comparison of the substrate kinetics of pig cyp3a29 with ... · three enzyme systems for tst...

Biosci. Rep. (2011) / 31 / 211–220 (Printed in Great Britain) / doi 10.1042/BSR20100084

Comparison of the substrate kinetics of pigCYP3A29 with pig liver microsomes and humanCYP3A4Min YAO, Menghong DAI, Zhaoying LIU, Lingli HUANG, Dongmei CHEN, Yulian WANG, Dapeng PENG, Xu WANG,Zhenli LIU and Zonghui YUAN1

National Reference Laboratory of Veterinary Drug Residues (HZAU)/MAO Key Laboratory of Food Safety Evaluation, Huazhong AgriculturalUniversity, Wuhan, Hubei 430070, People’s Republic of China

�

�

�

�

SynopsisCYP (cytochrome P450) 3A29 in pigs could be an important candidate gene responsible for xenobiotic metabolism,similar to CYP3A4 in humans. Accordingly, the tissue expression of CYP3A29 mRNA in domestic pigs has beendetermined by a real-time PCR. The enzymatic properties of CYP3A29, CYP3A4 and PLM (pig liver microsomes)were compared by kinetic analysis of TST (testosterone) 6β -hydroxylation and NIF (nifedipine) oxidation. CYP3A29mRNA was highly expressed in the liver and small intestines of domestic pigs. The CYP3A29 enzyme expressed inSf9 cells had the same TST-metabolizing activity as human CYP3A4 based on their roughly equal in vitro intrinsicclearance values. The affinity of CYP3A29 for NIF was lower than that of CYP3A4 but higher than that of PLM. KET(ketoconazole) was a more potent inhibitor of TST 6β -hydroxylation and NIF oxidation activities of CYP3A29 than TAO(troleandomycin). These findings indicate that pig CYP3A29 is similar to human CYP3A4 in both extent of expressionand activity. The results reported in this paper provide a basis for future in vitro toxicity and metabolism studies.

Key words: cytochrome P450, CYP3A29, characterization, metabolic kinetics, testosterone, nifedipine

INTRODUCTION

CYP (cytochrome P450) enzymes in mammals play a key tox-icological role in the oxidative metabolism and detoxificationof various xenobiotics [1]. CYP3A is well known as one of themost important CYP subfamilies because of its extensive set ofsubstrates. Human CYP3A4 is one of the major isoforms ex-pressed in adults and constitutes up to 30 % of total hepatic CYP[2]. Besides the metabolic detoxification of common xenobiot-ics, CYP3A4 is also involved in the metabolic activation of someserious food contaminants (for example, aflatoxin B1) [3]. Thisprocess is important since it increases the risk of drug-inducedtoxicity by facilitating drug elimination.

Pigs are becoming a potential non-rodent model in both com-parative pharmacological and toxicological studies because ofthe high similarity of pig and human anatomy and physiology[4]. The CYP3A activity and proteins have been found in hep-atocytes, enterocytes and microsomal proteins from domesticpigs by using specific human CYP3A substrates and human/rat

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Abbreviations used: CYP, cytochrome P450; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; hb5, human cytochrome b5; hNPR, human NADPH-P450 reductase; KET,ketoconazole; mAb, monoclonal antibody; NIF, nifedipine; ONIF, oxidized NIF; pb5, pig cytochrome b5; PLM, pig liver microsomes; pNPR, pig NADPH-P450 reductase; TAO,troleandomycin; TST, testosterone; 6β -OHT, 6β -hydroxytestosterone1To whom correspondence should be addressed (email [email protected]).

CYP3A antibodies [5–8]. Their expression can be induced byβ-naphthoflavone, phenobarbital, dexamethasone and rifampi-cin, which are concerned with pregnane X receptor- and con-stitutive androstane receptor-mediated gene activation [9–12].Some frequently used antibiotics, such as KET (ketoconazole)and tiamulin, are able to strongly inhibit pig CYP3A activity[13,14], which would produce metabolic interaction mediated byCYP3A when CYP3A substrates and inhibitors are administratedin combination. These studies highlighted the structural and func-tional presence of CYP3A isoforms in domestic pigs. However,very little information is available on the individual pig CYP3Aenzymes and their metabolic capabilities.

Pig CYP3A29 was considered to be one of the most active con-tributors to microsomal CYP3A activity because the N-terminalsequence of one of the partially purified CYP3A proteins identi-fied by immunostaining with antibodies against human CYP3A4was the same as that of CYP3A29 [15,16]. The DNA sequenceof CYP3A29 of the domestic pig has been cloned and was foundto be composed of an open reading frame of 503 amino acids[17]. The derivative amino acid sequence of porcine CYP3A29

www.bioscirep.org / Volume 31 (3) / Pages 211–220 211

M. Yao and others

Table 1 Primer sequences for real-time PCR and cDNA amplificationIn the forward (Fwd) primer, the BamHI site is underlined and the start codon is in bold. In the reverse (Rev) primer, the EcoRI site is underlined andthe stop codon is in bold.

Gene GenBank® accession number Primer sequences (5′→3′) Product size (bp)

CYP3A29* NM_214423.1 Fwd: TCCCTCAACAACCCACAAGA 238

Rev: GCTGAAGAAGGTCCACTCGG

GAPDH* U 44832 Fwd: AAGGTCGGAGTGAACGGATTT 158

Rev: CCATTTGATGTTGGCGGGAT

CYP3A29† NM_214423.1 Fwd: CGGGATCCATGGACCTGATCCCAGGCTTT 1525

Rev: GGAATTCAGGCTCCACTTACGGTCCCATCT

pNPR† L33893.1 Fwd: CGGGATCCATGGGGGACTCCAACGTGGAT 2051

Rev: GGAATTCTAGCTCCACACGTCCAGGGAGT

pb5† NM_001001770.1 Fwd: CGGGATCCATGGCCGAACAGTCCGACA 420

Rev: GAATTCTTAGTTTTCCGATGTGTAGAAGTGA

*Primer sequences for real-time PCR.†Primer sequences for cDNA amplification.

exhibits 76 % sequence identity with human CYP3A4. To the bestof our knowledge, no further work has been done on this pro-tein. Therefore we undertook a detailed characterization of theexpression and enzymatic properties of domestic pig CYP3A29.This work is of importance for drug metabolism and toxicologicalresearch.

