comparative structural and functional studies of nanoparticle formulations for dna and sirna...

BASIC SCIENCE

rticle
Research A
Nanomedicine: Nanotechnology, Biology, and Medicine 7 (2011) 210–219

Comparative structural and functional studies of nanoparticle formulationsfor DNA and siRNA delivery

Albert Kwok, PhDa,b,⁎, Stephen L. Hart, PhDb

aDepartment of Biochemistry, University of Cambridge, Cambridge, United KingdombWolfson Centre for Gene Therapy of Childhood Disease, UCL Institute of Child Health, London, United Kingdom

Received 20 May 2010; accepted 24 July 2010

www.nanomedjournal.com

Abstract

The transfection efficiencies of 25-kDa branched polyethylenimine (B-PEI) and 22-kDa linear PEI (L-PEI) with both DNA and smallinterfering RNA (siRNA) were compared and correlated with their biophysical properties relating to complex formation, stability, anddisassembly. L-PEI-DNA complexes transfected (5.18 × 108 relative luminescence units [RLU]/mg) around fivefold better than B-PEI-DNAcomplexes (0.95 × 108 RLU/mg), whereas B-PEI-siRNA complexes gave approximately 60% gene knockdown and L-PEI-siRNAcomplexes were inactive. Both B-PEI and L-PEI packaged DNA and siRNA to form positively charged nanoparticles; however, L-PEInanoparticles were less stable than B-PEI nanoparticles, particularly with siRNA. The poor stability of L-PEI-siRNA complexes seemed tobe the major factor contributing to an observed lack of cellular uptake and hence poor transfection. The more stable B-PEI-siRNAcomplexes, however, were bound, internalized, and detectable in the cytoplasm. These results highlight the importance of particle stabilityfor efficient siRNA and plasmid delivery, while retaining the ability to readily dissociate within the cell.

From the Clinical Editor: Comparison of branched versus linear cationic polymers, i.e, polyethylenimine (PEI), were compared for theirformation of condensed DNA and SiRNA complexes. Branched complexes were superior for transfection due to improved structuralstability, making this PEI approach more likely to succeed as a nanotherapy.© 2011 Elsevier Inc. All rights reserved.

Key words: Polyethylenimine (PEI); Biophysical characteristics; DNA delivery; siRNA delivery; RNA interference

RNA interference provides a specific and efficient way tosilence gene expression; it is an attractive tool for geneticresearch and drug target validation, and may provide newtherapeutic options for nondruggable targets. Small interferingRNA (siRNA) molecules are a double-stranded product of 21–23 nucleotides with two-nucleotide 3′ overhangs and 5′-phosphorylated ends.1-3 The siRNA is incorporated into amulticomponent nuclease complex present in the cytoplasm toform the RNA-induced silencing complex (RISC) within theprocessing bodies (P-bodies).4,5 In the RISC, a catalyticallyactive endonuclease called Argonaute binds to siRNA anddegrades the antiguide, or passenger strand, leaving the guidestrand intact to direct gene silencing.6 The guide strand basepairs with the target messenger RNA (mRNA), cleaving it at aposition between nucleotides 10 and 11 relative to the 5′ end of

No conflict of interest was reported by the authors of this paper.⁎Corresponding author: Department of Biochemistry, University of

Cambridge, Cambridge CB2 1GA, United Kingdom.E-mail address: [email protected] (A. Kwok).

1549-9634/$ – see front matter © 2011 Elsevier Inc. All rights reserved.doi:10.1016/j.nano.2010.07.005

Please cite this article as: A. Kwok, S.L. Hart, Comparative structural and funcNanomedicine: NBM 2011;7:210-219, doi:10.1016/j.nano.2010.07.005

the guide strand.7 The activated RISC complex is then recycledand targets other mRNAs.8

In mammalian cells, siRNA can be delivered to a target cellwith a carrier or vector system. Although delivery of siRNAfaces many of the same intracellular steps as delivery of plasmidDNA, siRNA activity is localized within the P-body in thecytoplasm, which eliminates the need to cross the nuclearenvelope to the nucleus. Despite this delivery advantage, inreality, siRNA delivery has proven to be highly challenging,particularly in vivo.9 Therefore, there is an urgent need to betterunderstand and characterize siRNA delivery formulations andmechanisms for the development of better delivery systems.

We hypothesized that an effective siRNA delivery systemcomprising self-assembling nanoparticles may have similarbiophysical properties to effective plasmid delivery systems.These properties should include efficient binding to the cellsurface, and uptake by endocytic processes, endosomal escape,and release of the siRNA cargo in the cytoplasm. Therefore, theaim of this study was to compare and contrast the structural,biophysical properties and functional, transfection efficiencies ofvector complexes formed by linear PEI (L-PEI) and branched

tional studies of nanoparticle formulations for DNA and siRNA delivery.

http://dx.doi.org/10.1016/j.nano.2010.07.005




mailto:[email protected]



211A. Kwok, S.L. Hart / Nanomedicine: Nanotechnology, Biology, and Medicine 7 (2011) 210–219

PEI (B-PEI) with plasmid DNA and siRNA, to identify the keystructural criteria for optimal functionality. Biophysical para-meters determined here included the binding and dissociationproperties of the vector components to the nucleic acid as well asthe size and surface charge of the complex. Functional studiesincluded luciferase and glyceraldehyde 3-phosphate dehydroge-nase (GAPDH) gene knockdown, cellular uptake, and traffickingof particles by fluorescence microscopy and flow cytometry.

