community analysis of coral mucus-associated bacteria and
TRANSCRIPT
![Page 1: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/1.jpg)
P a g e | I
COMMUNITY ANALYSIS OF CORAL
MUCUS-ASSOCIATED BACTERIA AND
IMPACT OF TEMPERATURE AND CO2
CHANGES ON THEM
By
JULIANA HO SING FANG
A thesis submitted in partial fulfilment of
the requirements for the degree of
Masters of Science (by Research)
Faculty of Engineering, Computing and Science
Swinburne University of Technology (Sarawak campus)
2015
![Page 2: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/2.jpg)
P a g e | II
Abstract The coral holobiont is a complex assemblage of the coral animal and microbial organism. Coral
mucus harbours distinct microbial communities and bacteria living in the coral mucus play a
major role in the survival of corals. While several studies have assessed their importance in
protecting their coral hosts from disease, very little is known about the response of these
bacteria to climate change. One of the major consequences of climate changes are enhanced
ocean temperatures which lead to coral bleaching. Another major cause of coral bleaching is
the increased amount of anthropogenic carbon dioxide (CO2) which leads to a phenomenon
called ocean acidification. In both cases, very little its known about how bacteria living in the
coral mucus react to the changing conditions. In a laboratory-based experiment, we assessed
the impact of temperature and carbon dioxide elevation on mucus-associated bacteria in
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.. Fragments of the selected
corals were placed into tanks and exposed to enhanced concentrations of CO2 and
temperature in a series of experiments. Coral mucus samples were collected on a weekly basis
and CO2 concentrations monitored using a Fourier-Transform Infrared (FTIR) trace gas
analyzer. Potential changes in the coral mucus-associated bacteria communities were
monitored by (a) culture based and (b) molecular approaches. Mucus samples were cultured
weekly and bacterial isolates identified using Sanger sequencing. Furthermore, fingerprinting
methods such as Denaturing Gel Gradient Electrophoresis (DGGE) and Ribosomal Intergenic
Spacer analysis (RISA) were applied to monitor changes in the microbial communities.
Enzymatic properties (amylase, caseinase, gelatinase and phospholipase) of the coral mucus-
associated bacteria were also assessed to identify potential pathogenic bacteria. Significant
shifts were detected in all three corals. For Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp., When the temperature and carbon dioxide were maintained around 25°C to
28°C and 500 ppm, Vibrio sp., Bacillus sp. and Pseudomonas sp. were found but as temperature
increases up to 29°C, Bacillus sp. started to dominate. However, when both temperature and
carbon dioxide were rised up to stressful conditions for the corals, Vibrio sp. dominated the
corals mucus layers. Lastly, the isolation of bacteriophage that has the ability to cause a plaque
in the Bacteriophage Plaque Assay when tested against selected potential pathogens was also
identified. The species identified are phylogenetically 96% similar to Enterobacteriophage
reference strain, which are potential bacteriophages for the inhibition of marine pathogens.
There were shifts in Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-
associated bacteria community when temperature and carbon dioxide content of the corals
surrounding changes.
![Page 3: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/3.jpg)
P a g e | III
Acknowledgements
For since the creation of the world God’s invisible qualities – his eternal power and
divine nature – have been clearly seen, being understood from what has been made, so
that people are without excuse.
(Romans 1:20)
Foremost, I would like to express my sincere gratitude to my principal coordinating
supervisor, Dr. Moritz Müller for his continuous support of my MSc study and research,
for his patience, motivation, enthusiasm, and immense knowledge. Thank you for
giving me the chance to explore this field, allowing me freedom and space to make
mistakes and for believing in me. I would also like to extend my appreciation to my co-
supervisors: Dr. Aazani Mujahid, and Dr. Irine Henry Ninjom for their encouragements,
insightful comments, hard questions, as well as access to laboratories and facilities in
Universiti Malaysia Sarawak (UNIMAS).
Heartfelt thanks also to the Biotechnology laboratory officers and technicians: Chua Jia
Ni, Nurul Arina, and Dyg. Rafika Atiqah for allowing me to use the labs past office hours
and for giving me access to use the apparatus and experiment materials. Without your
help, this project may not have been completed on time.
A big thank you to my fellow lab mates and student helpers: Edward Cheah, Miandy
Lee and Angelica Chong, or the stimulating discussions, the company during long hours
in the lab, the support during various existential crises and for all the fun we have had
in the last two years.
Last but not least, I would like to thank my family, especially my mother, for
encouraging me to take up this MSc opportunity and for having my back throughout
every circumstance in the past two years. I am grateful to Swinburne University of
Techonology for providing me with funding via the Swinburne Postgraduate Student
Scholarship which enabled me to pursue this postgraduate study.
Declaration
![Page 4: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/4.jpg)
P a g e | IV
I hereby declare that this research entitled “COMMUNITY ANALYSIS OF CORAL MUCUS-
ASSOCIATED BACTERIA AND IMPACT OF TEMPERATURE AND CO2 CHANGES ON THEM”
is original and contains no material which has been accepted for the award to the
candidate of any other degree or diploma, except where due reference is made in the
text of the examinable outcome; to the best of my knowledge contains no material
previously published or written by another person except where due reference is made
in the text of the examinable outcome; and where work is based on joint research or
publications, discloses the relative contributions of the respective workers or authors.
(JULIANA HO SING FANG)
Date: 29.06.2015
![Page 5: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/5.jpg)
P a g e | V
Table of Contents
Page
List of Figures
List of Tables
1 Introduction
1.1 Microbial life in the ocean
1.2 Coral reefs
1.3 Coral reefs and bacteria
1.3.1 Coral surface mucus layer (SML) and bacteria
1.4 Threats to coral reefs
1.4.1 Ocean Acidification
1.4.2 Temperature rise
1.4.3 Coral bleaching and coral diseases
1.4.4 Coral diseases and the role of microbes in coral surface mucus
layer
1.5 Phage Therapy
1.6 Significance and aims of the present study and dissertation outline
2 Methodology
2.1 Methodology Flowchart
2.2 Field sampling and Experimental Setup
2.2.1 Week 1 to week 4
2.3 Laboratory procedures
2.3.1 Isolation and DNA Extraction of bacteria of Coral Mucus
Associated Bacteria
2.3.2 Molecular characterisation
2.3.3 Constructing phylogenetic trees for coral mucus-associated
bacteria
2.3.4 Indices for bacteria diversity
VIII
XIII
1
2
3
4
7
8
10
11
16
18
20
21
23
25
32
32
32
34
36
37
![Page 6: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/6.jpg)
P a g e | VI
2.3.5 Fingerprinting Analysis
2.3.5 (i) Extraction of genomic DNA from coral mucus
samples
2.3.5 (ii) Automated Ribosomal Internal Spacer (ARISA)
Analysis
2.3.5 (iii) Denaturing gradient gel electrophoresis (DGGE)
Analysis
2.3.6 Enzyme Essays
2.3.6 (i) Amylase Activity
2.3.6 (ii) Caseinase Activity
2.3.6(iii) Phospholipase Activity
2.3.6. (iv) Gelatinase Activity
2.3.7 Screening and Isolation of Bacteriophages
2.3.8 Whole Genome Amplification via Multiple Displacement
Amplification (MDA) of Bacteriophages
2.3.9 Sequencing Analysis For Bacteriophages Identification
2.3.9(i) g20 genes
2.3.9(ii) phoH genes
2.3.9 (iii) Phylogenetic analyses
3 3 Diversity of the Bacterial Communities Associated to Coral Mucus Layer
3.1 Introduction
3.1.1 Bacteria associated with Trachyphyllia geoffroyi
3.1.2 Bacteria associated with Euphyllia ancora
3.1.3 Bacteria associated with Corallimorphs sp.
3.1.4 Diversity of Coral Mucus-Associated Bacteria
39
40
42
43
47
47
48
49
50
52
54
56
56
57
59
60
61
67
74
76
![Page 7: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/7.jpg)
P a g e | VII
4 Bacterial Communities Shifts
4.1 Introduction on Bacteria Communities Shifts
4.2 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Trachyphyllia sp.
4.2.1 Week 5 to Week 6 for Trachyphyllia geoffroyi 4.5.1(ii) Week 7 to
Week 8 For Trachyphyllia geoffroyi
4.2.2 Week 7 to Week 8 for Trachyphyllia geoffroyi
4.2.3 Week 9 for Trachyphyllia geoffroyi
4.3 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Euphyllia ancora
4.3.1 Week 5 to Week 6 for Euphyllia ancora
4.3.2 Week 7 to Week 8 for Euphyllia ancora
4.3.3 Week 9 for Euphyllia ancora
4.4 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Corallimorphs sp.
4.4.1 Week 5 to Week 6 for Corallimorphs sp.
4.4.2 Week 7 to Week 8 for Corallimorphs sp.
4.4.3 Week 9 for Corallimorphs sp.
4.5 Conclusion Bacterial Diversity Shifts in mucus layers of Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. under temperature and
CO2 stress
5 Bacteriophages
5.1 Potential coral pathogens and phage therapy
5. 2 Identification of potential coral pathogens
5.3 Results and Discussions for Bacteriophages Screening
6.0 Summary and Future Work
84
93
93
94
95
97
97
98
99
100
100
101
103
103
107
107
108
110
115
![Page 8: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/8.jpg)
P a g e | VIII
References 118-159
Appendix 159-172
![Page 9: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/9.jpg)
P a g e | IX
Figure Page
I: Distribution of coral reefs in the East Asian Seas
II: The Ocean Acidification cycle process which summarizes the whole process
on how this phenomenon occurs (UK Ocean Acidification Programme 2012).
III: Overall methodology flowchart that summarizes the overall experimental
procedures. The identity and enzymatic properties of Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus-associated
bacteria were assessed and potential coral pathogens isolated were tested
against potential bacteriophages to detect whether their growth could be
inhibited by the potential bacteriophages chosen (phage therapy).
IV: Types of coral species investigated in this experimental study (top left:
Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia
geoffroyi)
V: llustrations of experimental instruments used to monitor the parameters in
the aquaria
VI: Graph showing overall parameters during week 1 to 4 of the experiment.
Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and
temperature on secondary y-axis.
VII: Graph showing overall parameters during week 5 to 6 of the experiment.
Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and
temperature on secondary y-axis.
VIII: Graph showing overall parameters during week 7 to 8 of the experiment.
3
10
22
23
23
26
27
28
![Page 10: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/10.jpg)
P a g e | X
Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and
temperature on secondary y-axis.
IX: Graph showing overall parameters during Week 9 of the experimental
weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and
temperature on secondary y-axis.
X: Graph showing Week 1 to week 9 overall experimental period for carbon
dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on
primary y-axis, temperature on secondary y-axis.
XI: The condition of Trachyphyllia geoffroyi., Euphyllia ancora and Corallimorphs
sp. after a period of 9 experimental weeks..
XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp
DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-L11 represents
the DNA smears of bacterial isolates-associated to Trachyphyllia geoffroyi,
Euphyllia ancora and Corallimorphs sp.
XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes
of bacteria-associated to Trachyphyllia geoffroyi., Euphyllia ancora and
Corallimorphs sp. on gel band with 1kbp DNA ladder.
XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia
ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder.
XV: PyElph Software Analysis System. Screenshot showcases band matching
step during gel analysis.
XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear
halo zone).
XVII: Example bacterial isolates showing positive caseinase activity (clear
zones).
XVIII: Example bacterial isolates showing positive phospholipase activity
29
30
31
33
36
41
46
48
49
50
![Page 11: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/11.jpg)
P a g e | XI
(opalescence around the bacterial growth).
XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).
XX: Comparison of TFF and FeCl3 flocculation methods and the results of the
concentration efficiency via viral fraction (< 0.22µm filtrate)s
XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure
that there is no experimental errors during phage assay experiment.
XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via
MDA on gel band with 1kbp DNA ladder.
XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using
primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the
DNA of bacteriophages amplified.
XXIV: The DNA bands of the bacteriophages isolated and amplified via PCR using
primers vPhof.
XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Trachyphyllia geoffroyi (Brain coral).
XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Euphyllia ancora (Hammer coral).
XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Corallimorphs sp. (Mushroom coral).
XXIX: ARISA analysis result to detect the bacteria community associated to
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting
pattern.
XXX: DGGE Analysis Gel Result detect the bacteria community associated to
51
53
54
55
58
59
60
69
75
87
88
![Page 12: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/12.jpg)
P a g e | XII
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.
XXXI: Complete linkage agglomeration tree with genetic distances calculated
using PyElph software analysis tool.
XXXII: UPGMA tree with genetic distances calculated using PyElph software
analysis tool.
XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage
Cand E in forming plaques on the agar plates inoculated with the selected
potential coral pathogen isolates.
XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage
C and E in forming plaques on the agar plates inoculated with the selected
potential coral pathogen isolates.
XXXIII (c): Results of Bacteriophages Plaque Assay showing the activity of phage
B and C in forming plaques on the agar plates inoculated with the selected
potential coral pathogen isolates.
89
90
111
112
113
![Page 13: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/13.jpg)
P a g e | XIII
List of Tables
Table Page
A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2000) B: Overview of coral diseases, their common hosts and pathogens.
C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed
during weeks 1 to 9
D: Components of 16S rRna PCR reaction per PCR tube
E: List of Variables for Biodiversity Indices
F: Components of ARISA PCR reaction per PCR tube
G: Components of DGGE PCR reaction per PCR tube
H: Indices used to quantify the diversity of 3 selected corals’ mucus layer
associated bacterial communities
I: Results of Corallimorphs sp. after testing for their enzyme assays
J: Results of Euphyllia ancora after testing for their enzyme assays
K: Results Trachyphyllia geoffroyi after testing for their enzyme assays
L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer
associated bacterial communities
M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer
associated bacterial communities
N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer
associated bacterial communities
2
13
25
35
38
42
44
77
79
80
81
91
91
92
![Page 14: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/14.jpg)
P a g e | 1
CHAPTER 1
1 Introduction
1.1 Microbial Life in the Ocean
One of the major community members residing in the ocean are marine microbes with
an estimated number of 3.6×1029 microbial cells (Singh 2010). Marine
microorganisms have experienced billions of years worth of evolution, forming vast
and complex communities of bacteria, archaea, protists and fungi, within what is said
to be the dominant biome of the E a r t h (DeLong 2009). According to Karl (2002)
and Sogin et al. (2006), many marine microbes are still in the process of being
identified as an equally great percentage still remains undiscovered (Karl 2002; Sogin et
al. 2006).
Marine microbes play important roles in the oceanic ecosystem by mediating
geochemical cycles in the ocean (Arrigo 2005) and allowing for rapid nutrient recycling
in an environment that is poor in essential nutrients (Mayer & Wild 2010). They are
said to be responsible for around 98% of overall primary production in the ocean,
providing sustainability to the marine ecosystem (Karl 2002; Sogin et al. 2006). Since
Oceans cover approximately 40% of the Earth’s surface, marine microbes and their
involvement in biogeochemical processes are significant on a global scale (Karl 2002).
One of the most biologically diverse and productive ecosystem in the world are coral
reefs. They are a major source of protein and income to many people (Wilkinson &
Buddemeier 1994) and also contribute in revenue earned from tourism, recreation,
and education (Wilkinson & Buddemeier 1994). Coral reefs also act as a natural
protection between the open seas and coastlines by acting as wave breaks, thus
effectively preventing coastal erosion (McLeod et al. 2013). According to Wilkinson
(1999), they perform a vital role in protecting coastal areas from the consequences of
![Page 15: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/15.jpg)
P a g e | 2
rising sea levels such as storm flooding (Wilkinson 1999). Corals are further known to
act as host organisms to diverse bacterial populations (Wegley et al. 2007) and these
are the focus of the present study and will be introduced in the following.
1.2 Coral reefs
Southeast Asia is home to a large number of coral reefs with an approximate area of
87,000 km2 covered by reefs (see Table A).
Table A: Regional distribution of coral reefs (source: Veron & Stafford-Smith 2000)
Region Reef area (km2)
South Pacific
116,200
Southeast Asia 87,760
Indian Ocean 31,930
Middle East 21,450
Caribbean 20,360
Western Atlantic 2.820
Figure 1 shows an overview of reef distribution in the East Asian Seas and Southeast
Asia’s coral reefs have the highest biodiversity of all the world’s reefs (Veron &
Stafford-Smith 2000). This region contains more than 600 of the nearly 800 reef
building coral species found worldwide (Veron & Stafford-Smith 2000).
![Page 16: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/16.jpg)
P a g e | 3
Figure I: Distribution of coral reefs in the East Asian Seas ( S t a t e o f R e e f s
1 9 9 5 ) .
In the following, we introduce the various roles of microbes in coral reefs (with a focus
on the surface mucus layer), before we move to introduce threats to coral reefs and
their impacts on the microbes.
a
1.3 Coral reefs and bacteria
Bacterial communities residing in coral reefs are extremely diverse in their identities
(Rohwer et al. 2002) and have been found to play major roles in nutrient
recycling(Wild et al. 2004b). There are many different species of bacteria
discovered in the coral reefs environment ranging from α-proteobacteria, β-
proteobacteria, firmicutes, anaerobes and also actinobacteria (Ducklow & Mitchell
1979a; Tringe et al. 2005; Wegley et al. 2007).Generally, for coral associated bacteria
to sustain their normal health and survivability, they have to ensure that they are
![Page 17: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/17.jpg)
P a g e | 4
supplemented with adequate amount of nutrition. Corals obtain their nutrition via
capturing particulate organic material using their tentacles and also by sharing
photosynthetic products that are initially produced by their symbiotic algae
(zooxanthellae). The symbiotic algae provide the corals with carbon and energy
sources while prokaryotes associated to the corals often seem to provide nitrogen to
the corals (Lesser et al. 2004; Shashar et al. 1994). Nitrogen is vital to corals because
they need it for synthesizing essential building blocks such as amino acids, purines,
pyrimidines and amino-sugars. As for carbon and energy sources, the corals need these
for their growth and survival as well. Other than that, reef corals are also host to a
group of dinoflagellates symbionts which belong to the Symbiodinium genus.
Symbiodiniums are important symbionts tp the coral reefs as their loss in the reefs
during coral bleaching phenomenon will lead to mass mortality of coral reefs (Baker
2003).
1.3.1 Coral Surface Mucus Layer (SML) and Bacteria
The coral surface mucus layer (SML) plays a very important role in maintaining the coral
reefs ecosystem. It acts as protective physicochemical barrier (Hayes & Goreau 1998;
Peters 1997; Santavy & Peters 1997; Sutherland, Porter & Torres 2004), medium for
growth of bacteria, barrier for potential marine pathogens (Ducklow & Mitchell 1979a,
b), and is also involved in sediment cleansing (Brown & Bythell 2005)
Coral mucus is comprised of mucins which are complex mixture of polymeric
glycoprotein and also other exudates such as lipids that are secreted by mucocytes of
the epithelium (Brown & Bythell 2005). Mucins are highly heterogeneous glycoproteins
that consist of a filamentous protein core to which short polysaccharide side- chains
are attached. The core amounts are made up of about 20 % of the polymer by weight,
and the remaining 80 % are carbohydrate (Verdugo 1990). The composition of the coral
mucus layer is also greatly affected by the coral algae symbionts as about 20 to 45% of
photosynthate are being released as part of coral mucus and dissolved organic carbon
(Bythell 1988; Crossland 1987; Davies 1984; Edmunds & Davies 1989). It follows
then that during coral bleaching, when densities of algal symbionts are significantly
reduced, both the composition and secretion of mucus may be markedly affected. A
![Page 18: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/18.jpg)
P a g e | 5
decrease in mucus release has been shown to negatively affect the coral reef
ecosystem (Brown & Bythell 2005).
Since corals are able to obtain additional nutrients via their mucus layer, the potential
food resources for their growth is greatly increased (Lewis 1977). These food resources
include not only the zooplankton but also some suspended particulate material that
involves bacterioplankton, bacterial aggregates(Bak et al. 1998; Sorokin 1973) and
other fine particulates, such as silts and fine sands (Mills & Sebens 1997). However, the
coral host also known to use up energy for the production of coral mucus layer. For
example, about 40% of all carbon fixed by symbiotic algae in Acropora acuminata goes
into mucus production (Crossland 1987).
The SML helps corals in protecting them from desiccation, as well as binding or
absorbing pollutants such as heavy metals (Brown & Howard 1985; Howard & Brown
1984; Howell 1982) and aromatic hydrocarbons (Neff & Anderson 1981). There are
several studies showing an increase of mucus secretion when corals are exposed to
mechanical stresses and pollutants such as crude oil (Mitchell & Chet 1975; Neff &
Anderson 1981) and copper sulphate (Mitchell & Chet 1975). In addition, the coral
mucus layer also aids in excreting excess organic carbon produced by symbiont
photosynthesis of the dinoflagellates on the coral hosts (Davies 1984). Besides acting as
protecting layer to the coral host, coral mucus is also involved in reproduction and
larval behavior of the coral host. For example, “surface brooding” is a mode of
reproduction that has been observed in the Red Sea soft coral Parerythropodium
fulvum fulvum (Benayahu & Loya 1983). This mode of reproduction actually means
presence of larvae development in a protective mucous coat surrounding the parent
colony.
The coral mucus layer composes of 56 to 80% of a dissolved organic matter (DOM)
fraction so it is expected to be readily available for microbial biomineralisation.
However, there are also finding by Vacelet & Thomassin (1991) that argued that the
released coral mucus layer does not contribute to seawater microbial growth as the
dissolved organic matter (DOM) was not readily accessible and/or that the mucus
contained bacterial inhibitors (Vacelet & Thomassin 1991). According to Rohwer &
![Page 19: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/19.jpg)
P a g e | 6
Kelley (2004), corals have the ability to control the bacterial colonies that inhabit the
SML through changing the composition of the mucus (Rohwer & Kelley 2004). By
altering the mucus’ composition, the growth of beneficial bacteria (such as nitrogen
fixers or bacteria that inhibit potential pathogens), could be promoted. Recent studies
have indeed shown that the bacterial community harboring the surface layer of corals
is distinctly different from the bacteria of the water column surrounding the corals
(Cooney et al. 2002; Frias-Lopez et al. 2002). The SML was found to contain 100 times
the number of culturable bacteria than in of the surrounding seawater (Ritchie & Smith
2004). The coral mucus-associated bacteria are also several orders of magnitude more
metabolically active (Ritchie & Smith 2004) than the ones in seawater column.
According to Wegley et al. (2007), the coral-associated microorganisms are mostly
heterotrophic as they aid in carbon and nitrogen fixation processes of the corals
(Wegley et al. 2007). In return, the carbohydrate-rich mucus is exploited by these
microorganisms as a medium for their growth. This shows a symbiotic relationship
between the bacteria and the coral colony. However, the carbon source utilization
pattern by the coral mucus bacteria is coral specific and thus, the utilization pattern
differs among different species of corals (Brown & Bythell 2005).The bacterial
community does however not contribute much to the amount of carbon content of
mucous sheets which is only about < 0.1 % (Coffroth 1990). Oligotrophic tropical seas
lack of nutrients and organic matter. Therefore, the release of mucus to the seawater
can become an important substrate for microbial growth (Linley & Koop 1986;
Moriarty, Pollard & Hunt 1985; Paul, DeFlaun & Jeffrey 1986; Wild et al. 2004a; Wild
et al. 2004b). Bacterial communities living within the coral mucus layer are viable,
functional, and their diversity depends significantly on the physiological state of the
coral host (Ducklow & Mitchell 1979a). It has been shown that the organic content of
mucus collected from stressed corals was much higher (76 to 82% ash- free dry weight,
AFDW) than mucus collected in-situ from unstressed corals (9 to 60% AFDW)
(Gottfried & Roman 1983).
The coral mucus layer plays an important role in protecting the coral tissues against
bacterial attack. SML acts as a physical barrier to microbes inform the surrounding
seawater (Cooney et al. 2002) and also helps in mucociliary transport of food particles
![Page 20: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/20.jpg)
P a g e | 7
to the coral polyp’s opening (Ducklow 1990; Sorokin 1978), preventing colonization of
potential pathogenic bacteria on coral tissues (Garrett & DUCKLOW 1975; Rublee et al.
1980). For example, anti-bacterial activity was not observed against coral- associated
bacterial strains isolated from coral tissue and its mucoid surface while very high
activity was found against Vibrio sp. isolated from necrotic coral tissue in the Red Sea
soft Paerythropodium fulvum (Kelman et al. 1998). The specificity of SML antibacterial
property is important to allow only specific bacteria to live in association with the coral
host while the others are not allowed to. The SML also serves as a medium into which
allelochemicals, which have an anti- bacterial role, are deposited (Kelman et al. 1998;
Koh 1997; Slattery, McClintock & Heine 1995).
Novel bioactivities of coral mucus have been discovered in the scleractinian coral
Galaxea fascicularis in which mucus compounds showed a DNAse-like activity and
apoptotic activity against a multiple drug-resistant leukemia cell line (Ding et al. 1999)
and also contained a novel anti-tumour compound (Fung & Ding 1998).
As introduced above, the symbiotic interaction between corals and their associated
microbial community can influence on coral’s physiology and health. Therefore,
many studies have investigated the pathogens related to coral diseases (Hoegh-
Guldberg et al. 2007) and also the beneficial coral- associated bacteria which provides
essential nutrients for the coral host (for example, nitrogen) (Wegley et al. 2007)
and at the same time protecting the coral from infection by producing antimicrobial
agents that restrict the growth of potential pathogens ( R i t c h i e 2 0 0 6 ) .
The occurrence of coral pathogens is closely linked to a weakened state of health and
in the following, we highhlight ocean acidification and temperature increase as major
threats to corals, and move on to discuss microbial coral diseases.
![Page 21: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/21.jpg)
P a g e | 8
1.4 Threats to coral reefs
Due to the combined effects of global changes (increment in seawater
temperature) and local anthropogenic stressors (for example water pollution,
industrial pollution, overfishing), the coral reefs survival are threatened. Most reefs are
affected by diseases and their health starts to deteriorate during the past few
decades. According to ( D o w n s e t a l . 2 0 0 5 ) , the emerging pathogen-causing
diseases and vast global climate changes have contributed to estimated loss of 30% of
corals worldwide. Coral biologists also predicted that if current stresses on coral reefs
are not prevented, most of the world’s coral reefs may be destroyed by the year 2050
( D o w n s e t a l . 2 0 0 5 ) .
Due to the combined effects of global changes (increment in seawater temperature)
and local anthropogenic stressors (for example water pollution, industrial pollution,
overfishing), the coral reefs survival are threatened (Richmond 1993 ).
The increase in CO2 leads to a phenomenon known as ocean acidification (Rodriguez‐
Lanetty, Harii & Hoegh‐Guldberg 2009) which will be introduced in the following.
1.4.1 Ocean Acidification
The ocean plays a fundamental role in gaseous exchange such as absorbing and
releasing carbon dioxide gas (CO2) with the atmosphere. The factors that affect the
CO2 uptake by the ocean are chemical processes involving the changes to the CO2
buffering capacity (Gruber 1998) and also the effects of temperature on CO2
solubility. Hence, once the normal ocean environmental condition undergo changes
(change in pH value of the ocean), marine organism’s growth and survival will be
affected too.
The exchange of carbon dioxide gasses between important reservoirs of the
biosphere, the atmosphere and the ocean is part of the carbon cycle. The ocean
plays an important role as a carbonate buffer. The pH of the seawater is determined
by the composition of three forms of dissolved inorganic carbon (DIC), CO2, HCO3- and
![Page 22: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/22.jpg)
P a g e | 9
CO3
2-. DIC functions as the natural buffer during the addition of hydrogen ions
(carbonate buffer). When CO2 is absorbed by the ocean, hydrogen ions will react with
readily available carbonate (CO32-) ions, which results in the formation of bicarbonate
(HCO3-) ions. In that case, the hydrogen ions (that increase ocean’s acidity) added into
the ocean via CO2 absorption are reduced. Therefore, the change in pH value of the
ocean is not very visible (Gruber 1998).
When atmospheric CO2 dissolves in seawater, the acidity of the ocean should
increase but because of the efficiency of the carbonate buffer reaction, the seawater
remains alkaline. Scientifically, the seawater carbonate chemistry can be explained by
a series of chemical reactions below:
CO2(atmosphere) CO2(aq) + H2O H2CO3 H+ + HCO3- 2H+ + CO3
2-
The capacity of the carbonate buffer in restricting pH changes of the ocean is
however limited (Raven et al. 2005) . When the ocean loses its capability to act as a
carbonate buffer, the absorption of CO2 by the ocean will result in the surface
waters to become more acidic. This phenomena h a s b e e n t e r m e d called ocean
acidification ( D o n e y e t a l . 2 0 0 9 ) . Ocean acidification is predicted to become
more severe over the century unless future emissions of CO2 are reduced
dramatically (Doney et al. 2009). It is stated that the uptake of anthropogenic CO2
is the major reason why there is long-term increase in dissolved inorganic carbon
(DIC) and decrease in CaCO3 saturation state in the ocean (Takahashi et al. 2006).
Ocean acidification does not occur by itself as it is a phenomenon linked to climate
change and other factors (Doney et al. 2009).
According to Millero et al. (2006), the seawater reactions are reversible and near
equilibrium for surface seawater with pH of ∼8.1. The released of H+ ions results in
reduction of the ocean’s pH. Liberated H+ will react with the available carbonate
(CO3
2−) ion which further increases the bicarbonate (HCO3
−) in the ocean, causing a
![Page 23: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/23.jpg)
P a g e | 10
reduction in (CO3
2−) ions. Changing the acidity of the oceans can cause adverse
effects on calcifying marine organisms such as corals and shell animals because these
organisms undergo calcification which is impeded progressively as the ocean becomes
acidified (Raven et al. 2005). Figure II shows the process of how ocean acidification
phenomenon occurs in a simplified chemical equation form. Most carbon dioxide
released to the atmosphere due to human activity for example, burning of fossil fuels
will be absorbed by the ocean and eventually bring adverse consequences to marine
organism particularly calcifying organisms (Gruber 1998).
Figure ii: The Ocean Acidification cycle process which summarizes the whole process on
how this phenomenon occurs (UK Ocean Acidification Programme 2012).
Many studies have been carried out to investigate the ocean acidification phenomenon
as it has been a rising concern to everyone and researchers are trying to understand
the overall phenomenon process in order to come out with solutions to overcome it
(Ben-Yaakov & Goldhaber 1973; Gruber 1998; Takahashi, Broecker & Bainbridge 1981).
![Page 24: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/24.jpg)
P a g e | 11
1.4.2 Temperature rise
Back in the twentieth century, there was an average of 1°C increase in temperature,
which is the largest in more than 1000 years, and meteorologists are expecting a higher
increment in temperature in this century due to excessive pollutions and many other
contributing factors (Bijlsma et al. 1996). The rise of temperature in the world will
affects the weather, sea levels, distribution of flora and fauna as well as the
environment surrounding microorganisms. Bleaching of corals has been correlated
with high seawater temperatures and high levels of solar irradiance (Jokiel & Brown
2004). The phenomena of coral bleaching have been widespread and increased
dramatically over the last few decades. The big destruction of coral reefs is highly
correlated to increase in seawater temperature, which is indirectly caused by global
warming (Rosenberg & Ben‐Haim 2002). According to (Carpenter et al. 2008), coral
bleaching and disease outbreaks have been on the rise and several reefs around the
world are in danger of extinction. Coral bleaching events have been reported to
increase over wide geographical scales over the last two decades and in certain
location, the entire coral reefs ecosystems have been badly impacted ( B o u r n e et
a l . 2 0 0 8 ) . It is also stated that coral bleaching occurs in the world’s three major
oceans and involves more than 50 countries worldwide (Wilkinson & Network
2008). Therefore, many studies have been carried out to study the impact of gradual
environmental changes such as thermal changes (climate changes) and pH changes
(ocean acidification) on the coral reefs ecosystems in order to discover ways to
decrease bleaching events.
1.4.3 Coral Bleaching and Coral Diseases
Coral bleaching is defined as the disruption of symbiosis between coral hosts and
photosynthetic microalgae endosymbionts (zooxanthellae) (Brown 1997). Coral
bleaching is reversible within a few weeks or months, depending on the specific coral
species and condition. However, it can cause mortality to the coral species if left to
persist as the zooxanthellae, which produce the major portion of the coral’s nutrition,
![Page 25: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/25.jpg)
P a g e | 12
are gone (Glynn & De Weerdt 1991). It is expected that predicted ocean warming in
the current century will result in more coral bleaching events in the future which will
lead to mortality of the coral reefs ecosystem (Bourne et al. 2008).
Increases in temperature have also been linked to increase diseased outbreaks and
although coral reefs extend to water depths greater than 100 m (Goreau & Wells
1967), hermatypic (reef-building) scleractinian corals are most prevalent and
ecologically prone to suffer from diseases as they reside in warm, shallow (less than
10 m), near-shore reef environments. These stony corals develop diseases due to
elevated seawater temperatures and increase in concentrations of pollutants (Navas-
Camacho et al. 2010). The high seawater temperature surrounding the coral reefs
influence the outcome of bacterial infections by lowering resistance of the coral to
diseases and/ or increasing pathogen growth, infectivity as well as virulence
(Rodriguez‐Lanetty, Harii & Hoegh-Guldberg 2009; Ward, Kim & Harvell 2007).
Many disease outbreaks involve opportunistic infections by endemic microbes
following periods of stress ( B o u r n e e t a l . 2 0 0 9 ; L e s s e r e t a l . 2 0 0 7 ) .
Bleached corals are additionally vulnerable because the loss of algae reduces the
concentration of oxygen and the resulting radicals that protect the coral animal
(Banin et a l . 2000b ). One good example of how closely linked coral bleaching and
disease outbreaksare, was shown by studies on the scleractinian coral O.patagonica
along the Mediterranean coast of Israel in the year of 1993 (Fine & Loya 1995). Similar to
other bleaching phenomena, it occurred due to relations with high sea-water
temperature which lead to loss of endosymbiotic zooxanthellae and also impairment in
the coral’s reproductive ability (Rosenberg & Ben-Haim 2002). When the corals are
exposed to increase in sea-water temperature up to 29°C, the bleaching occurred.