MATERIALS AND METHODS

ReagentsGrace’s cell culture medium, fetal bovine serum and CELL-FECTIN reagent were obtained from Invitrogen. TST (testoster-one), 6β-OHT (6β-hydroxy testosterone), NIF (nifedipine),ONIF (oxidized NIF), TAO (troleandomycin), glucose 6-phosphate, glucose-6-phosphate dehydrogenase expressed in re-combinant Escherichia coli and an anti-human CYP3A4 mAb(monoclonal antibody) were purchased from Sigma. Humanrecombinant CYP3A4 with hNPR (human NADPH-P450reductase) and hb5 (human cytochrome b5) (baculovirus-expressed) were obtained from BD Gentest. KET was suppliedby the Institute of Veterinary Drug Control of China (Beijing,China). NADP was purchased from Roche. All other chemicalsand reagents were of the highest analytical grade.

Isolation of total RNA and synthesis of cDNAThree independent castrated landrace × large white crossbreedpigs (45 +− 5 kg body weight, aged approx. 3 months) were pur-chased from the Breeding Swine Testing Center (Wuhan, China).The pigs were fed and killed according to the ethics rules of theHubei Agricultural Academy (China). Approx. 100 mg each ofliver, duodenum, jejunum, ileum, kidney, spleen and lung tissueswere collected and then snap-frozen in liquid nitrogen. Total RNAwas isolated using a TRIzol® reagent according to the supplier’srecommendations (Invitrogen). RNA was treated with DNase I(Promega) and first-strand cDNA synthesis was performed from

2 μg of RNA using M-MLV reverse transcriptase (Takara) andoligo d(T)18.

Real-time PCR assayThe PCR assay was carried out in a 25 μl reaction system con-sisting of 0.3 μl of cDNA, 80 nM primer pairs (Table 1) for eachgene and 12.5 μl of SYBR mix (2×) according to the instruc-tions for the Bio-Rad SYBGreen kit. All PCR reactions were per-formed using a Bio-Rad IQ5 Multicolor Real-Time PCR Detec-tion System (Bio-Rad). The thermal cycling conditions consistedof an initial denaturation step at 95◦C for 5 min and 40 cycles of95◦C for 15 s and 58◦C for 40 s respectively. The standard curveswere performed with seven 10-fold serially diluted CYP3A29or GAPDH (glyceraldehyde-3-phosphate dehydrogenase) plas-mids. The mRNA expression levels of the target genes in eachsample were calculated according to the standard curve and nor-malized on the basis of its GAPDH content. Each sample wasanalysed in triplicate.

Immunoblot analysisMicrosomal proteins in tissue samples from pigs were obtainedby homogenization and differential speed centrifugation (10 000and 105 000 g). The proteins were separated by SDS/PAGEand then electrotransferred to a PVDF membrane. The blotswere developed with a primary antibody raised against humanCYP3A4 (MAb HL3, dilution 1:1000) followed by a horseradishperoxidase-labelled goat anti-mouse IgG (dilution 1:20 000) ac-cording to the methods of Guengerich [18]. The individual blotswere visualized on an X-film using Luminol chemiluminescentreagent (Millipore). Microsomes (20 μg) containing recombin-antly expressed CYP3A29 from infected Sf9 cells were used asa reference.

Construction of recombinant baculovirusesNADPH-P450 reductase is a diflavin enzyme responsible forelectron donation to mammalian CYP enzymes. CYP requires theNADPH-P450 reductase to function as a monooxygenase [19].In some oxidation reactions catalysed by CYP3As, cytochrome

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

212 C©The Authors Journal compilation C©2011 Biochemical Society

Expression and functional characterization of the pig CYP3A29 enzyme

b5 has been known to support the electron transfer from NADPHto CYP3As via the reductase [20,21]. Therefore pig CYP3A29was co-expressed in Sf9 cells together with pNPR (pig NADPH-P450 reductase) and pb5 (pig cytochrome b5). PCR amplific-ations of the target cDNAs were conducted using TaKaRa EXTaq DNA polymerase (DR007B; TaKaRa) with the forward andreverse primers containing the restriction enzyme site sequences(underlined) shown in Table 1. The PCR products were diges-ted with BamHI and EcoRI and further purified using a DNApurification kit (Bioteke). The plasmids pFastBac1-CYP3A29,pFastBac1-pNPR and pFastBac1-pb5 were constructed by insert-ing the complete coding sequences of CYP3A29, pNPR and pb5into the restriction sites of BamHI and EcoRI in the pFastBac1vector and then sequenced using an ABI Prism 3730 Genetic Ana-lyzer (Applied Biosystems). These recombinant plasmids weretransformed into DH10Bac cells, and the recombinant baculovir-uses containing the entire coding region of porcine CYP3A29,pNPR and pb5 were generated using the Bac-to-Bac baculovirusexpression system according to the manufacturer’s specifications(Invitrogen).

Expression of porcine CYP3A29 with pNPR and pb5in Sf9 insect cellsTo obtain the approximate protein ratio found in CYP3A4mixtures using the spectral method described earlier [22–24],logarithmic-phase Sf9 insect cells were co-infected with a virusencoding CYP3A29, pNPR and pb5 at a ratio of 8:1:1 and ata total multiplicity of infection of 3. At 24 h post-infection, ahemin–albumin complex was added to achieve a concentration of1 μg/ml hemin [25]. Cells were harvested by centrifugation 72 hafter infection. Microsomes were prepared by ultrasonicationand differential speed centrifugation (10 000 and 105 000 g). Thetotal protein concentration was measured using a bicinchoninicacid protein assay (Pierce). The content of P450 was measuredusing the carbon monoxide-difference spectrum [22], the co-expressed pNPR activity was measured using the cytochrome creduction assay [23] and the concentration of co-expressed pb5was estimated according to a method described previously [24].The expression of recombinant porcine CYP3A29 in microsomesisolated from baculovirus-infected insect cells was analysed byWestern blotting. Prestained protein molecular mass standard (10μg) was used as a reference. Microsomes (20 μg) from uninfec-ted Sf9 insect cells were used as a negative control. Microsomeswere stored at − 70◦C until use.

Assay for CYP3A enzymatic activityThe incubation mixture contained TST (0–200 μM) and NIF(0–80 μM) as the substrate, liver microsomes (500 μg protein/ml;CYP3As was presumed to be at 150 pmol/mg of protein [7,26])or pig recombinant CYP3A29 or human recombinant CYP3A4(5 pmol of recombinant P450) and an NADPH-generating system(2 mM NADP, 20 mM glucose 6-phosphate, 2 units/ml glucose-6-phosphate dehydrogenase and 5 mM MgCl2) in 50 mM po-tassium phosphate buffer (pH 7.4) in a final volume of 200 μl.