From these results, we demonstrated that L-PEI and B-PEIboth formed stable nanoparticles with plasmid DNA to formpositively charged nanoparticles. Exposure to anionic heparinled to complex dissociation of both formulations, but B-PEIcomplexes were more stable than L-PEI complexes, requiringapproximately fourfold higher concentration of heparin for 95%dissociation, which correlated inversely with transfectionefficiency. Even though both L-PEI and B-PEI formedpositively charged nanoparticles with siRNA, only B-PEI-siRNA complexes were taken up into cells and mediated genesilencing. L-PEI-siRNA complexes (N95% dissociation at 1.3U/mL) were shown to be considerably less stable with heparinthan the B-PEI-siRNA complexes (N95% dissociation at 5U/mL). Interestingly, the optimal B-PEI-siRNA complexes andthe optimal L-PEI-DNA complexes both required incubationwith 5 U/mL of heparin for N95% dissociation, which wepropose may be a common optimal characteristic for nucleicacid transfection complexes. Confocal data revealed littlecellular uptake of fluorescently labeled L-PEI-siRNA com-plexes, suggesting they dissociated on cell binding beforeuptake, whereas B-PEI appeared to be taken up abundantly withmost siRNA localized in the nucleus. B-PEI producedapproximately 60% knockdown of luciferase expression,which was less efficient than the Lipofectamine 2000 siRNAformulation, which regularly achieved 80% knockdown.Confocal analysis revealed that Lipofectamine-deliveredsiRNA was mainly cytoplasmic, where the processing machin-ery is localized. Along with other studies,10-12 this investigationprovides further evidence that siRNA complex stability and thesubcellular site of delivery are important parameters for efficientsiRNA-mediated gene knockdown.

Methods

Transfection reagents and cells

Plasmid pCEP4-Luc was created by subcloning the lucifer-ase gene into the pCEP4 plasmid, which contains a hygromycinB selection marker (Invitrogen, Paisley, United Kingdom), andwas used to generate Neuro-2A cells stably expressingluciferase (Neuro-2A-luc). Neuro-2A and Neuro-2A-luc cellswere maintained in Dulbecco's minimal essential mediumsupplemented with 10% fetal calf serum, 1% nonessentialamino acids, and sodium pyruvate at 37°C in a humidifiedatmosphere in 5% carbon dioxide. The plasmid pCI-Lucconsists of pCI (Promega, Southampton, United Kingdom)with the luciferase gene. siRNAs used included fireflyluciferase (siLuc) (gauaugggcugaauacaaa),13 enhanced greenfluorescent protein (siEGFP) (gacguaaacggccacaaguuc),14 andGAPDH (siGAPDH) (ggucauccaugacaacuuutt). The siLuc andsiEGFP were synthesized from Dharmacon, Inc. (Epsom,

United Kingdom). Cy3-labeled siRNA (siGAPDH) was pur-chased from Ambion, Inc. (Warrington, United Kingdom).Linear PEI (22 kDa) and branched PEI (25 kDa) werepurchased from Polyplus-Transfection (Illkirch, France) andSigma-Aldrich (Gillingham, United Kingdom), respectively.Lipofectamine 2000 (L2000; Invitrogen, Paisley, UnitedKingdom) was used as a positive control siRNA transfectionagent, in accordance with the manufacturer's instructions.

Gel retardation assay

DNA or siRNA (0.2 μg) was diluted to 10 μL in distilledwater and used to form complexes with 10 μL PEI in distilledwater at different Nitrogen-to-phophate (N/P) ratios. Following30 minutes incubation at room temperature (around 25°C), 4 μLloading dye was added to the complexes. Gel retardation wasassessed by agarose gel electrophoresis using 1% agarose forDNA and 4% agarose for siRNA.

PicoGreen fluorescence quenching experiment

siRNA or DNA (0.2 μg) was mixed with PicoGreen reagent(1:150) (Invitrogen) for 10 minutes at room temperature in TEbuffer, and the siRNA or DNA was then added to PEI to formcomplexes. Fluorescence was analyzed using a fluorescenceplate reader, Fluostar Optima (BMG Labtech, Aylesbury,United Kingdom). In complex dissociation assays, heparinsulfate (Sigma-Aldrich) was added to the complexes formulat-ed in the PicoGreen fluorescence quenching experiment in arange of concentrations (0.02, 0.04, 0.08, 0.16, 0.32, 0.65, 1.3,2.6, 5.3, 10.6, and 21.2 U/mL) to dissociate the siRNA orDNA from PEI. In each experiment naked siRNA or DNAstained with PicoGreen was used to normalize the PicoGreensignal detected from the complexes.

Particle sizing and zeta potential measurement

DNA or siRNA (10 μg) was mixed with PEIs at different N/Pratios at room temperature. The complexes were then transferredto a low-volume transparent cuvette. Dynamic light scattering(Malvern Nano ZS; Malvern Instruments Ltd., Worcestershire,United Kingdom) with the Mark-Houwink parameters was usedfor recording the size of the complexes, and laser Doppleranemometry with the Smoluchowski model was used for zetapotential estimation. The data were processed by softwareprovided by the manufacturer (DTS version 5.03). The sizingdata had a polydispersity index less than 0.3.

DNA and siRNA transfection

Neuro-2A orNeuro-2A-luc cells were seeded in 96-well platesat 1 × 104 cells per well 24 hours before transfection. For DNAtransfection, PEIs were mixed with pCI-Luc (0.25 μg/well) atdifferent N/P ratios in OptiMEM (Invitrogen) and incubated for30 minutes at room temperature. For siRNA (luciferase targeting)transfections, PEIs were mixed with siLuc or siEGFP control (2.4pmol; final concentration of siRNA = 120 nM) for luciferaseassays or siGAPDH or siEGFP control (4 pmol; final concen-tration of siRNA = 200 nM) for GAPDH knockdown assays, atdifferent N/P ratios in OptiMEM and incubated for 30 minutes.