Firstly, the infection process started with adhesion of the V.shiloi to a beta-galactoside-
containing receptor on the coral surface (Toren et al. 1998) and the adhesion process
was specific between the coral host and bacteria. Adhesion of V.shiloi on coral host
only occurs when the temperature surrounding the corals have been elevated to 25-
30°C (Rosenberg & Ben-Haim 2002). This showed that environmental stress condition
![Page 26: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/26.jpg)
P a g e | 13
such as higher sea-water temperature is needed to cause coral bleaching marine
pathogen to initiate infection on the coral host itself and become virulent itself. Other
than that, the synthesis and secretion of the bacterium’s receptor requires active
photosynthesis process by the zooxanthellae in the coral mucus layer (Banin et al.
2000b). After adhesion of the receptor on the coral host, the bacterium V. shiloi will
penetrate into the epidermal cells of the coral host. Then, these bacteria will start to
differentiate and multiply intracellularly. Although V.shiloi appears as viable –but-not-
culturable state (VBNC) in the epidermal cell, they are highly infectious (Israely, Banin
& Rosenberg 2001). Once the V.shiloi penetrates the coral host and become virulent, it
will produce extracellular toxins that block photosynthesis, bleach and lyse
zooxanthellae (Rosenberg et al. 1999). This bacterium produces heat-sensitive, high
molecular weight toxins which function in bleaching and lysing isolated zooxanthellae
especially when exposed to temperature at 28°C (Rosenberg et al. 1999).
There have been numerous reports being made on different types of coral diseases for
the last 20 years (Rosenberg & Ben-Haim 2002). For example, black band, white band,
red band, yellow band, dark spot, white pox and many other necrosis diseases. As
mentioned above. Infectious diseases could often be correlated to the increment in
seawater temperature. For example, coral diseases occur when there is increased in
virulence of the marine pathogen, increased in the sensitivity of the host to the
pathogen, higher frequency of transmission via a vector or the combination of all three
factors (Rosenberg & Ben-Haim 2002). . Table B summarises well-studied coral
diseases, their causative agents, the coral species involved and also the relevant
scientific publication.
Table B: Overview of coral diseases, their common hosts and pathogens.
Disease Hosts Pathogen Reference
Bleaching Oculina Vibrio shiloi (Kushmaro et al. 1996)
Bleaching and tissue
lysis
Pocillopora Vibrio corallyliiticus (Rosenberg et al. 2008)
Black Band Many species Consortium (Antonius 1973)
![Page 27: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/27.jpg)
P a g e | 14
White Band Acropora Vibrio charcharia (Gladfelter 1982)
(Peters 1993)
(Ritchie & Smith 1995)
Coral Plague Acropora,
Dichocenia
and other
species
Sphingomonas sp. (Dustan 1977;
Richardson et al. 1998)
Aspergillosis Gorgonacea Aspergillus sydowii (Ritchie & Smith 1995;
Smith et al. 1996)
The consortium contains Phormidium corallyticum, a marine fungus, Desulfovibrio and
Beggiatoa.
spp.
As for coral’s black band disease, it was first investigated by (Antonius 1973) and it is
known as a dark band that moves around across coral colonies destroying coral tissues.
According to (Kuta & Richardson 1996), this disease is most active on warm summer
days. During the occurrence of black band disease on corals, heterotrophic and
photosynthetic bacteria were discovered. For example, a few bacteria were identified
as the possible marine pathogens that caused the disease such as Phormidium
corallyticum (Antonius 1981; Rützler & Santavy 1983), a marine fungus (Ramos- Flores
1983) , Beggiatoa spp. (Ducklow & Mitchell 1979b) and sulphate-reducing bacteria
(Garrett & Ducklow 1975). The microbial communities found during the occurrence of
black band disease produces high level of sulphide which harms the coral’s tissue. In
order for the spreading and presence of black band disease, the presence of
Desulfovibrio sp. and sulphate-reducing bacterium are needed to establish a complete
set of conditions (sharp gradients of oxygen, sulphate-sulphide and nutrients)
(Antonius 1981). In addition, Cooney and colleagues also discovered the presence of a
Cytophaga sp., an α- Proteobacteriaium and a single cyanobacterial during the
spreading of the disease (Cooney et al. 2002).
Another well-known coral disease is the white band disease. This disease is known as a
white band appearing of bare coral skeleton of seen at the base of the coral Acropora
![Page 28: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/28.jpg)
P a g e | 15
sp. (Gladfelter 1982). The microbial communities present in the corals that are infected
with white band disease are mostly gram-negative bacteria which, indirectly means
these bacteria are mostly the causative agent of the disease (Rosenberg & Ben‐Haim
2002). However, it is not proven yet that these gram-negative bacteria are the
confirmed causative agent of the disease as the pathogenicity is not tested. White band
diseases are said to occur in two forms. Ritchie & Smith (1998) stated that type 1 white
band disease shows coral tissue undergo major necrosis while type 2 shows bleached
area on the coral that subsequently lysed (Ritchie & Smith 1998).
According to (Ritchie & Smith 1998; Ritchie & Smith 1995), they found out that Vibrio
charcharia is always present in the corals that infected by white band disease type 2.
Moreover, corals can also suffer from plague which is described further as spreading
disease of massive and plate-forming corals which in the end leads to mortality of
coral’s individual colonies (Dustan 1977). It was found that Sphingomonas sp. is one of
the causative agent of this plague disease (Richardson et al. 1998). Researchers have
managed to identify a few causative agents that contribute to the occurrence of certain
coral species’ bleaching and diseases. For example, the bleaching phenomenon of coral
Oculina patalogica is caused by a marine pathogen named Vibrio Shiloi (Kushmaro et
al. 1996) while the bleaching of coral Pocillopora damicronis by Vibrio coraliilyticus
(Rosenberg & Ben-Haim 2002), the black band disease is caused by a microbial
consortium (Antonius 1973), sea-fan disease which is better known as “aspergillosis” is
caused by Aspergillus sydowlii (Smith et al. 1996) and lastly, the coral white plague
disease caused by Sphingomonas sp. (Dustan 1977; Richardson et al. 1998).
Although the coral mucus layer serves as a protection against pathogenic bacterial
infection, there is also an exceptional case. For example, there is a study that showed
that the Mediterranean coral Oculina patagonica was infected by V.shiloi, a pathogen
that targets the symbiotic algae of the coral (Kushmaro et al. 1998;Kushmaro et al.
1997; Rosenberg & Ben-Haim 2002). Its infection is due to the fact the bacteria is able
to adhere to the coral mucus layer (Banin et al. 2000a). The study also shows that
adhesion of the pathogen to the coral was reduced when there was depletion of the
mucus layer and also the reduction in the symbiotic algae presence. For this case, it can
![Page 29: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/29.jpg)
P a g e | 16
be seen that the pathogen utilizes the mucus layer’s component to enter the coral
host.
1.4.4 Coral diseases and the role of microbes in coral surface mucus layer (SML)
Disease susceptibility is positively correlated with a change in coral SML composition,
loss of antibiotic activity and an increase in pathogenic microbes (Reshef et al .
2006b). The bacterial communities of diseased corals are different from healthy
ones, both qualitatively and quantitatively (Reshef et al. 2006). The bacterial
population of apparently healthy corals undergo changes within a period of a few
months, probably as a result of temperature changes (Koren & Rosenberg 2006).
Previous studies have shown a sudden shift to pathogen dominance occurring in the
coral SML prior to a bleaching event (Ritchie 2006; Rosenberg & Ben-Haim 2002) and
it has been demonstrated that antibiotic activity and antibiotic-producing bacteria in
the SML decline in times of increased water temperature when bleaching is most
likely to occur (Rit ch ie 2006 ) . One possible explanation for an increased
incidence of coral diseases is stress-induced susceptibility to opportunistic microbes
trapped in the coral SML (Ritchie 2006). Indigenous bacteria may help prevent
infection by pathogens by producing antibacterial materials (Koh 1997).
Vibrio shiloi is a known bacterial pathogen to the coral Oculina patagonica found in
the Mediterranean sea (Kushmaro et al. 2001; Kushmaro et al. 1996; Kushmaro et al.
1997). It induces bleaching by reducing the amount of viable zooxanthellae available
for symbiosis with the coral. This is achieved by the secretion of a toxin (a proline-rich,
12 amino acid peptide) (Banin et al. 2000a) that inhibits photosynthesis, and
bleaches and lyses zooxanthellae (Rosenberg et al. 1999). Vibrio shilonii only actively
pathogenic at temperatures of 20-32°C and displays maximum efficacy around 29-
30°C (Kushmaro et al. 2001).
A more recently discovered temperature-dependent agent of bleaching is Vibrio
coralliilyticus which infects the coral Pocillopora damicornis (Ben-Haim et al. 2003). A
patchy pattern of bleaching of Pocillopora damicornis has been observed at 24 °C,
![Page 30: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/30.jpg)
P a g e | 17
suggesting that bacterial bleaching results from an attack on the zooxanthellae,
followed by bacterium-induced coral lysis and death caused by bacterial extracellular
proteases which were produced at temperatures of 24 to 28 °C ( B e n - H a i m ,
Z i c h e r m a n - K e r e n & R o s e n b e r g 2 0 0 3 ) .
There is evidence that a community shift in the coral SML from beneficial bacteria
to Vibrio-dominance occurs prior to zooxanthellae loss (Ritchie 2006). Studies have
shown that Vibrio may be normal constituents of the coral microbial assemblages and
can opportunistically proliferate if holobiont health is compromised (Bourne & Munn
2005a). Previous studies have implicated Vibrio sp. as the principal causative agent in
seasonal and species-specific episodes of coral bleaching (Ben-Haim et al. 2003;
Kushmaro et al. 1996; Kushmaro et al. 1997). Three separate studies (Ben-Haim,
Zicherman-Keren & Rosenberg 2003; Kushmaro et al. 1996) showed that the
number of Vibrio in coral SML did increase with increasing temperatures. In elevated
temperatures, Vibrio sp. will produce a photosynthesis inhibitor (Rosen b erg et a l .
1 9 9 9) , thereby allowing them to multiply, leading to overgrowth and in turn,
causing the loss of antibiotic properties of the SML inhabiting microorganisms (Ritchie
2006). It was speculated that the endosymbiotic zooxanthellae (Symbiodinium sp.)
play a significant role in restricting Vibrio growth in the coral SML by producing free
radicals (Sharon & Rosenberg 2008) but their limited temperature tolerance leads
to the loss of the protective function for the coral.
Elevated sea water temperatures can also induce pathogens to produce adhesions
that allow it to adhere to the coral surface and subsequently establish infections in
the pathogenic systems of the coral (Banin et al. 2000a). The production of toxins and
lytic enzymes which cause bleaching and lysis of zooxanthellae were also found to be
temperature-regulated (Banin et al. 2000a).
Since mucus-associated bacteria play a major role as a first line of defence against
pathogens (Shnit-Orland, Sivan & Kushmaro 2012), and are of significance to the
survival of coral reefs in the area, the present study aimed to investigate:
![Page 31: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/31.jpg)
P a g e | 18
the bacterial communities in three different coral species, namely Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. and
the shift in the bacterial community associated to these three corals when their
surrounding temperature and carbon dioxide concentrations were increased.
Trachyphyllia geoffroyi and Euphyllia ancora belong to the order of scleractianian and
they are the most basal eumetazan taxon that provided the biological and physical
framework for coral reefs (Mydlarz, Jones & Harvell 2006). Although Corallimorphs sp.
is not classified under the order of scleractinian corals, they are closely related to
scleractinian corals. Scleractinian corals play an important role as they form the
tropical coral reef ecosystems adjacent to developing countries (Mydlarz, Jones &
Harvell 2006). In addition to that, they also support major industries such as in terms of
food production, tourism, and biotechnology development (Vidal-Dupiol et al. 2011).
Coral mucus associated bacteria that took over at higher temperatures were likely
pathogenic to the coral host (Banin et al. 2000a). In an extension to the above
questions, we performed phage assays to identify potential bacteriophages that could
potentially in the future be utilised as a treatment for diseased corals.
1.5 Phage Therapy
Bacteriophages are bacterial viruses that play an important role in the evolution of
their host and whole genome sequencing of the bacteria showed that phage elements
contribute to sequence diversity and are potential to influence bacterial pathogenicity
(Hanlon 2007).One of the best approaches to combat the issue of deteriorating coral’s
health condition due to diseases is through the application of phage therapy.
Bacteriophage (phage) therapy is defined as using phages or their products as
bioagents for the treatment or prophylaxis of bacterial infectious diseases
(M at suz ak i et a l . 2005 ) . Phage therapy is said to be a better approach in curing
coral’s disease rather than other methods such as immunization and antibiotic
![Page 32: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/32.jpg)
P a g e | 19
treatments. This is due to the fact that introduction of antibiotics in an open system
like the coral reefs is not practical and corals generally do not possess an adaptive
immune system (Nair et al. 2005). Phage therapy of coral diseases has many
advantages such as host specificity, self-replication ability and it is an environmentally
safety procedure (Efrony et al. 2006). Besides, phages used for phage therapy only
targets on specific pathogens and thus will not harm the remaining beneficial
microorganisms. In addition, phage multiplies at a very fast rate at the expense of its
host bacterium which in the end will increase the phage titer leading to more effective
control of the specific pathogen (Efrony et al. 2006). According to Weld et. al. (2004),
the phage concentration will also decline once the pathogens concentration starts
declining (Weld, Butts & Heinemann 2004). Therefore, this therapy is a good
alternative to help in combating coral diseases worldwide.
To hypothesize, changes of temperature and carbon dioxide (CO2) will affect the
diversity of coral-mucus associated bacteria.
![Page 33: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/33.jpg)
P a g e | 20
1.6 Aims of the present study and dissertation outline
In this present study, the main aim of the project is to investigate the diversity of
microbial community associated with the coral of Corallimorphs sp. (Mushroom coral),
Euphyllia ancora (Hammer coral) and Trachyphyllia geoffroyi (Brain coral) to
understand the bacterial community that reside in them.
Besides investigating the coral mucus-associated bacterial communities of the three
corals, t he second aim of the project is to understand the dynamics of the bacterial
community development changes when the corals are exposed to environmental
changes (eg. surrounding temperature changes).
The third aim of the study is to investigate potential bacteriophages isolates that can
inhibit growths of potential marine pathogens.
The objectives of this study are:
To isolate and identify microbial communities associated with the coral mucus
layer for the selected scleractinian stony corals.
To assess the effects of elevated temperatures on the microbial communities.
To identify potential bacteriophage isolates that can inhibit growths of
potential marine pathogens.
The results obtained will contribute in our understanding of the coral’s health
(Bourne et al. 2009) which will eventually aid in searching for potential ways to solve
the current deteriorating coral reefs' health.
![Page 34: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/34.jpg)
P a g e | 21
CHAPTER 2
2 Methodology
2.1 Methodology Overview
In the beginning, culture-based studies were applied by microbiologist in order to
study the marine microbial diversity. Although this methodology enables
microbiologist to gain understanding about the marine microbial diversity, there are a
number of limitations in this method such as the inability to detect those
‘unculturable’ bacteria (Jørgensen 2006). Today, the advances in molecular biology
have brought ecological studies in microbiology to even greater heights. Physiological
and biochemical studies, previously hindered by obstacles in culturing the
‘unculturable’, can now be carried out to establish the identities, phylogenetic
relationships and metabolic processes of both cultured and uncultured microbial
populations via DNA or RNA based methods (Jørgensen 2006).
The characterization of microbes by genera and species, which previously could not
be achieved through biochemical methods alone, can now be carried out with the
help of sequence-classifier algorithms (Petrosino et al. 2009). Sequencing studies are
conventionally carried out via the Sanger method (Sanger, Nicklen & Coulson 1977)
which is widely used in microbial population studies. Sequencing provides us with
an indication of whether specific genes of interest (for example a bacterial group) are
present in a sample (Rajendhran & Gunasekaran 2011). In this study, coral mucus-
associated bacteriawere investigated using both approaches; culture based, as well as
molecular approach. A summary of the methods utilised is provided in the following in
form of a flowchart.
![Page 35: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/35.jpg)
P a g e | 22
Figure III: Overall methodology flowchart that summarizes the overall experimental
procedures. The identity and enzymatic properties of Trachyphyllia geoffroyi, Euphyllia
ancora and Corallimorphs sp. mucus-associated bacteria were assessed and potential
coral pathogens isolated were tested against potential bacteriophages to detect
whether their growth could be inhibited by the potential bacteriophages chosen
(phage therapy).
Detecting the presence of plaques caused by isolated phages on the selected potential coral pathogens and sequence the postiive resutls for phages identities
Screening of potential bacteriophage
Phylogenetic Trees construction , Results and Discussions
Identifying types of coral mucus associated bacteria and their enzymatic
properties
Detecting the bacteria that present and disappear during changes in
environmental condition
Amplification of genes via PCR
16S rDNA ARISA and DGGE Fingerprinting Analysis
Assessing bacteria community of coral mucus-associated bacteria from Week 1 to Week 11
Cuturing for pure bacterial isolates and DNA Extraction
Genomic bacterial DNA Extraction
![Page 36: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/36.jpg)
P a g e | 23
2.2 Field Sampling and Experimental Set Up
The selected coral samples; Euphyllia ancora, Corallimorphs sp., and Trachyphyllia
geoffroyi (Figure IV) were obtained from Aquadot Aquarium Shop, Kuching, Malaysia in
1st July 2014 and placed into a 240 litre aquaria tank. The corals were allowed to settle
in the tank for a period of 4 weeks before any changes of temperature and carbon
dioxide content in their surrounding were applied.
Euphyllia ancora coral
Corallimorphs sp. coral
![Page 37: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/37.jpg)
P a g e | 24
Trachyphyllia geoffroyi coral
Figure IV: Types of coral species investigated in this experimental study (top left:
Euphyllia ancora; top right: Corallimorphs sp. and bottom left; Trachyphyllia geoffroyi.)
The main equipment used to monitor the aquarium conditions are the WTW 3420
Multiparameter and LI-COR 820 Carbon Dioxide Analyzer (Figure V). The WTW 3420
Multiparameter is a device used to measure and monitor the two parameters namely
the DO (dissolved oxygen) and pH value of the set-up aquarium tank. The software
used to output the data is called the SoftwareMultiLab® User (WTW Xylem Brand).
LI-COR 820 measures carbon dioxide content (ppm) via pumping air to the air inlet and
passing the sample gas through the instrument's optical path. As for data collection,
four convenient data output options are available such as Windows® Interface
Software, Analog Outputs, Digital Outputs and lastly the XML Communications
Protocol (LI-COR Environmental Home). The sampling intervals for throughout the
experiment are 30 minutes interval time.
LI-COR 820 Carbon Dioxide Analyzer
WTW Multi 3420 Multiparameter
![Page 38: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/38.jpg)
P a g e | 25
Figure V: llustrations of experimental instuments used to monitor the parameters in
the aquaria
The overall experimental period was a total of 9 weeks. The starting date of the
experiment was from 26.07.2013 and ended on 29.10.2013. Table C summarises the
detail on the exact dates of the experiment and also the changes in the parameters
throughout the experimental weeks. The experiment is divided into 4 different sets of
environmental conditions which are going to be discussed in the following paragraphs.
Table C: Overview of parameters (pH, CO2, dissolved oxygen, temperature) observed
during weeks 1 to 9
Date of
Experiment
26.07.2013-
22.08.2013
23.08.2013-
05.09.2013
06.09.2013-
19.09.2013
09.10.2013-
29.10.2013
Week of
Experiment
Week1 to
Week 4
Week 5 to
Week 6
Week 7 to
Week 8
Week 9
Temperature (°C) 25 27 29 29
Carbon dioxide
(ppm)
380 450 450 ~2000
pH value 8.1 8.1 8.1 7.5
Dissolved oxygen
(%)
~101 ~101 ~101 ~101
2.2.1 Week 1 to Week 4
The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a
set of controlled parameters during Week 1 to Week 4 of the experimental period:
Temperature (°C): 25
![Page 39: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/39.jpg)
P a g e | 26
Carbon dioxide (ppm): 380
Dissolved oxygen (%): 100
pH value: 8.1
Figure VI shows that the conditions did not vary significantly.
Figure VI: Graph showing overall parameters during week 1 to 4 of the experiment.
Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature
on secondary y-axis.
2.2.2 Week 5 to Week 6, Temperature increase to 27°C
The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a
set of controlled parameters during Week 1 to Week 4 of the experimental period:
Temperature (°C): 27
Carbon dioxide (ppm): 380
Dissolved oxygen (%): 100
pH value: 8.1
![Page 40: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/40.jpg)
P a g e | 27
Figure VII shows that the temperature was constant around 27°C and other
parameters were stable.
Figure VII: Graph showing overall parameters during week 5 to 6 of the experiment.
Dissolved oxygen and carbon dioxide are shown on primary y-axis, pH and
temperature on secondary y-axis.
2.2.3 Week 7 to Week 8, Temperature increase to 29°C
The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a
set of controlled parameters during Week 1 to Week 4 of the experimental period:
Temperature (°C): 27
Carbon dioxide (ppm): 380
Dissolved oxygen (%): 100
pH value: 8.1
![Page 41: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/41.jpg)
P a g e | 28
Figure VIII shows that the temperature was constant around 28°C and other
parameters were stable.
Figure VIII: Graph showing overall parameters during week 7 to 8 of the experiment.
Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and temperature
on secondary y-axis.
2.2.4 Week 9, Temperature 25°C and CO2 increase
The selected corals for testing were maintained in artificial seawater (Red Sea Salt) at a
set of controlled parameters during week 9 of the experimental period:
Temperature (°C): 25
Carbon dioxide (ppm): 380
Dissolved oxygen (%): 100
pH value: 8.1
Figure IX shows that the temperature was constant around 25°C and other parameters
were stable, except the CO2 increase upto close to 2500 ppm.
![Page 42: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/42.jpg)
P a g e | 29
Figure X provides an overview of the CO2 and temperature over the course of the
whole experiment.
Figure IX: Graph showing overall parameters during Week 9 of the experimental
weeks. Dissolved oxygen and carbon dioxide is shown on primary y-axis, pH and
temperature on secondary y-axis.
![Page 43: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/43.jpg)
P a g e | 30
Figure X: Graph showing Week 1 to week 9 overall experimental period for carbon
dioxide (ppm) and temperature (°C) in the aquaria. Carbon dioxide is shown on
primary y-axis, temperature on secondary y-axis.
After the conclusion of the experiment, Euphyllia ancora and Trachyphyllia geoffroyi
were dead (see Figure XI), whereas Corralimorphs sp. was struggling but still alive
(Figure XI).
![Page 44: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/44.jpg)
P a g e | 31
Figure XI: The condition of Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp. after a period of 9 experimental weeks.
Euphyllia ancora
• The coral experiences bleaching and gradually loses its polyps till it undergo mortality when temperature rised up to 30°C and with elevated CO2 content. The mucus secretion reduces gradually throughtout the experiment.
Trachyphyllia geoffroyi
• The coral experiences bleaching and increases in mucus secretion when undergo thermal stress (27°C). It undergo mortality when temperature rised to 30°C along with elevated temperature. The colour changes from neon green and red centre to faded color and dry skeletal condition.
Corralimorphs sp.
• The zooxanthellae that resides on the corals survived and threfore the coral does not undergo mortality throughout the experiment. There is no change in the morphology condition except producing less mucus secretion when the coral is exposed to temperature up to 30°C.
![Page 45: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/45.jpg)
P a g e | 32
2.3 Laboratory procedures
The first step to obtain the bacterial community identity associated to Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. is the need to extract their DNA. DNA
extraction is a step of removing the deoxyribonucleic acid (DNA) from the bacterial
cells. The target of any isolation and extraction procedure should be to maximise yield
and purity of the resulting DNA. The yield of DNA is important for increasing the
efficiency of lysis, as a yield 9 μg instead of 10 μg from the same sample can mean
either 90% efficiency of the lysis of all the different cells present or lysis of only 90% of
cells which are the most sensitive to the lytic protocol used (Rohwer et al. 2001). Purity
will determine the extent to which the microbial DNA template can be analysed by PCR
for community analysis. Also different PCR primers vary in sensitivity to impurities.
Pure DNA is essential also for other molecular techniques.
2.3.1 Isolation and DNA Extraction of coral mucus associated bacteria
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. mucus layer were
extracted on weekly basis starting from week 1 to week 9 respectively. The corals are
taken out from the aquaria tanks left in a beaker to let their mucus layers drip into the
beaker for collections. Then, in order to culture only the original residents of coral
mucus layer, steps for inhibition of potentially invasive microorganisms were applied.
For every tested coral samples, 50 µl of the fresh undiluted coral mucus samples were
collected from the corals and using a pipette and spreader, the mucus was spread
evenly onto the half-strength marine agar plate (HI-MEDIA) and allowed to dry for 10
minutes (Ritchie 2006). These mucus treated plate were sterilized via UV irradiation by
placing the plates onto laminar flow for UV irradiation treatment (10 mins at 320 nm
wavelength) as previously described by Ritchie KB (2006). UV irradiated mucus-treated
plates that were un-inoculated by mucus sample were used to control for complete UV
killing in the experiment. Then, the inoculated plates were spread with another 50 µL
of mucus layer on top evenly. Each sample was made duplicates. Then, these plates
![Page 46: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/46.jpg)
P a g e | 33
were incubated for 48 hours at 30 °C, followed by continuous sub-culturing and
isolation for purification(Ritchie 2006).
To extract the DNA of the pure isolates, the colony of each pure culture was inoculated
in 10ml of marine broth (HI-MEDIA) and left overnight for growth. Then, the inoculated
cultures were spun in 13,000g for 20minutes and the supernatant were removed.
100µL of autoclaved TE buffer was added to each bacterial pellets and the mixture was
vortexed to homogenize. Then, 3 cycles of freeze-thawing (5 minutes in -80 °C
followed by 3 minutes in 85 °C) were carried out(Ritchie 2006). Gel electrophoresis on
an agarose gel containing ethidium bromide (1 %, 100 V, 35 min) and viewing under
UV light and Geldoc was carried out to confirm the presence of the crude bacterial
DNA. Figure XII shows an example of crude bacterial DNA extracted from the pure
isolates.
Figure XII: Crude DNA Extraction of bacterial isolates-associated to Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp. on gel Band with 1kbp DNA ladder. L1
(Lane 1) represents the 1kbp DNA ladder. L2-L11 represent the DNA smears of
L1 L2 L3 L4 L5 L6 L7 L8 L9 L10 L11
![Page 47: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/47.jpg)
P a g e | 34
bacterial isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp.
2.3.2 Molecular characterisation
Small subunit ribosomal RNA (16S rRNA) has been proven to be most useful for
establishing evolutionary relationships because of their high information content,
conservative nature, and universal distribution (Lane et al. 1985). The 16S sequence
analysis is used in two major applications: (a) identification and classification of
isolated pure cultures and, (b) estimation of bacterial diversity in environmental
samples without culturing through metagenomic approaches. New bacterial isolates
are identified based on the 16S sequence homology analysis with existing sequences in
the databases (Rajendhran & Gunasekaran 2011).
Sequence analysis is chosen as one of the methods to assess the biodiversity of the
coral mucus associated bacteria because is the ability to use it for generation of
additive and retrievable data which can be used to generate phylogenetic probes and
primers for use in further studies (McCaig, Glover & Prosser 1999).
The bacterial DNA were amplified by polymerase chain reaction (PCR) and PCR
products were purified using PureLink® PCR Purification Kit following the
manufacturer’s protocol (Invitrogen Life Technologies). Amplification of bacterial 16S
rRNA genes was performed with primers 8F (Eden et al. 1991) and 519R (Lane et al.
1985). The availability of this set of universal 16s rRNA gene primers made the
amplification of a mixed population of 16s rRNA possible and enable the
characterization of phylogenetic diversity of coral-associated bacteria communities
(Rohwer et al. 2001). Amplification was performed by using REDTaq® ReadyMix™ PCR
Reaction Mix (Sigma Aldrich) using instructions provided by the Sigma Aldrich. An
overview of the reaction mixture in each PCR tube is provided below in Table D.
![Page 48: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/48.jpg)
P a g e | 35
Table D: Components of 16S Rrna PCR reaction per PCR tube
Components Volume (L)
2x Bioline Red Taq Mix 12.5
Forwardprimer
8F (AGAGTTTGATCCTGGCTCAG) 1.0
Reverse primer
519R (GWATTACCGCGGCKGCTG)
1.0
DNA template 3.0
ddH2O 7.5
Final volume 25.0
Amplification reactions were performed as follows: initial denaturation at 94°C for 5
min, followed by 30 cycles of 94°C for 30 sec, 55°C for 30 sec, 72°C for 45 sec, and final
extension at 72 °C for 10 min (Eden et al. 1991). PCR reaction results were checked
using 1% agarose gel containing 1 µg of ethidium bromide per ml for pure DNA bands
(see Figure XIII) via electrophoresis (100V, 40 min), then sent for sequencing to BGI
Tech, Hong Kong.
![Page 49: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/49.jpg)
P a g e | 36
Figure XIII: PCR bands result obtained from amplification of bacterial 16S rRNA genes
of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs
sp. on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder. L2-
L22 represents the DNA smears of bacterial isolates-associated to Trachyphyllia
geoffroyi, Euphyllia ancora and Corallimorphs sp.
Nucleotide sequences were determined by the dideoxynucleotide method by cycle
sequencing of the purified PCR products. An ABI Prism BigDye Terminator Cycle
Sequencing Kit was used in combination with an ABI Prism 877 Integrated Thermal
Cycler and ABI Prism 377 DNA Sequencer (Perkin Elmer Applied Biosystems).
2.3.3 Construction of phylogenetic trees for coral mucus-associated bacteria
A total of 265 isolates were isolated from the three selected corals mucus layer
samples (Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) via culturing
method. However, only 104 amounts of isolates are successfully sequenced for their
identity via Sanger sequencing (see Figures Figures XXVI, XVII and XXVIII for
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
![Page 50: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/50.jpg)
P a g e | 37
phylogenetic trees). This is due to some experimental errors such as failure in
optimization PCR condition for certain isolates, complications in yielding pure PCR
samples and low concentration of bacterial DNA extracted.
Returned DNA sequences were analysed using Basic Local Alignment Search Tool
software (NCBI) and Chromas 2.22 (Zhang et al. 2000). Phylogenetic analysis was
performed with Mega6.0 software. Sequences were aligned with ClustalX. BLASTN
from the source http://www.ncbi.nlm.nih.gov/BLAST/BLAST.cgi was then used to
characterize each sequence cluster. The phylogenetic tree was generated with
distance methods, and sequence distances were estimated with the neighbour-joining
method. Bootstrap values ≥50 are shown and the scale bar represents a difference of
0.05 substitution per site. Accession numbers for the reference sequences are
indicated. Resulting trees are presented in Figures XXVI, XVII and XXVIII.
Phylogenetic analysis and culture-based approaches used in this study provide
information regarding the identity of microbes present in the coral mucus layer and at
the same time also some information regarding the elucidation of true coral residents
which are microbes that benefits the coral host, zooxanthellae or other resident
microbes.
2.3.4 Indices for Bacterial Diversity
In order to retrieve more information about the bacteria diversity associated to the
coral mucus layer, a few ecological diversity indices are applied. These diversity indices
are defined as mathematical measures of species diversity in a community (Beals,
Gross & Harrell 2000). Diversity indices generally compare the diversity among
microbial communities that enables us to quantify the diversity within the
communities and describe their numerical structure (see Table E).
These mathematical formulae provide important information about rarity and
commonness of species in a community. Therefore, the ability to quantify diversity in
this way is a useful tool to understand community structure.
![Page 51: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/51.jpg)
P a g e | 38
Table E: List of Variables for Biodiversity Indices
H Shannon's diversity index
S total number of species in the community (richness)
N Total Number of Isolates
pi proportion of S made up of the ith species
EH equitability (evenness)
J’ Shannon Evenness
DMg Margalef Index
The first index method applied is the Margalef Index (DMg) which functions in
measuring the species richness and is highly sensitive to sample sizes although it tries
to compensate for sampling effects (Magurran 2004). It is calculated in this formula:
DA= (S-1)/logeN
Where S is the number of bacteria species, N is the total number of species present in
the coral on respective weeks. According to (Gamito 2010), DMg is a more accurate
index if data is related to species richness as it uses absolute numbers compared to a
density data matrix. Berger and Parker (1970) also stated that Margalef Index is useful
in conjuction with indices sensitive to evenness or changes in dominant species(Berger
& Parker 1970). Besides this method, another commonly use index formula called
Shannon index (H’) is also applied. The Shannon diversity index (H) is another index
that is commonly used to characterize species diversity in a community(Gamito 2010).
Shannon's index accounts for both abundance and evenness of the species present.
This method considers proportions which will ensure no differences when using either
data set (Gamito 2010). The proportion of species i relative to the total number of
species (pi) is calculated, and then multiplied by the natural logarithm of this
proportion (lnpi). The resulting product is summed across species, and multiplied by -1:
![Page 52: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/52.jpg)
P a g e | 39
As a result, if the particular sample has the highest H’, it appears to be the most
diverse. The Shannon evenness index (J’) is derived from H’ which therefore makes it
sensitive to changes in evenness of rare species, thereby possibly overestimating its
true value (Hill et al. 2003). The Smith and Wilson evenness index (Evar), however, is
known to show greater resolution in reflecting true values (Blackwood et al. 2007).
Shannon's equitability (EH) can be calculated by dividing H by Hmax (here Hmax = lnS).
Equitability assumes a value between 0 and 1 with 1 being complete evenness.