The final concentration of the organic solvent (methanol and/orDMSO) in the incubation mixture was less than 1 % (v/v). Allincubations were conducted in triplicate. The reactions were ini-tiated by the addition of the NADPH-generating system afterpreincubation at 37◦C for 5 min. After incubation at 37◦C for10 min, the reaction was terminated by the addition of 40 μlof ice-cold trichloroacetic acid (15 %). The incubated mixtureswere centrifuged for 20 min at 11 000 g to precipitate protein.The supernatants were analysed by HPLC.

Chemical inhibition assayThe inhibitory capacities of KET and TAO were used to comparethe activity of pig recombinant CYP3A29, human recombinantCYP3A4 and PLM (pig liver microsomes). The concentrationof the substrate chosen was below the Km (K0.5) values of thethree enzyme systems for TST 6β-hydroxylation and NIF oxid-ation. A lower substrate concentration was not chosen because10–20 % metabolism of NIF at 30 μM approached the limit ofquantification for ONIF. TST (25 μM) or NIF (30 μM) was co-incubated with a series of concentrations of KET (0–10 μM)using the same enzyme reaction conditions described earlier. ForTAO (0–200 μM), a preincubation (20 min) was undertaken inthe presence of the NADPH-generation system before the sub-strates were added. All incubations were conducted in triplicate.Samples were processed and then analysed by HPLC.

HPLC analysisThe HPLC system consisted of a Waters 2695 ternary pump anda Waters 2487 UV detector. An Eclipse XDB-C18 (250 mm ×4.6 mm internal diameter) (Agilent Technology) HPLC columnwas used for sample separation. The temperature of the HPLCcolumn was set at 30◦C. The mobile phase was methanol/water(56:44, v/v). The column was eluted over 25 min at a flow rate of1 ml/min. The column effluent was monitored by UV absorbanceat 254 nm for 6β-OHT and 270 nm for ONIF. The formationrate of ONIF and 6β-OHT in reaction mixtures was determinedbased on calibration curves constructed from a series of standardscontaining different known amounts of metabolite standards. Thecalibration curves were linear over a range of 0.1–10 μM ONIFand 0.05–10 μM 6β-OHT. Intraday (n = 5) and interday (n = 5)precision did not exceed 10 % in any of the assays.

Data analysisKinetic parameters [Km(K0.5) and Vmax] for the biotransforma-tion of TST and NIF in the absence of inhibitors were calcu-lated by fitting the data to either the Michaelis–Menten {v =Vmax[S]/(Km+[S])} or Hill {v = Vmax[S]n/(K0.5+[S]n)}, wheren is the Hill coefficient) equations, using non-linear regres-sion analysis. Equations were selected by goodness of fitbased on R2 values and least residual sum of squares. TheIC50 values for KET and TAO were determined through thenon-linear regression of relative reaction velocities at a singlesubstrate concentration in the presence of different inhibitor

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


M. Yao and others

Figure 1 Expression levels of CYP3A29 mRNA in tissues ofdomestic pigsRings represent the relative expression units of CYP3A29 mRNA fromthree independent pigs. Histograms represent the mean levels ofCYP3A29 mRNA (relative to GAPDH) in different pig tissues. The rel-ative expression of CYP3A29 mRNA is 0.23 +− 0.22 in heart, 137 +− 53in liver, 0.08 +− 0.07 in spleen, 6.4 +− 4.7 in lung, 0.66 +− 0.37 in kid-ney, 22.5 +− 7.6 in duodenum, 13.0 +− 10.3 in jejunum and 10.2 +− 6.5in ileum tissues respectively. Results are the means +− S.D. (n = 3).

concentrations. The equation is as follows: V i = V0/[1 + I/IC50]a], where V0 is the uninhibited velocity, V i is the observedvelocity, a is the slope factor and I is the inhibitor concentration.The analysis of statistical significance (P < 0.05) was performedwherever appropriate using a one-way ANOVA.

RESULTS

Tissue distribution of CYP3A29Figure 1 shows the mRNA levels of CYP3A29 relative to GAPDHin different tissues of domestic pigs. The relative expression ofCYP3A29 mRNA was greatest in the liver (137), followed byexpression in the duodenum (22.5) and the jejunum (13.0). Rel-ative expression in the ileum (10.2) and lungs (6.4) was moderate,whereas low expression was detected in the heart (0.23), kidneys(0.66) and spleen (0.08). Consistent results with high abundancesof CYP3A29 mRNA in porcine liver and small intestines wereseen in Puccinelli et al. [27]. The tissue distribution of CYP3A29mRNA in domestic pigs was in agreement with that of Bamaminiature pigs [28] and was also comparable to the distributionof CYP3A isoforms in humans and other mammals [14,29,30].In the present study, a gradient expression of CYP3A29 alongthe small intestine was observed. These findings were consist-ent with experiments that detected either CYP3A activity orthe immunohistochemically stained proteins in humans and pigs[31–33]. Four CYP genes belonging to the CYP3A subfamilyhave been found in pigs [11], and the corresponding CYP3A pro-teins in PLM were different in molecular mass and electrophoreticmobility [10]. In the present study, the visible immunoreacting

Figure 2 Immunoblot analysis of CYP3A proteins isolated fromdifferent swine tissues using an anti-CYP3A4 mAb (MAb HL3)Lanes 1–7 were loaded with 20 μg of microsomal proteins from porcineheart, liver, spleen, lung, kidney, small-intestine tissues and Sf9 cellsinfected with CYP3A29 recombinant baculovirus respectively. Lane 8was loaded with 10 μg of protein molecular-mass standard. kD, kDa.

bands in the hepatic and small intestinal microsomal prepara-tions exhibited the same electrophoretic mobility as recombinantCYP3A29 (Figure 2), which indicates that the blotted proteinsare CYP3A29 proteins rather than other CYP3A members, andfurthermore, CYP3A29 is likely to contribute the most to hepaticand intestinal CYP3A proteins. Weakly visible bands were ob-served for the lung and kidney samples, and no band was visiblefor the heart and spleen, suggesting that the results of the im-munoblot analysis are in agreement with the analysis of mRNApatterns.