212 A. Kwok, S.L. Hart / Nanomedicine: Nanotechnology, Biology, and Medicine 7 (2011) 210–219

Plasmid and siRNA transfections were performed for 4 hoursat 37°C, then medium was replaced with the complete growthmedium, and the cells were cultured for 24 hours. Luciferaseactivity was analyzed 24 hours following transfection, theminimum time for effective gene knockdown (SupplementaryFigure 1, to be found in the online version of this article). ThesiGAPDH gene knockdown assays were conducted 48 hoursfollowing transfection according to the manufacturer's instruc-tions of the KDalert GAPDH assay kit (Applied Biosystems,Warrington, United Kingdom).

Luciferase assay

Luciferase assays were performed (Promega) using a FluostarOptima luminometer (BMG Labtech). Protein content of eachcell lysate was measured by the Bio-Rad protein assay reagent(Bio-Rad, Hemel Hempstead, United Kingdom). Luciferaseactivity was expressed as relative luminescence units (RLU) permilligram of protein (RLU/mg). Each measurement wasperformed in groups of six with the mean determined andanalyzed for statistical significance (P b 0.05).

Flow cytometry and confocal microscopy

For flow cytometry 1 × 105 cells were transfected withCy3-labeled siRNA (100 pmol; final concentration of siRNA =200nM) (Ambion), then washed with phosphate-bufferedsaline and labeled with 7-amino-actinomycin D (7AAD)(Invitrogen). The cells were analyzed by the Epics XL flowcytometer (High Wycombe, United Kingdom). For confocalmicroscopy Neuro-2A-luc cells were transfected with Cy3-labeled siRNA complexes, then stained with Alexa Fluor 488phalloidin (Invitrogen) and DAPI (Vector Labs, Peterborough,UK). The slides were visualized using confocal microscopy(Leica-Microsystems, Wetzlar, Germany).

Statistical analysis

Data presented in this study were analyzed using a two-tailed,unpaired Student's t-test.

Results

L-PEI and B-PEI package plasmid DNA and siRNA

The packaging of DNA or siRNA by L-PEI and B-PEIwas investigated by gel retardation and PicoGreen fluores-cence quenching assays. B-PEI and L-PEI completely retardedDNA migration at N/P ratios of 5:1 and 2.5:1, respectively(Figure 1, A), and these results were consistent with maximalPicoGreen quenching (Figure 1, C). B-PEI completely retardedthe siRNA migration at an N/P ratio of 5:1, whereas L-PEIcompletely retarded the siRNA migration at an N/P ratio of 10:1(Figure 1, B), again consistent with the PicoGreen quenchinganalysis (Figure 1, D).

Complex size and zeta potential

The L-PEI DNA complexes at the N/P ratios of 2.5:1, 5:1,10:1, and 20:1 were positively charged nanoparticles with sizesranging from 70 nm at a 5:1 ratio to 108 nm at a 2.5:1 ratio

(Table 1). By contrast, the B-PEI-DNA complexes ranged from92 nm at a 20:1 ratio to 1073 nm at a 2.5:1 ratio. In addition, B-PEI-DNA particles displayed a trend of smaller particle sizewith increasing charge ratios, whereas L-PEI-DNA complexeswere fairly stable from a ratio of 5:1 upwards. Both B-PEI andL-PEI formed positively charged nanoparticles with DNA,although B-PEI-DNA particles (e.g. +50 mV at a 5:1 ratio) wereslightly more positively charged than those formulated with L-PEI (+40 mV at a 5:1 ratio).

L-PEI siRNA particles ranged in size from 75 nm (2.5:1 N/Pratio) to 107 nm (20:1 N/P ratio), and B-PEI complexes rangedfrom 147 nm (2.5:1 ratio) to 60 nm (20:1 N/P ratio) (Table 2).As with DNA, B-PEI displayed a consistent trend of smallerparticles with increasing charge ratio, and L-PEI complex sizesshowed no trend at the charge ratios tested. For zeta potentialmeasurements, as with DNA, B-PEI nanoparticles were slightlymore positively charged than the homologous L-PEI nanopar-ticles, except at the highest ratio, of 20:1. Imaging ofcomplexes by atomic force microscopy showed that B-PEIformed an oval particle with siRNA, whereas L-PEI formed arodlike particle (Supplementary Figure 2, found in the onlineversion of this article).

The dissociation properties of the DNA and siRNA complexes

The stability and dissociation properties of the complexeswere investigated by exposure to a range of concentrations ofheparin sulfate (0.02–21.2 U/mL). Heparin is anionic andcompetes with the nucleic acid binding to PEI, leading todissociation.15 PicoGreen-labeled complexes were prepared asabove at N/P ratios of 2.5:1, 5:1, 10:1, 20:1, and 40:1 with DNAand 1.25, 2.5:1, 5:1, 10:1, and 20:1 with siRNA. FluorescenceRFU values for each complex were compared at approximately50%, 80%, and complete (95% to 100%) dissociation.

The B-PEI-DNA complexes at an N/P ratio of 2.5:1 wereunstable with even trace amounts of heparin, whereas all othercharge ratios were 50% dissociated at 3–8 U/mL heparin and 80%dissociated at about 10U/mL heparin (Figure 2,A), requiringmorethan 20 U/mL heparin to achieve maximal dissociation. L-PEI-DNA complexes were less stable than B-PEI complexes at allcharge ratios, with 50% and 80% dissociation achieved with lessthan 2U/mL and 3U/mLheparin, respectively, for all formulations(Figure 2, B), and with maximal dissociation at about 5 U/mLheparin. Therefore, B-PEI-DNA complexes were more stable thanthe L-PEI-DNA complexes, with three times as much heparinrequired to achieve 80% dissociation, and four times as muchheparin for maximal dissociation.