2.3.5 Fingerprinting Analyses
In order to assess the changes in the bacterial communities associated to the coral
mucus layer, advanced molecular fingerprinting techniques such as denaturing gel
gradient electrophoresis (DGGE) (Ferris, Muyzer & Ward 1996) were applied in this
study. The use of molecular biological techniques is getting more popular and is
frequently used to explore microbial diversity (Muyzer & Smalla 1998) . This advanced
technique has also aid in overcome the limitations of traditional cultivation techniques
to retrieve the bacterial diversity (Muyzer & Smalla 1998). Examples include
Denaturing Gradient Gel Electrophoresis (DGGE), Temperature Gradient Gel
Electrophoresis (TGGE), Terminal Restriction Fragment Length Polymorphism (T-RFLP)
and (Automated) Ribosomal Intergenic Spacer Analysis (ARISA). These molecular
techniques have in common that they determine the variants of a certain gene (often
the small subunit ribosomal RNA; ssu rRNA or 16S rRNA in case of bacteria) and use
this measurement as a proxy for the actual microbial cell abundances in the sample. It
is thereby assumed that each gene variant (apparent as a band or peak in the
fingerprint) corresponds to a certain microbial taxon, often referred to as a phylotype
or Operational Taxonomic Unit (OTU) (Muyzer & Smalla 1998).
For this study, ARISA and DGGE analysis methods were chosen because both are
genetic fingerprinting techniques which provide a pattern or profile of the genetic
![Page 53: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/53.jpg)
P a g e | 40
diversity in a microbial community. The details of these methods are provided in the
following procedures below.
2.3.5.1 Extraction of genomic DNA from coral mucus samples
In order to perform DGGE and ARISA analysis, the genomic DNA of corals’ bacteria
needs to be extracted. Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.
mucus layers were extracted weekly throughout the experiment. The mucus for
molecular analysis was collected by holding the corals out of the water for 3 minutes,
rinsing them with seawater from the tank and dripping the freshly produced mucus
into autoclaved 1.5 ml Eppendorf centrifuge tubes. Mucus samples were maintained at
-20°C and processed within 2 hours of collections to prevent DNA degradations.
Initially, genomic DNA of coral mucus layer was extracted via the Nucleospin protein
purification kit (Macherey-Nagel, Duren, Germany). However, the product yielded very
low DNA concentrations. Another conventional method was also applied which is by
using the beat beater to break apart or "lyse" the bacterial cells in the early steps of
extraction in order to make the DNA accessible. Glass beads are added to an
Eppendorf tube containing a sample of interest and the bead beater vibrates the
solution causing the glass beads to physically break apart the bacterial cells in 8000 g
for 1 minute. The results were negative as there was very little genomic DNA detected
via gel electrophoresis. It could be due to excessive break down of the cells causing
damages to the bacterial DNA. Hence, another method for genomic DNA extraction
was applied which is by using SDS/Proteinase K. First, lysozyme was added (75 µL of
100 mg /ml) to the mucus samples and incubated at 37°C for an hour followed by 3
cycles of freeze and thaw (-80°C and +65°C). Lysozyme was added to break down the
lipid membranes so that the DNA in the bacterial cells can be freed (Bourne et al.
2008). Then, sodium dodecyl sulphate (SDS) was added (100µL of 25%) then mixed and
incubated at 70°C for 10 minutes. SDS is a detergent that used to further break down
the lipid membrane of the bacterial cell wall. The samples were cooled to room
temperature before adding 10 µl of 20 mg ml of Proteinase K solution and followed by
incubation in 37°C for an hour. The proteinase K solution is used to digest the
![Page 54: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/54.jpg)
P a g e | 41
contaminating proteins of the bacteria cells. Then, another 3 cycles of DNA freeze and
thaw method is applied to further rupture and lyse the bacterial cell wall so that the
bacteria DNA can be obtained (Bourne et al. 2008). Samples were then spun in
centrifuge machine for 1 min in 13,000rpm and supernatant was removed. The
genomic DNA pellets were eluted using 30 μL of TE buffer and stored at −20 °C. Gel
electrophoresis on an agarose gel containing ethidium bromide (1%, 100 V, 35 min)
and viewing under UV light and Geldoc was carried out to confirm the presence of the
genomic DNA.This method has yielded high genomic DNA (see Figure XIV) and was
therefore chosen as the method of choice.
Figure XIV: Genomic DNA of bacteria-associated to Trachyphyllia geoffroyi, Euphyllia
ancora and Corallimorphs sp. on gel band with 1kbp DNA ladder. L1 (Lane 1)
represents the 1kbp DNA ladder. L2-L7 represent the genomic DNA of bacterial
isolates-associated to Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.
L1 L2 L3 L4 L5 L6 L7
![Page 55: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/55.jpg)
P a g e | 42
2.3.5.2 (Automated) Ribosomal Internal Spacer Analysis (ARISA)
After obtaining the genomic DNA of the bacteria from the selected corals’ mucus
layers, Ribosomal Intergenic Apacer Analysis (ARISA) was carried out. ARISA is a
commonly used method for microbial community analysis that provides estimates of
microbial richness and diversity (Cardinale et al. 2004; Danovaro et al. 2006). This
method is based on the length heterogeneity of the bacterial rRNA operon 16S and 23S
intergenic spacer (better known as the internal transcribed spacer or ITS). In this study,
this analysis method is chosen because it is a suitable tool for comparing bacterial
community structure across multiple coral mucus samples on profile patterns and
estimate the bacterial richness and diversity (Cardinale et al. 2004).
RISA was performed as previously described by Cardinale et al. (2004) using primer set
ITS F/ITSReub. The 5’ and 3’ ends of primers ITSF (5’-GTC GTA ACA AGG TAG CCG TA-3’)
and ITSReub (5’-GCC AAG GCA TCC ACC-3’) are complementary to positions 1423 and
1443 of the 16S rDNA and 38 and 23 of the 23S rDNA of Escherichia coli, respectively
(Cardinale et al. 2004). An overview of the reaction mixture in each PCR tube is
provided in Table F:
Table F: Components of ARISA PCR reaction per PCR tube
Components Volume (L)
2x Bioline Red Taq Mix 12.5
Forward primer
ITSF
(5’-GTCGTAACAAGGTAGCCGTA-3’)
1.0
Reverse primer
ITSReub
(5’-GCCAAGGCATCCACC-3’)
1.0
![Page 56: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/56.jpg)
P a g e | 43
DNA template 3.0
ddH2O 7.5
Final volume 25.0
The mixture was amplified at 94 °C for 3 min, followed by 30 cycles of 94 °C for 45
seconds, 55 °C for 1 minute, 72 °C for 2 minutes, and a final extension at 72 °C for 7
minutes (Cardinale et al. 2004). PCR products were then analysed on a 3% agarose gel
(100 V for 40 minutes) and viewed under UV transluminator and Geldoc.
2.3.5.3 Denaturing gradient gel electrophoresis (DGGE) Analysis
Same as RISA, by using DGGE, many coral mucus samples taken at different time
intervals during the study can be simultaneously analysed. This makes the techniques a
suitable tool for monitoring community behaviour after environmental changes (eg.
temperature changed in the tank). With the attachment of a GC-rich sequence (GC
clamp) on the selected primer for DGGE, nearly 100% of the sequence variants can be
detected in DNA fragments up to 500 bp (Muyzer, De Waal & Uitterlinden 1993).
For this analysis, the bacterial genomic DNA was extracted from coral mucus samples
and segments of the 16S rRNA genes were amplified in the polymerase chain
reaction(Saiki et al. 1988). As a result, a mixture of PCR products obtained from the
different bacteria present in the sample. Then, the individual PCR products were
subsequently separated by DGGE. The result was a pattern of bands, for which the
number of bands corresponded to the number of predominant members in the
microbial communities.
PCR for DGGE was performed using the primers of GC341f (5'-
CCTACGGGAGGCAGCAG-3)
(Muyzer et al. 1996) and 907R(5'-CCGTCAATTCMTTTRAGTTT-3') (Ishii & Fukui 2001)for
![Page 57: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/57.jpg)
P a g e | 44
amplification of V3 region of the 16S rRNA genes of bacteria. The GC clamp ( 5'-
CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG-3') was attached to the 5’
end of the GC341f primer. It is recommended that 10-20 ng of template DNA. These
primers produce a 600 bp product (including the gc clamp sequence) (Muyzer, De Waal
& Uitterlinden 1993). An overview of the reaction mixture in each PCR tube is provided
in Table G.
Table G: Components of DGGE PCR reaction per PCR tube
Components Volume (L)
2x Bioline Red Taq Mix 22.5
Forwardprimer
341GCF 1.0
Reverse primer
907R
1.0
DNA template 5.0
ddH2O 20.5
Final volume 50.0
The thermocycling program for the touchdown PCR was as follows: initial denaturation
was performed at 95°C for 3 min and then at 95°C for 30 sec, followed by touchdown
primer annealing from 65°C to 55°C (the annealing temperature was decreased 1°C
every second cycle for the first 10 cycles, to touchdown at 55°C), followed by extension
at 72°C for 1min (for each of the 10 cycles), 20 more cycles were then performed at
95°oC for 30 sec, 55°C for 30 sec, and 72°C for 1 min, with a final extension step at
72°C for 10 min (Muyzer & Smalla 1998).
![Page 58: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/58.jpg)
P a g e | 45
PCR products availability was then checked on a 1% agarose gel (100 V for 40 minutes)
and view under UV transluminator and Geldoc. The preparation for the conduct of
DGGE analysis is done according to the manufacturer’s procedures (BioRad Manual). A
summary is provided in the following:
Gel Casting for DGGE Analysis
As for gel casting for parallel DGGE which the gradient and electrophoresis run in the
same direction, the gel is run overnight, at 70V for 16 hours. Before starting the
electrophoresis, 8 liters of 0.5X TAE are made and filled into the buffer tank. Then, the
lid is put on to ensure the stirring bar fits into support hole in tank. The buffer in the
gel tank is heated up by turning on the power and set the temperature to 65°C.
Running the DGGE Gel
The next step after gel casting is loading the DGGE PCR product into the wells of the
gel. 5 µl of gel-loading buffer is added to each PCR product before loading. Then, the
lid was placed and the power and heater are turned on. The gel is run for 16 hours at
70V and 60°C.
Staining
The last part is staining of the gel after electrophoresis. The gel is carefully transferred
to a plastic wrap. Then SYBR Green is poured onto the gel for staining purpose. The gel
is covered with aluminum foil (SYBR Green is light sensitive) and left for staining for 15-
30 minutes. Lastly.the gel image is viewed under Geldoc.
Analysing the DGGE Gel
Since the resulting DNA fragments in the DGGE analysis gel were not excised for
further sequencing process, the DGGE gel image were analysed via a software tool
called PyElph. Although sequencing analysis of the specific DNA bands obtained from
DGGE analysis enables the determination of more specific community structure traits,
the complex nature of the resulted DGGE fingerprinting makes interpretation of data
difficult. Many bands present in the gel have almost similar mobility and thus making
![Page 59: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/59.jpg)
P a g e | 46
the excision of the DNA bands difficult to be done. In order to gain a better
understanding and interpretation from the DGGE gel, the software PyElph was used
because it is software that automatically extracts data from gel images (Pavel & Vasile
2012). It then computes the molecular weights of the analysed molecules or fragments
and compares the DNA patterns which result from the experiments with molecular
markers and finally generating phylogenetic trees computed by 5 clustering methods
based on the information extracted from the analysed gel image (Pavel & Vasile 2012).
There are many different software that function almost similarly with PyElph such as
QuantityOne from Bio-Rad and GelAnalyzer but both these software have their
disadvantages. QuantityOne is expensive and has a complex design while GelAnalyzer
is not an open source and does not have phylogenetic analysis (Pavel & Vasile 2012).
To first start using the software, DGGE gel image is loaded into it and some editing
operation is done in order for the software to be able to detect all the bands present
(see Figure XV for an example in form of a screenshot). Then, the three selected coral
samples data are combined to infer a phylogenetic tree.
![Page 60: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/60.jpg)
P a g e | 47
Figure XV: PyElph Software Analysis System. Screenshot showcases band matching
step during gel analysis.
The PyElph software automatically detects the migration lanes and bands, computes
the molecular weight of each separated fragment, matches the bands from all
samples, based on their migration distance and finally computes similarity and
distance matrices which are then used to generate the phylogenetic trees(Pavel &
Vasile 2012). The results of the phylogenetic trees constructed for DGGE Analysis are
presented in the following chapter.
2.3.6 Enzyme Assays
Besides identifying the bacterial community associated to Trachyphyllia geoffroyi,
Euphyllia ancora and Corallimorphs sp. it is important to know about their enzymatic
properties too to further understand the roles they might play while harbouring the
coral hosts’ mucus layer. Therefore, enzymatic assays were carried out to test for the
presence of amylase, caseinase, phospholipase and gelatinase enzymes in bacterial
isolates of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.
2.3.6.1 Amylase Activity
Overnight bacterial isolates were inoculated in corn starch–agarose: 1% (w/v) agarose,
50 mM Tris-HCl pH 6.8, 1 mM CaCl2, and 0.5% (w/v) corn starch (Alves et al. 2014).
After incubation at room temperature for 5 days, the culture plates were flooded with
2% iodine solution to colorize the remaining starch, and the amylase-producing
isolates showed a clear halo (Alves et al. 2014). Example of a positive amylase activity
is shown below in Figure XVI:
![Page 61: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/61.jpg)
P a g e | 48
Figure XVI: Example bacterial isolates showing positive amylase activity (zig-zag clear
halo zone).
2.3.6.2 Caseinase Activity
Skimmed milk agar plates were prepare with double strength TNA mixed with an equal
volume of 4% (w/v) sterile (115°C for 10 min) skimmed milk (Oxoid) (Austin et al.
2005). Pure bacterial isolates were inoculated onto the skimmed milk agar plates and
incubated at room temperature (27°C) for up to 5 days. Example of a positive response
was recorded as the presence of clear zones around the bacterial colonies (Figure
XVII).
![Page 62: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/62.jpg)
P a g e | 49
Figure XVII: Example bacterial isolates showing positive caseinase activity (clear zones).
2.3.6.3 Phospholipase Activity
Overnight bacterial cultures were inoculated onto TNA supplemented with either 1%
(v/v) egg yolk emulsion (Oxoid) or 1% (w/v) Tween 80 (GibcoBRL; Life Sciences) for the
determination of phospholipase and lipase activity (Liuxy, Lee & Chen 1996). The
cultures were incubated in the agar at room temperature (27°C) for 7 days. A positive
![Page 63: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/63.jpg)
P a g e | 50
response was recorded as the development of opalescence around the bacterial
growth (Figure XVIII).
Figure XVIII: Example bacterial isolates showing positive phospholipase activity
(opalescence around the bacterial growth).
2.3.6.4 Gelatinase Acitivity
For gelatinase activity, pure bacteria cultures were inoculated on TNA agar which are
supplemented with 0.5% (w/v) gelatin (Oxoid)(Loghothetis & Austin 1996). Saturated
ammonium sulfate solution was poured over the plates after incubation at room
![Page 64: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/64.jpg)
P a g e | 51
temperature (27°C) for 7 day. A a positive response is recorded where there is the
presence of zones of clearing around the colonies (Figure XIX).
Figure XIX: Example bacterial isolates showing positive gelatinase activity (clear zones).
Testing the ability of coral-associated bacteria abilities to produce enzyme is vital as
some enzymes produce by marine bacteria such as amylase and proteases are useful
to produce industrial enzymes (Alves et al. 2014). Enzymes such as amylase and
proteases are widely used for the manufacturing of pharmaceuticals, foods, beverages,
confectioneries and even for waste water treatment (Alves et al. 2014). Results
![Page 65: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/65.jpg)
P a g e | 52
presented in Tables I, J and K are the bacteria isolates that produced positive results to
the enzyme assays. However, some of the bacteria were not identified due to failure in
sequencing of the 16S rRNA genes.
Bacteriophage assay was also conducted on selected potential coral pathogens derived
from the three corals. This assay is to find a suitable environmental friendly way to
inhibit the growth of coral pathogen to save the corals’ health from declining. Six (6)
bacterial strains which are potential pathogens (see chapter 5) derived from
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. were tested for phage
sensitivity via plaque assay.
2.3.7 Screening and Isolation of Bacteriophages
The extraction of marine bacteriophages began with concentrating the marine phages
in the seawater via the Fe-Virus Concentration Method. This method benefits in terms
of cost, reliability add recovery efficiency if compared to other method such as
Centramate Tangential Flow FilterTFF (John et al. 2011). Therefore, it has been chosen
to be implied in this research work. According to John et. al. (2011), TFF-set up will cost
up to 10 thousand dollars while FeCl2 method only cost above a few hundred dollars.
Figure XX shows the experiment done to prove the efficiency of virus recovery is higher
when using FeCl3 flocculation method compared to TFF.
![Page 66: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/66.jpg)
P a g e | 53
Figure XX: Comparison of TFF and FeCl3 flocculation methods and the results of the
concentration efficiency via viral fraction (< 022µM filtrate) seawater .
The recovery of the virus is based on virus counts by epifluorescence microscopy
(retrieved from . John, 2011). However, this method did not yield any positive result as
there was no phage DNA detected after the filtration process.
Bacteriophages utilised for this experiment were kindly provided by Associate
Professor Dr. Peter Morin Nissom of Swinburne University of Technology, Sarawak. The
phages were isolated as described in Tang and Ong (2013). In summary, the
bacteriophages were isolated from soil samples collected from a chicken farm in
Kuching, Sarawak, Malaysia. 5 g of soil sample were inoculated into 20 mL of Muller
Hinton Broth (HI-Media) and inoculated with a variety of test (host) bacteria. The
cultures were shaken at 150 rpm and incubated at 37⁰C for 18 hours. Five (5) ml of the
cultures were then transferred to sterile 15 ml falcon tube and centrifuged at 13,400
rpm, 4⁰C, for 30 minutes. The supernatant was filtered to remove sediments through
0.22 μm filters and used as phage lysate. The function of the 0.22 μm filter membrane
is to filter the liquid by removing microorganisms in the samples.
In order to detect the phages isolated, spot test method was applied to screen for the
presence of lytic phage activity. After bacterial lysis was observed, the solution was
centrifuged and the supernatant containing phage particles was filtered through 0.22-
μm filter membranes and used as the phage suspension. The phages were further
purified by soft agar method so as to ensure the homogeneity of the phage stock. Soft
agar method or known as the Double Layer Agar technique is a technique used to
enumerate and purify the isolated phages (Santos et al. 2009). High-titer phage stocks
were prepared from the lysates by liquid infection (Sambrook, Fritsch & Maniatis
1989).
Five (5) phages were chosen at random (termed A, B, C D and E for the remainder) and
used for phage assay to investigate their potential capability to inhibit the growth of
the six (6) selected potential coral pathogens derived from Trachyphyllia geoffroyi,
Euphyllia ancora and Corallimorph sp.. Before conducting the assay, chosen potential
![Page 67: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/67.jpg)
P a g e | 54
marine pathogens isolates cultured on marine agar and inoculated with one drop of
distilled water in replaced of bacteriophages for confirmation of plaque assay’s
accuracy (control set; see Figure XXI). All test organisms grew well without appearance
of any plaques or other growth inhibition.
Figure XXI: Experimental controls of Potential Coral Pathogen Isolates to make sure
that there is no experimental errors during phage assay experiment.
2.3.8 Whole Genome Amplification via Multiple Displacement Amplification (MDA) of
Bacteriophages
After the plaque assay, bacteriophages that successfully formed plaques on the
selected bacterial cultures were identified. Crude DNA extraction of the selected
bacteriophage samples was carried out via DNA freeze and thaw method. The selected
bacteriophages underwent whole-metagenome amplification to amplify their genomic
DNA before Sanger sequencing (Yokouchi et al. 2006). Multiple Disaplacement
Ampification is used to enrich the small and circular ssDNA genomes (Haible, Kober &
Jeske 2006), and has successfully assisted to identify many ssDNA phages and
eukaryotic viruses in the ocean. MDA can generate large amount of high quality
Vibrio azureus
Bacillus thuringiensis
Vibrio harveyi
Bacillus cereus
Bacilllus cereus
Vibrio
neoccalledonicus
Marine broth as Control
![Page 68: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/68.jpg)
P a g e | 55
bacteriophages DNA from a small amount of phage DNA using the ϕ29 DNA
polymerase and random exonuclease-resistant primers to amplify the entire genome
(Dean et al. 2001).
Extracted DNA of selected bacteriophages were used as template for the MDA. MDA
was performed by denaturing the DNA template at 95°C for 3 minutes after mixing
with 5– 110 µM random primers, 2.5 mM dNTP and 1x reaction buffer. The
bacteriophages samples were cooled on ice and added to 900 units of ϕ29 DNA
polymerase (EPICENTRE, Madison,WI). Multiple displacement amplification reactions
were performed up to 20 hours at 30°C followed by incubation at 65°C for 10 min to
inactivate the enzyme. DNA concentrations of the MDA products were subjected to gel
electrophoresis under the following conditions: 1% agarose, 100 V, 35 minutes to
confirm the presence of the genomic DNA samples. Figure XXII shows the presence of
genomic DNA after the MDA process.
Figure XXII: The Genomic DNA bands of the bacteriophages isolated and amplified via
MDA on gel band with 1kbp DNA ladder. L1 (Lane 1) represents the 1kbp DNA ladder.
L1 L2 L3 L4 L5
![Page 69: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/69.jpg)
P a g e | 56
L2-L5 represent the genomic DNA bands of samples bacteriophages extracted from
chicken dunk samples.
2.3.9 Sequencing Analysis For Bacteriophages Identification
Several signature genes of phages are used to study phage diversities such as primers
available for amplifying the DNA polymerase gene of T7-like podophages which are
only restricted to a subset of that particular phage group and g20 primers that target
specifically on cyanomyophages (Goldsmith et al. 2011). The presence of phoH genes
in phages that infect both herotrophic and autotrophic hosts allows the primers that
targets on that specific phoH genes have the potential to capture a wider range of
phage diversity (Goldsmith et al. 2011). For example, phoH genes are detected in a
group of phages infecting the heterotrophic bacteria such as roseophage SI01 and a
broad range of vibrio phage (Rohwer et al. 2000). Besides, another benefit of having
phoH gene as a signature gene for identifying phages diversity is this gene is not
restricted to only one morphological type of phage. These genes are discovered in the
genomes of podophages, siphophages and enterobacterial phage as well as
myophages (Goldsmith et al. 2011).The MDA products were subjected to amplification
of the g20 and the phoH genes.
2.3.9.1 g20 gene
Primers CPS 1 and CPS 8 were used to amplify g20 gene fragments from our samples.
The primers sequences were CPS1 (59-GTAG[T/A]ATTTTCTACATTGA[C/T]GTTGG-39)
designed by (Fuller et al. 1998) and CPS 8 5’-
AAATA(C/T)TT(G/A/T)CCAACA(A/T)ATGGA-3, respectively (Zhong et al. 2002). 3 µL of
extracted phageDNA were used as DNA template for PCR amplification. The reaction
mixture (total volume, 25 µL) contained 3 µL of template DNA, 1 µL each of 25 µmol of
CPS1or CPS8, 12.5 µL of MyRedtaq (Bioline) and 8.5 µL of MilliQ deionised water.
![Page 70: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/70.jpg)
P a g e | 57
PCR amplification was carried out with thermal cycling consisted of an initial
denaturation step of 94°Cfor 3 min, followed by 35 cycles of denaturation at 94°C for
15s, annealing at 35°Cfor 15s, ramping at 0.3°C/s, and elongation at 73°C for 1 min,
with a final elongation step of 73°C for 4 min (Zhong et al. 2002). A 6µl aliquot of PCR
product was analysed by electrophoresis in a 1.5% agarose gel and stained with
ethidium bromide for 15 min. The results of the amplication are displayed in Figure
XXXVI can be seen that the amplification of expected products of 592 bp was
successful.
2.3.9.2 phoH gene
The phoH primers are based on a CLUSTALX alignment of the full-length phoH gene
from Synechococcus phage S-PM2, Prochlorococcus phages P-SSM2 and P-SSM4, and
Vibrio phage KVP40.PCR primers of vPhoHf (5_-TGCRGGWACAGGTAARACAT-3_) and
vPhoHr (5_-TCRCCRCAGAAAAYMATTTT-3_) were used to amplify a product of
approximately 420 bp (Goldsmith et al. 2011). The 25 µL reaction mixture for PCR
amplification of the phoH gene contained 12.5 µL MyRedTaq reaction buffer, 1 µL of
each 25 µM of the primers, 3 µL of the DNA templates and 8.5 µL of milliQ deionized
water.
![Page 71: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/71.jpg)
P a g e | 58
Figure XXIII: The DNA bands of the bacteriophages isolated and amplified via PCR using
primers CPS1/8. Lane 1(L1) represents DNA ladder and L3 and L4 represents the DNA
of bacteriophages amplified.
The PCR reaction conditions were (i) 5 min of initial denaturation at 95°C; (ii) 35 cycles
of 1 min of denaturation (95°C), 1 min of annealing (53°C), and 1 min of extension
(72°C); and (iii) 10 min of final extension at 72°C (Goldsmith et al. 2011).
L1 L2 L3 L4 L5 L6 L7 L8 L9
![Page 72: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/72.jpg)
P a g e | 59
Figure XXIV: The sDNA bands of the bacteriophages isolated and amplified via PCR
using primers vPhof . Lane 1(L1) represents 1kbp DNA ladder and L5 and L6 represents
the DNA of bacteriophages amplified.
2.3.9.3 Phylogenetic analyses
The DNA sequences were analyzed with MEGA 5 software (Kumar et al. 2008). From
All sequences were aligned at the amino acid level using CLUSTALW (using default
parameters). This is because protein-coding sequences such as phoH and g20 are more
conserved at the amino acid level than they are at the nucleotide level and thus
alignments are more accurate when conducted at the amino acid level. Genbank
analysis via MEGA 5 software, reference sequences from cultured phages were
obtained. The back-translated nucleotide sequences obtained from the amino acid
alignments were used to build the tree.
L1 L2 L3 L4 L5
![Page 73: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/73.jpg)
P a g e | 60
CHAPTER 3
3 Diversity of the Bacterial Communities Associated to Coral
Mucus Layer
3.1 Introduction
Studies show that many coral microbes reside within or upon the coral mucus layer
which is a layer secreted onto the surface of the exposed coral tissues area (Bythell
1988; Ducklow & Mitchell 1979a). These mucus layers are suitable for microbial
growth as it has high concentration of proteins, polysaccharides and lipids (Bythell
1988; Ducklow & Mitchell 1979a) (Ducklow & Mitchell 1979b; Wild et al. 2004a).
Therefore, many researchers assumed that the mucus composition must play an
important role in shaping microbial communities (Ritchie and Smith, 2004).
Investigations on corals via molecular analysis have shown that the microbial
community associated to corals is extremely diverse in terms of species richness and
abundance (Bourne & Munn 2005b; Cooney et al. 2002; Frias-Lopez et al. 2002;
Rohwer et al. 2002). One good example is a study by Rohwer and colleagues in 2002
who managed to identify a total of 430 ribotypes from 14 coral sample in the
Carribean (Rohwer et al. 2002). The coral associated bacteria that they managed to
identify and considered the most common ranged from ɣ-Proteobacteria to α-
Proteobacteria. In addition to that, Bacillus/ Clostridium, Cytophaga-
Flavobacter/Flexibacter-Bacteroides and cyanobacteria were also found to be common
except that these groups were less dominant in the 16S DNA banks (Rohwer et al.
2002).
Generally, coral-associated bacteria are also discovered to be involved in additional
nitrogen cycling processes which includes nitrification, ammonium assimilation,
ammonification and denitrification. The members of the coral-associated microbiota
were also found to be involved in carbon and sulfur cycling (Wegley et al. 2007).
![Page 74: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/74.jpg)
P a g e | 61
In the following we introduce the bacteria associated with the three coral mucus layers
under normal conditions, before we move to discuss changes in bacterial communities
over the course of the experiment in chapter 4.
3.1.1 Bacteria associated with Trachyphyllia geoffroyi
Based on Genbank analysis, the genus of bacteria obtained from Trachyphyllia
geoffroyi mucus layers ranged from the Vibrio sp, Bacillus sp., Pseudoalteromonas sp.
and Chromohalobacter sp. and Halophilic sp. group (see Figure XXVI for phylogenetic
tree and Table 1 in Appendix for overview of closest matches).
The dominant bacteria group in Trachyphyllia geoffroyi mucus layer comprised of the
ɤ-Proteobacteria and Firmicutes. ɤ-Proteobacteriaare commonly found as coral
associated bacteria (Kvennefors et al. 2010). Isolates linked to the ɤ -Proteobacteria
were related mostly to Vibrio species such as V. parahaemolyticus, V. communis,
V.harveyi, V. owensii, V. alginolyticus (Figure XXVI). Isolates linked to Firmicutes were
mostly related to Bacilli such as B. cereus, B. subtilis, B. anthracis, B. thuriengiensis.
In week 1 of the experiment where all the parameters were set to normal seawater
condition, there were isolates collected that showed similarities to the references
Pseudoalteromonas sp. up to >91% as well as P. piscicida and P. flaviputra (Figure
XXXIX and Table 1, Appendix). Pseudoalteromonas sp. has been reported to display
activity against the coral pathogen Vibrio shilonii (Nissimov, Rosenberg & Munn 2009).
The study by Nissimov, Rosenberg & Munn (2009) also reported that during the test on
the antimicrobial property of Pseudoalteromonas sp. on V. shilonii, there was complete
inhibition of the V. shilonii observed with stationary-phase cultures at low cell
densities. From the finding by Nissimov, Rosenberg & Munn (2009), it is likely to state
that Pseudoaltermonas sp. plays a role in protecting the coral host by producing
antibiotics and therefore, it is reasonable to have abundance of this genus found
during the beginning of the experiment (Week 1) as they act as potential beneficial
bacteria to Trachyphyllia geoffroyi that protects Trachyphyllia geoffroyi from
opportunistic pathogens. Pseudoalteromonas piscicida or originally known as
![Page 75: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/75.jpg)
P a g e | 62
Flavobacterium piscicida (sp. nov), was also discovered as a reference strain that has
91% similarity with one of the isolates derived from Trachyphyllia geoffroyi during
week 1. This species was indicated as bacteria that is capable of killing certain fishes
when exist as pure culture in laboratory condition (Bein 1954).
![Page 76: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/76.jpg)
P a g e | 63
Figure XXVI: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Trachyphyllia geoffroyi (Brain coral). The phylogenetic tree was generated with
![Page 77: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/77.jpg)
P a g e | 64
distance methods, and sequence distances were estimated with the neighbour-
joining method. Bootstrap values ≥50 are shown and the scale bar represents a
difference of 0.05 substitution per site. Accession numbers for the reference
sequences are indicated.
Pseudoalteromonas piscicida is also investigated to have anti-yeast properties aside
from its virulent factor in killing certain fishes (Buck & Meyers 1966). A bacteria strain
identified as Pseudoalteromonas piscicida designated as X153, was known for its
production of a vibriostatic protein with a broad spectrum inhibition against marine
bacteria (Longeon et al. 2004). Other than that, NJ6-3-1, also related to
Pseudoalteromonas piscicida, showed antimicrobial activity against Staphylococcus
aureus (Zheng et al. 2005) by a β-carboline alkaloid. The discovery of bacteria strain
that are related to Pseudomonas piscicida in Trachyphyllia geoffroyi can be considered
normal because this species is commonly found in the marine environment (Rohwer et
al. 2001). It might be not harmful to Trachyphyllia geoffroyi’s health and play a role in
the corals defense against potential pathogens. Pseudoalteromonas flavipulchra is
classified under the pigmented species clades as it is P.flavipulchra JG1 has been
shown to produce a protein PfaP and small-molecule compounds which inhibit the
growth of Vibrio anguillarum, a pathogen which causes vibrosis (a type of fish
diseases) (Austin & Austin 2007). This JG1 strain has excellent antibacterial activated
against pathogens in marine aquaculture and is harmless to aquatic animals (Bowman
2007). This isolate could potentially also play an important role in the corals initial
defense.
In week 3 of the experiment (control experiment period), a strain with 97% similarities
to Lysinibacillus fusiformis was identified in Trachyphyllia geoffroyi mucus layer. In a
study on antibacterial activity of marine bacteria, an isolate which was phylogenetically
identical to L. sphaericus and L. fusiformis, has shown positive results in inhibiting a
selection of bacteria such as Bacillus lentus, Pseudomonas aeruginosa, Yersinia
enercolitica and Bacillus cereus. This shows that Lysinibacillus sp. has antimicrobial
![Page 78: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/78.jpg)
P a g e | 65
properties and therefore, making it theoretically reasonable to conclude that it is
common to discover this species when Trachyphyllia geoffroyi is in healthy state as
Lysinibacillus sp. act as one of the coral’s symbionts that aids in maintaining coral’s
health. Based on the phylogenetic tree of Trachyphyllia geoffroyi in Figure XXVI, one of
the isolates collected in Week 4 has 100% similarity with the reference strain of
Chromohalobacter salexigens. This is the first study that has found bacteria related to
Chromohalobacter salexigens to be associated with scleractinian corals. It was
reported in Rodriguez-Moya et al. (2013) that C. salexigens is a natural producer of
hydroxyectoine, which is an extremolyte produced by halophiles to cope with extreme
saline environments (Rodríguez-Moya et al. 2013). This capability might aid the the
coral itself to become more resilient towards environmental changes in terms of
salinity. In another study, it has been shown that Chromohalobacter sp. possesses
antimicrobial activity against Aerobacter aerogenes (Velho-Pereira & Furtado 2012)
and might also serve as protection to the coral host.