Heterologous expression of CYP3A29 and thepartner enzyme genesThe pFastBac1-CYP3A29, pFastBac1-pNPR and pFastBac1-pb5 plasmids were constructed by inserting the complete cod-ing sequences of CYP3A29, pNPR and pb5 into the cloningsite of BamHI/EcoRI in the pFastBac1 vector. After sequen-cing, the 1512 bp fragment was nearly identical with porcineCYP3A29, having differences in only three sites compared withthe CYP3A29 cDNA sequence reported previously (GenBank®

accession number NM_214423.1) [17]. None of these substi-tutions resulted in changes in amino acid coding. The 2054 bpand 405 bp fragments were completely in accordance with pNPR(GenBank® accession number L33893.1) and pb5 (GenBank®

accession number NM_001001770.1) respectively.Porcine CYP3A29 was co-expressed with pNPR and pb5 in

Sf9 insect cells, and approx. 50 pmol of P450, 200 units of pNPRand 110 pmol of pb5 were detected per 106 cells. The ratio ofCYP:pNPR:b5 was close to that of recombinant CYP3A4 mix-tures purchased from BD Gentest. The specific spectrogramswere observed using whole infected cells (Figures 3A–3C),which indicates that CYP3A29 was functionally expressed asthe holoenzyme in Sf9 cells when co-expressed with pNPR andpb5. CYP3A29 expression was also confirmed by immunoblotanalysis using an anti-CYP3A4 antibody (Figure 3D).

Enzymatic properties of CYP3A enzymesFigure 4(A) compares the kinetic data for the 6β-hydroxylationof TST catalysed by pig CYP3A29, human CYP3A4 and PLM.The Vmax value (see Table 2) for the 6β-hydroxylation of TSTby CYP3A29 (24.6 nmol · nmol− 1 of P450 · min− 1) was highlysimilar to that of PLM (22.6 nmol · nmol− 1 of P450 · min− 1)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .



Figure 3 Spectra of CYP3A29, pNPR and pb5(A) Fe2+-CO difference spectra of CYP3A29 expressed in infected Sf9 insect cells. (B) 424 nm spectra of pb5 reduced withsodium hydrosulfite. (C) Reductive spectra of cytochrome c by pNPR expressed in infected Sf9 insect cells. (D) Immunoblotanalysis of CYP3A29 expression with an anti-CYP3A4 mAb (MAb HL3); lane 1 was loaded with 10 μg of protein molecularmass standard, whereas lanes 3 and 2 were loaded with 20 μg of microsomal proteins from infected Sf9 insect cells anduninfected Sf9 insect cells respectively. kD, kDa.

Figure 4 Plots for the determination of the apparent K0.5 and Vmax values for TST (A) and NIF (B) metabolism by porcineCYP3A29 (�), PLM (�) and human CYP3A4 (�)Incubations contained 5 pmol of CYP3A enzymes or 500 μg/ml PLM, an NADPH-generating system and TST (0, 2.5, 5,10, 25, 50, 100, 150 or 200 μM) or NIF (0, 2, 4, 8, 10, 20, 40, 60 or 80 μM) and were incubated for 10 min at 37◦C.Values are the means from data obtained from three separate incubations at each substrate concentration. The S.D. ofthe replicate samples did not exceed 10 % of the mean values. The solid lines through the experimental data show thebest fits for the non-linear regression analysis using the Hill equation (v = Vmax[S]n/(K0.5 + [S]n) for sigmoidal kinetics.

and human recombinant CYP3A4 (23.0 nmol · nmol− 1 ofP450 · min− 1). The K0.5 value of CYP3A29 for TST (33.7 μM)was approximately half of that of PLM (64.7 μM) and slightlyhigher than that of CYP3A4 (28.0 μM). Accordingly, the in vitrointrinsic clearance value, CLint (Vmax/K0.5), of CYP3A29 for TSTwas 0.73 ml · nmol− 1 of P450 · min− 1, much higher than that of

PLM (0.35 ml · nmol− 1 of P450 · min− 1) and roughly equal tothat of human CYP3A4 (0.82 ml · nmol− 1 of P450 · min− 1).

The kinetic data for the generation of ONIF by recombin-ant porcine CYP3A29, recombinant human CYP3A4 and PLMwith increasing concentrations of NIF (0–80 μM) are dis-played in Figure 4(B). The Vmax values for NIF oxidation by

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


M. Yao and others

Table 2 Enzyme kinetic parameters for the 6β-OHT and oxidized NIF by recombinant CYP3A enzymes and PLM respectivelyResults are means +− S.D. (n = 3).

Enzyme Substrate Vmax (nmol · nmol− 1 of P450 · min− 1) K0.5 (μM) CLint (ml · nmol− 1 of P450 · min− 1) n

CYP3A4-hNPR-hb5 TST 23.0 +− 1.2 28.0 +− 3.7 0.82 +− 0.08 1.2 +− 0.1

CYP3A29-pNPR-pb5 24.6 +− 1.8 33.7 +− 6.6 0.73 +− 0.10 1.1 +− 0.1

PLM 22.6 +− 2.3 64.7 +− 11.8 0.35 +− 0.09 1.3 +− 0.1

CYP3A4-hNPR-hb5 NIF 11.0 +− 0.6 5.1 +− 2.1 2.2 +− 0.9 1.3 +− 0.1

CYP3A29-pNPR-pb5 8.6 +− 0.5 16.3 +− 1.7 0.52 +− 0.08 1.2 +− 0.1

PLM 10.1 +− 3.4 33.0 +− 20.9 0.31 +− 0.12 1.1 +− 0.1

Figure 5 Chemical inhibition of the 6β-hydroxylation of TST and oxidation of NIF catalysed by recombinant CYP3A29 (�),CYP3A4 (�) and PLM (�) in the presence of a series of concentrations of KET (0–10 μM) (A and B) and TAO(0–200 μM) (C and D)The substrate concentrations used were 25 μM for TST and 30 μM for NIF. Results are calculated as percentage inhibitionof 6β -OHT or ONIF formation as a function of increasing concentration of KET or TAO. Curves are plotted with the meanvalues from three incubations, and the values for duplicate incubations were within 10 % of each other in all cases.

the three metabolism systems were relatively similar at 11.0,8.6 and 10.1 nmol · nmol− 1 of P450 · min− 1 respectively. TheK0.5 value of NIF for PLM (33 μM) was roughly twice thatof CYP3A29 (16.3 μM), and the latter was 3-fold higher thanthat of CYP3A4 (K0.5 = 5.1 μM). The various K0.5 values had apredominant effect on the CLint value (see Table 2). CYP3A4was 4-fold more active at metabolizing NIF than CYP3A29and 6-fold more active than PLM based on a CLint value of

2.2 ml · nmol− 1 of P450 · min− 1, compared with values of 0.52and 0.31 ml · nmol− 1 of P450 · min− 1 respectively.

Inhibitory effect on CYP3A activityFigure 5 reveals the effects of KET and TAO on the TST6β-hydroxylation and NIF oxidation activities of recombinantCYP3A29, CYP3A4 and PLM respectively. The IC50 values of

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .



Table 3 IC50 values for KET and TAO towards 25 μM TST and 30 μM NIF respectivelyResults are means +− S.D. (n = 3). *P < 0.05 compared with CYP3A29.

IC50 values (μM)

Enzymes system KET towards TST KET towards NIF TAO towards TST TAO towards NIF

CYP3A4-hNPR-hb5 0.018 +− 0.004 0.023 +− 0.015 9.8 +− 1.3* 1.3 +− 0.7*

CYP3A29-pNPR-pb5 0.031 +− 0.015 0.044 +− 0.010 17.8 +− 2.0 4.7 +− 0.9

PLM 0.078 +− 0.015 0.19 +− 0.11 69.5 +− 12.1 25.5 +− 4.4

KET and TAO towards CYP3A enzymatic activities were cal-culated and are shown in Table 3. The inhibition of TST 6β

hydroxylation and NIF oxidation activities by KET were forCYP3A29 (IC50 = 0.031 and 0.044 μM respectively) roughlyidentical with those for CYP3A4 (IC50 = 0.018 and 0.023 μM re-spectively) and slightly lower than those for PLM (IC50 = 0.078and 0.19 μM respectively). There were no significant differencesin the IC50 values between CYP3A29 and PLM and betweenCYP3A29 and CYP3A4. Apparently higher IC50 values for TAOthan KET were observed in the present study. The respectiveIC50 values for TAO for TST 6β-hydroxylation and NIF oxida-tion were 17.8 and 4.7 μM for pig CYP3A29, 9.8 and 1.3 μMfor human CYP3A4 and 69.5 and 25.5 μM for PLM.

DISCUSSION

Pigs are increasingly used as an animal model for the develop-ment of medicines [13,31,32,34]. Many reports have even raisedinterest in pigs as the best animal for supplying hepatocyte-basedbioartificial liver or extracorporeal liver perfusion for the treat-ment of patients with liver failure [35,36]. Based on studies utiliz-ing PLM and isoform-selective substrates of CYP3A, it has beensuggested that a member of the CYP3A family present in pigliver may be capable of metabolizing substrates similar to thoseof CYP3A4. However, little is known about the enzymatic prop-erties and other details of the CYP3A enzyme isoforms. CYP3Asubfamily enzymes tend to lose catalytic activity during puri-fication, and many of their reactions require special conditionsfor reconstitution of optimal activity. Furthermore, CYP3A pro-teins purified from liver microsomes are always contaminated bysmall amount of other CYP isoenzymes. The only definitive wayto determine precisely which enzyme is responsible for the meta-bolism of a given drug and which metabolites a specific enzymeproduces is to construct a recombinant enzyme. To that end, inthe present study, CYP3A29 was confirmed to be a highly ex-pressed CYP3A isoform in domestic pigs, and CYP3A29 cDNAwas cloned and expressed in insect cells in order to characterizeits enzymatic activity and compare it with PLM and its humancounterpart CYP3A4.

The 6β-hydroxylation of TST, the most commonly used re-action for estimating the activity of CYP3A, has been employedto assess the activities of CYP3A29, CYP3A4 and PLM. Pre-

vious studies have demonstrated that CYP3A enzymes in PLMand hepatocytes are capable of oxidizing TST; however, the res-ults were presented only with a mean reaction velocity at a fixedconcentration of substrate [8,37]. The kinetic properties of in-dividual CYP3A isoforms in domestic pigs for these activitieshave received very limited attention. This study reveals that pigCYP3A29 and human CYP3A4 possessed similar metabolic ca-pacity and affinity for TST. Human CYP3A4 displayed a highlyconcordant result with the report of Carr et al. [38] (K0.5 =24.1 μM), but domestic pig CYP3A29 exhibited a notably higherapparent affinity for TST than purified minipig CYP3A29 (K0.5

> 70 μM [39]). These results strongly suggest that domestic pigCYP3A29 could be more similar to human CYP3A4 than minipigCYP3A29 with regard to the metabolism of TST.

For TST 6β-hydoxylation, PLM displayed a relatively higherK0.5 value, which is also consistent with an earlier observation(K0.5 = 83.6 μM [39]). Currently, the higher K0.5 and lower CLint

values for PLM than for CYP3A29 probably indicate that pigCYPs are either inefficient at metabolizing TST or that pigsmight produce metabolites other than the 6β-hydoxy product.TST 15β-, 7α-, 6β-, 16α-, 6β-, 2α- and 2β-hydroxylase activit-ies also have been found to be present predominantly in PLMand cultured hepatocytes from domestic pigs [5], which in-dicates that other CYP isoforms in pigs could be involved inTST metabolism. An additional LC (liquid chromatography)-MS analysis revealed one additional product in PLM incub-ations. Based on a signal at m/z of 287 for the dehydrogen-ated metabolite (see Supplementary Figures S1 and S2 availableat http://www.bioscirep.org/bsr/031/bsr0310211add.htm) and as-suming that the ionization efficiencies were similar to 6β-OHT,we found that the formation of this dehydrogenated product inPLM occurred at a higher rate compared with the rate of form-ation of the 6β-hydroxylation product. These findings suggestthat, besides 6β-OHT, dehydrogenated TST could also be a ma-jor product of TST metabolism in PLM. Moreover, the dehyd-rogenated TST could also be produced by the other CYP iso-forms in PLM due to its existence in CYP3A29 incubations at alower level than in PLM. Therefore the present findings supportthe need to fully characterize other CYP enzymes in domesticpigs.

NIF, a frequently employed substrate probe used to charac-terize CYP3A in various model animals, has been shown to beoxidized by CYP3A29 enzymes. CYP3A29 displayed a sim-ilar metabolic capacity to CYP3A4 and PLM for NIF oxidation.However, CYP3A29 was proven to have a relatively lower NIF

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


http://www.bioscirep.org/bsr/031/bsr0310211add.htm

M. Yao and others

oxidase activity than CYP3A4 for a much lower CLint value. Inaddition, CYP3A29 demonstrated an apparent lower K0.5 valueand much higher CLint value for NIF oxidization compared withPLM, indicating low NIF oxidase activity in PLM. Besides theinvolvement of multi-enzymes in PLM, the different kinetic para-meters for NIF oxidation between CYP3A29 and PLM could alsobe the result of probable different levels of pNPR and pb5 in thetwo metabolism systems. However, when compared with TST,NIF should be used as a selective probe drug for pig CYP3Aenzyme activity in vitro due to its lower K0.5 values both inCYP3A29 and PLM.

