiplications. Although single treatment of NAA induced multiple shoots from the explant and 2 mg/L BAP + 0.4 mg/L

NAA produced taller shoots, we believe the growth performance could be better if their culturing environment was optimized

and mimicked their natural ecosystem in the wild. Micropropagation is considered efficient in term of cost when mass number of

plantlets is produced within a short period of time. The protocol in this study could produce more than five shoots per explant but

it took 16 weeks of culturing. Therefore, micropropagation is considered not suitable for propagation of B. stenophylla if the

main objective is to achieve large number of seedlings within a short period of time. Nevertheless, because this species is

difficult to find and growth requires specific environment, the tissue culture protocol that was developed in this study is

important for the multiplications of B. stenophylla.

Conclusion

This study on genetic diversity found that there are no genetic variations among B. stenophylla accessions from three sub-

populations in Bario. The main factor responsible for high level of differentiation among populations and the low level of

diversity within populations is probably the clonal nature of plant species (Li & Ge, 2001; Dev et al., 2010). Nevertheless,

despite high natural fragmentation and the importance of vegetative reproduction, some plant species do display levels of gene

flow. RAPDs analysis showed low polymorphic bands were detected, indicating that the genetic diversity of Boesenbergia

tenuispicata was low, and all the endemic populations in Thailand was most likely consisted of the same genotype. The result

suggested that the management for the conservation of genetic variability in B. tenuispicata should aim to preserve every

population (Vanijajiva, 2012). The proposed protocol for the in vitro cultures of B. stenophylla includes initial culturing using

shoot tips in MS media containing 0.2 mg/L NAA for shoot induction followed by sub-culturing to MS media with 2 mg/L BAP

+ 0.4 mg/L NAA for rapid shoot elongation. However, the cultures took 16 months to produce shoots.

In situ and ex situ conservation methods are complementary and the method chosen should depend on the species concerned and

such factors as its distribution and ecology as well as the availability of resources in areas in which it occurs (Rao & Hodgkin,

2002; Normah et al., 2012) and as apart conserving the biodiversity . The genetic variation of B.stenophylla from Bario

population was determined and the in vitro culture protocol was developed. B. stenophylla is highly endemic, having small

populations, possibly lacks genetic variations and difficult to grow in in vitro cultures. This study suggests that their conservation

should remain as in situ and seedlings production under optimum nursery conditions should be carried out near to their natural

populations.

Acknowledgements

The authors would like to acknowledge the financial assistance provided by Ministry of Education Malaysia under Exploratory

Research Grant Scheme (ERGS) (Project No: ERGS/1-2013/STWN03/UPM/02/5). They also extended their appreciation to

Faculty of Agriculture and Food Science, Universiti Putra Malysia for the use of laboratory, technical assistance and also to

Forest Department Sarawak and Sarawak Biodiversity Centre for permit and approval.


2015

100

References

Afendia, S. A. M., Leeb, C. T., Disfania, M. N., Javeda, M. A. (2013). A Non Mercuric Shoots Bud Sterilization Technique for

Boesenbergia rotunda (L.) Mansf. Kulturpfl. Jurnal Teknologi (Sciences & Engineering), 64(2), 21–24.

Ahmad, F. & Jantan, I. (2003). The essential oils of Boesenbergia stenophylla R. M. Sm. as natural sources of methyl (E)-

cinnamate. Flavor and Fragrance Journal, 18 (6), 485-486.

Anish, N. P., Dan, M. and Bejoy, M. (2008) Conservation using inviro progenies of the threatened ginger- Boesenbergia

pulcherrima (Wall.) Kuntze. International Journal of Botany, 4(1), 93-98.

Chai, P. P. K. (2006). Medicinal Plants of Sarawak. Sarawak: Lee Miing Press.

Christensen, H. (2002). Ethnobotany of the Iban and the Kelabit. Malaysia: Forest Department Sarawak.

Dev, S. A., Shenoy, M. & Borges, R. M. (2010). Genetic and clonal diversity of the endemic ant-plant Humboldtia brunonis

(Fabaceae) in the Western Ghats of India. J. Biosci, 35 (2), 1-12.

Condello, E., Palombi, M. A., Tonelli, M. G., Damiano, C., Caboni, E. (2009). Genetic stability of wild pear (Pyrus pyraster,

Burgsd) after cryopreservation by encapsulation dehydration. Agri. Food Sci, 18, 136-143.

Goldstein, D. B. & Pollock, D. D. (1997). Launching microsatellites: a review of mutation processes and methods of

phylogenetic inference. J Hered, 88, 335–342.

Gupta, M., Chyi Y-S, Romero-Severson, J., Owen, J. L. (1994). Amplification of DNA markers from evolutionary diverse

genomes using single primers of simple sequence repeats. Theoretical and applied genetics, 89, 998-1006.

Jing, L. J., Mohamed, M., Rahmat, A., Bakar, A. B. (2010). Phytochemicals, antioxidant properties and anticancer investigations

of the different parts of several gingers species (Boesenbergia rotunda, Boesenbergia pulchella var attenuata and Boesenbergia

armeniaca. Journal of Medicinal Plants Research, 4(1), pp. 27-32.