Approximately 70% of the isolates derived from Trachyphyllia geoffroyi mucus layer
have >97% similarities with various Vibrio species. In week 1, isolates having
similarities up to >97% with reference strains V. rotiferianus and V. algonolyticus were
identified in Trachyphyllia geoffroyi mucus layer. In week 2, isolates with 99% of
similarities with V. parahaemolyticus and V. alginolyticus were discovered followed by
week 3 with also isolates that have 99% similarities with reference V. communis, V.
owensii, V. harveyi and V. parahaemolyticus were identified. It is interesting that Vibrio
sp. is dominant during this stage of the experiment as Trachyphyllia geoffroyi is still in
a healthy state because Vibrio sp. are associated with disease in corals (Rosenberg et
al. 2007) in many studies. The presence of Vibrio sp. when the coral species are
exposed to normal seawater temperature (25°C) indicate that the members of this
group form natural part of the microbial community associated to the healthy corals
too besides being classified as potential marine pathogens. This is supported by finding
from Bourne and Munn (2005) who also discovered Vibrionaceae when the selected
corals are in normal and healthy state (Bourne & Munn 2005a). According to Bourne
and Munn (2005), Vibrionaceae can exist as normal microbial residents on coral mucus
layer when the surrounding seawater condition is normal. Only when the
![Page 79: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/79.jpg)
P a g e | 66
environmental condition changes such as increment in temperature will switch on
their virulent factors (Rosenberg & Falkovitz 2004). These will cause the occurrence of
infections and subsequently lead to bleaching or necrosis of corals (Rosenberg &
Falkovitz 2004). Vibrio sp. are said to be involved in nitrogen fixation (Kvennefors et al.
2010) (Chimetto et al. 2008a; Rincón‐Rosales et al. 2009) and also breakdown of amino
acids.
During Week 4 of the experiment where the parameters were still in constant normal
condition with temperature of 25°C, one of the strains were discovered to have 99%
similarities with Vibrio coraliilytiicus, which is a well-known marine coral pathogen
(Reshef et al. 2006b). Vibrio coraliilytiicus’ cells are Gram-negative, in non-sporing
forming rods that are motile (Ben-Haim et al. 2003). Vibrio coraliilytiicus is identified as
temperature-dependent coral pathogen in Pocillopora damicornis in the Red Sea and
Indian Ocean (Ben-Haim et al. 2003). It is very interesting that the isolate found in this
Trachyphyllia geoffroyi is similar to Vibrio coraliilytiicus as Trachyphyllia geoffroyi is still
exposed to normal seawater temperature (25°C) during its presence while Ben-Haim
et. al. (2003) stated that infection by this species will only occur when the seawater
rised up to 27°C and above as it is a temperature-dependent bacteria species. The
pathogenicity of Vibrio corallytiicus is related to their function in producing putative
toxins, also known as zinc-metalloprotease (Ben-Haim et al. 2003). This zinc-
metalloprotease compound was proven to be able to cause coral tissue damage within
18 hours at 27°C (Ben-Haim et al. 2003).The result finding in this experiment could
indicate that Vibrio corallytiicus possibly survive in non-virulent state in Trachyphyllia
geoffroyi as this isolate brought no damage to the Trachyphyllia geoffroyi’s health as
observed.
![Page 80: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/80.jpg)
P a g e | 67
3.1.2 Bacteria associated with Euphyllia ancora.
According to the phylogenetic tree in Figure XXVII of Euphyllia ancora, it has variety of
bacterial community harbouring at the mucus layer.
There is presence of isolates related to Vibrio sp., Bacillus sp., Pseudoalteromonas sp.,
Shewanella and Photobacterium sp. (see Figure XXVII for phylogenetic tree and Table 2
in Appendix for overview of closest matches) which is relatively similar to other related
journals findings such as (Geffen & Rosenberg 2004). All these groups of bacteria are
very common in the marine environment and can be found either as residents of the
coral hosts or in the seawater column (Geffen & Rosenberg 2004).
In week 1 to week 4 of the control experiment week, approximately more than 50% of
the isolates derived in the mucus layer of Euphyllia ancora were from the family of ɤ-
Proteobacteria. Vibrio sp. was the dominant group during this duration of the
experiment This data further support the report finding that stated Vibrio core group
(V. harveyi, V. rotiferianus, V. campbellii, V.alginolyticus, V. mediterranei(= V. shilonii)
as common marine coral inhabitants as they are found abundant associated to
Brazilian coral Mussismilia hispida (V. meditteranei). These Vibrio core groups are said
to contribute beneficial effects to the coral host which include nitrogen fixation
(Chimetto et al. 2009), food resource(Shashar et al. 1994), chitin decomposition and
production of antibiotics (Chimetto et al. 2009). Several isolates were related to V.
parahaemolyticus which is a gram-negative, halophilic bacteria that occurs naturally in
the marine environment (DePaola et al. 2003). Higher densities of V. parahaemolyticus
are often associated with an increment of seawater temperatures (DePaola et al. 2003)
as they are known for their pathogenicity role on coral hosts. V. parahaemolyticus
produces a thermostable direct hemolysin (TDH), which is the product of tdh gene
(Nishibuchi & Kaper 1995). Based on Nishibuchi & Kaper (1995), V. parahaemolyticus
are normally classified as coral pathogen due to their virulence factor which did not
correlate with our data finding which has discovered this pathogen when Euphyllia
ancora was still in healthy state. However, there is also a report that can explain our
data finding in terms of occurrence of V. parahaemolyticus which is that Vibrio sp. can
generally appear as a considerable fraction of the microbiota of coral species (with
![Page 81: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/81.jpg)
P a g e | 68
counts of up to 107 cells ml-1 of coral mucus), in both healthy (Koren & Rosenberg
2006) and diseased specimens (Chimetto et al. 2009) (Kooperman et al. 2007).
![Page 82: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/82.jpg)
P a g e | 69
![Page 83: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/83.jpg)
P a g e | 70
Figure XXVII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Euphyllia ancora (Hammer coral).The phylogenetic tree was generated with distance
methods, and sequence distances were estimated with the neighbour-joining method.
Bootstrap values ≥50 are shown and the scale bar represents a difference of 0.05
substitution per site. Accession numbers for the reference sequences are indicated.
There is also isolated that is 99% similar of 1432 bp to the reference strain of V.
proteolyticus during week 1 of the experiment which are associated to Euphyllia
ancora. Based on a report that detected two of their coral-bacteria isolates are 99%
similar to V. proteolyticus, this report has identified that V. proteolyticus which in the
report is associated to Oculina patagonica, showed high protease activity which
suggest that they could utilize the high protein available in the coral mucus (Sharon &
Rosenberg 2008). Other than that, V. proteolyticus were also tested to be able to carry
out nitrogen fixing process (Sharon & Rosenberg 2008) which could explain the
presence of this bacteria species in Euphyllia ancora during the early experimental
week as they could serve as the coral symbionts that contribute in nitrogen fixation for
Euphyllia ancora health maintenance (Sharon & Rosenberg 2008).
In week 3 and 4of the experiment, one of the isolates were sequenced and found to
have 99% similarities with the reference species of Vibrio shilonii or better known as V.
shilonii. And another was found to be 97% similar to V. mediterranei which is also
regarded as phylogenetically related to V. shilonii (Chimetto et al. 2009). Kushmaro
and colleagues were the first to discover about V. shilonii as the causative agent that
caused the infection and bleaching of O. patagonica sp. (Kushmaro et al. 1996;
Kushmaro et al. 1997). The infection by V. shilonii is temperature dependent as it does
not occur at 16-20°C and only stimulated when the temperature is above 25°C
(Kushmaro et al. 1998). V. shilonii only infects the coral species at high temperature
condition which it will adhere to the β-galactoside receptor of the coral surface and
also only on corals that possesses photosynthetically active zooxanthellae (Ben‐Haim
et al. 1999). When V. shilonii successfully enters the coral host’s tissue, this coral
pathogen itself will multiply and produce extracellular protein toxin that blocks
![Page 84: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/84.jpg)
P a g e | 71
photosynthesis and results in the bleaching and lysing of the zooxanthellae (Banin et
al. 2001a; Banin et al. 2000a; Banin et al. 2001b). Since Kushmaro et. al. (1996) has
acknowleged and identified V. shilonii as a coral pathogen, it is interesting that the
isolate collected when Euphyllia ancora is still in healthy state is closely related to V.
shilonii. Another interesting finding about V.shilonii presence in the coral of O.
patagonica is that its presence was no longer detected during the annual bleaching
event in year 2005 (Ainsworth et al. 2007). V. shilonii is reported to still adhere to the
O. patagonica tissue but its population in the coral slowly decline and eventually no
longer present in the coral host. One possible explanation to this incident is based on
the Coral Probiotic Hypotheses proposed by (Reshef et al. 2006a) and developed by
(Rosenberg & Falkovitz 2004). This hypothesis proposed that the abundance and types
of microorganisms associated to the coral species will change in response to
environmental changes such as temperature in order to adapt to the new condition for
survival purpose. In a study, Pseudoalteromonas sp. is known for being the strongest
inhibitor to a coral pathogen, Vibrio shilonii (Nissimov, Rosenberg & Munn 2009;
Rosenberg et al. 1999). Vibrio shilonii were first discovered during week 3 of the
experiment but its presence was not detected on the following week (week 4). Based
on the experimental result from NIssimov et. al. (2009) which Pseudoaltermonas sp.
was found to inhibit the growth of Vibrio shilonii, it is theoretically reasonable to
speculate that one of the isolates found in Week 4 which has 97% similarity with
reference strain of Pseudoalteromonas rubra has inhibited the growth of V. shilonii
found previously resulting to the absence of Vibrio shilonii in Euphyllia ancora This
statement supports the concept of probiotic effect on microbial communities that are
related with the coral holobiont.
Isolates that are 97% similar to the reference strain of Photobacterium rosenbergii and
97% similar to Photobacterium rubra were also discovered associated to Euphyllia
ancora. Although there is study that discovered P. rosenbergii isolated from mucus and
surrounding bleached corals, researchers stated that there was no evidence that that
particular species exhibits any pathogenic characteristic (Austin et al. 2005; Munn,
Marchant & Moody 2008b). Moreover, in a study which investigates superoxide
![Page 85: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/85.jpg)
P a g e | 72
dismutase activity of Photobacterium rosenbergii, the result shows that P. rosenbergii
has the highest activity observed among other tested species such as Vibrio
corallyliiticus which means it contains high amount of SOD enzyme that responsible to
break down oxygen obtained to superoxide (O2-) radical and hydrogen peroxide (H2O2).
In addition, the study also revealed that the tested P. rosenbergii shows very low levels
of catalase which is an enzyme responsible in breaking down hydrogen peroxide (H202)
(Munn, Marchant & Moody 2008a). Therefore, the tested P. rosenbergii strain is very
sensitive to even an extremely low level of H2O2. Judging from this study, P.rosenbergii
could be classify under the non-pathogenic bacteria that are associated to Euphyllia
ancora and that would be the reason why this strain existed when the coral host is still
in healthy state during normal control experimental weeks. Also, Photobacterium
mandapamensis which is a type of Photobacterium sp. was classified as commensal
bacteria for the coral Acopora palmata (Krediet et al. 2009; Ritchie 2006). Hence, it
could be possible that Photobacterium sp. is coral-associated commensal bacteria that
bring no threat to coral species.
During week 2 to week 4, a few isolates collected from Euphyllia ancora also have
similarity with the genus of Bacillus sp. such as B.cereus with 100% similarity and
Lysinibacillus fusiformis with 99% similarity as well as Bacillus firmus with (100%). The
Bacillus sp. genus is well-known to produce lipoproteins, phenolic derivatives, aromatic
acids, acetyl-amino acids (amino acid analogues), peptides (Gebhardt et al. 2002),
isocoumarin antibiotics (Pinchuk et al. 2002) and bacteriocin like substances (Bizani &
Brandelli 2002) which classified this genus as having a broad antibiotic spectrum. In a
study conducted to investigate potential marine bacteria that can act as a source of
anti-biofilm agents against Pseudomonas aeruginosa, strains with >99% similarities to
B.cereus and B. arseniscus were identified as showing antibiofilm activity (Itoh et al.
1981). Therefore, it is reasonable for us to find Bacillus sp during the beginning of the
experiment where Euphyllia ancora is exposed to normal parameter condition with
temperature of 25°C as this species will serve as symbiotic bacteria that contribute in
defending Euphyllia ancora from any harmful pathogens via their ability in producing
antimicrobial properties. The presence of strains similar to the reference strains of
![Page 86: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/86.jpg)
P a g e | 73
Bacillus sp. could possibly inhibit the growth of harmful bacteria such as P. aeruginosa
from invading Euphyllia ancora.
![Page 87: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/87.jpg)
P a g e | 74
3.1.3 Bacteria associated with Corallimorphs sp.
As for Mushroom coral, there is also variety of bacterial community in reference to the
Vibrio sp., Photobacterium sp., Pseudoalteromonas sp., Chlomahalobacter sp. and
Bacillus sp. and this findings can be correlated with the data in other journal that is
related to coral bacteria biodiversity (Geffen & Rosenberg 2004). For Corallimorphs sp.,
based on the references bacteria from Genbank analysis, when the corals were
exposed to 25°C (normal temperature), α-Proteobacteria such as V. parahaemolyticus,
V. alginolyticus, V. owensii and V. harveyi dominated the coral mucus layer (see Figure
XXVIII for phylogenetic tree and Table 3 in Appendix for overview of closest matches).
Approximately 85% of the isolates associated to Corallimorphs sp. were discovered
during the first four weeks of the experiment were phylogenetically related to Vibrio
sp.. There was little diversity discovered associated to Corallimophs sp. One isolate is
found 99% similar to Lysinibacillus fusiformis and another one is 95% similar to
Photobacterium leiognathi. Presence of Lysinibacillus fusiformis is considered not
unusual as this species has been associated to antibiotic production (Pinchuk et al.
2002) for maintenance of coral host’s health as discussed in Trachyphyllia geoffroyi
phylogenetic studies. As for Photobacterium leiognathi, this species is also known as
coral-associated commensal bacteria (Krediet et al. 2009; Ritchie 2006).
Among the Vibrio sp. discovered associated to Corallimophs sp. during the control
experiment weeks were isolates related to V. rotiferianus, V harveyi, V. alginolyticus, V.
parahaemolyticus, V. azureus and V, owensii. Since these Vibrio sp. are categorised
under the Vibrio core group, it has the same observation as the investigation of
bacteria community associated to the Brazilian coral Mussismilia hispida which also
stated the dominance of Vibrio sp. even when the coral host was in healthy state
(Chimetto et al. 2009). Since during the presence of these Vibrio sp. the health
condition of Corallimorphs sp. is favourable, we can conclude that these Vibrio sp. are
in a non-virulent state for the beginning of the experiment despite their abundance.
![Page 88: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/88.jpg)
P a g e | 75
![Page 89: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/89.jpg)
P a g e | 76
Figure XXVIII: 16S rRNA Phylogenetic Tree representing bacterial sequences found in
Corallimorphs sp. (Mushroom coral).The phylogenetic tree was generated with
distance methods, and sequence distances were estimated with the neighbour-joining
method. Bootstrap values ≥50 are shown and the scale bar represents a difference of
0.05 substitution per site. Accession numbers for the reference sequences are
indicated.
3.1.4 Diversity of Coral Mucus-Associated Bacteria
This study is the first report of coral mucus-associated bacteria isolated from corals
Euphyllia ancora and Trachyphyllia geoffroyi. Limited scientific papers have been
published on bacteria interactions with genus Euphyllia. Only two evaluations of
bacterial association with coral genuses Trachyphyllia and Euphyllia (Vob, Larrieu &
Wells 2013) respectively have been made but with emphasis on green fluorescent
protein and its isolation. No studies could be found on the characterisation of mucus-
associated bacteria with the host coral Trachyphyllia geofroyyi.
In addition, based on phylogenetic trees in Figure Figures XXVI, XVII and XXVIII, our
results show the first and successful isolation of an isolate related to Vibrio azureus
from the mucus of Euphyllia ancora and Corralimorphs sp.. Chimetto et al. (2011) are
the only previous study that found V. azureus to be associated with Mussismilia
hispida, which is a coral native to Brazil (Chimetto et al. 2011).
V. azureus differ from related Vibrio species in the utilization of starch and other
complex carbohydrates. Hence current research focuses on unique enzymes which can
only be isolated from this Vibrio strain. Another successful and first isolation from the
mucus of coral Trachyphyllia geofroyyi, Euphyllia ancora and Corallimorph sp. is Vibrio
communis, a novel Vibrio species isolated in 2011. In the previous study, Vibrio
communis sp. was also linked with marine corals (Chimetto et al. 2011).
Many microbes identified in the mucus layer are not only comprised of the actual
‘residents’ or mutualist of the coral hosts but they can be also the ‘visitors’ which
consist of commensal organisms that do not bring any benefit or harm to the hosts.
![Page 90: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/90.jpg)
P a g e | 77
These microbes could also be potential opportunistic pathogens when they are
exposed to the right condition for their proliferation.
Due to the fact that diversity indices provide more information than simply the
number of species present (i.e., they account for some species being rare and others
being common), they serve as valuable tools that enable biologists to quantify diversity
in a community and describe its numerical structure.
Diversity indices were calculated by using sequence data of isolates obtained from the
coral mucus of all three corals. Isolates which showed >97% sequence similarity were
clustered into OTUs after normalization of sample sizes in order to directly compare
individual corals. Table H shows the diversity indices obtained.
Figures that are underlined and in blue font indicate the highest values of biodiversity
for Shannon Index and Smith and Wilson evenness indices methods. Both the highest
biodiversity values appear to be under Euphyllia ancora.
Table H: Indices used to quantify the diversity of 3 selected corals’ mucus layer
associated bacterial communities.
Genus Trachyphyllia
geoffroyi.
Euphyllia
ancora
Corallimorph
s sp.
Total isolates (N) 17 19 15
Total genus (S) 4 4 3
Margalef index (DMg) 10.57 11.73 10.20
Shannon index (H’) 0.66 0.95 0.62
Shannon evenness (J’) 0.82 0.34 0.46
Smith and Wilson evenness (Evar) 1.87 3.57 2.20
*Formulae of diversity indices are from(Margalef 1958; Shannon-Weaver 1963; Smith
& Wilson 1996)
![Page 91: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/91.jpg)
P a g e | 78
Based on the indices values, it can be concluded that all three corals has approximately
similar diverse community associated to their mucus layer (DMg of Trachyphyllia
geoffroyi = 10.57, Euphyllia ancora = 11.33 and Corallimorphs sp. = 10.20). The limited
findings of species diversity for this research study could possibly be due to the choice
of coral samples as different coral samples would yield different result findings. These
three selected corals’ mucus layer associated bacteria community were never studied
by other researchers before in terms of its coral mucus layer associated bacteria
community and thus, no comparison can be made.
Differences between the diversities of the three coral samples bacterial diversity were
still evident though as the values of the Shannon Index, Shannon evenness and Smith
and Wilson evenness values are quite varied (see Table I). The calculated bacterial
indices show that diversity and evenness of the bacterial community associated to
Euphyllia ancora coral mucus layer are much higher than the Trachyphyllia geoffroyi
and Euphyllia ancora. corals (shown by the highest value for Evar and DMg in Table H.
In order to understand the mechanism of the coral-associated bacteria community in
more detail, enzyme assay have also been carried out. Corals are generally harboured
by bacteria that produce enzymes which have ability to overcome toxic effects of
reactive oxygen species (ROS) which includes superoxide dismutase (SOD) and catalase
as well as amylase and many more other enzymes that aid In coral’s and their own
survival (Munn, Marchant & Moody 2008b). These assays are important to investigate
whether the coral-associated bacteria community contains enzymes that contribute or
harm the health and survival of Trachyphyllia geoffroyi, Euphyllia ancora. and
Corallimorphs sp. The amylase assay for example was carried out to identify if coral-
associated bacteria are involved in degrading carbon sources into glucose to provide
the coral hosts with food source. Although many coral-associated bacteria function are
still not widely known, there are studies that show certain bacteria provide food
source to the coral hosts either directly or indirectly ( Environmental Protection Agency
![Page 92: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/92.jpg)
P a g e | 79
United States 2007). Based on our results, among the total 104 isolates tested, only 12
isolates produced amylase (Table I, J and K).
Table I : Results of Corallimorphs sp. after testing for their enzyme assays
STRAIN ID Amylase Gelatinase Caseinase Phospholipa
se
MH
WK4 (1)
Unidentified YES
(STRONG)
YES NO YES
MH
WK4 (4)
Vibrio harveyi YES NO NO NO
MH
WK8 (2)
Pseudoalteromonas
prydensis
YES YES NO YES
MH
WK8 (5)
Vibrio harveyi YES NO YES NO
Bacillus subtilis is widely used to produce enzymes such as amylase, protease , inosine,
ribosides and amino acids ( Environmental Protection Agency United States, 2007). In
addition, B. subtilis also known to produce a variety of proteases and other enzymes
that enables it to degrade a variety of natural substrates and contribute to nutrient
cycling ( Environmental Protection Agency United States, 2007). From the data finding
regarding Bacillus subtilis, we know that Bacillus sp. contains amylase that will function
in degrading carbon sources such as starch into glucose. A bacterium identified
associated with Trachyphyllia geoffroyi as Bacillus cereus via phylogenetic analysis was
found to have positive result when tested for amylase assay. Hence, the result data
correlates with the journal that also stated Bacillus sp. possesses amylase. This Bacillus
sp. strain discovered during Week 8 of the experiment in Trachyphyllia geoffroyi could
be contributing in supplying Trachyphyllia geoffroyi with food sources (glucose) for the
![Page 93: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/93.jpg)
P a g e | 80
coral host survival. However, this isolate does not show any positive results for other
enzyme assays tested in this study.
Table J: Results of Euphyllia ancora after testing for their enzyme assays
STRAIN ID Amylase Gelatinase Caseinase Phospholipa
se
HM
WK4 (3)
Unidentified YES NO NO NO
HM
WK4 (5)
Pseudoalteromas
rubra
YES
(WEAK)
NO NO NO
HM
WK4 (6)
Unidentified YES
(WEAK)
NO NO YES
HM
WK8 (1)
Unidentified YES
(WEAK)
NO NO NO
HM
WK8 (5)
Unidentified YES
(STRONG)
NO NO NO
HM
WK8 (8)
Unidentified NO NO YES NO
Other than Bacillus cereus, isolates with phylogenetic similarity with Chromahalobacter
salaxigens were also discovered to yield positive result when tested with amylase
assay. This result showed that C. salaxigens play a role in contributing food sources by
breaking down carbon sources to glucose for Trachyphyllia geoffroyi survival.
However, the data finding did not correlate with an article (Arahal et al. 2001) which
discovered that C. salaxigen is catalase- positive, oxidase-negative, caseinase-positive
![Page 94: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/94.jpg)
P a g e | 81
and amylase negative (does not hydrolysed starch into glucose) (Arahal et al. 2001).
Based on our result finding, C. salaxigens found in Trachyphyllia geoffroyi was found to
be casein-negative. It was only found to be amylase-positive while the other enzyme
assays tested results were negative.
Table K: Results Trachyphyllia geoffroyi after testing for their enzyme assays
STRAIN ID Amylase Gelatinase Caseinase Phospholipa
se
BR WK4
(1)
Chromahalobacter
salaxigens
YES
(WEAK)
NO NO NO
BR WK4
(2)
Unidentified NO NO NO NO
BR WK4
(3)
Unidentified YES YES NO YES
BR WK8
(3)
Unidentified NO NO YES NO
BR WK8
(4)
Bacillus cereus YES NO NO NO
BR WK8
(6)
Unidentified NO NO YES NO
For isolates discovered in Euphyllia ancora mucus layer, identified isolate strain which
is the Pseudoalteromonas rubra found in Euphyllia ancora during Week 4 (control
experimental week) only shows positive result for amylase assay. The rest of the
enzyme assay tested was negative. Based on a study that stated Pseudoalteromonas
![Page 95: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/95.jpg)
P a g e | 82
sp. utilized glucose oxidatively and hydrolysed starch (Lee et al. 2010), it is reasonable
to conclude that Pseudoalteromonas sp. plays a role in degrading carbon sources to
glucose for coral host’s growth and maintenance. Besides being amylase-positive,
Pseudoalteromonas sp. strain discovered to be associated with Corallimorphs sp. is
also found to be gelatinase and phospholipase positive. However, it is not caseinase
positive in this study. This result correlated well with Lee et. al. (2010) as they also
stated that the Pseudoalteromonas sp. strain tested appeared to be gelatinase and
lipase positive while catalase was negative. Gelatinase enzyme found in
Pseudoalteromonas sp. plays an important role as proteolytic enzyme that hydrolysed
gelatin into its sub-compound such as polypeptides, peptides and amino acids so that
the compounds can cross the cell membrane and be utilized by itself and also
Trachyphyllia geoffroyi for growth and maintenance (Lee et al. 2010). As for
phospholipase enzyme, Pseudoalteromonas sp. would utilize them to hydrolysed
phospholipids intro fatty acids and other lipophilic substances. A novel extracellular
phospholipase C was discovered from a marine bacterium, Pseudoalteromonas sp.
J937 (Mo, Kim & Cho 2009), which showed the potential of Pseudoalteromonas sp. in
secreting phospholipase enzyme. Generally, coral mucus layer consists of polymers of
mixed origin (Krediet et al. 2009) and glycoprotein is the major component for soft and
hard corals (Meikle, Richards & Yellowlees 1987, 1988; Molchanova et al. 1985). One
of the components in glycoproteins are lipids (Krediet et al. 2009). Therefore,
Pseudoalteromonas sp. could secrete phospholipase enzymes which will contribute in
breaking phospholipids down into smaller units which is used by Trachyphyllia
geoffroyi to construct its mucus layer.
Another isolate discovered to be amylase-positive and caseinase-positive was an
isolate related to Vibrio harveyi. However, this isolate yielded negative result for
enzyme assays for gelatinase and phospholipase. This isolate was discovered in week 8
of the experiment where temperature surrounding Corallimorphs sp. was high. Based
on a study on virulence of Vibrio to Artemia nauplii, the Vibrio harveyi strains tested
were able to hydrolyse glucose, produce phospholipase and gelatinase (Lee 1995). This
data finding does not correlate with our data as we did not discover positive results for
phospholipase and gelatinase assay. The differences could be due to the fact that the
![Page 96: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/96.jpg)
P a g e | 83
Vibrio strains were obtained from different areas and therefore, exhibit different
properties.
As for isolates discovered in Corallimorphs sp., one of the isolates identified as Vibrio
harveyi (discovered during week 4 of the experiment), showed positive results for
amylase test only. Vibrio are known to be able to function as corals symbionts
(providing nutrients for coral’s survival) or opportunistic pathogens when they turn
virulent due to environmental factors (Chimetto et al. 2009). In this scenario, Vibrio
harveyi could be concluded as playing a role as coral symbiont in terms of contributing
to nutrient cycling by breaking down carbon sources into glucose for Corallimorphs sp.
There are not many studies on enzymatic properties of Vibrio sp. Some other studies
include the discovery that V. communis and is catalase and oxidase positive (Chimetto
et al. 2011) which has similar result with another paper investigating Vibrio azureus
which is also classified as oxidase-positive and catalase-positive (Yoshizawa et al.
2009). These findings could indicate that many Vibrio sp. yield similar enzymatic assay
results.
To sum up, every bacterial strain associated to the coral species are seen to have
different enzymatic properties. The enzymes produced such as amylase are important
for the coral host and the bacterial isolate itself sustainability of their growth and
health.
![Page 97: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/97.jpg)
P a g e | 84
CHAPTER 4
4 Shift in Bacterial Communities of Coral Mucus-Associated
Bacteria
4.1 Introduction on Bacterial Communities Shifting
Reef-building corals have a narrow range of thermal tolerance, making them extremely
susceptible to temperature stress and outbreaks of coral diseases, whereby the
immunity of corals decrease (Baker, Glynn & Riegl 2008). This makes the corals more
vulnerable towards pathogens that are more virulent, especially at higher
temperatures (Goreau & Hayes 2008). The coral surface mucus layer (SML) contains a
complex microbial community that respond to such changes in the environment
(Ritchie & Smith 2004). The normal microbial flora within the SML can protect the coral
against pathogen invasion and disturbances which may have led to coral diseases
(Sutherland, Porter & Torres 2004). On average, 20-30 % of bacterial isolates
originating from coral SML possess antibacterial properties (Ritchie 2006) that may
assist the coral’s survival. Elevated seawater temperature of 1-3°C above with increase
solar irradiance can result in large scale of coral bleaching (Brown 1997; Klaus et al.
2007). Bleaching normally caused the corals to be susceptible to diseases and previous
studies have demonstrated shift in the microbial populations of diseased corals
(Cooney et al. 2002).
Generally, the chemical nature and quantity of mucus can change when corals are
exposed to environmental stresses (Ritchie & Smith 1995), which in the end changes
the coral mucus layer’s environment. Changes in the coral mucus layer will therefore
affect the survival of the coral-mucus associated bacteria. Also, the differences among
the bacterial community found among the three selected corals can be explained by
the fact that the biochemical composition of the coral mucus layer differ among
different species. Hence, it results in different populations of coral associated
microorganisms among different coral types (Ritchie & Smith 1995). Changes in
environmental conditions will alter the coral host physiology which leads to variable
microbiota. For instance, since coral mucus is an important carbon source to coral-
![Page 98: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/98.jpg)
P a g e | 85
associated bacteria (Ferrier-Pages et al. 1998), the changes in the mucus secretion rate
and amount due to abiotic factors changes (eg. temperature and carbon dioxide
content changes) could also lead to shift in the bacteria community of the coral mucus
layer (La Barre 2011). Thurber et. al. (2009)demonstrated that elevation in seawater
temperature shifted the microbial community of Porites compressa to a more disease-
associated state which means the number of genes encoding the virulence pathways
and abundance of ribosomal sequences associated with diseased organism is greater
(Thurber et al. 2008). For most coral diseases, the growth rates and/or virulence
pathogens are temperature dependent (Alker, Smith & Kim 2001). To sum up, the
increase in seawater temperature could potentially shift the coral-associated microbial
assemblages by selecting for more pathogenic taxanomy (La Barre 2011). Infectious
diseases may be a major cause of biodiversity loss and change in bacterial species
distribution in the context of predicted climate warming (Bally & Garrabou 2007;
Harvell et al. 2002).
As discussed earlier, molecular fingerprinting methods such as DGGE and RISA are
helpful to monitor changes over time and have hence been used for this study. The
ARISA analysis showed shifting of banding patterns indicating changes in the bacterial
community when the selected corals are exposed to different environmental
conditions (Figure XXIV). According to ARISA gel results, it demonstrated that thermal
stresses and carbon dioxide content changes can result in shift in coral-associated
bacterial community which led to deteriorating coral health and mortality. Based on
Figure XXIX that shows the gel images of ARISA analysis, there are significant changes
in the bacteria community species as indicated by the positioning of the gel bands
which each of them represent the bacteria isolates’ identity. There is a clear decrease
in band numbers from week 2 to week 7 to week 9. Unfortunately, the DNA bands
were not sequenced so no species identity could be derived.
Figure XXX shows the gel results obtained from DGGE analysis. The coral mucus layers
of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. show shifting in the
![Page 99: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/99.jpg)
P a g e | 86
bacterial community based on the changes of the bands positioning. These DGGE band
results confirmed ARISA results and were further analyzed PyElph software.
![Page 100: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/100.jpg)
P a g e | 87
Figure XXIX: ARISA analysis result to detect the bacteria community associated to
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. shifting pattern.
Week 2 Week 7 Week 9
DNA TR EU CO TR EU CO TR EU CO
LEGEND
TR TRACHIPHYLLIA GEOFFROYI.
EU EUPHYLLIA ANCORA
CO CORALLIMORPHS SP.
![Page 101: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/101.jpg)
P a g e | 88
Figure XXX: DGGE Analysis Gel Result detect the bacteria community associated to
Trachyphyllia geoffroyi, Euphyllia ancor. and Corallimorphs sp. shifting pattern.
LEGEND
TR TRACHYPHYLLIA
GEOFFROYI
EU EUPHYLLIA ANCORA
CO CORALLIMORPHS SP.
TR EU CO TR EU CO TR EU
Week 2 Week 7 Week 9
![Page 102: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/102.jpg)
P a g e | 89
Based on the gel image of the DGGE analysis, a complete linkage agglomeration tree or
also known as furthest neighbour sorting was calculated (Figure XXX). In this method,
proposed by Sorensen (1948), the fusion of two clusters depends on the most distant
pair of objects instead of the closest (Sørensen 1948). Thus, an isolate joins a cluster
only when it is linked to the all the other isolates that are already members of the
same cluster. Two clusters can only fuse when all isolates of the first are linked to
isolates of the second and vice-versa.
Figure XXXI: Complete linkage agglomeration tree with genetic distances calculated
using PyElph software analysis tool.
According to Figure XXXI, the bacterial communities from week 2 of all three corals
(Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.) were all grouped in
the same cluster. Some was true for communities from week 7 and week 9 (CO2), thus
supporting the observed shifts in community structures (DDGE, RISA) and highlighting
![Page 103: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/103.jpg)
P a g e | 90
the significant differences of the bacterial communties isoalted under different
conditions. The same analysis was repeated using the Unweighted Pair-Group Method
(UPGMA; Figure XLVII). It is also called the “average linkage” (Sneath & Sokal 1973) and
in this method, the lowerst distance (or highest similarity) identifies the next cluster to
be formed. This method computes the arithmetic average of the distance between a
candidate isolate and each of the cluster members between all members of two
clusters. All isolates of bacteria receive equal weights in the computation.
Figure XXXIII: UPGMA tree with genetic distances calculated using PyElph software
analysis tool.
Both methods produced the same distinction between the microbial communities.
Based on Tables L, M and N, the values of Margalef index (DMG) for all three coral
species (Trachyphyllia geoffroyi, Corallimorphs sp. and Euphyllia ancora) shows that
the values are highest on the first four weeks (Week 1-4), indicating a high biodiversity
of bacteria when the corals are exposed to normal seawater temperature of 25°C.