For the oxidation of NIF and 6β-hydroxylation of TST,CYP3A29, CYP3A4 and PLM all displayed sigmoidal or auto-activation kinetic behaviours with Hill coefficients of n>1(Table 2). Consistent results were previously reported for sev-eral other CYP3A enzymes [38]. Sigmoidal kinetics can be in-terpreted by the allosteric effect hypothesis. CYP3A proteinsusually undergo dramatic conformational changes upon ligandbinding with an increase in the active site volume, which couldincrease the adaptability of enzyme to ligands [40,41].

Inhibitors that are capable of selectively inhibiting a particularenzymatic reaction are extremely useful for characterizing themetabolic pathway or the fate of a new drug. KET inhibition ofboth TST 6β-hydroxylation and NIF oxidation in the three meta-bolism systems was stronger than that of TAO, and the resultsare in agreement with earlier results from micropigs [14]. Fur-thermore, in PLM, KET inhibition of CYP3A activities is verysimilar to KET inhibition of CYP3A29 and CYP3A4 activity,with IC50 values ranging from 0.02 to 0.2 μM (P > 0.05), whichare also highly comparable to those of the corresponding indi-vidual isoforms in other mammals (in the 0.1 μM range) [38].These results confirmed that KET could be a uniformly powerfulinhibitor for targeting CYP3A activities in pigs and humans andsupport the notion that CYP3A29 contributes the major CYP3Aactivity in PLM. TAO had significantly higher IC50 values to-wards CYP3A activity in CYP3A29 compared with its effects onCYP3A4 (P < 0.05), and similar results were found in minipigand human liver microsomes [42]. In addition, the IC50 valuesof TAO and KET towards CYP3A activities in PLM were 2–5-fold different than those of CYP3A29 respectively, although thedifferences did not reach a significant level (P > 0.05), whichagain suggests that other P450 enzymes were involved in themetabolism of TST and NIF.

CYP3A29 has been shown to metabolize TST and NIF;furthermore, this can be inhibited by TAO and KET, specificinhibitors of human CYP3A4. Accordingly, it is consideredthat the functional similarities of pig CYP3A29 and humanCYP3A4 are due to the high identity of amino acid residues.The amino acid sequence of pig CYP3A29 is 76 % similarto that of human CYP3A4. Consequently, CYP3A29 probablyshares an overlapping set of substrates with CYP3A4. However,the CYP3A29 and CYP3A4 proteins have been shown to pos-sess different enzymatic properties for NIF, including inhibitorysusceptibility to TAO, indicating the likely differences in theirprotein structures. When compared, the amino acid sequencesof the two enzymes with respect to substrate recognition re-

gion, the most distinct differences observed were located in thehelices F–G region (see Supplementary Figure S3 available athttp://www.bioscirep.org/bsr/031/bsr0310211add.htm). HelicesF–G were considered as an important region for determiningthe substrate specificities of CYP3A enzymes [43] due to theirfunction in initial substrate recognition [41,44]. This region con-tains a number of residues that have been shown by site-directedmutagenesis to have a direct or indirect role in CYP3A4 func-tion. For example, Leu210, was implicated in effector binding aswell as the stereo- and regio-selectivity profile of CYP3A4 [45].Leu211 and Asp214 were implicated in co-operativity of CYP3A4[45,46]. These sequence divergences located in functional re-gions are likely to be an explanation for the different enzymaticproperties of the CYP3A enzymes with respect to ligands.

In conclusion, this work has demonstrated that domestic pigshave a functionally active CYP3A29 gene that is well expressedin the liver and small intestines and has biochemical propertiesquite similar to those of the corresponding human enzyme; thissimilarity implies the probable important role of pig CYP3A29in the metabolism of xenobiotics and contributes to the ideathat pigs are a useful human model in toxicological and phar-macological studies. Some differences were observed betweenrecombinant CYP3A29 and PLM with regard to substrate and in-hibitor kinetics. Therefore the other pig CYP isoenzymes shouldalso be cloned, heterologously expressed and further tested forsubstrate and inhibitor specificities before those probe activitiescan be employed to assess special CYP isoforms. Furthermore,additional studies are necessary to determine the content of CYPproteins in porcine tissues with specific antibodies raised againstrecombinant swine CYP proteins. However, the expression andfunctional characterization of CYP3A29 have provided a basisfor developing an in vitro assay to facilitate the evaluation of thetoxicity and metabolism of new drugs.

AUTHOR CONTRIBUTION

Zonghui Yuan defined the research theme. Min Yao designed themethods and experiments, carried out the laboratory experiments,analysed the data, interpreted the results and wrote the paper.Menghong Dai co-designed the real-time PCR and immunoblot ex-periments, and co-worked on the associated data collection andtheir interpretation. Zhaoying Liu and Lingli Huang co-designed themetabolic kinetics experiments, and co-worked on the associateddata collection and their interpretation. Dongmei Chen contributedto the HPLC analysis. Yulian Wang, Dapeng Peng, Xu Wang andZhenli Liu co-designed the experiments, and discussed the ana-lyses, interpretation and presentation. All authors have contributedto, seen and approved the manuscript.

ACKNOWLEDGEMENT

We thank Professor F. Peter Guengerich (Vanderbilt University Med-ical Center, Nashville, TN, U.S.A.) for the gift of pCWori+ and foruseful suggestions.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


http://www.bioscirep.org/bsr/031/bsr0310211add.htm


FUNDING

This work was supported by State Basic Research Develop-ment Program of China through the 973 Program [grant number2009CB118800].

REFERENCES

1 Guengerich, F. P. (1997) Comparisons of catalytic selectivity ofcytochrome P450 subfamily enzymes from different species.Chem. Biol. Interact. 106, 161–182

2 Wrighton, S. A. and Stevens, J. C. (1992) The human hepaticcytochromes P450 involved in drug metabolism. Crit. Rev. Toxicol.22, 1–21

3 Kamdem, L. K., Meineke, I., Godtel-Armbrust, U., Brockmoller, J.and Wojnowski, L. (2006) Dominant contribution of P450 3A4 tothe hepatic carcinogenic activation of aflatoxin B1. Chem. Res.Toxicol. 19, 577–586

4 Skaanild, M. T. (2006) Porcine cytochrome P450 and metabolism.Curr. Pharm. Des. 12, 1421–1427

5 Donato, M. T., Castell, J. V. and Gomez-Lechon, M. J. (1999)Characterization of drug metabolizing activities in pig hepatocytesfor use in bioartificial liver devices: comparison with other hepaticcellular models. J. Hepatol. 31, 542–549