The B-PEI-siRNA complexes formulated at N/P ratios of1.25:1 and 2.5:1 dissociated with even trace amounts of heparin,whereas at N/P ratios of 5:1, 10:1, and 20:1, 50% and 80%dissociation was achieved with approximately 2–3 U/mL and 4.3U/mL heparin, respectively (Figure 2, C). These complexes werecompletely dissociated at about 5.3 U/mL heparin. However, L-PEI-siRNA complexes at all N/P ratios tested, from 1.25:1 to20:1, were very sensitive to heparin, even at concentrationsbelow 1 U/mL (Figure 2, D). B-PEI-siRNA formulations at eachcharge ratio were more stable than L-PEI complexes with

Table 1Average diameter and zeta potential of the DNA complexes

N/P ratio B-PEI L-PEI

Averagediameter (nm)

Zeta potential(mV)


Zeta potential(mV)

2.5 1073 ± 32 37.7 ± 1.6 108.0 ± 3.0 35.8 ± 4.55 218.3 ± 3.1 51.0 ± 1.0 69.9 ± 1.0 40.2 ± 0.510 142.3 ± 1.5 49.4 ± 1.5 83.6 ± 1.5 37.8 ± 3.020 91.8 ± 0.7 52.0 ± 1.2 79.1 ± 0.3 48.0 ± 1.0

Table 2Average diameter and zeta potential of the siRNA complexes

N/P ratio B-PEI L-PEI


Zeta potential(mV)


Zeta potential(mV)

2.5 147.0 ± 0.1 51.1 ± 3.0 74.8 ± 10.9 30.8 ± 1.35 102.3 ± 0.9 55.6 ± 1.8 91.7 ± 3.3 40.8 ± 1.410 70.1 ± 1.5 48.3 ± 1.1 84.5 ± 1.6 46.2 ± 1.420 59.6 ± 26.3 42.5 ± 1.0 106.7 ± 1.4 46.1 ± 3.6

Figure 1. The binding properties of polyethylenimine (PEI) with plasmid DNA or siRNA. (A) The PEI-DNA complexes resolved by a 1% agarose gel. (B) ThePEI-siRNA complexes resolved by a 4% agarose gel. (C) Relative fluorescence unit (RFU) of the DNA complexes at a range of N/P charge ratios, labeled withPicoGreen as a percentage of signal from free DNA. (D) RFU of the siRNA complexes as a percentage of signal from free siRNA.


approximately fivefold differences in stability at 20:1 N/P ratiosand approximately 20-fold differences at 5:1 ratios.

Overall, B-PEI complexes with both DNA and siRNA aremore resistant to challenge by heparin than L-PEI complexes atsimilar charge ratios, but the difference was particularly markedwith siRNA formulations.

Transfection efficacy of the DNA and siRNA complexes

B-PEI- and L-PEI-DNA transfections in Neuro-2A cells wereboth optimal at 10:1 N/P ratios (Figure 3), similar to previousfindings.16 However, luciferase transfection levels with theL-PEI-DNA complex were approximately fivefold higher thanB-PEI complexes, even though the B-PEI-DNA complexes (72%

positive cells) were slightly more efficient in mediating Cy5-labeled complex uptake into cells (measured by flow cytometry)than the L-PEI-DNA complexes (64% positive cells) (Supple-mentary Figure 3, found in the online version of this article).

Transfections with siRNA were performed in Neuro-2A-luccells. Transfections with L2000, a known vector for siRNAtransfection, induced an approximately 80% knockdown ofluciferase activity (Figure 4, A and B), whereas B-PEI-siRNAcomplexes at N/P ratios of 20:1 mediated a 60% luciferaseknockdown (Figure 4, B). The L-PEI-siRNA complexes,formulated in a range of N/P ratios from 2.5:1 to 20:1, did notsilence luciferase expression (Figure 4, A). At N/P ratios of 40:1the B-PEI-siRNA transfections resulted in a decreased luciferase

Figure 2. The dissociation properties of PEI-DNA or PEI-siRNA complexes. PicoGreen fluorescence of L-PEI and B-PEI DNA or siRNA complexes afterincubation with heparin (0 to 21 U/mL) was expressed as a percentage of RFU from free DNA or siRNA. (A) B-PEI-DNA complexes; (B) L-PEI-DNAcomplexes; (C) B-PEI-siRNA complexes; (D) L-PEI-siRNA complexes. The scale is from 0 to 1.3 U/mL of heparin, different from (A), (B), and (C).