![Page 104: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/104.jpg)
P a g e | 91
Table L: Indices used to quantify the diversity of Trachyphyllia geoffroyi mucus layer
associated bacterial communities
Genus Week 1-4 Week 5-6 Week 7-8 Week 9
Total isolates (N) 17 9 9 1
Total genus (S) 4 3 3 1
Margalef index (DMg) 10.57 7.33 6.29 0
Shannon index (H’) 0.66 1.06 0.85 0
Shannon evenness (J’) 0.82 1.06 0.63 0
Smith and Wilson evenness (Evar) 1.87 2.47 2.71 1
*Formulae of diversity indices are from Margalef (1958), Shannon & Weaver (1963)
and Smith & Wilson (1996)
Table M: Indices used to quantify the diversity of Euphyllia ancora corals’ mucus layer
associated bacterial communities
Genus Week 1-4 Week 5-6 Week 7-8 Week 9
Total isolates (N) 19 9 4 4
Total genus (S) 4 5 2 2
Margalef index (DMg) 11.73 5.4 8.3 6.65
Shannon index (H’) 0.95 1.00 0.56 0.56
Shannon evenness (J’) 0.34 0.56 0.20 0.20
Smith and Wilson evenness (Evar) 3.57 3.99 2.99 1.99
*Formulae of diversity indices
![Page 105: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/105.jpg)
P a g e | 92
Table N: Indices used to quantify the diversity of Corallimorphs sp. corals’ mucus layer
associated bacterial communities
Genus Week 1-4 Week 5-6 Week 7-8 Week 9
Total isolates (N) 15 10 12 1
Total genus (S) 3 3 2 1
Margalef index (DMg) 10.20 7.00 9.27 0
Shannon index (H’) 0.62 1.03 0.68 0
Shannon evenness (J’) 0.46 1.01 0.39 0
Smith and Wilson evenness (Evar) 2.20 2.38 1.89 1
*Formulae of diversity indices
However, it is also observed that Corallimorphs sp. and Euphyllia ancora mucus
samples’ H’, J’ and EVAR values show the same pattern as they have gradual decrease in
the EVAR values starting from Week 5-6 to Week 9. These indicate the decrease in
biodiversity of bacteria in both Corallimorphs sp. and Euphyllia ancora when their
environmental temperature starts increasing from 27°C to 30°C. All three corals
species mucus samples show increment int the EVAR values from Week 1-4 to Week 5-6
indicating the increment in the biodiversity of the bacteria group when the corals are
exposed to temperature increment from 25°C to 27°C. The H’ and J’ values for all three
corals are at the highest when the corals are exposed to 27°C (Week5-6) indicating
wide range of diversity. All three corals have the lowest amount of values for all the
indices calculated in week 9 as the diversity of bacteria decreases when the corals are
exposed to both elevated temperature and carbon dioxide content.
In the following, we discuss shifts in microbial communities associated with the mucus
layer in more detail for each coral tested.
![Page 106: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/106.jpg)
P a g e | 93
4.2 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Trachyphyllia geoffroyi
4.2.1 Week 5 to Week 6 for Trachyphyllia geoffroyi
On week 5 of the experiment when Trachyphyllia geoffroyi surrounding temperature
were increased to 27°C, there were diverse groups of bacteria identified. There were
isolates that are phylogenetically identical to Bacillus sp. such as to reference strains of
Bacillus thuringiensis (99%), Lysinibacillus boronitolerans (99%) and Lysinibacillus
fusiformis (97%; Figure XXXIX and Table 1, Appendix). Lysinibacillus sp. isolates are
discovered in this stage of the experiment where it was observed that Trachyphyllia
geoffroyi started to secrete more mucus secretions. It could be possible that during
this stage which Trachyphyllia geoffroyi started to undergo thermal stress that Bacillus
sp. present are also secreting antibiotic protection to protect the coral host from
pathogenic infections. There were no papers found that stated about the virulence of
this bacteria species when they are exposed to different environmental condition
except that they turned dormant when they are exposed to extreme environment such
as heat, UV and chemicals (Abideen & Babuselvam 2014).
Besides Bacillus sp., Pseudoalteromonas sp. strains were also discovered during week 5
of the experiment in Trachyphyllia geoffroyi mucus layer. The isolates were 95%
identical with the reference strain of P. plecoglossicida in Genbank analysis. It is
common to find P.plecoglossicida from Trachyphyllia geoffroyi because there was also
study that found P. plecoglossicida is one of the bacteria-associated with the
Caribbean coral Montastraea franksi (also a scleractianian coral) (Rohwer et al. 2001).
Moreover, there were also isolates phylogenetically related to Vibrio sp. discovered
during Week 5 of the experiment that are associated to Trachyphyllia geoffroyi. The
isolates are phylogenetically similar to the reference strains of V. persian (99%) and V.
owensii (100%). Vibrio persian and V. owensii are classified under the Vibrio core group
and these strains are also abundantly found associated to the mucus layer of Brazillian
![Page 107: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/107.jpg)
P a g e | 94
coral Musssismilia hispida and were also categorised as the dominant species
(Chimetto et al. 2009). This finding shows that it is reasonable to discover the
continuous presence of Vibrio sp. especially the core groups throughout the
experimental weeks as they are also found to be abundant in other coral species as
mentioned (Chimetto et al. 2009).
4.2.2 Week 7 to Week 8 for Trachyphyllia geoffroyi
In week 8 where the coral’s surrounding temperature were elevated, one of the
isolates derived from Trachyphyllia geoffroyi has 99%similarity with the reference
strain of Bacillus subtilis. B. subtilis is generally known for possessing antagonistic
activities against numerous bacterial and also fungal pathogens (Logan 1988; Mazza
1994; Walker, Powell & Seddon 1998). Besides, this species is also known for its use as
biocontrol and probiotic agents for the treatment of different plants and animal
infections (Krebs et al. 1998). Isocoumarins compound is a type of antibiotic which was
discovered in B. subtilis and this compound exhibits specific UV absorption properties
(Kinder, Kopf & Margaretha 2000; Krohn et al. 1997; Schwebel & Margaretha 2000). To
be more specific, the antibiotic compounds found in B. subtilis are known as
amicoumacins A, B and C which belong to the Isocoumarins antibiotic family.
Amicoumacins A. B and C possess antibacterial, anti-inflammatory and anti-ulcer
activity (Itoh et al. 1981; Itoh et al. 1982). Since B. subtilis is a potential strain well-
known for producing antibiotic compounds, it is interesting that the strain similar to
this species was derived when Trachyphyllia geoffroyi is undergoing bleaching and
health deterioration as the seawater temperature was 29°C high. For theoretical
explanation, one possible reason for the occurence of B. subtilis strain during high
seawater temperature could be due to the fact that this bacteria species is trying to
secrete antibiotic compounds to kill the potential coral pathogens that will further
harm Trachyphyllia geoffroyi. Another valid explanation to explain the existing of B.
subtilis during week 8 where Trachyphyllia geoffroyi is exposed to extreme
environment (thermal stress) is that this bacterium might have produced an
endospore that allows it to endure extreme conditions of heat in the environment (
Environmental Protection Agency United States, 2007). Although this species synthesises a
![Page 108: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/108.jpg)
P a g e | 95
variety of proteases and enzymes that contribute to nutrient cycling of the coral host,
it normally exist in a non-biologically active state which is in the spore form (Alexander
1977).Therefore, its presence in week 8 might be in an endospore form which did not
contribute in secreting any antibacterial compounds to protect the invasion of
opporturnistic pathogens which hence, making Trachyphyllia geoffroyi susceptible to
bleaching and eventually leading to mortality.
Other than B. subtilis, another strain identical to reference strain of B. cereus was also
found to be associated to Trachyphyllia geoffroyi mucus layer in week 7 and 8. Recent
studies discovered that strains of B. subtilis and B cereus are one of the common
inhabitants of the Pacific Ocean habitat (Pinchuk et al. 2002) and in fact they were also
reported to be have been detected in marine environments among other numerous
Bacillus species (Pinchuk et al. 2002).
Another strain isolated in week 8 was related to Oceanobacillus sp. with 88% of
similarity. Oceanobacillus sp. is known to be an extreme halotolerant and alkaliphilic
bacterium and it is gram positive (Lu, Nogi & Takami 2001). Its presence and potential
impact on the coral is uncertain and warrants further investigations. Its low match
percentage also indicates that it might be a novel species.
A bacteria strain related to Chromahalobacter salaxigens (99% similarity) was also
discovered in week 8. Since it is a halophilic bacteria, this bacteria is able to survive in
extreme environmental conditions which is environment with high salinity. However, it
is interesting to discover that C. salaxigens is also able to survive in high temperature.
A potential role for this isolate might be in the breakdown of amylase (see chapter
5.1).
4.2.3 Week 9 for Trachyphyllia geoffroyi
For week 11 when Trachyphyllia geoffroyi is exposed to extreme environmental
condition with increment of maximum temperature up to 29°C and approximately
![Page 109: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/109.jpg)
P a g e | 96
2500 ppm of carbon dioxide content, an isolate was found with 99% similarity to
reference strain Vibrio communis. Vibrio communis is commonly widespread in the
marine environment and they are gram-negative bacteria and is catalase and oxidase
positive (Soto-Rodriguez et al. 2003). Since strain related to V. communis is discovered
during the elevation of both temperature and carbon dioxide concentration of
Trachyphyllia geoffroyi surrounding, this data can correlate with a report that stated
that Vibrio sp. produced a photosynthetic inhibitor when there is elevation of
temperature which allow Vibrio sp to have a conducive environment to survive and
multiply (Rosenberg & Ben-Haim 2002; Sharon & Rosenberg 2008). This data can also
explain the existence of Vibrio harveyi in week 8 of the experiment during high
temperature elevation (29°C) when there is no elevation in carbon dioxide content of
Trachyphyllia geoffroyi surrounding yet. Besides, according to V. proteolyticus, the
inhibition of Vibrio’s growth inhibition in the mucus by zooxanthellae via producing
free radicals is no longer there when the mucus layer of Trachyphylia geoffroyi is
extracted from the coral host itself and therefore, allowing the growth of Vibrio sp.
throughout the experimental weeks ( not just week 8 and above). As mentioned earlier
regarding the finding that scleractinian corals produces damicornin compound which
has antibacterial property against several marine Vibrio sp. such as the core group
inclusive of V. communis (Mydlarz, Jones & Harvell 2006), scleractinian coral’s immune
defense is also said to be supressed in terms of their production when they are
exposed to pathogenic virulent Vibrios sp.. (Choquet et al. 2003; Labreuche et al.
2006a; Labreuche et al. 2006b). This statement could be used as a logical explanation
regarding the mortality of Trachyphyllia geoffroyi once the coral is exposed to extreme
high temperature combined with high carbon dioxide content on its surrounding as
Trachyphyllia geoffroyi could have lost its ability to synthesize its immune defense due
to the presence of V. communis.
![Page 110: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/110.jpg)
P a g e | 97
4.3 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Euphyllia ancora.
It was observed that there is more diversity of bacteria species when Euphyllia ancora
is exposed to 25°C (Week1 to 4). The diversity slowly decreases as temperature rised
up to 29°C which only Bacillus sp. is found. However, the diversity of bacteria increases
again in week 8 when there are presence of both Vibrio sp. and Bacillus sp. When the
coral is exposed to both increment of temperature and CO2 content, more Vibrio sp. is
found to be dominating the Euphyllia ancora mucus layer than the Bacillus sp.
4.3.1 Week 5 to Week 6 for Euphyllia ancora
When Euphyllia ancora was exposed to increment in temperature up to 27°C, data
obtained shows one of the isolates closely related to Shewanella sp. (99%). According
to (Godwin et al. 2012), Shewanella sp. was only detected in healthy coral tissues.
Thus, it is reasonable to discover Shewanella sp. related isolates at this period of the
experiment when the coral host is still in semi-healthy state as the bleaching process
just started to occur after this phase. Supporting this, Shewanella species were only
detected during this period of the experiment and no longer presents when the
surrounding temperature was increased up to 29°C (Figure XL). Interestingly,
Shewanella-related isolates were not discovered in the other two tested corals,
Trachyphyllia geoffroyi and Corallimorphs sp., potentially pointing towards a close
relationship with Euphyllia ancora.
During week 6 of the experiment, an isolate with 99% similarity to Bacillus cereus was
isolated in Euphyllia ancora this finding is similar to Trachyphyllia geoffroyi as B.cereus
was also identified associated to Trachyphyllia geoffroyi. during Week 6 of the
experiment. Therefore, the interpretation regarding the existence of this species could
be similar as both coral hosts are of same order (scleractinians). One of the bacterial
isolates associated with an endermic marine sponge, Arenosclera brasiliensis, is
phylogenetically identical to B. cereus and based on a study investigating its
![Page 111: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/111.jpg)
P a g e | 98
antimicrobial potential, B. cereus is said to have potential in producing antibiotic as the
strain showed inhibition against the growth of B. subtilis (Rua et al. 2014).
Many Vibrio sp. related isolates were also discovered in Euphyllia ancora mucus layer
in week 5. The isolates are mostly dominated by the Vibrio core group (V. harveyi, V.
owensii, V.alginolyticus, V. communis and V. campbelli). This data again correlates well
with the report by V. mediterranei which indicated that the Vibrio core group is
dominant in the mucus layer of Brazillian cnidarians. However, based on high Vibrio
colony counts and high proportion of different coral species in both healthy (Koren &
Rosenberg 2006) and diseased corals (Chimetto et al. 2008b; Weil, Smith & Gil-Agudelo
2006), some authors stated that high dominance of Vibrio sp. in coral mucus layer
could be an indication of an unhealthy environment (Chimetto et al. 2008a). As only
limited Bacillus sp. related strains and high abundance of Vibrio sp. were discovered
when Euphyllia ancora was exposed to higher temperatures (25 to 27°C), it could be an
indication that the environment is starting to get undesirable. Another supportive
observation would be that during this stage of the experiment, it was observed that
Euphyllia ancora started to produce less mucus secretions as it started to get more
difficult to extract Euphyllia ancora mucus for investigation purpose. One of the
isolates discovered during Week 5 is 97% similar to V. alginolyticus which is one of the
most well-known coral pathogens (Cervino et al. 2008; Chimetto et al. 2008a) and
therefore, making the interpretation more valid.
4.3.2 Week 7 to Week 8 for Euphyllia ancora
As the surrounding temperature of Euphyllia ancora rised up to 29°C, it is interesting to
discover the re-occurrence of Bacillus sp. such as isolates similar to reference strains B.
thuringiensis (99%) and B. cereus (95%). The occurrence of Bacillus sp. could be due to
their ability to produce endospores, as previously discussed under Trachyphyllia
geoffroyi. Bacillus sp. discovered could be present in order to defend Euphyllia ancora
by producing antibiotic from pathogens.
![Page 112: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/112.jpg)
P a g e | 99
The abundance of Vibrio sp. detected declined and only one of the isolates discovered
was 95% similar to V. owensii. The decrease in the abundance of Vibrio sp. could be
due to PCR error as in less isolates were successfully been sequenced for their
identities due to laboratory errors when retrieving data. This study cannot conclusively
rule out that PCR bias may contribute to these findings of species replacements.
4.3.3 Week 9 for Euphyllia ancora
In week 9 of the experiment, Euphyllia ancora died after exposure to extreme
temperature and carbon dioxide content (29°C and approximately 2500 ppm). All the
isolates discovered during this period were phylogenetically related to Vibrio species
such as V. azureus (99%) and V. neocalledonicus (99%). There was a dramatic shift from
isolates with more Bacillus sp. related strains in week 7-8 to only Vibrio sp. related
strains in week 9. This observation is similar to a report which also showed the same
pattern of bacteria community distributions where S. pistillata and A. hyacinthus
associated bacteria switched to a community dominated by Vibrio sp. when the corals
are exposed to high temperature surroundings (Kvennefors et al. 2010). It is also
evident that various Vibrio sp. are well-known to be coral pathogens (Cervino et al.
2008; Sussman et al. 2008). A similar pattern of bacterial community shift was
observerd in Acropora millepora; from α-Proteobacteria to Vibrio sp. when the coral
host started to experience bleaching (Kvennefors et al. 2010).
![Page 113: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/113.jpg)
P a g e | 100
4.4 Shifts in Bacterial Community Associated to Coral Mucus Layer of
Corallimorphs sp.
4.4.1 Week 5 to Week 6 for Corallimorphs sp.
In week 5 and 6, isolates with 99% similarity to Lysinibacillus fusiformis were identified.
This species is well-known for their antimicrobial properties as mentioned under
Trachyphyllia geoffroyi’s coral’s sections. In the study by Abideen et. al. (2014), isolates
with phylogenetic identity similar to reference strain of Lysinibacillus fusiformis
presented a high inhibition zone against Streptococcus pneumonia which is another
evidence that this species exhibit antimicrobial properties (Abideen & Babuselvam
2014).
Pseudoalteromonas sp. genus is generally known for their antibacterial properties as
they produce a wide range of bioactive compounds (Bowman 2007). Generally,
Pseudoalteromonas sp. is found in both healthy (Kellogg 2004; Koren & Rosenberg
2006; Kushmaro et al. 1997; Nissimov, Rosenberg & Munn 2009; Wegley et al. 2004;
Wilson et al. 2005) and diseased corals(Kushmaro et al. 1996). Therefore, the presence
of isolates related to P. prydensis (99%) and 86% to P. plecoglossicida are common in
Corallimorphs. sp. There are many studies related to testing the antibacterial activity
of Pseudoalteromonas sp. against coral-related gram positive and gram negative
bacteria (Shnit-Orland, Sivan & Kushmaro 2012). However, the results on the types of
bacteria that Pseudoalteromonas sp. can inhibit differs between different studies. For
example, coral mucus layer collected from stony corals originating from Gulf of Eilat
contained isolates related to Pseudoalteromonas sp. which only inhibited gram-
positive bacteria strains (Shnit-Orland, Sivan & Kushmaro 2012). As for another study,
Pseudoalteromonas sp. was reported to only have antibacterial activity against gram-
negative bacterial strains (Nissimov, Rosenberg & Munn 2009; Shnit-Orland, Sivan &
Kushmaro 2012). For this study, we could speculate that the isolates related to
Pseudoalteromonas sp. inhibited the gram negative bacteria such as the Vibrio sp. as
according to the phylogenetic tree of Corallimorphs sp., most Vibrio sp. were no longer
present after week 5 of the experiment. In week 6, 7 and 8, there was only one isolate
![Page 114: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/114.jpg)
P a g e | 101
found to be related to the Vibrio sp. genus. Therefore, it could be that
Pseudoalteromonas sp. had inhibited their growth during week 5 of the experiment.
4.4.2 Week 7 to Week 8 for Corallimorphs sp.
There is one isolate in week 7 that is 100% identical to Lysinibacillus fusiformis. During
week 7 where the elevation of coral surrounding temperature (27°C) is already above
the normal seawater temperature (25°C), this species could form dormant endospores
as it is resistant to heat and forming dormant endospores is its natural way of surviving
in harsh conditions (Abideen & Babuselvam 2014). These spores are said to be able to
remain viable for a longer time which explains its survival around Corallimorphs’
mucus layer despite the unfavourable high surrounding temperature. As stated before,
this bacterial species possesses antimicrobial activity and no study mentioned it
turning virulent towards corals, so it can be regarded as not the causative agent for the
deteriorating health condition of Corallimorphs at this stage (week 7 and week 8).
An isolate closely related to Desulfovubrio vullgaris (100%) was also detected in the
Corallimorphs sp. mucus layer when the coral is exposed to temperature up to 29°C
and according to Schnell et.al (1996), sulphate-reducing bacteria were discovered to
be part of the microbial community that contributes to induction of black band disease
in corals (Meron et al. 2011; Schnell, Assmus & Richardson 1996). However, Arboleda
and Reichardt (2009) found that these sulfate-reducing bacteria are also present in
healthy corals. In general, all living organism require sulphur for the synthesis of
proteins and essential cofactors and therefore, sulphur compounds are usually
assimilated by microbes for the biosynthesis of amino acids such as cysteine and
methionine (Arboleda & Reichardt 2009; Wegley et al. 2007). No black band disease
was observed and we hence assume that this isolate was not harmful to the coral.
In week 8 of the experiment where Corallimorphs sp. was exposed to temperature up
to 29°C, an isolate related to Pseudoalteromonas prydensis (99% similarity) was
discovered. This is interesting as another study found that Pseudomoalteromonas sp.
![Page 115: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/115.jpg)
P a g e | 102
wer able to survive in dead corals (Frias-Lopez et al. 2002). Therefore, it is reasonable
to discover this species during week 8 of the experiment.
One isolate that was discovered in Corallimorphs sp. mucus layer was similar to Vibrio
owensii (99%). According to an investigation in the Hawaii Reef Coral, Vibrio owensii
was found to be the main causative agent that induced the tissue loss disease which is
better known as Montipora white syndrome (MWS) in Montipora capitata (Vibrio
owensii). This finding is one good evident that Vibrio owensii is a potential coral
pathogen. Therefore, Vibrio owensii’s presence during high temperature exposure
(29°C) to Corallimorphs sp. that made the coral’s health decreased is not surprising as
they might be opportunistic pathogen that caused Corallimorphs sp.’ health to worsen
as they act as the opportunistic pathogen. Although in week 8 Corallimorphs sp. has
not undergone mortality yet, the health condition has already deteriorated (lack of
mucus secretion and some white discolouration spots on the coral tissues).
Besides the presence of isolates identical to V. owensii, isolates with similarities up to
95% with reference strains V. harveyi, were also found in week 8. It is found that Vibrio
harveyi and Vibrio alginolyticus function as nitrogen-fixing bacteria in the coral mucus
layer and they are discovered to even dominate the culturable nitrogen-fixing bacteria
of the Brazilian coral Mussismilia hispida (Klaus et al. 2007). In contrast, Vibrio harveyi
is also found to have caused vibrionic coral bleaching in the Mediterranean (Kushmaro
et. al. 2007). Vibrio harveyi sp. is only discovered in unhealthy coral host and not
discovered in healthy coral colonies (Klaus et al. 2007). This finding is contradict to our
finding as our study showed presence of isolates phylogenetically identical to V.
harveyi throughout the experiment even when Corallimorphs sp. is still in good health
condition. However, this statement regarding V. harveyi is closely related to the
unhealthy state of the coral at this point of time.
![Page 116: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/116.jpg)
P a g e | 103
4.4.3 Week 9 for Corallimorphs sp.
When Corallimorphs sp. was exposed to high surrounding temperature and carbon
dioxide content, the only isolate discovered during this period is related to Vibrio
communis (99%). This finding is similar to Trachyphyllia geoffroyi as V. communis was
also discovered in Trachyphyllia geoffroyi during week 8 of the experiment.
Trachyphyllia geoffroyi experienced extreme health deterioration and eventually
mortality, we could speculate that Vibrio communis strains discovered within the
corals are among the potential causative agents that contribute to the deteriorating
health of Corallimorphs sp. and Trachyphyllia geoffroyi.
4.5 Conclusion Bacterial Diversity Shifts in mucus layers of
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.
under temperature and CO2 stress
The shifting banding patterns observed using DGGE and RIASA can be correlated with
the finding by Cooney et. al. (2002) which stated that the community of coral-
associated bacteria will undergo changes in response to stress or disease (Cooney et al.
2002). Phylogenetic trees analysis also clearly indicated that there are obvious shifts in
the bacterial community when the corals are exposed to different impact of sudden
environmental changes such as the increment of temperature and carbon dioxide
content.
In general, Trachyphyllia geoffroyi and Euphyllia ancora experienced severe
deterioration of health and eventually mortalrty during the last week of the
experiment when they are exposed to extreme temperature and carbon dioxide
content. As for Corallimorphs sp., this coral also underwent health deterioration but
managed to survive after the whole experiment. Based on an investigation regarding
coral’s survival when they are exposed to extreme environmental condition, it is stated
that bleached coral reefs cannot survive very long unless conditions are changed back
to normal condition and the symbiosis between coral host and their associated
bacteria and zooxanthellae are re-established (Szmant & Gassman 1990). Therefore, it
is reasonable to conclude that in our experiment, the corals are exposed to
![Page 117: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/117.jpg)
P a g e | 104
unfavourable environmental condition for too long and too extreme for them to
recover back to their normal health conditions. It was also observed that the mortality
rate among the corals differed. Euphyllia ancora was observed to have undergone
mortality first then followed by Trachyphyllia geoffroyi This observation could be
explained by a report that stated different species of corals showed different
sensitivity to bleaching with variation between individual colonies of the same species.
Some coral species were said to have higher resistance to bleaching and health
deterioration such as Montipora capitata and Montipora patula (Szmant & Gassman
1990). Besides, the rate of recovery of the coral hosts is also stated to be related to
bleaching sensitivity (Szmant & Gassman 1990). From here, we could conclude that
Euphyllia ancora is the most sensitive to bleaching copared to Trachyphyllia geoffroyi
and Corallimorphs sp. in terms of its rate of bleaching and mortality.
In terms of bacterial community shifts, Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp. experienced decrease in the diversity of bacteria community after
Week 4 where the surrounding temperature rose from 25 to 27°C. This data correlates
well with other findings which also show reduction in microbial group numbers
compared to when the coral hosts were in healthy states (Kooperman et al. 2007;
Pantos et al. 2003).
In this study, Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. have the
same class of bacteria that generally dominates the corals species throughout the
experimental weeks which are ɤ-Proteobacteria and Firmicutes. However, when it
comes to the classification of the bacteria species via their genus, there are differences
of isolates’ identities when compared among the three corals. This shows that coral-
associated bacteria are species specific and there was an evident study that also
observed that coral-associated bacteria are species specific regardless of their
geographical location (Rohwer et 2001, UV).
According to 16s rRNA gene sequences, for Trachyphyllia geoffroyi, 23 of the isolates
are related to ɤ-Proteobacteria while as for Euphyllia ancora coral 27 of them are also
related to the ɤ-Proteobacteria family. Corallimorphs sp. coral has 21 also in relation
![Page 118: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/118.jpg)
P a g e | 105
with the family ɤ-Proteobacteria based on the bacteria references too. The results
show that ɤ-Proteobacteria is the dominant species for all three corals. The majority of
the isolates for all three corals are related to the Vibrio core group (Trachyphyllia
geoffroyi n= 18, Euphyllia ancora n=22 and Corallimorphs sp. n=21). This group also
appears to be dominant in other corals such as Montasstrea cavernosa from the
Caribbean (Frias-Lopez et al. 2002). According to Godwin and colleagues, based on
their culture based survey, they discovered that both healthy and Australian
Subtropical White Syndrome (ASWS) - affected Turbinaria mesenterina were
dominated by ɤ-Proteobacteria, in particular Vibrio species (Godwin et al. 2012). This
finding is also similar to our research data which shows the domination of ɤ-
Proteobacteria throughout the experiment. Shnit-Orland & Kusheuphyllmaro (2009)
also stated that Vibrio sp. associated with the coral mucus produce anti-bacterial
compounds against several pathogens, thereby protecting the coral host against
pathogens. This proves the potential of Vibrio as beneficial residential bacteria on the
coral mucus layer. This correlates with our data that shows Vibrio sp. dominance in the
Trachyphyllia geoffroyi, Euphylliaancora. and Corallimorphs sp.’ corals mucus layers
under control conditions.
The different roles played by Vibrio sp. such as coral mutualists and also coral
pathogens are due to the fact that they respond swiftly to changes in environmental
conditions. For example, when there is increase in temperature of seawater higher
than 25°C and in carbon-rich environments such as the coral mucus, the doubling time
of the Vibrio sp. growth rate may increase higher. When the corals are exposed to
stressful conditions such as high seawater temperature and high nutrient loads (high
concentration of dissolved ammonia, phosphate and organic matters), Vibrio sp. will
switch their roles to become opportunistic pathogens that will outcompete other
species present in the coral mucus (Chimetto et al. 2008a). These species will turn
virulence to the corals species to adapt with the surrounding environmental changes in
order to continue dominating and surviving in the corals. This statement explains why
there is domination of Vibrio sp. when the 3 selected corals in this study are exposed
to increment in both temperature and carbon dioxide content.
![Page 119: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/119.jpg)
P a g e | 106
Ritchie and Smith (1995;2004) had demonstrated that Vibrio sp. population increase
during the bleaching of coral species and when the coral experience recovery, the
amount of Vibrio sp. returned to previous normal level (Ritchie & Smith 1995, 2004).
As observed on our results. Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp. did not revived back to their normal healthy state as both
Trachyphyllia geoffroyi and Euphyllia ancora experienced immediate mortality while
Corallimorphs sp. no longer secretes mucus. Therefore, the corals tested did not
manage to recover after our experiment due to too sudden and extreme
environmental impact conditions.
As observed in the phylogenetic trees in Figure XXVI, XXVII and XXVIII no
Photobacterium sp. were isolated when the selected corals are exposed to higher
seawater temperatures for all three tested coral species. Photobacterium sp. was not
found in the Trachyphyllia geoffroyi but they were discovered in both Euphyllia ancora
and Corallimorphs sp.. Photobacterium sp. is only discovered in both Hammer and
Mushroom corals when they are in the first four weeks of the control experiment
when the corals are exposed to normal condition which means they are in healthy
states at that period of time. This results correlate with other journal finding which
also stated that no Photobacterium sp. strains were isolated from any part of T.
mesenterina colonies affected by disease as these isolates only present when the coral
host is still in healthy condition(Godwin et al. 2012).
Another dominant family related to Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp. are the Firmicutes (Trachyphyllia geoffroyi n= 18, Euphyllia ancora
n=22 and Corallimorphs sp. n=21). Based on the phylogenetic results, Bacillus sp. was
found in the Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. during
Week1 to Week 4 which was during the control weeks of the experiment. It is common
to discover the presence of Bacillus sp. when the corals are still in normal state of
health condition. This is due to the fact that Bacillus sp. (Weisenborn, Brown & Meyers
1984) play important roles in producing antibiotics and also functions as UV-absorbing
bacteria that contribute to the coral’s health. According to Ravindran et. al. (2013),
majority UV-absorbing bacteria belonged to the Firmicutes family (Ravindran et al.
![Page 120: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/120.jpg)
P a g e | 107
2013). However, it is also observed that Bacillus sp. dominates bacterial communities
in the mucus layers of Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp.
during week 6 and 7.
All the three corals exhibit the same bacterial community shifting phase pattern in this
study. This domination of Bacillus sp. over Vibrio sp. in the coral mucus layer indicates
an obvious bacterial community shift. This finding did not correlate with previous
studies as normally Bacillus sp. appears as beneficial bacteria instead of potential
pathogenic species that would dominate the corals mucus layer during increase in
seawater temperature (Shnit‐Orland & Kushmaro 2009). Ritchie (2006) also stated the
opposite statement with the current finding which is that thermal stresses would
cause the increase of Vibrio sp. as these species would replace the community of
beneficial bacteria instead of other species (Ritchie 2006). When the temperature rose
further to 29°C in week 8, the diversity of the bacterial community increased back as
the coral is not only dominated by Bacillus sp. but also the Vibrio sp. Then, the shift is
followed by domination of only the Vibrio sp. when all the three corals are exposed to
both elevation in temperature (30°C) and carbon dioxide content. This pattern is again
in agreement with Ritchie et al. (2006). It seems that Bacilli living in the coral mucus try
to fight off the infection but cannot sustain their defense under more extreme
conditions.
CHAPTER 5
5.1 Potential coral pathogens and phage therapy
This study investigates the feasibility of applying bacteriophage therapy to treat the
assumed potential coral pathogens such as the Vibrios sp. and Bacillus sp. isolated in
the tested corals during an increase in temperature and carbon dioxide content of
their surroundings. The study of bacteriophage is applied here in this study in order to
seek for potential bacteriophages that can inhibit the growth of potential coral marine
pathogen as this will help to reduce the deterioration of coral’s health. The worldwide
decline of coral reefs ecosystems due to their health deterioration has brought up the
![Page 121: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/121.jpg)
P a g e | 108
need to seek for tools and strategies to treat and control coral diseases. Antibiotics
were used as a way to treat the coral diseases but unfortunately, this method is not
applicable for long term. This is because of the general effects of antibiotic on bacteria
and the potential dangers of selection for antibiotic-resistant strains (Parisien et al.
2008). Besides, corals also do not possess an adaptive immune system (Nair et al.
2005). Therefore, another alternative should be applied instead and one of the most
suitable treatment is via phage therapy as it does not bring negative effects to the
coral hosts (Cohen et al. 2013). Bacteriophage plaque assay were carried out to
identify whether any of the selected bacteriophages samples collected from the
chicken dunk have the ability to cause plaques on the growth of the potential coral
pathogens.
5.2 Identification of potential coral pathogens
Since there is shift of bacteria community from more diverse population to only
dominating ones when temperature and carbon dioxide content increases, the isolates
that dominated the coral mucus layer in the later stages of the experiment are
expected to be potential coral pathogens. In this experiment, six (6) bacterial isolates
that are potential coral pathogens (based on analysis of experiment results and also
related journal regarding coral pathogens), were selected for the phage therapy assay.
The potential phages were isolated from chicken dunk samples and phage assay was
applied to investigate whether the potential phages can inhibit the growth of the
selected potential pathogens.
Potential coral pathogens derived from Trachyphyllia geoffroyi, Euphyllia ancora and
Corallimorphs sp. mucus layer were selected from isolates collected during Week 8
and also week 11 of the experimental period. The main reason is due to the fact that
Trachyphyllia geoffroyi, Euphyllia ancora and Corallimorphs sp. health condition only
started to show obvious deterioration and eventually mortality during week 8 of the
experiment. For Trachyphyllia geoffroyi, isolate identified as Vibrio harveyi (derived in
week 8) was selected because Vibrio sp. are well-known to be coral pathogens that
caused coral diseases (Cervino et al. 2008; Kvennefors et al. 2010; Sussman et al.
![Page 122: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/122.jpg)
P a g e | 109
2008). It could be concluded that since V. harveyi was discovered during the period
where Trachyphyllia geoffroyi. underwent severe bleaching; V. harveyi could be the
virulent causative agent that contribute to this. Therefore, V. harveyi strain was
selected for the phage assay to see whether their growth could be inhibited by
potential bacteriophages.