6 Bader, A., Hansen, T., Kirchner, G., Allmeling, C., Haverich, A. andBorlak, J. T. (2000) Primary porcine enterocyte and hepatocytecultures to study drug oxidation reactions. Brit. J. Pharmacol. 129,331–342

7 Nebbia, C., Dacasto, M., Rossetto Giaccherino, A., Giuliano Albo,A. and Carletti, M. (2003) Comparative expression of livercytochrome P450-dependent monooxygenases in the horse and inother agricultural and laboratory species. Vet. J. 165, 53–64

8 Szotakova, B., Baliharova, V., Lamka, J., Nozinova, E., Wsol, V.,Velik, J., Machala, M., Neca, J., Soucek, P., Susova, S. andSkalova, L. (2004) Comparison of in vitro activities ofbiotransformation enzymes in pig, cattle, goat and sheep. Res.Vet. Sci. 76, 43–51

9 Myers, M. J., Farrell, D. E., Howard, K. D. and Kawalek, J. C.(2001) Identification of multiple constitutive and inducible hepaticcytochrome P450 enzymes in market weight swine. Drug Metab.Dispos. 29, 908–915

10 Hosagrahara, V. P., Hansen, L. K. and Remmel, R. P. (1999)Induction of the metabolism of midazolam by rifampin in culturedporcine hepatocytes: preliminary evidence for CYP3A isoforms inpigs. Drug Metab. Dispos. 27, 1512–1518

11 Nannelli, A., Chirulli, V., Longo, V. and Gervasi, P. G. (2008)Expression and induction by rifampicin of CAR- and PXR-regulatedCYP2B and CYP3A in liver, kidney and airways of pig. Toxicology252, 105–112

12 Messina, A., Nannelli, A., Fiorio, R., Longo, V. and Gervasi, P. G.(2009) Expression and inducibility of CYP1A1, 1A2, 1B1 bybeta-naphthoflavone and CYP2B22, 3A22, 3A29, 3A46 byrifampicin in the respiratory and olfactory mucosa of pig.Toxicology 260, 47–52

13 Witkamp, R. F., Nijmeijer, S. M., Monshouwer, M. and Van Miert,A. S. (1995) The antibiotic tiamulin is a potent inducer and inhibitorof cytochrome P4503A via the formation of a stable metabolicintermediate complexStudies in primary hepatocyte cultures andliver microsomes of the pig. Drug Metab. Dispos. 23, 542–547

14 Bogaards, J. J., Bertrand, M., Jackson, P., Oudshoorn, M. J.,Weaver, R. J., van Bladeren, P. J. and Walther, B. (2000)Determining the best animal model for human cytochrome P450activities: a comparison of mouse, rat, rabbit, dog, micropig,monkey and man. Xenobiotica 30, 1131–1152

15 Zuber, R., Anzenbacherova, E. and Anzenbacher, P. (2002)Cytochromes P450 and experimental models of drug metabolism.J. Cell Mol. Med. 6, 189–198

16 Soucek, P., Zuber, R., Anzenbacherova, E., Anzenbacher, P. andGuengerich, F. P. (2001) Minipig cytochrome P450 3A, 2A and 2Cenzymes have similar properties to human analogs. BMCPharmacol. 1, 11

17 Nissen, P. H., Wintero, A. K. and Fredholm, M. (1998) Mapping ofporcine genes belonging to two different cytochrome P450subfamilies. Anim. Genet. 29, 7–11

18 Guengerich, F. P., Martin, M. V., Guo, Z. and Chun, Y. J. (1996)Purification of functional recombinant P450s from bacteria.Methods Enzymol. 272, 35–44

19 Gutierrez, A., Grunau, A., Paine, M., Munro, A. W., Wolf, C. R.,Roberts, G. C. and Scrutton, N. S. (2003) Electron transfer inhuman cytochrome P450 reductase. Biochem. Soc. Trans. 31,497–501

20 Yamazaki, H., Nakano, M., Imai, Y., Ueng, Y. F., Guengerich, F. P.and Shimada, T. (1996) Roles of cytochrome b5 in the oxidation oftestosterone and nifedipine by recombinant cytochrome P450 3A4and by human liver microsomes. Arch. Biochem. Biophys. 325,174–182

21 Yantsevich, A. V., Gilep, A. A. and Usanov, S. A. (2009) Electrontransfer properties and catalytic competence of cytochrome b5 inthe fusion protein Hmwb5-EGFP in reactions catalyzed bycytochrome P450 3A4. Biochemistry 74, 862–873

22 Omura, T. and Sato, R. (1964) The carbon monoxide-bindingpigment of liver microsomes. Evidence for its hemoprotein nature.J. Biol. Chem. 239, 2370–2378

23 Strobel, H. W. and Dignam, J. D. (1978) Purification and propertiesof NADPH-cytochrome P-450 reductase. Methods Enzymol. 52,89–96

24 Holmans, P. L., Shet, M. S., Martin-Wixtrom, C. A., Fisher, C. W.and Estabrook, R. W. (1994) The high-level expression inEscherichia coli of the membrane-bound form of human and ratcytochrome b5 and studies on their mechanism of function. Arch.Biochem. Biophys. 312, 554–565

25 Shou, M., Norcross, R., Sandig, G., Lu, P., Li, Y., Lin, Y., Mei, Q.,Rodrigues, A. D. and Rushmore, T. H. (2003) Substrate specificityand kinetic properties of seven heterologously expressed dogcytochromes P450. Drug Metab. Dispos. 31, 1161–1169

26 Skaanild, M. T. and Friis, C. (1997) Characterization of the P450system in Gottingen minipigs. Pharmacol. Toxicol. 80 (Suppl. 2),28–33

27 Puccinelli, E., Gervasi, P. G., La Marca, M., Beffy, P. and Longo, V.(2010) Expression and inducibility by phenobarbital of CYP2C33,CYP2C42, CYP2C49, CYP2B22, and CYP3As in porcine liver,kidney, small intestine, and nasal tissues. Xenobiotica 40,525–535

28 Shang, H., Yang, J., Liu, Y. and Wei, H. (2009) Tissue distributionof CYP3A29 mRNA expression in Bama miniature pig byquantitative reverse transcriptase-polymerase chain reaction(RT-PCR). Xenobiotica 39, 423–429

29 Mealey, K. L., Jabbes, M., Spencer, E. and Akey, J. M. (2008)Differential expression of CYP3A12 and CYP3A26 mRNAs incanine liver and intestine. Xenobiotica 38, 1305–1312