Figure 3. Plasmid transfection efficiency mediated by PEI/plasmid. Neuro-2A cells were transfected with a luciferase expression plasmid (pCI-Luc) using B-PEI- or L-PEI-DNA at different N/P ratios. Luciferase activity (RLU/mg) in the cells was analyzed 24 hours post-transfection to estimate the transfectionefficiencies of the complexes. Luciferase activity in the cells treated with the L-PEI-DNA complexes at N/P ratios of 10:1 and 20:1 was significantly higher thanexpression from B-PEI-DNA complexes at the same ratios (P b 0.05). * indicates a significant difference between L-PEI and B-PEI transfections at the sameratios (P b 0.05).


image of Figure 2

image of Figure 3

Figure 4. siRNA transfection efficiency mediated by the B-PEI-siRNA and L-PEI-siRNA complexes. Neuro-2A luciferase-expressing cells were transfectedwith the B-PEI-siRNA or L-PEI-siRNA complexes at different N/P ratios. siLuc-targeted luciferase mRNA and siEGFP was a negative control. Untreated cellsreceived no siRNA complexes. The luciferase activity of the untreated control was used to normalize the luciferase activity of transfected cells. (A) siRNAtransfection using the L-PEI-siRNA complexes. (B) siRNA transfection using the B-PEI-siRNA complexes. * indicates significantly reduced luciferase activityrelative to siEGFP control (P b 0.05).


signal with either siLuc and control siEGFP siRNAs, suggestingcytotoxicity or nonspecific gene silencing. Cytotoxicity assaysrevealed that B-PEI-siRNA complexes at N/P ratios of 20:1 and40:1 mediated 20% and 40% cell death, respectively (Supple-mentary Figure 4, found in the online version of this article),although B-PEI itself was not toxic. Knockdown studies ofGAPDH gene expression were performed to validate the B-PEI-siRNA luciferase data (Supplementary Figure 5, found in theonline version of this article). The data further confirmed that B-PEI-siRNA complexes at a 20:1 N/P ratio mediated specificdecreases of GAPDH activity and mRNA level.

L-PEI fails to mediate cellular uptake of siRNA

The relationship between cellular uptake of the siRNAcomplexes and transfection efficiencies was examined with Cy3-labeled siRNA complexes made with B-PEI, L-PEI, or L2000(Figure 5). Cy3 signals were detected from cells transfected withB-PEI- (±60% of viable cells; Figure 5, C) and L2000- (±70% ofviable cells; Figure 5, E) siRNA complexes. Only a very lowCy3 signal from viable cells (±1%) was detected from cellstransfected with L-PEI siRNA complexes (Figure 5, D). Thepercentages of dead cells staining with 7AAD after exposure to

image of Figure 4

Figure 5. Cellular binding and uptake efficiencies of the PEI-siRNAcomplexes. Neuro-2A luciferase-expressing cells transfected with PEI Cy3-labeled siRNA complexes for 4 hours. The cells were harvested for analysisafter transfection. Cells stained with 7AAD were used to estimate the cellviability following transfection. (A) Untreated cells; (B) naked siRNA; (C)B-PEI-siRNA at a 20:1 N/P ratio; (D) L-PEI-siRNA at a 20:1 N/P ratio; (E)L2000-siRNA.


B-PEI- or L-PEI-siRNA complexes were 26% and 28%,respectively (Figure 5, C and D). The L2000-siRNA complexesinduced 11% cell toxicity (Figure 5, E), whereas cell death withsiRNA alone was 55% (Figure 5, B).

Internalization of the siRNA complexes

To further study the siRNA complex uptake, Neuro-2A-luccells were transfected with Cy3-labeled siRNA complexes. Thecells were then harvested and stained with phalloidin for the cellmembrane and DAPI for the nucleus, then assessed by confocalmicroscopy. No fluorescence was detected from the cellstransfected with the L-PEI-siRNA (Figure 6, A) complexes,consistent with the findings from flow cytometry. In cellsexposed to the L2000 complexes (Figure 6, C), siRNA waspredominantly clustered in the cytoplasm, whereas in cellstreated with B-PEI-siRNA (Figure 6, B) complexes, siRNA waslocalized predominantly in the nucleus, with far less in thecytoplasm compared with L2000. Because siRNA activity is

cytoplasmic, this may explain why the B-PEI-siRNA complexeswere not as effective as the L2000-siRNA complexes.

Discussion

Delivery of nucleic acids to cells is potentially a powerfultherapeutic tool to treat a wide spectrum of diseases. Polycationicformulations that have been used to deliver siRNA includePEI,12,17 polyarginine,18,19 polylysine,19 histidylated polylysinepeptides,20 chitosan,14,21 and polyamidoamine dendrimers.22

Generally, these systems were selected for siRNA deliveryhaving been effective for plasmid delivery. siRNA transfection,however, has proven to be more problematic, particularly for invivo applications, and studies suggest that optimal transfectionagents for siRNA may differ from those for DNA.

Although siRNA activity occurs in the cytoplasm whereasgenes on plasmids are expressed in the nucleus, the delivery ofsiRNA faces many of the same challenges as gene delivery withpolycationic complexes, from cell targeting to internalization andendosomal escape.17,23 The size of the complexes should be50 nm to 200 nm for efficient internalization by endocyticprocesses,23-25 and once inside the cell they should dissociate torelease the plasmid DNA or siRNA from the vector system fortheir respective functions.26 Despite these similarities, nanopar-ticle formulation with siRNA presents some important differ-ences to plasmid formulation. Although both self-assembling byelectrostatic forces, plasmids are several hundred-fold larger thansiRNA, suggesting that different kinds of polycations may beoptimal. In this study we aimed to differentiate siRNA andplasmid DNA transfection complexes in terms of their structureand function to help identify the key requirements of an optimalsiRNA delivery system. To that end we have compared thebiophysical properties, cellular interactions, and transfectionperformance of DNA and siRNA formulations made withbranched PEI (B-PEI) with a molecular weight of 25 kDa andlinear PEI (L-PEI) of 22 kDa. These two polycations arechemically very similar but present with different structures andtransfection behavior.