Besides, Bacillus cereus strain derived from Trachyphyllia geoffroyi during week 8 was
also selected for the phage assay. This isolate was selected due to that fact that there
was more Bacillus sp. found during week 8 of the experiment in Trachyphyllia geoffroyi
compared to Vibrio sp. It is very unlikely to discover more Bacillus sp. isolates than
Vibrio sp. during elevation of temperature surrounding coral species as most studies
found that Vibrio sp. are the dominating species when there is an increase in
temperature that caused adverse health condition to coral host (Kushmaro et al. 1996;
Ritchie et al. 1994; Sharon & Rosenberg 2008). The trend of the bacterial community
shifting in this study could be considered as the first to discover higher abundance of
Bacillus sp. genus than Vibrio sp. during temperature elevation around the coral host.
Although there was no scientific journal evidence that stated that Bacillus sp. could be
virulent to coral host, it could be possible that this study is the first to discover that
Bacillus strain found in Trachyphyllia geoffroyi during week 8 is virulent to the coral
host as during its presence and dominance, Trachyphyllia geoffroyi health were
deteriorating badly.
As for Euphyllia ancora, three (3) isolates were selected for bacteriophages assay
which are derived from week 8 (temperature up to 29°C) and week 11 (temperature
29°C coupled by increment in CO2) of the experiment. Similar to Trachyphyllia
geoffroyi, there were more Bacillus sp. found in Euphyllia ancora during week 8 of the
experiment compared to Vibrio sp. therefore, Bacillus sp. could be a potential virulent
organism that contribute to the deteriorating health of Euphyllia ancora during week 8
when there is elevation in temperature up to 29°C. Vibrio azureus strain from week 11
isolated from Euphyllia ancora mucus layer were selected as Vibrio azureus is known to
be one of the V. harveyi-related species that are associated with diseased aquatic
oprganisms (Gomez-Gil et al. 2004). During its presence, Euphyllia ancora experienced
death (removal of all polyps). Therefore, based on the journal finding and also
![Page 123: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/123.jpg)
P a g e | 110
experimental observation, V. azureus could be the potential causative agent that acted
as opportunistic pathogen which caused mortality to Euphyllia ancora. Another isolate
identified as V. neocalledonicus found in week 11 was also selected for phage assay for
similar reasons as V. azureus.
Only one isolate from Corallimorphs sp. mucus layer was selected for the phage assay
which was phylogenetically identified as Bacillus thuringiensis. This species is isolated
from Corallimorphs sp. during week 8 of the experiment where the coral host started
to experience less mucus secretion due to unfavourable environmental condition. B.
thuringiensis was selected as there were more Bacillus present compared to Vibrio sp.
during week 8 (similar to Trachyphyllia geoffroyi. and Euphyllia ancora bacterial shift
trend). Therefore, it could also be one of the potential coral pathogens that are
virulent to Corallimorphs sp.
The pathogenicity of these six (6) chosen isolates is not proven as no scientific
experimental procedures has been carried out to determine their pathogenicity factors
such as Koch postulates. Hence, there is a chance that these 6 isolates might not be
coral pathogens.
5.3 Results and Discussions for Bacteriophages Screening
Marine agar plates with selected bacterial isolates were used for phage assay. Each
isolate was analysed in duplicates for more accurate results. Each plate is divided into
5 sections with the 5 different isolated bacteriophages (labelled as A B C D E)
inoculated on top of the isolates on the plate. The isolates chosen were labelled as:
Isolate 1: Bacillus thuringiensis (derived from Corallimorphs.sp. during week 8)
Isolate 2: Vibrio harveyi (derived from Trachyphyllia geoffroyi during week 8)
Isolate 3: Vibrio azureus (derived from Euphyllia ancora during week 11)
Isolate 4: Vibrio neocalledonicus (derived from Euphyllia ancora during week 11)
Isolate 5: Bacillus cereus (derived from Trachyphyllia geoffroyi during week 8)
Isolate 6: Bacillus cereus (derived from Euphyllia ancora during week 8)
![Page 124: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/124.jpg)
P a g e | 111
Bacteriophages that were able to form plaques on the marine agar plates inoculated
with the potential coral pathogens isolates were regarded as being able to inhibit the
growth of the isolates. The results were observed and recorded as follows:
Figure XXXIII(a): Results of Bacteriophages Plaque Assay showing the activity of phage
C and E in forming plaques on the agar plates inoculated with the selected potential
coral pathogen isolates.
![Page 125: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/125.jpg)
P a g e | 112
Figure XXXIII (b): Results of Bacteriophages Plaque Assay showing the activity of phage
C and E in forming plaques on the agar plates inoculated with the selected potential
coral pathogen isolates.
![Page 126: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/126.jpg)
P a g e | 113
Figure XXXIII(c): Results of Bacteriophages Plaque Assay showing the activity of phage
B and C in forming plaques on the agar plates inoculated with the selected potential
coral pathogen isolates.
The formation of plaques show the inhibition of the growth of the selected potential
coral pathogens isolates tested in this experiment. Based on Figures XXXIII(a), XXXIII
(b) and XXXIII(c), it is observed that bacteriophages labelled C and E yield positive
results by causing plaques against all isolates. Despite the positive results, there are
major limitations to this experiment. Plaque assay alone cannot conclude that the
potential bacteriophages that inhibited the growth of the potential coral pathogens
and the selected coral pathogens are also not certified experimentally as real coral
pathogens unless Koch’s postulates studies is applied and been satisfied (Efrony et al.
2006). Despite the limitations, intitial were highly promising and phages type C and E
were analysed further for their identifications.
![Page 127: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/127.jpg)
P a g e | 114
Based on Figures XXIII and XXIV (methodology section), the gel results show the
success in amplifying the specific targeted genes of Phage C and E as they show clear
bands approximately of 500 to 600 bp. The results obtained show the potential of the
isolated bacteriophage to be a virus belonging to the family of cyanophages. However,
based on the BLAST result in NCBI, the reference sequence did not show any relation
to cyanophages. Instead, the reference sequence is related to the family of Inoviridae,
in particular the Enterobacterio phage M13 with phylogenetic similarity up to 96%
(accession number CP002824). Due to the complications in concentrating the viruses in
the marine water samples collected, bacteriophages isolated from other sources
(chicken dunk) were used instead. E.coli is the common host for the replication of
Enterobacterio phage M13 hand despite the high degree of host specificity; it seems to
be able to inhibit our potential coral pathogens.
It is definitely an interesting finding that both phages type C and E are closely related
to Enterobacterio phage M13 and they actually yield positive results in inhibiting the
selected potential coral pathogens growth in the phage plaque assay. There were no
studies found that shows the potential of phage M13 as potential phage that can
combat the growth of coral pathogens in the marine environment. These were only
studies related to utilizing phage M13 for technological purposes such as using it as a
viral gene delivery vehicle (Molenaar et al. 2002). Therefore, this finding could be the
first study to have identified Enterobacterio phage M13 ability in inhibiting the growth
of potential coral pathogens which are Bacillus thuringiensis, Vibrio harveyi, Vibrio
azureus, Bacillus cereus and Vibrio neocalledonicus.
![Page 128: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/128.jpg)
P a g e | 115
CHAPTER 6
Summary and Future Work
This study has presented (i) an overview of culturable bacterial communities of corals
mucus layers obtained from 3 coral samples (ii) the shift in the bacteria community
patterns when exposed to different environmental changes such as temperature and
carbon dioxide content (iii) the role of potential bacteriophage inhibiting the growth of
the potential extracted marine pathgens.
The present study showed the complexity of the coral holobiont and its response to
changes in extreme environmental conditions. It is also found that the microbial
community associated to the coral mucus layer and the surrounding environmental
conditions determined the coral’s general health and function. Therefore, it is
important to find out possible solutions to solve the deteriorating health of the coral
reefs that are due to environmental factors. Phage therapy is one of the most
desirable methods to counter the deteriorating health of corals caused by marine
pathogens as it is not harmful. The threats to coral reefs worldwide give new urgency
to understanding the nature of the relationships between healthy corals and their
associated microbes. Characterizing these organisms and documenting their patterns
of distribution, as what had been applied here, is an essential first step.
In order to gain more insights understanding of the bacterial community shifts for this
research the DGGE gel obtained should be excised, re-amplified and re-run on the
DGGE gel to ensure correct migration and purity of the product and identified via
sequencing (Bourne & Munn 2005a). Then, the bands should be submitted for
sequencing to identify the bacterial community species in order to see the changes of
the species community throughout the experiment clearly (Bourne et al. 2008). Other
than that, bacterial communities of the corals could also be analysed via
pyrosequencing (Wegley et al. 2007). Metagenomics analysis via pyrosequencing,
provides an opportunity to describe the taxonomic components (Tyson et al. 2004),
![Page 129: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/129.jpg)
P a g e | 116
relative abundances (Breitbart et al. 2002; Rodriguez-Brito, Rohwer & Edwards 2006)
and metabolic potential (Tringe et al. 2005) of all microbes within the coral holobiont.
Screening for secondary metabolite-producing bacteria associated with corals via 16S
rDNA approach should also be carried out. For example, polyketides and non-
ribosomal peptides are compounds widely used in pharmaceuticals, industrial agents
or agrochemicals (Silakowski et al, 2000). These compounds are biosynthesized by
large polyfunctional enzyme systems within the protein. The biosynthetic proteins are
known as polyketide synthases (PKS) and nonribosomal polypeptide sythetases (NRPS)
(Cane, 1997). Hence, to detect these two genes in the isolated bacteria cultures, PCR
screening needs to be conducted which a specific oligonucleotides primer was used to
amplify DNA non-ribosomal peptide synthetase (NRPS) and polyketide synthases (PKS)
(Radjasa OK. & Sabdono A., 2003). This is because PCR-based screening allows a rapid
evaluation of many isolates among coral-associated bacteria produced secondary
metabolites.
Bacteria isolates identified as phylogenetically similar to Vibrio sp. should be tested to
see whether they are scientifically proven as culturable nitrogen-fixing bacteria to
Trachyphyllia geoffroyi, Euphyllia ancora. and Corallimorph sp. The cultures identical to
Vibrio sp. should be cultured in nitrogen-free medium to see whether do they show
nitrogenase acitivity by means of the acetylene reduction assay (ARA) (Chimetto et. Al.,
2008).
Besides, an investigation should be carried out to determine whether or not any of the
isolated bacteria species are potentially pathogenic to coral. This can be done via
pathogenesis test. The test can be done by hatching Artemia cysts in seawater
(salinity = 32‰) at room temperature for 48 hours. The groups of nauplii were
transferred to filtered (0.22 µm) seawater into which was pipetted 1.0 ml volumes of
the overnight bacterial cultures isolated from the three selected corals, which were
incubated at room temperature in TNB or T2NB, as appropriate to achieve 106 cells
ml−1 (as deduced using an Improved Neubauer type haemocytometer slide at a
![Page 130: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/130.jpg)
P a g e | 117
magnification of ×400 on a Carl Zeiss Axiophot light microscope) or ECP preparation
(Austin B. et. a.,2005). Then, these were incubated at room temperature, and
examined daily for the presence of dead nauplii over a 4-day period.
In addition, only surface mucus layer of Trachyphyllia geoffroyi, Euphyllia ancoraand
Corallimorph sp. samples were extracted for bacterial community analysis and in order
to understand better of the entire bacterial community of the corals, future study
should include the investigation of the corals’ tissue layer too. A study which compared
the bacteria diversity of Oculina patagonica’s mucus layer and tissue layer
demonstrated that there are differences in the diversity of the bacterial community
(Koren & Rosenberg 2006). The tissue layer of the coral host has larger bacterial
diversity compared to the mucus layer of the coral host (Koren & Rosenberg 2006). By
providing both microbial analysis investigation of the corals tissues and mucus extract,
it will help in providing a comprehensive database for future examinations of changes
in the bacterial community during bleaching events.
In a controlled experiment conducted to test the impact of increased partial pressure
of carbon dioxide (pCO2) on calcifying coral reefs organisms (Jokiel et al. 2008),
mesocosm approach was applied and it was very effective at detecting the relative
importance of various calcifying organisms in accounting for declines in reef
community calcification under acidified conditions. Jokiel and colleagues had
successfully identified groups of organisms that show a profound response to
conditions of ocean acidification. Therefore, another recommended future research
work would be conducting a mesocosm investigation where the corals are studied in
their actual habitat. This would contribute in providing a more accurate and realistic
data as the experiment will be conducted in replicate continuous flow coral reef
mesocosms flushed with unfiltered sea water and original seawater parameter such as
surrounding temperature and pH condtions.
In order to scientifically prove the pathogenicity of the bacterial isolates and their
identities as causative agents of coral bleaching, Koch’s postulates can be applied
(Bourne & Munn 2005a).
![Page 131: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/131.jpg)
P a g e | 118
References
Abideen, S & Babuselvam, M 2014, 'Antagonistic activity of Lysinibacillus fusiformis n
139 strain isolated from marine fish Triacanthus strigilifer and genome sequence', Int.
J. Curr. Microbiol. App. Sci, vol. 3, no. 4, pp. 1066-1072.
Ainsworth, T, Fine, M, Roff, G & Hoegh-Guldberg, O 2007, 'Bacteria are not the primary
cause of bleaching in the Mediterranean coral Oculina patagonica', The ISME journal,
vol. 2, no. 1, pp. 67-73.
Ainsworth, T, Kramasky-Winter, E, Loya, Y, Hoegh-Guldberg, O & Fine, M 2007b, 'Coral
disease diagnostics: what's between a plague and a band?', Applied and environmental
microbiology, vol. 73, no. 3, pp. 981-992.
Alker, AP, Smith, GW & Kim, K 2001, 'Characterization of Aspergillus sydowii (Thom et
Church), a fungal pathogen of Caribbean sea fan corals', Hydrobiologia, vol. 460, no. 1-
3, pp. 105-111.
Alves, PDD, de Faria Siqueira, F, Facchin, S, Horta, CCR, Victória, JMN & Kalapothakis, E
2014, 'Survey of Microbial Enzymes in Soil, Water, and Plant Microenvironments', The
open microbiology journal, vol. 8, p. 25.
Antonius, A 1973, 'New observations on coral destruction in reefs,' Tenth Meeting of
the Association of Island Marine Laboratories of the Caribbean, University of Puerto
Rico (Mayaguez),
Antonius, A 1981, 'The ‘band’diseases in coral reefs,' Proc 4th Int Coral Reef Symp, 7-
14.
Arahal, DR, García, MT, Vargas, C, Cánovas, D, Nieto, JJ & Ventosa, A 2001,
'Chromohalobacter salexigens sp. nov., a moderately halophilic species that includes
![Page 132: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/132.jpg)
P a g e | 118
Halomonas elongata DSM 3043 and ATCC 33174', International journal of systematic
and evolutionary microbiology, vol. 51, no. 4, pp. 1457-1462.
Arboleda, M & Reichardt, W 2009, 'Epizoic communities of prokaryotes on healthy and
diseased scleractinian corals in Lingayen Gulf, Philippines', Microbial ecology, vol. 57,
no. 1, pp. 117-128.
Austin, B, Austin, D, Sutherland, R, Thompson, F & Swings, J 2005, 'Pathogenicity of
vibrios to rainbow trout (Oncorhynchus mykiss, Walbaum) and Artemia nauplii',
Environ Microbiol, vol. 7, no. 9, Sep, pp. 1488-95.
Austin, B & Austin, DA 2007, Bacterial fish pathogens: disease of farmed and wild fish,
Springer.
Banin, E, Israely, T, Fine, M, Loya, Y & Rosenberg, E 2001a, 'Role of endosymbiotic
zooxanthellae and coral mucus in the adhesion of the coral‐bleaching pathogen Vibrio
shiloi to its host', FEMS Microbiology Letters, vol. 199, no. 1, pp. 33-37.
Banin, E, Israely, T, Kushmaro, A, Loya, Y, Orr, E & Rosenberg, E 2000, 'Penetration of
the Coral-Bleaching Bacterium Vibrio shiloi into Oculina patagonica', Applied and
Environmental Microbiology, vol. 66, no. 7, pp. 3031-3036.
Banin, E, Khare, SK, Naider, F & Rosenberg, E 2001b, 'Proline-Rich Peptide from the
Coral PathogenVibrio shiloi That Inhibits Photosynthesis of Zooxanthellae', Applied and
environmental microbiology, vol. 67, no. 4, pp. 1536-1541.
Bein, SJ 1954, 'A study of certain chromogenic bacteria isolated from “red tide” water
with a description of a new species', Bulletin of Marine Science, vol. 4, no. 2, pp. 110-
119.
![Page 133: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/133.jpg)
P a g e | 118
Ben-Haim, Y, Thompson, F, Thompson, C, Cnockaert, M, Hoste, B, Swings, J &
Rosenberg, E 2003, 'Vibrio coralliilyticus sp. nov., a temperature-dependent pathogen
of the coral Pocillopora damicornis', International Journal of Systematic and
Evolutionary Microbiology, vol. 53, no. 1, pp. 309-315.
Bizani, D & Brandelli, A 2002, 'Characterization of a bacteriocin produced by a newly
isolated Bacillus sp. Strain 8 A', Journal of Applied Microbiology, vol. 93, no. 3, pp. 512-
519.
Buck, JD & Meyers, SP 1966a, 'Growth and Phosphate Requirement of Pseudomonas
Piscicida and Related Antiyeast Pseudomonads', Bulletin of Marine Science, vol. 16, no.
1, pp. 93-101.
Bak, R, Joenje, M, De Jong, I, Lambrechts, D & Nieuwland, G 1998, 'Bacterial
suspension feeding by coral reef benthic organisms', Marine Ecology Progress Series,
vol. 175, pp. 285-288.
Bally, M & Garrabou, J 2007, 'Thermodependent bacterial pathogens and mass
mortalities in temperate benthic communities: a new case of emerging disease linked
to climate change', Global Change Biology, vol. 13, no. 10, pp. 2078-2088.
Beals, M, Gross, L & Harrell, S 2000, 'Diversity indices: Shannon's H and E', The Institute
for Environmental Modelling (TIEM), University of Tennessee, USA.
Becking, LB, Kaplan, IR & Moore, D 1960, 'Limits of the natural environment in terms of
pH and oxidation-reduction potentials', The Journal of Geology, pp. 243-284.
Ben-Haim, Y, Zicherman-Keren, M & Rosenberg, E 2003, 'Temperature-regulated
bleaching and lysis of the coral Pocillopora damicornis by the novel pathogen Vibrio
coralliilyticus', Applied and Environmental Microbiology, vol. 69, no. 7, pp. 4236-4242.
![Page 134: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/134.jpg)
P a g e | 118
Ben‐Haim, Y, Banim, E, Kushmaro, A, Loya, Y & Rosenberg, E 1999, 'Inhibition of
photosynthesis and bleaching of zooxanthellae by the coral pathogen Vibrio shiloi',
Environmental Microbiology, vol. 1, no. 3, pp. 223-229.
Benayahu, Y & Loya, Y 1983, 'Surface brooding in the Red Sea soft coral
Parerythropodium fulvum fulvum (Forskål, 1775)', The Biological Bulletin, vol. 165, no.
2, pp. 353-369.
Berger, WH & Parker, FL 1970, 'Diversity of planktonic foraminifera in deep-sea
sediments', Science, vol. 168, no. 3937, pp. 1345-1347.
Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities
and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und
Pflanzenschutz, vol. 105, no. 2, pp. 181-197.
Bijlsma, L, Ehler, C, Klein, R, Kulshrestha, S, McLean, R, Mimura, N, Nicholls, R, Nurse, L,
Nieto, HP & Stakhiv, E 1996, Cambridge University Press, Cambridge, United Kingdom
and New York, NY, USA, pp. 289-324.
Blackwood, CB, Hudleston, D, Zak, DR & Buyer, JS 2007, 'Interpreting ecological
diversity indices applied to terminal restriction fragment length polymorphism data:
insights from simulated microbial communities', Appl Environ Microbiol, vol. 73, no. 16,
Aug, pp. 5276-83.
Bonilla-Findji, O, Malits, A, Lefèvre, D, Rochelle-Newall, E, Lemée, R, Weinbauer, MG &
Gattuso, J-P 2008, 'Viral effects on bacterial respiration, production and growth
efficiency: consistent trends in the Southern Ocean and the Mediterranean Sea', Deep
Sea Research Part II: Topical Studies in Oceanography, vol. 55, no. 5, pp. 790-800.
Bourne, D 2005, 'Microbiological assessment of a disease outbreak on corals from
Magnetic Island (Great Barrier Reef, Australia)', Coral Reefs, vol. 24, no. 2, pp. 304-312.
![Page 135: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/135.jpg)
P a g e | 118
Bourne, D, Iida, Y, Uthicke, S & Smith-Keune, C 2008, 'Changes in coral-associated
microbial communities during a bleaching event', ISME J, vol. 2, no. 4, Apr, pp. 350-63.
Bourne, DG, Garren, M, Work, TM, Rosenberg, E, Smith, GW & Harvell, CD 2009,
'Microbial disease and the coral holobiont', Trends in Microbiology, vol. 17, no. 12,
12//, pp. 554-562.
Bourne, DG & Munn, CB 2005a, 'Diversity of bacteria associated with the coral
Pocillopora damicornis from the Great Barrier Reef', Environ Microbiol, vol. 7, no. 8,
Aug, pp. 1162-74.
Bourne, DG & Munn, CB 2005b, 'Diversity of bacteria associated with the coral
Pocillopora damicornis from the Great Barrier Reef', Environmental Microbiology, vol.
7, no. 8, pp. 1162-1174.
Bowman, JP 2007, 'Bioactive compound synthetic capacity and ecological significance
of marine bacterial genus Pseudoalteromonas', Marine drugs, vol. 5, no. 4, pp. 220-
241.
Bratbak, G, Thingstad, F & Heldal, M 1994, 'Viruses and the microbial loop', Microbial
Ecology, vol. 28, no. 2, pp. 209-221.
Breitbart, M, Miyake, JH & Rohwer, F 2004, 'Global distribution of nearly identical
phage-encoded DNA sequences', FEMS Microbiol Lett, vol. 236, no. 2, Jul 15, pp. 249-
56.
Breitbart, M, Thompson, LR, Suttle, CA & Sullivan, MB 2007, 'Exploring the vast
diversity of marine viruses', OCEANOGRAPHY-WASHINGTON DC-OCEANOGRAPHY
SOCIETY-, vol. 20, no. 2, p. 135.
![Page 136: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/136.jpg)
P a g e | 118
Brown, B 1997, 'Coral bleaching: causes and consequences', Coral reefs, vol. 16, no. 1,
pp. S129-S138.
Brown, B & Bythell, J 2005, 'Perspectives on mucus secretion in reef corals', Marine
Ecology Progress Series, vol. 296, pp. 291-309.
Brown, B & Howard, L 1985, 'Assessing the effects of “stress” on reef corals', Advances
in marine biology, vol. 22, pp. 1-63.
Buck, JD & Meyers, SP 1966, 'In vitro inhibition ofRhodotorula minuta by a variant of
the marine bacterium, Pseudomonas piscicida', Helgoländer Wissenschaftliche
Meeresuntersuchungen, vol. 13, no. 1-2, pp. 171-180.
Bythell, J 1988, 'A total nitrogen and carbon budget for the elkhorn coral Acropora
palmata (Lamarck),' Proceedings of the 6th International Coral Reef Symposium, 535-
540.
Cardinale, M, Brusetti, L, Quatrini, P, Borin, S, Puglia, AM, Rizzi, A, Zanardini, E, Sorlini,
C, Corselli, C & Daffonchio, D 2004, 'Comparison of different primer sets for use in
automated ribosomal intergenic spacer analysis of complex bacterial communities',
Applied and Environmental Microbiology, vol. 70, no. 10, pp. 6147-6156.
Carpenter, KE, Abrar, M, Aeby, G, Aronson, RB, Banks, S, Bruckner, A, Chiriboga, A,
Cortés, J, Delbeek, JC & DeVantier, L 2008, 'One-third of reef-building corals face
elevated extinction risk from climate change and local impacts', Science, vol. 321, no.
5888, pp. 560-563.
Cervino, J, Thompson, F, Gomez‐Gil, B, Lorence, E, Goreau, T, Hayes, R, Winiarski‐
Cervino, K, Smith, G, Hughen, K & Bartels, E 2008, 'The Vibrio core group induces
yellow band disease in Caribbean and Indo‐Pacific reef‐building corals', Journal of
Applied Microbiology, vol. 105, no. 5, pp. 1658-1671.
![Page 137: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/137.jpg)
P a g e | 118
Chenard, C & Suttle, C 2008, 'Phylogenetic diversity of sequences of cyanophage
photosynthetic gene psbA in marine and freshwaters', Applied and environmental
microbiology, vol. 74, no. 17, pp. 5317-5324.
Chimetto, LA, Brocchi, M, Gondo, M, Thompson, CC, Gomez-Gil, B & Thompson, FL
2009, 'Genomic diversity of vibrios associated with the Brazilian coral Mussismilia
hispida and its sympatric zoanthids (Palythoa caribaeorum, Palythoa variabilis and
Zoanthus solanderi)', J Appl Microbiol, vol. 106, no. 6, Jun, pp. 1818-26.
Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RC, Ramos, HR & Thompson, FL
2008a, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral
Mussismilia hispida', Syst Appl Microbiol, vol. 31, no. 4, Sep, pp. 312-319.
Chimetto, LA, Brocchi, M, Thompson, CC, Martins, RCR, Ramos, HR & Thompson, FL
2008b, 'Vibrios dominate as culturable nitrogen-fixing bacteria of the Brazilian coral
Mussismilia hispida', Systematic and Applied Microbiology, vol. 31, no. 4, 9//, pp. 312-
319.
Chimetto, LA, Cleenwerck, I, Alves, N, Jr., Silva, BS, Brocchi, M, Willems, A, De Vos, P &
Thompson, FL 2011, 'Vibrio communis sp. nov., isolated from the marine animals
Mussismilia hispida, Phyllogorgia dilatata, Palythoa caribaeorum, Palythoa variabilis
and Litopenaeus vannamei', Int J Syst Evol Microbiol, vol. 61, no. Pt 2, Feb, pp. 362-8.
Cho, H-B, Lee, J-K & Choi, Y-K 2003, 'The genetic diversity analysis of the bacterial
community in groundwater by denaturing gradient gel electrophoresis (DGGE)',
JOURNAL OF MICROBIOLOGY-SEOUL-, vol. 41, no. 4, pp. 327-334.
![Page 138: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/138.jpg)
P a g e | 118
Choquet, G, Soudant, P, Lambert, C, Nicolas, J-L & Paillard, C 2003, 'Reduction of
adhesion properties of Ruditapes philippinarum hemocytes exposed to Vibrio tapetis',
Diseases of aquatic organisms, vol. 57, no. 1-2, pp. 109-116.
Coffroth, M 1990, 'Mucous sheet formation on poritid corals: an evaluation of coral
mucus as a nutrient source on reefs', Marine biology, vol. 105, no. 1, pp. 39-49.
Cohen, Y, Joseph Pollock, F, Rosenberg, E & Bourne, DG 2013, 'Phage therapy
treatment of the coral pathogen Vibrio coralliilyticus', Microbiologyopen, vol. 2, no. 1,
Feb, pp. 64-74.
Cooney, RP, Pantos, O, Le Tissier, MD, Barer, MR & Bythell, JC 2002, 'Characterization
of the bacterial consortium associated with black band disease in coral using molecular
microbiological techniques', Environmental Microbiology, vol. 4, no. 7, pp. 401-413.
Correa, AM, Welsh, RM & Thurber, RLV 2012, 'Unique nucleocytoplasmic dsDNA and
+ ssRNA viruses are associated with the dinoflagellate endosymbionts of corals',
The ISME journal, vol. 7, no. 1, pp. 13-27.
Crossland, C 1987, 'In situ release of mucus and DOC-lipid from the corals Acropora
variabilis and Stylophora pistillata in different light regimes', Coral Reefs, vol. 6, no. 1,
pp. 35-42.
Danovaro, R, Luna, GM, Dell'anno, A & Pietrangeli, B 2006, 'Comparison of two
fingerprinting techniques, terminal restriction fragment length polymorphism and
automated ribosomal intergenic spacer analysis, for determination of bacterial
diversity in aquatic environments', Appl Environ Microbiol, vol. 72, no. 9, Sep, pp. 5982-
9.
![Page 139: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/139.jpg)
P a g e | 118
Davies, PS 1984, 'The role of zooxanthellae in the nutritional energy requirements of
Pocillopora eydouxi', Coral Reefs, vol. 2, no. 4, pp. 181-186.
Deacon, E 1979, 'The role of coral mucus in reducing the wind drag over coral reefs',
Boundary-Layer Meteorology, vol. 17, no. 4, pp. 517-521.
Dean, FB, Nelson, JR, Giesler, TL & Lasken, RS 2001, 'Rapid amplification of plasmid and
phage DNA using Phi 29 DNA polymerase and multiply-primed rolling circle
amplification', Genome Res, vol. 11, no. 6, Jun, pp. 1095-9.
Denkin, SM & Nelson, DR 2004, 'Regulation of Vibrio anguillarum empA
metalloprotease expression and its role in virulence', Applied and environmental
microbiology, vol. 70, no. 7, pp. 4193-4204.
Denner, EB, Smith, GW, Busse, H-J, Schumann, P, Narzt, T, Polson, SW, Lubitz, W &
Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent
of white plague type II on Caribbean scleractinian corals', International Journal of
Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.
DePaola, A, Nordstrom, JL, Bowers, JC, Wells, JG & Cook, DW 2003, 'Seasonal
abundance of total and pathogenic Vibrio parahaemolyticus in Alabama oysters', Appl
Environ Microbiol, vol. 69, no. 3, Mar, pp. 1521-6.
Ding, J, Fung, F, Ng, G & Chou, L 1999, 'Novel bioactivities from a coral, Galaxea
fascicularis: DNase-like activity and apoptotic activity against a multiple-drug-resistant
leukemia cell line', Marine Biotechnology, vol. 1, no. 4, pp. 328-336.
Doney, SC, Fabry, VJ, Feely, RA & Kleypas, JA 2009, 'Ocean acidification: the other CO2
problem', Ann Rev Mar Sci, vol. 1, pp. 169-92.
![Page 140: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/140.jpg)
P a g e | 118
Downs, CA, Woodley, CM, Richmond, RH, Lanning, LL & Owen, R 2005, 'Shifting the
paradigm of coral-reef ‘health’assessment', Marine Pollution Bulletin, vol. 51, no. 5, pp.
486-494.
Drollet, J, Glaziou, P & Martin, P 1993, 'A study of mucus from the solitary coral Fungia
fungites (Scleractinia: Fungiidae) in relation to photobiological UV adaptation', Marine
Biology, vol. 115, no. 2, pp. 263-266.
Ducklow, H 1990, 'The biomass, production and fate of bacteria in coral reefs',
Ecosystems of the world, vol. 25, pp. 265-289.
Ducklow, HW & Mitchell, R 1979a, 'Bacterial populations and adaptations in the mucus
layers on living corals', Limnol. Oceanogr.;(United States), vol. 24, no. 4
Ducklow, HW & Mitchell, R 1979b, 'Observations on naturally and artificially diseased
tropical corals: a scanning electron microscope study', Microbial ecology, vol. 5, no. 3,
pp. 215-223.
Dustan, P 1977, 'Vitality of reef coral populations off Key Largo, Florida: recruitment
and mortality', Environmental Geology, vol. 2, no. 1, pp. 51-58.
Edmunds, P & Davies, PS 1986, 'An energy budget for Porites porites (Scleractinia)',
Marine biology, vol. 92, no. 3, pp. 339-347.
Edmunds, P & Davies, PS 1989, 'An energy budget for Porites porites (Scleractinia),
growing in a stressed environment', Coral Reefs, vol. 8, no. 1, pp. 37-43.
Efrony, R, Loya, Y, Bacharach, E & Rosenberg, E 2006, 'Phage therapy of coral disease',
Coral Reefs, vol. 26, no. 1, pp. 7-13.
![Page 141: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/141.jpg)
P a g e | 118
Ferrier-Pages, C, Gattuso, J, Cauwet, G, Jaubert, J & Allemand, D 1998, 'Release of
dissolved organic carbon and nitrogen by the zooxanthellate coral Galaxea fascicularis',
Marine Ecology Progress Series, vol. 172, pp. 265-274.
Ferris, M, Muyzer, G & Ward, D 1996, 'Denaturing gradient gel electrophoresis profiles
of 16S rRNA-defined populations inhabiting a hot spring microbial mat community',
Applied and Environmental Microbiology, vol. 62, no. 2, pp. 340-346.
Fine, M & Loya, Y 1995, 'The coral Oculina patagonica: a new immigrant to the
Mediterranean coast of Israel', Isr J Zool, vol. 41, p. 81.
Finkelstein, RA & Hanne, LF 1982, 'Purification and characterization of the soluble
hemagglutinin (cholera lectin)(produced by Vibrio cholerae', Infection and immunity,
vol. 36, no. 3, pp. 1199-1208.
Frias-Lopez, J, Zerkle, AL, Bonheyo, GT & Fouke, BW 2002, 'Partitioning of Bacterial
Communities between Seawater and Healthy, Black Band Diseased, and Dead Coral
Surfaces', Applied and Environmental Microbiology, vol. 68, no. 5, pp. 2214-2228.
Fuller, NJ, Wilson, WH, Joint, IR & Mann, NH 1998, 'Occurrence of a sequence in
marine cyanophages similar to that of T4 g20 and its application to PCR-based
detection and quantification techniques', Applied and Environmental Microbiology, vol.
64, no. 6, pp. 2051-2060.
Fung, FMY & Ding, JL 1998, 'A novel antitumour compound from the mucus of a coral,<
i> Galaxea fascicularis</i>, inhibits topoisomerase I and II', Toxicon, vol. 36, no. 7, pp.
1053-1058.
Gamito, S 2010, 'Caution is needed when applying Margalef diversity index', Ecological
Indicators, vol. 10, no. 2, pp. 550-551.
![Page 142: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/142.jpg)
P a g e | 118
Gauthier, G, Gauthier, M & Christen, R 1995, 'Phylogenetic analysis of the genera
Alteromonas, Shewanella, and Moritella using genes coding for small-subunit rRNA
sequences and division of the genus Alteromonas into two genera, Alteromonas
(emended) and Pseudoalteromonas gen. nov., and proposal of twelve new species
combinations', International journal of systematic bacteriology, vol. 45, no. 4, pp. 755-
761.