30 Bieche, I., Narjoz, C., Asselah, T., Vacher, S., Marcellin, P.,Lidereau, R., Beaune, P. and de Waziers, I. (2007) Reversetranscriptase-PCR quantification of mRNA levels from cytochrome(CYP)1, CYP2 and CYP3 families in 22 different human tissues.Pharmacogenet. Genom. 17, 731–742

31 Lampen, A., Christians, U., Gonschior, A. K., Bader, A., Hackbarth,I., von Engelhardt, W. and Sewing, K. F. (1996) Metabolism of themacrolide immunosuppressant, tacrolimus, by the pig gut mucosain the Ussing chamber. Br. J. Pharmacol. 117, 1730–1734

32 Nishi, K., Ishii, T., Wada, M., Amae, S., Sano, N., Nio, M. andHayashi, Y. (2004) The expression of intestinal CYP3A4 in thepiglet model. Transplant. Proc. 36, 361–363

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


M. Yao and others

33 Paine, M. F., Khalighi, M., Fisher, J. M., Shen, D. D., Kunze, K. L.,Marsh, C. L., Perkins, J. D. and Thummel, K. E. (1997)Characterization of interintestinal and intraintestinal variations inhuman CYP3A-dependent metabolism. J. Pharmacol. Exp. Ther.283, 1552–1562

34 Olsen, A. K., Hansen, K. T. and Friis, C. (1997) Pig hepatocytes asan in vitro model to study the regulation of human CYP3A4:prediction of drug–drug interactions with 17 alpha-ethynylestradiol.Chem-Biol. Interact. 107, 93–108

35 Chari, R. S., Collins, B. H., Magee, J. C., DiMaio, J. M., Kirk, A. D.,Harland, R. C., McCann, R. L., Platt, J. L. and Meyers, W. C. (1994)Brief report: treatment of hepatic failure with ex vivo pig-liverperfusion followed by liver transplantation. New Engl. J. Med. 331,234–237

36 Gerlach, J. C. (1996) Development of a hybrid liver supportsystem: a review. Int. J. Artif. Organs 19, 645–654

37 Skaanild, M. T. and Friis, C. (1999) Cytochrome P450 sexdifferences in minipigs and conventional pigs. Pharmacol. Toxicol.85, 174–180

38 Carr, B., Norcross, R., Fang, Y., Lu, P., Rodrigues, A. D., Shou, M.,Rushmore, T. and Booth-Genthe, C. (2006) Characterization of therhesus monkey CYP3A64 enzyme: species comparisons of CYP3Asubstrate specificity and kinetics using baculovirus-expressedrecombinant enzymes. Drug Metab. Dispos. 34, 1703–1712

39 Anzenbacherova, E., Baranova, J., Zuber, R., Pechova, A.,Anzenbacher, P., Soucek, P. and Martinkova, J. (2005) Modelsystems based on experimental animals for studies on drugmetabolism in man: (mini)pig cytochromes P450 3A29 and 2E1.Basic Clin. Pharmacol. Toxicol. 96, 244–245

40 Ueng, Y. F., Kuwabara, T., Chun, Y. J. and Guengerich, F. P. (1997)Cooperativity in oxidations catalyzed by cytochrome P450 3A4.Biochemistry 36, 370–381

41 Ekroos, M. and Sjogren, T. (2006) Structural basis for ligandpromiscuity in cytochrome P450 3A4. Proc. Natl. Acad. Sci. U.S.A.103, 13682–13687

42 Anzenbacher, P., Soucek, P., Anzenbacherova, E., Gut, I., Hruby, K.,Svoboda, Z. and Kvetina, J. (1998) Presence and activity ofcytochrome P450 isoforms in minipig liver microsomes.Comparison with human liver samples. Drug Metab. Dispos. 26,56–59

43 Torimoto, N., Ishii, I., Toyama, K., Hata, M., Tanaka, K.,Shimomura, H., Nakamura, H., Ariyoshi, N., Ohmori, S. andKitada, M. (2007) Helices F-G are important for the substratespecificities of CYP3A7. Drug Metab Dispos. 35, 484–492

44 Williams, P. A., Cosme, J., Vinkovic, D. M., Ward, A., Angove, H. C.,Day, P. J., Vonrhein, C., Tickle, I. J. and Jhoti, H. (2004) Crystalstructures of human cytochrome P450 3A4 bound to metyraponeand progesterone. Science 305, 683–686

45 Harlow, G. R. and Halpert, J. R. (1997) Alanine-scanningmutagenesis of a putative substrate recognition site in humancytochrome P450 3A4. Role of residues 210 and 211 in flavonoidactivation and substrate specificity. J. Biol. Chem. 272,5396–5402

46 Wang, H., Dick, R., Yin, H., Licad-Coles, E., Kroetz, D. L.,Szklarz, G., Harlow, G., Halpert, J. R. and Correia, M. A. (1998)Structure-function relationships of human liver cytochromes P4503A: aflatoxin B1 metabolism as a probe. Biochemistry 37,12536–12545

Received 28 July 2010/20 September 2010; accepted 24 September 2010Published as Immediate Publication 24 September 2010, doi 10.1042/BSR20100084

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


Biosci. Rep. (2011) / 31 / 211–220 (Printed in Great Britain) / doi 10.1042/BSR20100084

SUPPLEMENTARY ONLINE DATA

Comparison of the substrate kinetics of pigCYP3A29 with pig liver microsomes and humanCYP3A4Min YAO, Menghong DAI, Zhaoying LIU, Lingli HUANG, Dongmei CHEN, Yulian WANG, Dapeng PENG, Xu WANG,Zhenli LIU and Zonghui YUAN1

National Reference Laboratory of Veterinary Drug Residues (HZAU)/MAO Key Laboratory of Food Safety Evaluation, Huazhong AgriculturalUniversity, Wuhan, Hubei 430070, People’s Republic of China

Figure S1 Accurate extracted mass chromatogram of possible metabolites of TST in PLM incubationsAn extracted ion chromatogram is shown.

Figure S2 Accurate MS spectrum of a dehydrogenated metaboliteof TST

1To whom correspondence should be addressed (email [email protected]).

www.bioscirep.org / Volume 31 (3) / Pages 211–220

M. Yao and others

Figure S3 Sequence alignment between pig CYP3A29 and human CYP3A4

Received 28 July 2010/20 September 2010; accepted 24 September 2010Published as Immediate Publication 24 September 2010, doi 10.1042/BSR20100084

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

C©The Authors Journal compilation C©2011 Biochemical Society

comparison of the substrate kinetics of pig cyp3a29 with ... · three enzyme systems for tst...

Documents