L-PEI produced fivefold higher luciferase expression plasmidDNA transfection than B-PEI. L-PEI-DNA complexes, at 84 nm,were somewhat smaller than their B-PEI counterparts at 142 nm,and at +38 mV had a lower surface charge than B-PEI-DNAparticles at +49 mV. Additionally, at the 10:1 charge ratio, B-PEIwas more stable than L-PEI complexes, requiring four times asmuch heparin for complete dissociation from DNA. Strongerbinding of B-PEI binding than L-PEI to DNA was also reportedby Dunlap et al.27 These biophysical differences in size, charge,and stability of the PEI DNA nanoparticles may contribute totransfection differences, particularly the easier dissociationcharacteristics and smaller size of L-PEI complexes. However,the cellular binding and uptake of the L-PEI particles wasactually slightly lower than the B-PEI complexes (Supplemen-tary Figure 3 in the online version of this article), possibly as aresult of the lower zeta potential of the L-PEI particles. Thisresult suggested that cellular uptake was not a transfection-limiting factor. More likely it seemed that the lower level ofparticle stability of L-PEI compared with B-PEI may allow it to

image of Figure 5

Figure 6. Localization of siRNA following transfection. Neuro-2A luciferase-expressing cells were transfected with PEI Cy3-labeled siRNA (red) complexes for4 hours. The Cy3-labeled siRNAs are indicated by the white arrows. The white scale bar represents 10 μm. The cells were stained with phalloidin for the F-actinon the cell membrane (green) and DAPI for the nucleus (blue). (A) L-PEI-siRNA; (B) B-PEI-siRNA; (C) L2000-siRNA.

Table 3Summary of the biophysical properties of the DNA and siRNA transfection complexes with L-PEI and B-PEI at 10:1 and 20:1 N/P ratios⁎

Formulation N/P ratio 50% dissociation(Heparin U/ml)

80% dissociation(Heparin U/mL)

Complete (95-100%)dissociation (Heparin U/mL)

Size (nm) Zeta potential (mV)

L-PEI-DNA 10:1 0.7 3 5.3 83 +37L-PEI-DNA 20:1 1 2.5 5.3 79 +48L-PEI-siRNA 10:1 0.5 0.6 0.7 85 46L-PEI-siRNA 20:1 1 1.2 1.3 107 46B-PEI-DNA 10:1 8 11 21.3 142 49B-PEI-DNA 20:1 7 10 21.3 92 52B-PEI-siRNA 10:1 3 4.3 5.3 70 48B-PEI-siRNA 20:1 2.6 4.3 5.3 60 +42

⁎ The best DNA and siRNA formulations are bold italicized.


be more readily displaced from the DNA in the nucleus thanB-PEI, promoting higher levels of transcription.

With siRNA, however, B-PEI at a 20:1 N/P ratio mediatedgene knockdown (±60%), whereas L-PEI was completelyinactive. This was confirmed with both luciferase and GAPDHknockdown assays. Similarly, Grayson and co-workers alsofound that L-PEI was unable to deliver siRNA in vitro whereasB-PEI formed complexes with siRNA and mediated genesilencing.17 Activity of B-PEI-siRNA specifically at the 20:1ratio may be due to the amount of free B-PEI present in theformulation at this N/P ratio,28 which was shown to be animportant factor in B-PEI nucleic acid delivery.29,30 Furtherincrease of the N/P ratio to 40:1 increases the amount of free PEI,which may result in the higher toxicity observed.29

In contrast to the DNA complexes, at the 20:1 charge ratio, B-PEI-siRNA complexes (60 nm) were significantly smaller thanthose formed with L-PEI (107 nm), whereas there were nosignificant differences in surface charge. Striking differenceswere observed in terms of particle stability, with approximatelyfourfold more heparin required for maximal B-PEI-siRNAdissociation than the L-PEI-siRNA complexes, consistent withthe trend for DNA formulation comparison.

Comparing the four types of formulation of B-PEI and L-PEI with siRNA and plasmid DNA, some trends have emergedthat enable correlation of biophysical characteristics with

transfection efficiency (Table 3). Similarities of the optimalDNA (L-PEI, 10:1) and siRNA (B-PEI, 20:1) formulationswere formed at ratios where packaging was complete, asassessed by gel retardation and fluorescence quenching assays.Optimized particles were of similar sizes (b100 nm) andsurface charge (± +40mV). The most characteristic feature,however, was particle stability to heparin exposure, a factorknown to influence DNA transfection efficiency.31 Optimalcomplexes for DNA transfection (L-PEI) and siRNA transfec-tion (B-PEI) displayed similar stability, with maximal dissoci-ation at a minimum of ±5 U/mL of heparin. B-PEI-DNAcomplexes were more stable than L-PEI-DNA complexes,requiring more than 10 U/mL heparin to achieve maximaldissociation, whereas L-PEI-siRNA complexes were less stablethan the optimal B-PEI-siRNA complexes, maximally dissoci-ated at 1–1.5 U/mL. The capacity to dissociate in the presenceof heparin is an indication of the potential of the complex todissociate within the cell releasing the nucleic acid for itsfunction, while providing sufficient stability outside the cells toprotect the nucleic acid and preserve the size and integrity ofthe nanoparticle. Interestingly, the similar stability of theoptimal L-PEI-DNA complexes and B-PEI-siRNA complexessuggests that 5 U/mL heparin may be a constant for nucleicacid delivery systems, at least for PEI formulations, althoughthis would require further testing with other reagents.

image of Figure 6


The cellular binding and trafficking of fluorescently labeledsiRNA complexes showed that although there was abundantbinding and uptake of B-PEI- and L2000-siRNA complexes,very few L-PEI-siRNA complexes were associated with cells.These data, combined with the observed low stability of the L-PEI-siRNA nanoparticles to heparin, suggest that L-PEI-siRNAcomplexes are dissociated by negatively charged cell surfacemoieties, such as cell surface proteoglycan and sialic acidresidues, before they can be endocytosed.10 These studies alsoprovide possible explanations why B-PEI transfections (60%knockdown) were less efficient than L2000 transfections (N80%knockdown). Flow cytometry revealed that B-PEI was moretoxic than L2000. Confocal microscopy revealed that most of thesiRNA delivered by B-PEI was localized in the nucleus, whereassiRNA delivered by L2000 was mainly cytoplasmic. This is notsurprising, in that B-PEI is known to induce nuclearlocalization,30 but it is an undesirable property for siRNAknockdown, in which activity is mainly cytoplasmic.