Gebhardt, K, Schimana, J, Müller, J, Fiedler, HP, Kallenborn, HG, Holzenkämpfer, M,
Krastel, P, Zeeck, A, Vater, J & Höltzel, A 2002, 'Screening for biologically active
metabolites with endosymbiotic bacilli isolated from arthropods', FEMS microbiology
letters, vol. 217, no. 2, pp. 199-205.
Geffen, Y & Rosenberg, E 2004, 'Stress-induced rapid release of antibacterials by
scleractinian corals', Marine Biology, vol. 146, no. 5, pp. 931-935.
Geffen, Y & Rosenberg, E 2005, 'Stress-induced rapid release of antibacterials by
scleractinian corals', Marine Biology, vol. 146, no. 5, 2005/04/01, pp. 931-935.
Gill, DM 1982, 'Bacterial toxins: a table of lethal amounts', Microbiological Reviews,
vol. 46, no. 1, p. 86.
Gladfelter, WB 1982, 'White-band disease in Acropora palmata: implications for the
structure and growth of shallow reefs', Bulletin of Marine Science, vol. 32, no. 2, pp.
639-643.
Glynn, P & De Weerdt, W 1991, 'Elimination of two reef-building hydrocorals following
the 1982-83 el nino warming event', Science(Washington), vol. 253, no. 5015, pp. 69-
71.
![Page 143: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/143.jpg)
P a g e | 118
Godwin, S, Bent, E, Borneman, J & Pereg, L 2012, 'The role of coral-associated bacterial
communities in Australian Subtropical White Syndrome of Turbinaria mesenterina',
PLoS One, vol. 7, no. 9, p. e44243.
Goldberg, WM 2002, 'Feeding behavior, epidermal structure and mucus cytochemistry
of the scleractinian< i> Mycetophyllia reesi</i>, a coral without tentacles', Tissue and
Cell, vol. 34, no. 4, pp. 232-245.
Goldsmith, DB, Crosti, G, Dwivedi, B, McDaniel, LD, Varsani, A, Suttle, CA, Weinbauer,
MG, Sandaa, RA & Breitbart, M 2011, 'Development of phoH as a novel signature gene
for assessing marine phage diversity', Appl Environ Microbiol, vol. 77, no. 21, Nov, pp.
7730-9.
Gomez-Gil, B, Soto-Rodriguez, S, García-Gasca, A, Roque, A, Vazquez-Juarez, R,
Thompson, FL & Swings, J 2004, 'Molecular identification of Vibrio harveyi-related
isolates associated with diseased aquatic organisms', Microbiology, vol. 150, no. 6, pp.
1769-1777.
Goreau, TF & Wells, JW 1967, 'The Shallow-Water Scleractinia of Jamaica: Revised List
of Species and their Vertical Distribution Range', Bulletin of Marine Science, vol. 17, no.
2, //, pp. 442-453.
Gottfried, M & Roman, M 1983, 'Ingestion and incorporation of coral-mucus detritus
by reef zooplankton', Marine Biology, vol. 72, no. 3, pp. 211-218.
Green, EP & Bruckner, AW 2000, 'The significance of coral disease epizootiology for
coral reef conservation', Biological Conservation, vol. 96, no. 3, pp. 347-361.
Haible, D, Kober, S & Jeske, H 2006, 'Rolling circle amplification revolutionizes
diagnosis and genomics of geminiviruses', Journal of virological methods, vol. 135, no.
1, pp. 9-16.
![Page 144: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/144.jpg)
P a g e | 118
Hall-Stoodley, L, Costerton, JW & Stoodley, P 2004, 'Bacterial biofilms: from the natural
environment to infectious diseases', Nature Reviews Microbiology, vol. 2, no. 2, pp. 95-
108.
Hanlon, GW 2007, 'Bacteriophages: an appraisal of their role in the treatment of
bacterial infections', Int J Antimicrob Agents, vol. 30, no. 2, Aug, pp. 118-28.
Harvell, CD, Mitchell, CE, Ward, JR, Altizer, S, Dobson, AP, Ostfeld, RS & Samuel, MD
2002, 'Climate warming and disease risks for terrestrial and marine biota', Science, vol.
296, no. 5576, pp. 2158-2162.
Hayes, RL & Goreau, NI 1998, 'The significance of emerging diseases in the tropical
coral reef ecosystem', Rev. Biol. Trop, vol. 46, no. Supl 5, pp. 173-185.
Hill, TC, Walsh, KA, Harris, JA & Moffett, BF 2003, 'Using ecological diversity measures
with bacterial communities', FEMS Microbiology Ecology, vol. 43, no. 1, pp. 1-11.
Hoegh-Guldberg, O, Mumby, P, Hooten, A, Steneck, R, Greenfield, P, Gomez, E, Harvell,
C, Sale, P, Edwards, A & Caldeira, K 2007, 'Coral reefs under rapid climate change and
ocean acidification', science, vol. 318, no. 5857, pp. 1737-1742.
Holmström, C, James, S, Egan, S & Kjelleberg, S 1996, 'Inhibition of common fouling
organisms by marine bacterial isolates ith special reference to the role of pigmented
bacteria', Biofouling, vol. 10, no. 1-3, pp. 251-259.
Howard, L & Brown, B 1984, 'Heavy metals and reef corals', Oceanogr. Mar. Biol. Ann.
Rev, vol. 22, pp. 195-210.
![Page 145: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/145.jpg)
P a g e | 118
Howell, R 1982, 'The secretion of mucus by marine nematodes (Enoplus spp.): A
possible mechanism influencing the uptake and loss of heavy metal pollutants',
Nematologica, vol. 28, no. 1, pp. 110-114.
Hsieh, Y-J & Wanner, BL 2010, 'Global regulation by the seven-component P< sub>
i</sub> signaling system', Current opinion in microbiology, vol. 13, no. 2, pp. 198-203.
Isa, Y & Yamazato, K 1981, 'The ultrastructure of calicoblast and related tissues in
Acropora hebes (Dana),' Proc. 4th Int. Coral Reef Symp, 99-105.
Ishii, K & Fukui, M 2001, 'Optimization of annealing temperature to reduce bias caused
by a primer mismatch in multitemplate PCR', Applied and environmental microbiology,
vol. 67, no. 8, pp. 3753-3755.
Israely, T, Banin, E & Rosenberg, E 2001, 'Growth, differentiation and death of Vibrio
shiloi in coral tissue as a function of seawater temperature', Aquatic Microbial Ecology,
vol. 24, no. 1, pp. 1-8.
Itoh, J, Omoto, S, Shomura, T, Nishizawa, N, Miyado, S, Yuda, Y, Shibata, U & Inouye, S
1981, 'Amicoumacin-A, a new antibiotic with strong antiinflammatory and antiulcer
activity', The Journal of antibiotics, vol. 34, no. 5, p. 611.
Itoh, J, Shomura, T, Omoto, S, Miyado, S, Yuda, Y, Shibata, U & Inouye, S 1982,
'Isolation, physicochemical properties and biological activities of amicoumacins
produced by Bacillus pumilus', Agricultural and Biological Chemistry, vol. 46, no. 5, pp.
1255-1259.
Jensen, P, Harvell, C, Wirtz, K & Fenical, W 1996, 'Antimicrobial activity of extracts of
Caribbean gorgonian corals', Marine Biology, vol. 125, no. 2, pp. 411-419.
![Page 146: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/146.jpg)
P a g e | 118
Jiang, SC & Paul, JH 1998, 'Gene transfer by transduction in the marine environment',
Applied and Environmental Microbiology, vol. 64, no. 8, pp. 2780-2787.
John, SG, Mendez, CB, Deng, L, Poulos, B, Kauffman, AK, Kern, S, Brum, J, Polz, MF,
Boyle, EA & Sullivan, MB 2011, 'A simple and efficient method for concentration of
ocean viruses by chemical flocculation', Environ Microbiol Rep, vol. 3, no. 2, Apr, pp.
195-202.
Jokiel, PL & Brown, EK 2004, 'Global warming, regional trends and inshore
environmental conditions influence coral bleaching in Hawaii', Global Change Biology,
vol. 10, no. 10, pp. 1627-1641.
Jones, RJ, Hoegh-Guldberg, O, Larkum, AWD & Schreiber, U 1998, 'Temperature-
induced bleaching of corals begins with impairment of the CO2 fixation mechanism in
zooxanthellae', Plant, Cell & Environment, vol. 21, no. 12, pp. 1219-1230.
Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral
bleaching', Nature, vol. 380, no. 6573, pp. 396-396.
Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina
patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1,
pp. 159-165.
Kellogg, CA 2004, 'Tropical Archaea: diversity associated with the surface microlayer of
corals', Marine ecology. Progress series, vol. 273, pp. 81-88.
Kelman, D, Kushmaro, A, Loya, Y, Kashman, Y & Benayahu, Y 1998, 'Antimicrobial
activity of a Red Sea soft coral, Parerythropodium fulvum fulvum: reproductive and
developmental considerations', Marine Ecology Progress Series, vol. 169, pp. 87-95.
![Page 147: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/147.jpg)
P a g e | 118
Kinder, MA, Kopf, J & Margaretha, P 2000, 'Solid state photochemistry of isocoumarins
and isothiocoumarins', Tetrahedron, vol. 56, no. 36, pp. 6763-6767.
Klaus, JS, Janse, I, Heikoop, JM, Sanford, RA & Fouke, BW 2007, 'Coral microbial
communities, zooxanthellae and mucus along gradients of seawater depth and coastal
pollution', Environ Microbiol, vol. 9, no. 5, May, pp. 1291-305.
Koh, EG 1997, 'Do scleractinian corals engage in chemical warfare against microbes?',
Journal of Chemical Ecology, vol. 23, no. 2, pp. 379-398.
Kooperman, N, Ben-Dov, E, Kramarsky-Winter, E, Barak, Z & Kushmaro, A 2007, 'Coral
mucus-associated bacterial communities from natural and aquarium environments',
FEMS Microbiol Lett, vol. 276, no. 1, Nov, pp. 106-13.
Koren, O & Rosenberg, E 2006, 'Bacteria associated with mucus and tissues of the coral
Oculina patagonica in summer and winter', Appl Environ Microbiol, vol. 72, no. 8, Aug,
pp. 5254-9.
Krebs, B, Höding, B, Kübart, S, Workie, MA, Junge, H, Schmiedeknecht, G, Grosch, R,
Bochow, H & Hevesi, M 1998, 'Use of Bacillus subtilis as biocontrol agent. I. Activities
and characterization of Bacillus subtilis strains', Zeitschrift für Pflanzenkrankheiten und
Pflanzenschutz, vol. 105, no. 2, pp. 181-197.
Krediet, CJ, Ritchie, KB, Cohen, M, Lipp, EK, Sutherland, KP & Teplitski, M 2009,
'Utilization of mucus from the coral Acropora palmata by the pathogen Serratia
marcescens and by environmental and coral commensal bacteria', Applied and
environmental microbiology, vol. 75, no. 12, pp. 3851-3858.
Krohn, K, Bahramsari, R, Flörke, U, Ludewig, K, Kliche-Spory, C, Michel, A, Aust, H-J,
Draeger, S, Schulz, B & Antus, S 1997, 'Dihydroisocoumarins from fungi: isolation,
![Page 148: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/148.jpg)
P a g e | 118
structure elucidation, circular dichroism and biological activity', Phytochemistry, vol.
45, no. 2, pp. 313-320.
Kudva, IT, Jelacic, S, Tarr, PI, Youderian, P & Hovde, CJ 1999, 'Biocontrol of Escherichia
coli O157 with O157-specific bacteriophages', Applied and environmental
microbiology, vol. 65, no. 9, pp. 3767-3773.
Kumar, S, Nei, M, Dudley, J & Tamura, K 2008, 'MEGA: a biologist-centric software for
evolutionary analysis of DNA and protein sequences', Briefings in bioinformatics, vol. 9,
no. 4, pp. 299-306.
Kushmaro, A, Banin, E, Loya, Y, Stackebrandt, E & Rosenberg, E 2001, 'Vibrio shiloi sp.
nov., the causative agent of bleaching of the coral Oculina patagonica', International
journal of systematic and evolutionary microbiology, vol. 51, no. 4, pp. 1383-1388.
Kushmaro, A, Loya, Y, Fine, M & Rosenberg, E 1996, 'Bacterial infection and coral
bleaching', Nature, vol. 380, no. 6573, pp. 396-396.
Kushmaro, A, Rosenberg, E, Fine, M, Ben Haim, Y & Loya, Y 1998, 'Effect of
temperature on bleaching of the coral Oculina patagonica by Vibrio AK-1', Marine
Ecology Progress Series, vol. 171, pp. 131-137.
Kushmaro, A, Rosenberg, E, Fine, M & Loya, Y 1997, 'Bleaching of the coral Oculina
patagonica by Vibrio AK-1', Marine ecology progress series. Oldendorf, vol. 147, no. 1,
pp. 159-165.
Kuta, K & Richardson, L 1996, 'Abundance and distribution of black band disease on
coral reefs in the northern Florida Keys', Coral reefs, vol. 15, no. 4, pp. 219-223.
Kvennefors, ECE, Sampayo, E, Ridgway, T, Barnes, AC & Hoegh-Guldberg, O 2010,
'Bacterial communities of two ubiquitous Great Barrier Reef corals reveals both site-
![Page 149: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/149.jpg)
P a g e | 118
and species-specificity of common bacterial associates', PloS one, vol. 5, no. 4, p.
e10401.
Labonté, JM, Reid, KE & Suttle, CA 2009, 'Phylogenetic analysis indicates evolutionary
diversity and environmental segregation of marine podovirus DNA polymerase gene
sequences', Applied and environmental microbiology, vol. 75, no. 11, pp. 3634-3640.
Labreuche, Y, Lambert, C, Soudant, P, Boulo, V, Huvet, A & Nicolas, J-L 2006a, 'Cellular
and molecular hemocyte responses of the Pacific oyster, Crassostrea gigas, following
bacterial infection with Vibrio aestuarianus strain 01/32', Microbes and Infection, vol.
8, no. 12, pp. 2715-2724.
Labreuche, Y, Soudant, P, Gonçalves, M, Lambert, C & Nicolas, J-L 2006b, 'Effects of
extracellular products from the pathogenic Vibrio aestuarianus strain 01/32 on
lethality and cellular immune responses of the oyster Crassostrea gigas,
Developmental & Comparative Immunology, vol. 30, no. 4, pp. 367-379.
Lee, K-K 1995, 'Pathogenesis studies on Vibrio alginolyticus in the grouper, Epinephelus
malabaricus, Microbial pathogenesis, vol. 19, no. 1, pp. 39-48.
Lee, SY, Oh, TK, Kim, W & Yoon, JH 2010, 'Oceanobacillus locisalsi sp. nov., isolated
from a marine solar saltern', Int J Syst Evol Microbiol, vol. 60, no. Pt 12, Dec, pp. 2758-
62.
Lenski, RE 1988, 'Dynamics of interactions between bacteria and virulent
bacteriophage', in Advances in microbial ecology, Springer, pp. 1-44.
Lesser, MP, Falcón, LI, Rodríguez-Román, A, Enríquez, S, Hoegh-Guldberg, O & Iglesias-
Prieto, R 2007, 'Nitrogen fixation by symbiotic cyanobacteria provides a source of
![Page 150: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/150.jpg)
P a g e | 118
nitrogen for the scleractinian coral Montastraea cavernosa', Marine Ecology Progress
Series, vol. 346, pp. 143-152.
Lesser, MP, Mazel, CH, Gorbunov, MY & Falkowski, PG 2004, 'Discovery of symbiotic
nitrogen-fixing cyanobacteria in corals', Science, vol. 305, no. 5686, pp. 997-1000.
Lewis, JB 1977, 'Suspension feeding in Atlantic reef corals and the importance of
suspended particulate matter as a food source,' Proceedings of the 3rd International
Coral Reef Symposium, 405-408.
Lin, B, Wang, Z, Malanoski, AP, O'Grady, EA, Wimpee, CF, Vuddhakul, V, Alves Jr, N,
Thompson, FL, Gomez-Gil, B & Vora, GJ 2010, 'Comparative genomic analyses identify
the Vibrio harveyi genome sequenced strains BAA-1116 and HY01 as Vibrio campbellii',
Environ Microbiol Rep, vol. 2, no. 1, Feb, pp. 81-89.
Lindell, D, Jaffe, JD, Johnson, ZI, Church, GM & Chisholm, SW 2005, 'Photosynthesis
genes in marine viruses yield proteins during host infection', Nature, vol. 438, no.
7064, pp. 86-89.
Lindell, D, Sullivan, MB, Johnson, ZI, Tolonen, AC, Rohwer, F & Chisholm, SW 2004,
'Transfer of photosynthesis genes to and from Prochlorococcus viruses', Proceedings of
the National Academy of Sciences of the United States of America, vol. 101, no. 30, pp.
11013-11018.
Linley, E & Koop, K 1986, 'Significance of pelagic bacteria as a trophic resource in a
coral reef lagoon, One Tree Island, Great Barrier Reef', Marine Biology, vol. 92, no. 4,
pp. 457-464.
![Page 151: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/151.jpg)
P a g e | 118
Liuxy, PC, Lee, KK & Chen, SN 1996, 'Pathogenicity of different isolates of Vibrio harveyi
in tiger prawn, Penaeus monodon', Letters in Applied Microbiology, vol. 22, no. 6, pp.
413-416.
Logan, N 1988, 'Bacillus species of medical and veterinary importance', Journal of
medical microbiology, vol. 25, no. 3, pp. 157-165.
Loghothetis, P & Austin, B 1996, 'Variations in antigenicity of Aeromonas hydrophila
strains in rainbow trout Oncorhynchus mykiss, Walbaum): an association with surface
characteristics', Fish & Shellfish Immunology, vol. 6, no. 1, pp. 47-55.
Longeon, A, Peduzzi, J, Barthelemy, M, Corre, S, Nicolas, J-L & Guyot, M 2004,
'Purification and partial identification of novel antimicrobial protein from marine
bacterium Pseudoalteromonas species strain X153', Marine biotechnology, vol. 6, no.
6, pp. 633-641.
Lu, J, Chen, F & Hodson, RE 2001, 'Distribution, isolation, host specificity, and diversity
of cyanophages infecting marine Synechococcus spp. in river estuaries', Applied and
environmental microbiology, vol. 67, no. 7, pp. 3285-3290.
Lu, J, Nogi, Y & Takami, H 2001, 'Oceanobacillus iheyensis gen. nov., sp. nov., a deep‐
sea extremely halotolerant and alkaliphilic species isolated from a depth of 1050 m on
the Iheya Ridge', FEMS microbiology letters, vol. 205, no. 2, pp. 291-297.
Mann, NH, Cook, A, Millard, A, Bailey, S & Clokie, M 2003, 'Marine ecosystems:
bacterial photosynthesis genes in a virus', Nature, vol. 424, no. 6950, pp. 741-741.
Margalef, R 1958, Temporal succession and spatial heterogeneity in phytoplankton,
University of California press.
![Page 152: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/152.jpg)
P a g e | 118
Marshall, A & Wright, O 1993, 'Confocal laser scanning light microscopy of the extra-
thecal epithelia of undecalcified scleractinian corals', Cell and tissue research, vol. 272,
no. 3, pp. 533-543.
Matsuzaki, S, Rashel, M, Uchiyama, J, Sakurai, S, Ujihara, T, Kuroda, M, Ikeuchi, M,
Tani, T, Fujieda, M, Wakiguchi, H & Imai, S 2005, 'Bacteriophage therapy: a revitalized
therapy against bacterial infectious diseases', J Infect Chemother, vol. 11, no. 5, Oct,
pp. 211-9.
Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism',
Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.
Mazza, P 1994, 'The use of Bacillus subtilis as an antidiarrhoeal microorganism',
Bollettino chimico farmaceutico, vol. 133, no. 1, pp. 3-18.
McCaig, AE, Glover, LA & Prosser, JI 1999, 'Molecular analysis of bacterial community
structure and diversity in unimproved and improved upland grass pastures', Applied
and Environmental Microbiology, vol. 65, no. 4, pp. 1721-1730.
McLeod, E, Anthony, KRN, Andersson, A, Beeden, R, Golbuu, Y, Kleypas, J, Kroeker, K,
Manzello, D, Salm, RV, Schuttenberg, H & Smith, JE 2013, 'Preparing to manage coral
reefs for ocean acidification: lessons from coral bleaching', Frontiers in Ecology and the
Environment, vol. 11, no. 1, pp. 20-27.
Meikle, P, Richards, G & Yellowlees, D 1987, 'Structural determination of the
oligosaccharide side chains from a glycoprotein isolated from the mucus of the coral
Acropora formosa', Journal of Biological Chemistry, vol. 262, no. 35, pp. 16941-16947.
Meikle, P, Richards, G & Yellowlees, D 1988, 'Structural investigations on the mucus
from six species of coral', Marine biology, vol. 99, no. 2, pp. 187-193.
![Page 153: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/153.jpg)
P a g e | 118
Meron, D, Atias, E, Iasur Kruh, L, Elifantz, H, Minz, D, Fine, M & Banin, E 2011, 'The
impact of reduced pH on the microbial community of the coral Acropora eurystoma',
ISME J, vol. 5, no. 1, Jan, pp. 51-60.
Millard, A, Clokie, MR, Shub, DA & Mann, NH 2004, 'Genetic organization of the psbAD
region in phages infecting marine Synechococcus strains', Proceedings of the National
Academy of Sciences of the United States of America, vol. 101, no. 30, pp. 11007-
11012.
Millard, AD, Zwirglmaier, K, Downey, MJ, Mann, NH & Scanlan, DJ 2009, 'Comparative
genomics of marine cyanomyoviruses reveals the widespread occurrence of
Synechococcus host genes localized to a hyperplastic region: implications for
mechanisms of cyanophage evolution', Environmental microbiology, vol. 11, no. 9, pp.
2370-2387.
Mills, M & Sebens, K 1997, 'Particle ingestion efficiency of the corals Siderastrea
siderea and Agaricia agaricites: Effects of flow speed and sediment loads,' Proc 8th Int
Coral Reef Symp, 1059-1064.
Mitchell, R & Chet, I 1975, 'Bacterial attack of corals in polluted seawater', Microbial
Ecology, vol. 2, no. 3, pp. 227-233.
Miyoshi, Si & Shinoda, S 1988, 'Role of the protease in the permeability enhancement
by Vibrio vulnificus', Microbiology and immunology, vol. 32, no. 10, pp. 1025-1032.
Mo, S, Kim, J-h & Cho, K 2009, 'A novel extracellular phospholipase C purified from a
marine bacterium, Pseudoalteromonas sp. J937', Biotechnology Letters, vol. 31, no. 1,
2009/01/01, pp. 89-94.
![Page 154: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/154.jpg)
P a g e | 118
Molchanova, VI, Ovodova, RG, Ovodov, YS, Elkin, YN & Fernandez Santana, V 1985,
'Studies of the polysaccharide moiety of corallan, a glycoprotein from
Pseudopterogorgia americana, Carbohydrate research, vol. 141, no. 2, pp. 289-293.
Molenaar, TJ, Michon, I, de Haas, SA, van Berkel, TJ, Kuiper, J & Biessen, EA 2002,
'Uptake and processing of modified bacteriophage M13 in mice: implications for phage
display', Virology, vol. 293, no. 1, Feb 1, pp. 182-191.
Moriarty, D, Pollard, P & Hunt, W 1985, 'Temporal and spatial variation in bacterial
production in the water column over a coral reef', Marine biology, vol. 85, no. 3, pp.
285-292.
Mouchka, ME, Hewson, I & Harvell, CD 2010, 'Coral-associated bacterial assemblages:
current knowledge and the potential for climate-driven impacts', Integr Comp Biol, vol.
50, no. 4, Oct, pp. 662-74.
Mumby, PJ & Steneck, RS 2008, 'Coral reef management and conservation in light of
rapidly evolving ecological paradigms', Trends in ecology & evolution, vol. 23, no. 10,
pp. 555-563.
Munn, CB, Marchant, HK & Moody, AJ 2008a, 'Defences against oxidative stress in
vibrios associated with corals', FEMS microbiology letters, vol. 281, no. 1, pp. 58-63.
Munn, CB, Marchant, HK & Moody, AJ 2008b, 'Defences against oxidative stress in
vibrios associated with corals', FEMS Microbiol Lett, vol. 281, no. 1, Apr, pp. 58-63.
Muscatine, L, Falkowski, P, Porter, J & Dubinsky, Z 1984, 'Fate of photosynthetic fixed
carbon in light-and shade-adapted colonies of the symbiotic coral Stylophora pistillata',
Proceedings of the Royal Society of London. Series B. Biological Sciences, vol. 222, no.
1227, pp. 181-202.
![Page 155: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/155.jpg)
P a g e | 118
Muyzer, G, De Waal, EC & Uitterlinden, AG 1993, 'Profiling of complex microbial
populations by denaturing gradient gel electrophoresis analysis of polymerase chain
reaction-amplified genes coding for 16S rRNA', Applied and environmental
microbiology, vol. 59, no. 3, pp. 695-700.
Muyzer, G, Hottenträger, S, Teske, A & Wawer, C 1996, 'Denaturing gradient gel
electrophoresis of PCR-amplified 16S rDNA—a new molecular approach to analyse the
genetic diversity of mixed microbial communities', Molecular microbial ecology
manual, vol. 3, no. 4, pp. 1-23.
Muyzer, G & Smalla, K 1998, 'Application of denaturing gradient gel electrophoresis
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology',
Antonie van Leeuwenhoek, vol. 73, no. 1, pp. 127-141.
Mydlarz, LD, Jones, LE & Harvell, CD 2006, 'Innate immunity, environmental drivers,
and disease ecology of marine and freshwater invertebrates', Annual Review of
Ecology, Evolution, and Systematics, pp. 251-288.
Nair, SV, Del Valle, H, Gross, PS, Terwilliger, DP & Smith, LC 2005, 'Macroarray analysis
of coelomocyte gene expression in response to LPS in the sea urchin. Identification of
unexpected immune diversity in an invertebrate', Physiological Genomics, vol. 22, no.
1, pp. 33-47.
Navas-Camacho, R, Gil-Agudelo, DL, Rodríguez-Ramírez, A, Reyes-Nivia, MC & Garzón-
Ferreira, J 2010, 'Coral diseases and bleaching on Colombian Caribbean coral reefs',
Revista de Biología Tropical, vol. 58, pp. 95-106.
Nishibuchi, M & Kaper, JB 1995, 'Thermostable direct hemolysin gene of Vibrio
parahaemolyticus: a virulence gene acquired by a marine bacterium', Infection and
Immunity, vol. 63, no. 6, p. 2093.
![Page 156: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/156.jpg)
P a g e | 118
Nissimov, J, Rosenberg, E & Munn, CB 2009, 'Antimicrobial properties of resident coral
mucus bacteria of Oculina patagonica', FEMS Microbiol Lett, vol. 292, no. 2, Mar, pp.
210-5.
Okazaki, H, Kishi, T, Beppu, T & Arima, K 1975, 'Letter: A new antibiotic, baciphelacin',
The Journal of antibiotics, vol. 28, no. 9, pp. 717-719.
Pantos, O, Cooney, RP, Le Tissier, MD, Barer, MR, O'Donnell, AG & Bythell, JC 2003,
'The bacterial ecology of a plague‐like disease affecting the Caribbean coral
Montastrea annularis', Environmental Microbiology, vol. 5, no. 5, pp. 370-382.
Parisien, A, Allain, B, Zhang, J, Mandeville, R & Lan, C 2008, 'Novel alternatives to
antibiotics: bacteriophages, bacterial cell wall hydrolases, and antimicrobial peptides',
Journal of Applied Microbiology, vol. 104, no. 1, pp. 1-13.
Paul, JH, DeFlaun, MF & Jeffrey, WH 1986, 'Elevated levels of microbial activity in the
coral surface microlayer', Marine Ecology-Progress Series, vol. 33, no. 1, p. 29.
Pavel, AB & Vasile, CI 2012, 'PyElph - a software tool for gel images analysis and
phylogenetics', BMC Bioinformatics, vol. 13, p. 9.
Peters, E 1997, 'Diseases of coral-reef organisms', Life and death of coral reefs.
Chapman & Hall, New York, pp. 114-139.
Peters, EC 1993, 'Diseases of other invertebrate phyla: Porifera, cnidaria, ctenophora,
annelida, echinodermata', Pathobiology of Marine and Estuarine Organisms, pp. 393-
449.
Pinchuk, IV, Bressollier, P, Sorokulova, IB, Verneuil, B & Urdaci, MC 2002,
'Amicoumacin antibiotic production and genetic diversity of< i> Bacillus subtilis</i>
![Page 157: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/157.jpg)
P a g e | 118
strains isolated from different habitats', Research in Microbiology, vol. 153, no. 5, pp.
269-276.
Raven, J, Caldeira, K, Elderfield, H, Hoegh-Guldberg, O, Liss, P, Riebesell, U, Shepherd, J,
Turley, C & Watson, A 2005, Ocean acidification due to increasing atmospheric carbon
dioxide, The Royal Society.
Ravindran, J, Kannapiran, E, Manikandan, B, Francis, K, Arora, S, Karunya, E, Kumar, A,
Singh, SK & Jose, J 2013, 'UV-absorbing bacteria in coral mucus and their response to
simulated temperature elevations', Coral Reefs, vol. 32, no. 4, pp. 1043-1050.
Reshef, L, Koren, O, Loya, Y, Zilber-Rosenberg, I & Rosenberg, E 2006a, 'The Coral
Probiotic Hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.
Reshef, L, Koren, O, Loya, Y, Zilber‐Rosenberg, I & Rosenberg, E 2006b, 'The coral
probiotic hypothesis', Environmental Microbiology, vol. 8, no. 12, pp. 2068-2073.'
Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the
Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.
Richardson, LL, Goldberg, WM, Kuta, KG, Aronson, RB, Smith, GW, Ritchie, KB, Halas,
JC, Feingold, JS & Miller, SL 1998, 'Florida's mystery coral-killer identified', Nature, vol.
392, no. 6676, pp. 557-558.
Richardson, LL 2003, 'Aurantimonas coralicida gen. nov., sp. nov., the causative agent
of white plague type II on Caribbean scleractinian corals', International Journal of
Systematic and Evolutionary Microbiology, vol. 53, no. 4, pp. 1115-1122.
Richmond, RH 1993, 'Coral reefs: present problems and future concerns resulting from
anthropogenic disturbance', American Zoologist, vol. 33, no. 6, pp. 524-536.
![Page 158: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/158.jpg)
P a g e | 118
Rincón‐Rosales, R, Lloret, L, Ponce, E & Martínez‐Romero, E 2009, 'Rhizobia with
different symbiotic efficiencies nodulate Acaciella angustissima in Mexico, including
Sinorhizobium chiapanecum sp. nov. which has common symbiotic genes with
Sinorhizobium mexicanum', FEMS microbiology ecology, vol. 67, no. 1, pp. 103-117.
Ritchie, K & Smith, G 1998, 'Type II white-band disease', Rev Biol Trop, vol. 46, no.
suppl 5, pp. 199-203.
Ritchie, KB 2006, 'Regulation of microbial populations by coral surface mucus and
mucus-associated bacteria', Marine Ecology Progress Series, vol. 322, September 20,
2006, pp. 1-14.
Ritchie, KB, Dennis, J, McGrath, T & Smith, GW 1994, 'Bacteria associated with
bleached and nonbleached areas of Montastrea annularis,' Proc Symp Nat Hist
Bahamas, 75-80.
Ritchie, KB & Smith, GW 1995, 'Preferential carbon utilization by surface bacterial
communities from water mass, normal, and white-band diseased Acropora
cervicornis', Molecular Marine Biology and Biotechnology, vol. 4, no. 4, pp. 345-352.
Ritchie, KB & Smith, GW 2004, 'Microbial communities of coral surface
mucopolysaccharide layers', in Coral health and disease, Springer, pp. 259-264.
Richardson, L & Aronson, R 2002, 'Infectious diseases of reef corals,' Proceedings of the
Ninth International Coral Reef Symposium, Bali, 23-27 October 2000, 1225-1230.
Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria
associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1,
pp. 85-91.
![Page 159: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/159.jpg)
P a g e | 118
Radjasa OK. &Sabdono A. 2003, ‘Screening of Secondary Metabolite-Producing
Bacteria associated with Corals using 16S rDNA Based Approach’, Journal of Coastal
Development, vol.7, no.1, pp. 11-19.
Rodríguez-Moya, J, Argandoña, M, Iglesias-Guerra, F, Nieto, JJ & Vargas, C 2013,
'Temperature-and salinity-decoupled overproduction of hydroxyectoine by
Chromohalobacter salexigens', Applied and environmental microbiology, vol. 79, no. 3,
pp. 1018-1023.
Rodriguez-Lanetty, M, Harii, S & Hoegh-Guldberg, O 2009, 'Early molecular responses
of coral larvae to hyperthermal stress', Molecular Ecology, vol. 18, no. 24, pp. 5101-
5114.
Rohwer, F, Breitbart, M, Jara, J, Azam, F & Knowlton, N 2001, 'Diversity of bacteria
associated with the Caribbean coral Montastraea franksi', Coral Reefs, vol. 20, no. 1,
pp. 85-91.
Rohwer, F & Kelley, S 2004, 'Culture-independent analyses of coral-associated
microbes', in Coral health and disease, Springer, pp. 265-277.
Rohwer, F, Segall, A, Steward, G, Seguritan, V, Breitbart, M, Wolven, F & Azam, F 2000,
'The complete genomic sequence of the marine phage Roseophage SIOI shares
homology with nonmarine phages', Limnology and Oceanography, vol. 45, no. 2, pp.
408-418.
Rohwer, F, Seguritan, V, Azam, F & Knowlton, N 2002, 'Diversity and distribution of
coral-associated bacteria', Marine Ecology Progr.ess Series, vol. 243, no. 1.