Kalpana, J., Warude, P. C. and Bhushan, P. (2004). Molecular markers in herbal drug technology. Current Science, 87(2), 159-

165.

Kumar, P., Gupta, V.K., Misra, A.K., Modi, D. R. and Pandey, B. K. (2009).Potential of Molecular Markers in Plant

Biotechnology. Plant Omics Journal, 2(4), 141-162

Li, A. and GE, S. (2001). Genetic variation and clonal diversity of Psammochloa villosa (Poaceae) detected by ISSR Markers.

Annals of Botany, 87, 585 - 590.

Mohanty, S., Panda, M. K.., Acharya, L., Nayak, S. 2013. Genetic diversity and gene differentiation among ten species of

Zingiberaceae from Eastern India. 3 Biotech, 4, 383–390

Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol.

Plant, 15, 495-497.

Normah, M. N., Chin, H. F. and Reed, B. M. (2012). Conservation of Tropical plant species. Springer science& business media.

pp 445.

Pourmohammad, A. (2013). Application of molecular markers in medicinal plant studies. Acta Universitatis Sapientiae.

Agriculture and Environment, 5, 80-90.

Poulsen, A. D. (2006). Gingers of Sarawak. Borneo: Natural History Publication.

Rao, V. R. & Hodgkin, T. (2002). Genetic diversity and conservation and utilization of plant genetic resources. Plant Cell,

Tissue and Organ Culture, 68, 1-19.

Rodríguez-Bernal, A., Piña-Escutia, J. L., Vázquez-García, L. M. and Arzate-Fernández, A.M. (2013) .Genetic diversity of

Cosmos species revealed by RAPD and ISSR markers. Genetics and Molecular Research, 12 (4), 6257-6267.

Sakai, S. and Nagamasu, H. (2006). Systematic studies of Borneon Zingiberaceae v. Zingiberoideae of Lambir Hills, Sarawak.

BLUMEA, 51, 95-115.

Srivatsava S. and Nidhi M. (2009). Genetic Markers – A Cutting Edge Technology in Herbal Drug Research. Journal of

Chemical and Pharmaceutical Research, 1(1), 1-18.

Steve, R. and Skaletsky, H. J. (2000). Primer3 on the WWW for general users and for biologistogrammers.In: Krawetz S,

Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.


2015

101

Tappiban, P. & Triwitayakorn, K. (2012). SSR Markers of Krachai Sayam, endmic plant in Kanchanaburi province,

Thailand.38th Congress on Science and Technology of Thailand (Full paper). I_I0055.

Tharachand, C., Immanuel, S. C. and Mythili, M. N. (2012). Review Article Molecular markers in characterization of medicinal

plants: An overview. Research in Plant Biology, 2(2), 01-12.

Vanijajiva, O., Sirirugsa, P. and Suvachittanont, W. (2005).Confirmation of relationships among Boesenbergia (Zingiberaceae)

and related genera by RAPD. Biochemical Systematics and Ecology, 33(2), 159–170.

Wangsomnuk, P. P., Wangsomnuk, P., Muza, B. (2002). Biodiversity and molecular aspects of Curcuma species from the north-

east of Thailand, Proceeding of the Third Symposium on the Family Zingiberaceae. Thailand :Khon Kean University, pp. 109–

119.

Vanijajiva, O., Sirirugsa, P. and Suvachittanont, W. (2004).Confirmation of relationships among Boesenbergia (Zingiberaceae)

and related genera by RAPD. Biochemical Systematics and Ecology, 33,159–170

Vanijajiva, O. (2012). Low genetic variation of Boesenbergia tenuispicata, a species endangered and endemic to Thailand, using

RAPD markers. Thai Journal of Genetics, 25(1), 67-78.

Weber, J. L., and May, P. E. (1989). Abundant class of human DNA polymorphisms which can be typed using the polymerase

chain reaction. Am. J. Hum. Genet, 44, 388–396.

Williams, J. G. K., Kublelik, A. R., Livak ,K. J., Rafalski, J. A. and Tingey, S. V. (1990). DNA polymorphism’s amplified by

arbitrary primers are useful as genetic markers. Nucleic Acids Res, 18,6531-6535.

Yusuf, N. A. Annuar, M. M. S. and Khalid, N. (2011). Rapid micropropagation of Boesenbergia rotunda (L.) Mansf. Kulturpfl.

(a valuable medicinal plant) from shoot bud explants. African Journal of Biotechnology, 10(7), 1194-1199.

Zheng, Y., Zhang, G., Lin, F., Wang, Z., Jin, G., Yang, L., Wang, Y., Chen, X., Xu, Z., Zhao, X. (2008). Development of

microsatellite markers and construction of genetic map in rice blast pathogen Magnaporthe grisea. Fungal Genet Biol, 45, 1340-

1347.

conservation strategies for jerangau merah … · bs93 f: tcagtcgttggtcgtgaaag r:...

Documents