It was observed that siRNA alone mediated cytotoxicity in thesiRNA uptake experiment but not the luciferase and GAPDHknockdown experiments. In the gene knockdown experiments, asmaller amount of siRNA (4 pmol in a 96-well plate) was used ascompared with the amount used (100 pmol in a 12-well plate) inthe flow cytometry. Therefore, it could be that the higher amountof siRNA in the flow cytometry caused the higher toxicityobserved.32 Indeed, when a smaller amount of siRNA (25 pmol)was used, the cell toxicity decreased drastically but the cellularuptake efficacy of B-PEI-siRNA complexes was also reduced(data not shown). Interestingly, in this study the toxicity of theformulated siRNA decreased when cellular uptake of theformulated siRNA increased. It seems that there is an inverserelationship between effective siRNA transfer and cytotoxicity.The toxicity of free siRNA may be caused by its overwhelmingnegative charges in the culture medium, which are neutralized bythe PEI reagents.

L-PEI and B-PEI complexes with plasmid DNA and siRNApresent with some similarities but also, importantly, quantifiablestructural differences, which we hypothesize to have impact onthe observed functional differences of cellular uptake andtransfection. L-PEI is a 22-kDa, linear polycation that containsmainly secondary amine groups and has a pKa of 7.9.33 B-PEI isonly slightly larger at 25 kDa, but it is branched and consists ofprimary, secondary, and tertiary amine groups and has a pKa of8.4.34 The branched structure may allow B-PEI more three-dimensional folding options with siRNA as compared withL-PEI,35 which may be beneficial for packaging, in that siRNAis a very rigid, inflexible structure.36,37 Conversely, lineartopology may be more important for the delivery of largerplasmid DNA (5 kilobases).38 Similarly, high-molecular-weightchitosan was found to mediate siRNA delivery, whereas low-molecular-weight chitosan, which is less flexible, cannot doso.14 Therefore, polycationic polymers with branched structuresand flexibility seem to be important features for siRNApackaging and delivery.

The nanoparticle ability in condensing nucleic acids, nanopar-ticle hydrodynamic size, and zeta potential are often considered asimportant criteria to estimate the efficacy of the nanoparticle todeliver nucleic acids. This study demonstrated that particle stability

represents a specific criterion for nucleic acid delivery, especiallyfor siRNA delivery. Therefore, investigating the nanoparticlestability would be useful for screening siRNA formulations.

Appendix A. Supplementary data

Supplementary data associated with this article can be found,in the online version, at doi:10.1016/j.nano.2010.07.005.

References

1. Bernstein E, Caudy AA, Hammond SM, Hannon GJ. Role for a bidentateribonuclease in the initiation step of RNA interference. Nature 2001;409:363-6.

2. Vermeulen A, Behlen L, Reynolds A, Wolfson A, Marshall WS,Karpilow J, et al. The contributions of dsRNA structure to Dicerspecificity and efficiency. RNA 2005;11:674-82.

3. Zamore PD, Tuschl T, Sharp PA, Bartel DP. RNAi: double-strandedRNA directs the ATP-dependent cleavage of mRNA at 21 to 23nucleotide intervals. Cell 2000;101:25-33.

4. Sen GL, Blau HM. Argonaute 2/RISC resides in sites of mammalianmRNA decay known as cytoplasmic bodies. Nat Cell Biol 2005;7:633-6.

5. Jagannath A, Wood MJ. Localization of double-stranded smallinterfering RNA to cytoplasmic processing bodies is Ago2 dependentand results in up-regulation of GW182 and Argonaute-2. Mol Biol Cell2009;20:521-9.

6. Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. Human RISCcouples microRNA biogenesis and posttranscriptional gene silencing.Cell 2005;123:631-40.

7. Rand TA, Petersen S, Du F, Wang X. Argonaute2 cleaves the anti-guidestrand of siRNA during RISC activation. Cell 2005;123:621-9.

8. Hutvagner G, Zamore PD. A microRNA in a multiple-turnover RNAienzyme complex. Science 2002;297:2056-60.

9. de Fougerolles A, Vornlocher HP, Maraganore J, Lieberman J.Interfering with disease: a progress report on siRNA-based therapeutics.Nat Rev Drug Discov 2007;6:443-53.

10. Bolcato-Bellemin AL, Bonnet ME, Creusat G, Erbacher P, Behr JP.Sticky overhangs enhance siRNA-mediated gene silencing. Proc NatlAcad Sci U S A 2007;104:16050-5.

11. Buyens K, Meyer M, Wagner E, Demeester J, De Smedt SC, SandersNN. Monitoring the disassembly of siRNA polyplexes in serum iscrucial for predicting their biological efficacy. J Control Release 2009.

12. Merkel OM, Librizzi D, Pfestroff A, Schurrat T, Buyens K, Sanders NN,et al. Stability of siRNA polyplexes from poly(ethylenimine) and poly(ethylenimine)-g-poly(ethylene glycol) under in vivo conditions: effectson pharmacokinetics and biodistribution measured by fluorescencefluctuation spectroscopy and single photon emission computed tomog-raphy (SPECT) imaging. J Control Release 2009;138:148-59.

13. Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, Khvorova A.Rational siRNA design for RNA interference. Nat Biotechnol 2004;22:326-30.

14. Howard KA, Rahbek UL, Liu X, Damgaard CK, Glud SZ, AndersenMO, et al. RNA interference in vitro and in vivo using a novel chitosan/siRNA nanoparticle system. Mol Ther 2006;14:476-84.

15. Sundaram S, Viriyayuthakorn S, Roth CM. Oligonucleotide structureinfluences the interactions between cationic polymers and oligonucleo-tides. Biomacromolecules 2005;6:2961-8.

16. Boussif O, Lezoualc'h F, Zanta MA, Mergny MD, Scherman D,Demeneix B, et al. A versatile vector for gene and oligonucleotidetransfer into cells in culture and in vivo: polyethylenimine. Proc NatlAcad Sci U S A 1995;92:7297-301.

17. Grayson AC, Doody AM, Putnam D. Biophysical and structuralcharacterization of polyethylenimine-mediated siRNA delivery invitro. Pharm Res 2006;23:1868-76.



18. Kumar P, Wu H, McBride JL, Jung KE, Kim MH, Davidson BL, et al.Transvascular delivery of small interfering RNA to the central nervoussystem. Nature 2007;448:39-43.

19. El-Sayed A, Khalil IA, Kogure K, Futaki S, Harashima H. Octaarginine-and octalysine-modified nanoparticles have different modes of endoso-mal escape. J Biol Chem 2008;283:23450-61.

20. Leng Q, Scaria P, Lu P, Woodle MC, Mixson AJ. Systemic delivery ofHK Raf-1 siRNA polyplexes inhibits MDA-MB-435 xenografts. CancerGene Ther 2008;15:485-95.

21. Katas H, Alpar HO. Development and characterisation of chitosannanoparticles for siRNA delivery. J Control Release 2006;115:216-25.

22. Patil ML, Zhang M, Betigeri S, Taratula O, He H, Minko T. Surface-modified and internally cationic polyamidoamine dendrimers forefficient siRNA delivery. Bioconjug Chem 2008;19:1396-403.

23. Gao H, Shi W, Freund LB. Mechanics of receptor-mediated endocytosis.Proc Natl Acad Sci U S A 2005;102:9469-74.

24. Lawrence MS, Foellmer HG, Elsworth JD, Kim JH, Leranth C,Kozlowski DA, et al. Inflammatory responses and their impact onβ-galactosidase transgene expression following adenovirus vectordelivery to the primate caudate nucleus. Gene Ther 1999;6:1368-79.

25. Aoki H, Satoh M, Mitsuzuka K, Ito A, Saito S, Funato T, et al. Inhibitionof motility and invasiveness of renal cell carcinoma induced by shortinterfering RNA transfection of β1,4GalNAc transferase. FEBS Lett2004;567:203-8.

26. Gary DJ, Puri N, Won YY. Polymer-based siRNA delivery: perspectiveson the fundamental and phenomenological distinctions from polymer-based DNA delivery. J Control Release 2007;121:64-73.

27. Dunlap DD, Maggi A, Soria MR, Monaco L. Nanoscopic structure ofDNA condensed for gene delivery. Nucleic Acids Res 1997;25:3095-101.

28. Clamme JP, Azoulay J, Mely Y. Monitoring of the formation anddissociation of polyethylenimine/DNA complexes by two photonfluorescence correlation spectroscopy. Biophys J 2003;84:1960-8.

29. Boeckle S, von Gersdorff K, van der Piepen S, Culmsee C, Wagner E,Ogris M. Purification of polyethylenimine polyplexes highlights the roleof free polycations in gene transfer. J Gene Med 2004;6:1102-11.

30. Clamme JP, Krishnamoorthy G, Mely Y. Intracellular dynamics of thegene delivery vehicle polyethylenimine during transfection: investiga-tion by two-photon fluorescence correlation spectroscopy. BiochimBiophys Acta 2003;1617:52-61.

31. Ramsay E, Gumbleton M. Polylysine and polyornithine gene transfercomplexes: a study of complex stability and cellular uptake as a basis fortheir differential in-vitro transfection efficiency. JDrugTarget 2002;10:1-9.

32. Semizarov D, Frost L, Sarthy A, Kroeger P, Halbert DN, Fesik SW.Specificity of short interfering RNA determined through gene expressionsignatures. Proc Natl Acad Sci U S A 2003;100:6347-52.

33. Brissault B, Kichler A, Guis C, Leborgne C, Danos O, Cheradame H.Synthesis of linear polyethylenimine derivatives for DNA transfection.Bioconjug Chem 2003;14:581-7.

34. von Harpe A, Petersen H, Li Y, Kissel T. Characterization ofcommercially available and synthesized polyethylenimines for genedelivery. J Control Release 2000;69:309-22.

35. Grayson SM, Godbey WT. The role of macromolecular architecture inpassively targeted polymeric carriers for drug and gene delivery. J DrugTarget 2008;16:329-56.

36. Kebbekus P, Draper DE, Hagerman P. Persistence length of RNA.Biochemistry 1995;34:4354-7.

37. Hagerman PJ. Flexibility of RNA. Annu Rev Biophys Biomol Struct1997;26:139-56.

38. Brissault B, Leborgne C, Guis C, Danos O, Cheradame H, Kichler A.Linear topology confers in vivo gene transfer activity to polyethyleni-mines. Bioconjug Chem 2006;17:759-65.

comparative structural and functional studies of nanoparticle formulations for dna and sirna...

Documents