Rohwer, F & Thurber, RV 2009, 'Viruses manipulate the marine environment', Nature,
vol. 459, no. 7244, pp. 207-212.
![Page 160: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/160.jpg)
P a g e | 118
Rosenberg, E & Ben-Haim, Y 2002, 'Microbial diseases of corals and global warming',
Environmental Microbiology, vol. 4, no. 6, pp. 318-326.
Rosenberg, E, Ben-Haim, Y, Toren, A, Banin, E, Kushmaro, A, Fine, M & Loya, Y 1999,
'Effect of temperature on bacterial bleaching of corals', Microbial ecology and
infectious disease. ASM Press, Washington, DC, pp. 242-254.
Rosenberg, E & Ben‐Haim, Y 2002, 'Microbial diseases of corals and global warming',
Environmental microbiology, vol. 4, no. 6, pp. 318-326.
Rosenberg, E & Falkovitz, L 2004, 'The Vibrio shiloi/Oculina patagonica model system
of coral bleaching', Annu. Rev. Microbiol., vol. 58, pp. 143-159.
Rosenberg, E, Koren, O, Reshef, L, Efrony, R & Zilber-Rosenberg, I 2007, 'The role of
microorganisms in coral health, disease and evolution', Nature Reviews Microbiology,
vol. 5, no. 5, pp. 355-362.
Rosenberg, E, Kushmaro, A, Kramarsky-Winter, E, Banin, E & Yossi, L 2008, 'The role of
microorganisms in coral bleaching', The ISME journal, vol. 3, no. 2, pp. 139-146.
Rua, CP, Trindade-Silva, AE, Appolinario, LR, Venas, TM, Garcia, GD, Carvalho, LS, Lima,
A, Kruger, R, Pereira, RC, Berlinck, RG, Valle, RA, Thompson, CC & Thompson, F 2014,
'Diversity and antimicrobial potential of culturable heterotrophic bacteria associated
with the endemic marine sponge Arenosclera brasiliensis', PeerJ, vol. 2, p. e419.
Rublee, PA, Lasker, HR, Gottfried, M & Roman, MR 1980, 'Production and bacterial
colonization of mucus from the soft coral Briarium asbestinum', Bulletin of Marine
Science, vol. 30, no. 4, pp. 888-893.
Rützler, K & Santavy, DL 1983, 'The black band disease of Atlantic reef corals', Marine
Ecology, vol. 4, no. 4, pp. 301-319.
![Page 161: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/161.jpg)
P a g e | 118
Saiki, RK, Gelfand, DH, Stoffel, S, Scharf, SJ, Higuchi, R, Horn, GT, Mullis, KB & Erlich, HA
1988, 'Primer-directed enzymatic amplification of DNA with a thermostable DNA
polymerase', Science, vol. 239, no. 4839, pp. 487-491.
Sambrook, J, Fritsch, EF & Maniatis, T 1989, Molecular cloning, Cold spring harbor
laboratory press New York.
Sandaa, RA, Clokie, M & Mann, NH 2008, 'Photosynthetic genes in viral populations
with a large genomic size range from Norwegian coastal waters', FEMS microbiology
ecology, vol. 63, no. 1, pp. 2-11.
Santavy, D & Peters, E 1997, 'Microbial pests: coral disease in the Western Atlantic,'
Proc 8th Int Coral Reef Symp, 607-612.
Schnell, S, Assmus, S & Richardson, L 1996, 'Role of sulfate reducing bacteria in the
black band disease of corals', Abstr. Annu. Meet. VAAM (Ver. Allg. Angew. Mikrobiol.)
GBCH (Ges. Biol. Chem.). Elsevier, Cologne, Germany, p. 116.
Schwebel, D & Margaretha, P 2000, 'Photocycloaddition of 2H‐1‐Benzopyran‐3‐
carbonitriles and 2H‐1‐Benzothiopyran‐3‐carbonitriles to Alkenes and Alkenynes',
Helvetica Chimica Acta, vol. 83, no. 6, pp. 1168-1174.
Shannon-Weaver 1963, Mathematical theory of communication, University Illinois
Press.
Sharon, G & Rosenberg, E 2008, 'Bacterial growth on coral mucus', Current
microbiology, vol. 56, no. 5, pp. 481-488.
Sharon, I, Tzahor, S, Williamson, S, Shmoish, M, Man-Aharonovich, D, Rusch, DB,
Yooseph, S, Zeidner, G, Golden, SS & Mackey, SR 2007, 'Viral photosynthetic reaction
![Page 162: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/162.jpg)
P a g e | 118
center genes and transcripts in the marine environment', The ISME journal, vol. 1, no.
6, pp. 492-501.
Shashar, N, Cohen, Y, Loya, Y & Sar, N 1994, 'Nitrogen fixation(acetylene reduction) in
stony corals: Evidence for coral-bacteria interactions', Marine ecology progress series.
Oldendorf, vol. 111, no. 3, pp. 259-264.
Shick, J, Lesser, M, Dunlap, W, Stochaj, W, Chalker, B & Won, JW 1995, 'Depth-
dependent responses to solar ultraviolet radiation and oxidative stress in the
zooxanthellate coral Acropora microphthalma', Marine Biology, vol. 122, no. 1, pp. 41-
51.
Shick, J, LESSER, MP & JOKIEL, PL 1996, 'Effects of ultraviolet radiation on corals and
other coral reef organisms', Global Change Biology, vol. 2, no. 6, pp. 527-545.
Shnit-Orland, M, Sivan, A & Kushmaro, A 2012, 'Antibacterial activity of
Pseudoalteromonas in the coral holobiont', Microb Ecol, vol. 64, no. 4, Nov, pp. 851-9.
Shnit‐Orland, M & Kushmaro, A 2009, 'Coral mucus‐associated bacteria: a possible first
line of defense', FEMS microbiology ecology, vol. 67, no. 3, pp. 371-380.
Short, CM & Suttle, CA 2005, 'Nearly identical bacteriophage structural gene
sequences are widely distributed in both marine and freshwater environments',
Applied and environmental microbiology, vol. 71, no. 1, pp. 480-486.
Slattery, M, McClintock, JB & Heine, JN 1995, 'Chemical defenses in Antarctic soft
corals: evidence for antifouling compounds', Journal of Experimental Marine Biology
and Ecology, vol. 190, no. 1, pp. 61-77.
Smith, B & Wilson, JB 1996, 'A consumer's guide to evenness indices', Oikos, pp. 70-82.
![Page 163: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/163.jpg)
P a g e | 118
Smith, GW, Ives, LD, Nagelkerken, IA & Ritchie, KB 1996, 'Caribbean sea-fan
mortalities',
Sneath, PH & Sokal, RR 1973, Numerical taxonomy. The principles and practice of
numerical classification.
Soffer, N, Zaneveld, J & Vega Thurber, R 2014, 'Phage-bacteria network analysis and its
implication for the understanding of coral disease', Environ Microbiol, Jul 8
Sørensen, T 1948, '{A method of establishing groups of equal amplitude in plant
sociology based on similarity of species and its application to analyses of the
vegetation on Danish commons}', Biol. skr., vol. 5, pp. 1-34.
Sorokin, YI 1973, 'On the feeding of some scleractinian corals with bacteria and
dissolved organic matter', Limnol Oceanogr, vol. 18, no. 3, pp. 380-385.
Sorokin, YI 1978, 'Microbial-production in coral-reef community', Archiv fur
Hydrobiologie, vol. 83, no. 3, pp. 281-323.
Soto-Rodriguez, S, Roque, A, Lizarraga-Partida, M, Guerra-Flores, A & Gomez-Gil, B
2003, 'Virulence of luminous vibrios to Artemia franciscana nauplii', Diseases of aquatic
organisms, vol. 53, no. 3, pp. 231-240.
Sullivan, MB, Coleman, ML, Quinlivan, V, Rosenkrantz, JE, DeFrancesco, AS, Tan, G, Fu,
R, Lee, JA, Waterbury, JB & Bielawski, JP 2008, 'Portal protein diversity and phage
ecology', Environmental microbiology, vol. 10, no. 10, pp. 2810-2823.
Sullivan, MB, Coleman, ML, Weigele, P, Rohwer, F & Chisholm, SW 2005, 'Three
Prochlorococcus cyanophage genomes: signature features and ecological
interpretations', PLoS biology, vol. 3, no. 5, p. e144.
![Page 164: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/164.jpg)
P a g e | 118
Sullivan, MB, Krastins, B, Hughes, JL, Kelly, L, Chase, M, Sarracino, D & Chisholm, SW
2009, 'The genome and structural proteome of an ocean siphovirus: a new window
into the cyanobacterial ‘mobilome’', Environmental microbiology, vol. 11, no. 11, pp.
2935-2951.
Sullivan, MB, Lindell, D, Lee, JA, Thompson, LR, Bielawski, JP & Chisholm, SW 2006,
'Prevalence and evolution of core photosystem II genes in marine cyanobacterial
viruses and their hosts', PLoS biology, vol. 4, no. 8, p. e234.
Sunagawa, S, DeSantis, TZ, Piceno, YM, Brodie, EL, DeSalvo, MK, Voolstra, CR, Weil, E,
Andersen, GL & Medina, M 2009, 'Bacterial diversity and White Plague Disease-
associated community changes in the Caribbean coral Montastraea faveolata', ISME J,
vol. 3, no. 5, May, pp. 512-21.
Sussman, M, Loya, Y, Fine, M & Rosenberg, E 2003, 'The marine fireworm Hermodice
carunculata is a winter reservoir and spring‐summer vector for the coral‐bleaching
pathogen Vibrio shiloi', Environmental Microbiology, vol. 5, no. 4, pp. 250-255.
Sussman, M, Willis, BL, Victor, S & Bourne, DG 2008, 'Coral pathogens identified for
white syndrome (WS) epizootics in the Indo-Pacific', PLoS One, vol. 3, no. 6, p. e2393.
Sutherland, KP, Porter, JW & Torres, C 2004, 'Disease and immunity in Caribbean and
Indo-Pacific zooxanthellate corals', Marine ecology progress series, vol. 266, pp. 265-
272.
Suttle, CA & Chen, F 1992, 'Mechanisms and rates of decay of marine viruses in
seawater', Applied and Environmental Microbiology, vol. 58, no. 11, pp. 3721-3729.
![Page 165: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/165.jpg)
P a g e | 118
Szmant, A & Gassman, N 1990, 'The effects of prolonged “bleaching” on the tissue
biomass and reproduction of the reef coral Montastrea annularis', Coral reefs, vol. 8,
no. 4, pp. 217-224.
Takami, H, Kobata, K, Nagahama, T, Kobayashi, H, Inoue, A & Horikoshi, K 1999,
'Biodiversity in deep-sea sites located near the south part of Japan', Extremophiles, vol.
3, no. 2, pp. 97-102.
Teo, JW, Zhang, L-H & Poh, CL 2003, 'Cloning and characterization of a metalloprotease
from< i> Vibrio</i>< i> harveyi</i> strain AP6', Gene, vol. 303, pp. 147-156.
Thurber, RLV, Barott, KL, Hall, D, Liu, H, Rodriguez-Mueller, B, Desnues, C, Edwards, RA,
Haynes, M, Angly, FE & Wegley, L 2008, 'Metagenomic analysis indicates that stressors
induce production of herpes-like viruses in the coral Porites compressa', Proceedings of
the National Academy of Sciences, vol. 105, no. 47, pp. 18413-18418.
Toren, A, Landau, L, Kushmaro, A, Loya, Y & Rosenberg, E 1998, 'Effect of Temperature
on Adhesion ofVibrio Strain AK-1 to Oculina patagonica and on Coral Bleaching',
Applied and environmental microbiology, vol. 64, no. 4, pp. 1379-1384.
Tucker, KP, Parsons, R, Symonds, EM & Breitbart, M 2011, 'Diversity and distribution of
single-stranded DNA phages in the North Atlantic Ocean', ISME J, vol. 5, no. 5, May, pp.
822-30.
Vacelet, E & Thomassin, BA 1991, 'Microbial utilization of coral mucus in long term in
situ incubation over a coral reef', Hydrobiologia, vol. 211, no. 1, pp. 19-32.
Velho-Pereira, S & Furtado, I 2012, 'Antibacterial activity of halophilic bacterial bionts
from marine invertebrates of Mandapam-India', Indian journal of pharmaceutical
sciences, vol. 74, no. 4, p. 331.
![Page 166: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/166.jpg)
P a g e | 118
Verdugo, P 1990, 'Goblet cells secretion and mucogenesis', Annual review of
physiology, vol. 52, no. 1, pp. 157-176.
Vidal-Dupiol, J, Ladrière, O, Destoumieux-Garzón, D, Sautière, P-E, Meistertzheim, A-L,
Tambutté, E, Tambutté, S, Duval, D, Fouré, L & Adjeroud, M 2011, 'Innate immune
responses of a scleractinian coral to vibriosis', Journal of Biological Chemistry, vol. 286,
no. 25, pp. 22688-22698.
Vob, U, Larrieu, A & Wells, DM 2013, 'From jellyfish to biosensors: the use of
fluorescent proteins in plants', International journal of developmental biology, vol. 57,
no. 6, pp. 525-533.
Walker, R, Powell, A & Seddon, B 1998, 'Bacillus isolates from the spermosphere of
peas and dwarf French beans with antifungal activity against Botrytis cinerea and
Pythium species', Journal of Applied Microbiology, vol. 84, no. 5, pp. 791-801.
Ward, JR, Kim, K & Harvell, C 2007, 'Temperature affects coral disease resistance and
pathogen growth', Marine Ecology Progress Series, vol. 329, pp. 115-121.
Wegley, L, Edwards, R, Rodriguez-Brito, B, Liu, H & Rohwer, F 2007, 'Metagenomic
analysis of the microbial community associated with the coral Porites astreoides',
Environ Microbiol, vol. 9, no. 11, Nov, pp. 2707-19.
Wegley, L, Yu, Y, Breitbart, M, Casas, V, Kline, DI & Rohwer, F 2004, 'Coral-associated
archaea', Marine Ecology Progress Series, vol. 273, pp. 89-96.
Weigele, PR, Pope, WH, Pedulla, ML, Houtz, JM, Smith, AL, Conway, JF, King, J, Hatfull,
GF, Lawrence, JG & Hendrix, RW 2007, 'Genomic and structural analysis of Syn9, a
![Page 167: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/167.jpg)
P a g e | 118
cyanophage infecting marine Prochlorococcus and Synechococcus', Environmental
microbiology, vol. 9, no. 7, pp. 1675-1695.
Weil, E, Smith, G & Gil-Agudelo, DL 2006, 'Status and progress in coral reef disease
research', Diseases of Aquatic Organisms, vol. 69, no. 1, pp. 1-7.
Weinbauer, MG & Rassoulzadegan, F 2004, 'Are viruses driving microbial diversification
and diversity?', Environmental microbiology, vol. 6, no. 1, pp. 1-11.
Weisenborn, F, Brown, W & Meyers, E 1984, 'Antibiotic kristenin from Bacillus subtilis
ATCC 31340 useful as against Gram-positive bacteria', Unlisted-Drug, vol. 36, p. 9Q.
Weld, RJ, Butts, C & Heinemann, JA 2004, 'Models of phage growth and their
applicability to phage therapy', Journal of theoretical biology, vol. 227, no. 1, pp. 1-11.
Wiese, J, Thiel, V, Nagel, K, Staufenberger, T & Imhoff, JF 2009, 'Diversity of antibiotic-
active bacteria associated with the brown alga Laminaria saccharina from the Baltic
Sea', Marine Biotechnology, vol. 11, no. 2, pp. 287-300.
Wild, C, Huettel, M, Klueter, A, Kremb, SG, Rasheed, MY & Jørgensen, BB 2004a, 'Coral
mucus functions as an energy carrier and particle trap in the reef ecosystem', Nature,
vol. 428, no. 6978, pp. 66-70.
Wild, C, Rasheed, M, Werner, U, Franke, U, Johnstone, R & Huettel, M 2004b,
'Degradation and mineralization of coral mucus in reef environments', Marine ecology.
Progress series, vol. 267, pp. 159-171.
Wilhelm, SW & Suttle, CA 1999, 'Viruses and Nutrient Cycles in the Sea Viruses play
critical roles in the structure and function of aquatic food webs', Bioscience, vol. 49, no.
10, pp. 781-788.
![Page 168: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/168.jpg)
P a g e | 118
Wilkinson, C & Network, GCRM 2008, Status of coral reefs of the world: 2008, Global
Coral Reef Monitoring Network Townsville.
Wilkinson, CR 1999, 'Global and local threats to coral reef functioning and existence:
review and predictions', Marine and Freshwater Research, vol. 50, no. 8, pp. 867-878.
Wilkinson, CR & Buddemeier, RW 1994, Global Climate Change and Coral Reefs:
Implications for People and Reefs: Report of the UNEP-IOC-ASPEI-IUCN Global Task
Team on the Implications of Climate Change on Coral Reefs, IUCN.
Williamson, SJ, Rusch, DB, Yooseph, S, Halpern, AL, Heidelberg, KB, Glass, JI, Andrews-
Pfannkoch, C, Fadrosh, D, Miller, CS & Sutton, G 2008, 'The Sorcerer II Global Ocean
Sampling Expedition: metagenomic characterization of viruses within aquatic microbial
samples', PloS one, vol. 3, no. 1, p. e1456.
Wilson W., Dale A., Davy, J & Davy, S 2005, 'An enemy within? Observations of virus-
like particles in reef corals', Coral Reefs, vol. 24, no. 1, pp. 145-148.
Wommack, KE & Colwell, RR 2000, 'Virioplankton: viruses in aquatic ecosystems',
Microbiology and molecular biology reviews, vol. 64, no. 1, pp. 69-114.
Wu, Z, Milton, D, Nybom, P, Sjö, A & Magnusson, K-E 1996, Vibrio cholerae
hemagglutinin/protease (HA/protease) causes morphological changes in cultured
epithelial cells and perturbs their paracellular barrier function', Microbial
pathogenesis, vol. 21, no. 2, pp. 111-123.
Yokouchi, H, Fukuoka, Y, Mukoyama, D, Calugay, R, Takeyama, H & Matsunaga, T 2006,
'Whole-metagenome amplification of a microbial community associated with
![Page 169: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/169.jpg)
P a g e | 118
scleractinian coral by multiple displacement amplification using phi29 polymerase',
Environ Microbiol, vol. 8, no. 7, Jul, pp. 1155-63.
Yonge, CM 1940, The biology of reef-building corals, British Museum (Natural History).
Yoshizawa, S, Wada, M, Kita-Tsukamoto, K, Ikemoto, E, Yokota, A & Kogure, K 2009,
'Vibrio azureus sp. nov., a luminous marine bacterium isolated from seawater', Int J
Syst Evol Microbiol, vol. 59, no. Pt 7, Jul, pp. 1645-9.
Zeng, Z, Qian, L, Cao, L, Tan, H, Huang, Y, Xue, X, Shen, Y & Zhou, S 2008, 'Virtual
screening for novel quorum sensing inhibitors to eradicate biofilm formation of
Pseudomonas aeruginosa', Applied microbiology and biotechnology, vol. 79, no. 1, pp.
119-126.
Zheng, L, Chen, H, Han, X, Lin, W & Yan, X 2005, 'Antimicrobial screening and active
compound isolation from marine bacterium NJ6-3-1 associated with the sponge
Hymeniacidon perleve', World Journal of Microbiology and Biotechnology, vol. 21, no.
2, pp. 201-206.
Zhong, Y, Chen, F, Wilhelm, SW, Poorvin, L & Hodson, RE 2002, 'Phylogenetic Diversity
of Marine Cyanophage Isolates and Natural Virus Communities as Revealed by
Sequences of Viral Capsid Assembly Protein Gene g20', Applied and Environmental
Microbiology, vol. 68, no. 4, pp. 1576-1584.
State of Reefs , May 1995. Available from: <
http://www.ncdc.noaa.gov/paleo/outreach/coral/sor/sor_contents.html#toc >. [9 July
2014].
WTW Xylem Brand. Available from: <http://www.wtw.de/en/home.html >. [10 August
2014].
![Page 170: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/170.jpg)
P a g e | 118
LI-COR Environmental Home. Available from:
<http://www.licor.com/env/products/gas_analysis/LI-820/features.html >. [9 July
2014].
UK Ocean Acidification Research Programme. Available from: <
http://www.oceanacidification.org.uk>. [5 July 2014].
![Page 171: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/171.jpg)
P a g e | 118
APPENDIX
Table 1: 16S rRNA gene sequence analysis of bacterial cultures from Trachyphyllia
geoffroyi based on BLAST analysis.
Species Closest match Identities %/bp Phylogenetic division
Trachyphyllia
geoffroyi.
WEEK 1(1)
Vibrio rotiferianus
[KC534191]
97%/1420bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 1(12)
Vibrio alginolyticus
[KC734518]
99%/899bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 1(13)
Pseudoalteromonas
piscicida [FJ457196]
99%/1371bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 1(9)
Pseudoalteromonas
flavipulchra
[JQ409375]
91%./1338bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 2(3)
Vibrio
parahaemolyticus
[JF432066]
99%/1453bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 2(4)
Vibrio alginolyticus
[JN188406]
99%/1459bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
Vibrio
parahaemolyticus
99%/1450bp GammaProteobacteriaia
![Page 172: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/172.jpg)
P a g e | 118
WEEK 2(9) [DQ991216]
Trachyphyllia
geoffroyi
WEEK 3(1)
Vibrio communis
[JQ663883]
99%/1431bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 3(10)
Lysinibacillus
fusiformis
[JF343177]
97%/1437bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 3(2)
Vibrio owensii
[GQ281105]
99%/1464bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 3(3)
Vibrio harveyi
[DQ995246]
99%/775bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 3(5)A
Vibrio communis
[HQ161734]
99%/1423bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 3(6)
Vibrio
parahaemolyticus
[JN188419]
99%/1456bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 4(1)
Chromahaobacter
salaxigen
[GU397381]
100%/934bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 4(6)
Vibrio coralliitycus
[NR117892]
99%/1471bp GammaProteobacteriaia
![Page 173: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/173.jpg)
P a g e | 118
Trachyphyllia
geoffroyi
WEEK 5(1)
Lysinibacillus
boronitolerans
[FJI74646]
99%/1045bp Bacilli
Trachyphyllia
geoffroyi
WEEK 5(11)
Vibrio sp. Persian
[KC765089]
99%/1443bp
GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 5(15)
Vibrio owensii
[JX280419]
100%/1418bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 5(17)
Pseudomonas
plecoglossicida
[EU594553]
97%/1445bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 5(18)
Pseudomonas
plecoglossicida
[KF358256]
97%/1441bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 5(20)
Lysinibacillus
fusiformis
[KC775773]
99%/1457bp Bacilli
Trachyphyllia
geoffroyi
WEEK 5(21)
Lysinibacillus
fusiformis
[KF916674]
98%/1445bp Bacilli
Trachyphyllia
geoffroyi
WEEK 5(9)
Bacillus thuringiensis
[FJ61355]
99%/908bp Bacilli
![Page 174: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/174.jpg)
P a g e | 118
Trachyphyllia
geoffroyi
WEEK 7(2)
Bacillus subtilis
[HQ684005]
99%/1464bp Bacilli
Trachyphyllia
geoffroyi
WEEK 1(7)
Bacillus cereus
[KF841622],
99%/1420bp Bacilli
Trachyphyllia
geoffroyi
WEEK 7(5)
Bacillus cereus
[K376341]
100%/1042bp Bacilli
Trachyphyllia
geoffroyi
WEEK 8(11)
Chromahaobacter
salaxigen [KJ676975]
99%/1424bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK C3(16)
Vibrio communis
[JQ663883]
99%/1431bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 8(1)
Bacillus cereus
[JN944764]
97%/1402bp Bacilli
Trachyphyllia
geoffroyi
WEEK 8(2)
Oceanobacillus sp.
[KC433666]
88%/883bp Bacilli
Trachyphyllia
geoffroyi
WEEK 8(4)
Bacillus cereus
[JQ311944]
95%/759bp Bacilli
Trachyphyllia
geoffroyi
Vibrio harveyi
[HM008704]
99%/1414bp GammaProteobacteriaia
![Page 175: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/175.jpg)
P a g e | 118
WEEK 8(5)
Trachyphyllia
geoffroyi
WEEK 5(14)
Vibrio owensii
[HQ908697]
99%/1464bp GammaProteobacteriaia
Trachyphyllia
geoffroyi
WEEK 4(8)
Vibrio owensii
[HQ908697]
99%/1464bp GammaProteobacteriaia
![Page 176: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/176.jpg)
P a g e | 118
Table 2: 16S rRNA gene sequence analysis of bacterial cultures from Euphyllia
ancora., based on BLAST analysis
Species Closest match %/bp Phylogenetic division
Euphyllia ancora
WEEK 1(3)
Vibrio
parahaemolyticus
[JN188419]
97%/1448bp GammaProteobacteria
Euphyllia
ancoraWEEK 1(6)
Lysinibacillus
sphaericus [JX286700]
99%/1186bp Bacilli
Euphyllia
ancoraWEEK 1(7)
Vibrio proteolyticus
[AF513463]
99%/1432bp GammaProteobacteria
Euphyllia ancora.
WEEK 1(8)
Lysinibacillus
fusiformis [JX286689]
99%/1273bp Bacilli
Euphyllia
ancoraWEEK
2(10)
Lysinibacillus
fusiformis [HM101171]
99%/1471bp Bacilli
Euphyllia ancora.
WEEK 2(2)
Bacillus cereus
[EU621383]
100%/1273bp Bacilli
Euphyllia
ancoraWEEK
2(5)A
Lysinibacillus
fusiformis [FJ973545]
99%/1460bp Bacilli
Euphyllia
ancoraWEEK
3(1)A
Vibrio owensii
[HQ908697]
99%/1464bp GammaProteobacteria
Euphyllia
ancoraWEEK
Vibrio azureus 99%/1431bp GammaProteobacteria
![Page 177: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/177.jpg)
P a g e | 118
3(15) [JN188419]
Euphyllia
ancoraWEEK
3(3)A
Vibrio shilonii
[NR118242]
99%/815bp GammaProteobacteria
Euphyllia
ancoraWEEK
3(6)A
Vibrio harveyi
[FJ161275]
99%/1060bp GammaProteobacteria
Euphyllia
ancoraWEEK
4(10)
Vibrio coralliilyticus
[NR028014]
99%/1444bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(4)
Photobacterium
rosenbergii
[HQ449973]
97%/1193bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(7)
Bacillus firmus
[JN700106]
100%/1410bp Bacilli
Euphyllia
ancoraWEEK
5(17)
Vibrio harveyi
[FJ161275]
99%/1060bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(9)
Vibrio coralliilyticus
[JQ307093]
99%/1465bp GammaProteobacteria
Euphyllia
ancoraWEEK 5(1)
Vibrio owensii
[JX2804419]
99%/1418bp GammaProteobacteria
Euphyllia
ancoraWEEK
5(12)
Shewanella haliotis
[KF500918]
99%/1436bp GammaProteobacteria
![Page 178: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/178.jpg)
P a g e | 118
Euphyllia
ancoraWEEK
5(15)
Vibrio alginolyticus
[KC734518]
97%/899bp GammaProteobacteria
Euphyllia
ancoraWEEK
5(16)
Vibrio communis
[HQ161734]
99%/1423bp GammaProteobacteria
Euphyllia
ancoraWEEK
5(20)
Vibrio
communis[JQ663883]
99%/1431bp GammaProteobacteria
Euphyllia
ancoraWEEK
5(23)
Vibrio owensii
[HQ908673]
99%/1464bp GammaProteobacteria
Euphyllia
ancoraWEEK
5(24)
Shewanella haliotis
[KF500918]
86%/1436bp GammaProteobacteria
Euphyllia
ancoraWEEK 5(6)
Vibrio campbellii
[KC534273]
99%/1413bp GammaProteobacteria
Euphyllia
ancoraWEEK 5(8)
Shewanella sp.
[KC335140]
99%/1436bp GammaProteobacteria
Euphyllia
ancoraWEEK 6(3)
Bacillus cereus
[JX317637]
99%/1448bp Bacilli
Euphyllia
ancoraWEEK
C2(4)
Vibrio harveyi
[FJ161275]
99%/1457bp GammaProteobacteria
Euphyllia
ancoraWEEK
Vibrio azureus 99%/1455bp GammaProteobacteria
![Page 179: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/179.jpg)
P a g e | 118
C3(3) [JQ663884]
Euphyllia
ancoraWEEK
C3(6)
Vibrio neocalledonicus
[KJ841877]
99%/1517bp GammaProteobacteria
Euphyllia
ancoraWEEK 8(2)
Bacillus thuringiensis
[FJ897722]
96%/1425bp Bacilli
Euphyllia
ancoraWEEK 4(2)
Vibrio owensii [FJ5062] 99%/1464bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(8)
Photobacterium
leiognathi[FJ240417]
97%/1193bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(3)
Photobacterium
leiognathi [AB680576]
95%/1469bp GammaProteobacteria
Euphyllia
ancoraWEEK 4(5)
Pseudomoalteromonas
rubra [JQ409378]
97%/1411bp GammaProteobacteria
Euphyllia
ancoraWEEK
4(16)A
Vibrio mediterranei
[HF541959]
96%/1484bp GammaProteobacteria
Euphyllia
ancoraWEEK 8(6)
Bacillus cereus
[KF591117]
95%/1438bp Bacilli
Euphyllia
ancoraWEEK
8(13)
Vibrio owensii
[AB719181]
89%/809bp GammaProteobacteria
![Page 180: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/180.jpg)
P a g e | 118
Table 3: 16S rRNA gene sequence analysis of bacterial cultures from Corallimorphs
sp., based on BLAST analysis.
Species Closest match Identities %/bp Phylogenetic division
Corralimorphs
sp. WEEK 1(1)
Vibrio harveyi
[GQ249053]
99%/1461bp GammaProteobacteria
Corralimorphs
sp. WEEK 1(2)
Vibrio rotiferianus
[KC534191]
99%/1433bp GammaProteobacteria
Corralimorphs
sp. WEEK 1(6)
Vibrio harveyi
[DQ995240
99%/775bp GammaProteobacteria
Corralimorphs
sp. WEEK 1(8)
Vibrio brasiliensis
[JF721971]
98%/1044bp GammaProteobacteria
Corralimorphs
sp. WEEK 2(2)
Vibrio alginolyticus
[JN188403]
99%/1461bp GammaProteobacteria
Corralimorphs
sp. WEEK 2(4)
Vibrio
parahaemolyticus
[JF432066],
99%/1453bp GammaProteobacteria
Corralimorphs
sp. WEEK 2(5)
Vibrio
azureus[JQ663884]
99%/1387bp GammaProteobacteria
Corralimorphs
sp. WEEK 2(7)
Lysinibacillus
fusiformis [JN416567]
99%/1455bp Bacilli
Corralimorphs
sp. WEEK
3(10)
Vibrio alginolyticus
[JN188406]
99%/1459bp GammaProteobacteria
![Page 181: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/181.jpg)
P a g e | 118
Corralimorphs
sp. WEEK
3(11)
Vibrio alginolyticus
[KC734518]
99%/899bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
4(10)
Vibrio
parahaemolyticus
[KC210812]
99%/1434bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 4(2)
Photobacterium
leiognathi [FJ240415]
95%/1460bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 4(3)
Vibrio owensii
[JX280419]
99%/1418bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 4(4)
Vibrio harveyi
[GQ203111]
99%/1436bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
5(10)
Vibrio harveyi
[DQ995246]
99%/775bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
5(12)
Bacillus sphaericus
[DQ923492]
99%/1427bp Bacilli
Corralimorphs
sp. WEEK
5(13)
Lysinibacillus
fusiformis
[HQ829830]
99%/1048bp Bacilli
Corralimorphs
sp. WEEK
5(15)
Pseudoalteromonas
prydensis
[HM583997]
99%/942bp GammaProteobacteriaia
Corralimorphs Vibrio owensii 99%/1463bp GammaProteobacteriaia
![Page 182: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/182.jpg)
P a g e | 118
sp. WEEK 5(2) [HQ908694]
Corralimorphs
sp. WEEK 5(6)
Vibrio harveyi
[K700304]
99%/884bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 6(2)
Lysinibacillus
fusiformis [AB732972]
99%/1458bp Bacilli
Corralimorphs
sp. WEEK 6(8)
Pseudomonas
plecoglossicida
[KF358256]
86%/1311bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
C2(2)
Vibrio communis
[HQ161744]
99%/1420bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 2(1)
Vibrio alginolyticus
[EU249987]
99%/1433bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 7(4)
Bacillus cereus
[HQ670590]
99%738/bp Bacilli
Corralimorphs
sp. WEEK 7(9)
Desulfovibrio vulgaris
[KC462187]
100%/1449bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
8(14)
Bacillus thuriengiensis
[FJ897722]
94%/1425bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 8(2)
Pseudoalteromonas
prydensis
[HM584031]
99%/945bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 8(5)
Vibrio harveyi
[KJ00304]
99%/1078bp GammaProteobacteriaia
![Page 183: Community analysis of coral mucus-associated bacteria and](https://reader030.vdocuments.us/reader030/viewer/2022012500/617971df6e597d7ba57bc128/html5/thumbnails/183.jpg)
P a g e | 118
Corralimorphs
sp. WEEK 8(1)
Lysinibacillus
fusiformis [JN012077]
99%/1458bp Bacilli
Corralimorphs
sp. WEEK 8(3)
Vibrio harveyi
[KJ00304]
99%/1464bp GammaProteobacteriaia
Corralimorphs
sp. WEEK 8(6)
Lysinibacillus
fusiformis
[KM817206]
100%/1506bp Bacilli
Corralimorphs
sp. WEEK 8(9)
Vibrio owensii
[HQ908687]
99%/1464bp GammaProteobacteriaia
Corralimorphs
sp. WEEK
8(10)
Lysinibacillus
sphaericus [FJ844477]
100%/1286bp Bacilli