coding region deletions associated with the major form of rdna

volume g Number ig 1981 Nucleic Acids Research

Coding region deletions associated with the major form of rDNA interruption in Drosophilamelanogaster

Peter M.M.Rae

Department of Biology, Yale University, New Haven, CT 06511, USA

Received 24 June 1981

ABSTRACTThe nucleotide sequences at and around the termini of 5 kb type 1 inter-

ruptions in three separate clones of D. melanogaster rDNA repeats have beendetermined, and have been compared with the sequence of the corresponding re-gion of an insertion-free rDNA repeat. All three interrupted rDNA repeatscontain a small deletion of 28S rRNA coding material at the left coding/inser-tion sequence junction. A second deletion was found in one of the threeclones, and other aberrations were suggested by the results of restrictionenzyme digestions of unfractionated rDNA. The termini of 5 kb type 1 rDNAinsertions in D. melanogaster were also compared with the corresponding re-gions of 28S rDNA interruptions in D. virilis: the insertion site is identi-cal in the two species, but the termini of the two species' interruptionsshow no homology. I sequenced a 1.1 kb region of the 5 kb type 1 D. mela-nogaster rDNA interruption that covers the sequences of the 1 kb and 0.5 kbinsertions. There is 98$ homology between the rightmost 1 kb of the 5 kbinterruption and the sequences of the shorter insertions. Data suggest thatDrosophila rDNA interruptions arose as a transposable element, and that diver-gence has included length alterations generated by unequal crossing over.

INTRODUCTION

Nearly two-thirds of the ribosomal DNA repeats in the Drosophila melano-

gaster genome contain interrupted 28S rRNA coding regions (Glover and Hogness,

1977; White and Hogness, 1977; Wellauer and Dawid, 1977; Pellegrini et al.,

1977). The insertions are of two classes, type 1 and type 2 (Dawid e_t al.,

1978; Wellauer and Dawid, 1978), neither of which shows appreciable in vivo

transcription (Long and Dawid, 1979; Jolly and Thomas, 1979; Long et al.,

1980). Type 1 insertions are heterogeneous in length, ranging from about 0.5

kb to about 6 kb; all are related insofar as the 0.5 kb insertion is homolo-

gous with the right end of 1 kb insertions, and these are homologous with the

right end of 5 kb insertions (Dawid e_t al., 1978; Wellauer and Dawid, 1978).

About one-third of all rDNA repeats in D. melanogaster contain a 5 kb type 1

insertion. Type 2 insertions are also complex, and they share no sequence

homology with type 1 insertions (Long et al., 1980; Roiha and Glover, 1980).

The 5 kb type 1 insertions are the subject of this report. We have al-

© IRL Press Umited, 1 Falconberg Court, London W1V 5FG. U.K. 4997

Downloaded from https://academic.oup.com/nar/article-abstract/9/19/4997/2375490by gueston 18 March 2018

Nucleic Acids Research

ready shown the sequences at coding region/interruption junctions in D. viri-

lis rDNA, and have suggested that rDNA insertions arose as a transposable

element (Rae e_t al., 1980)- Here, it is shown that 5 kb type 1 insertions in

D. melanogaster rDNA have one flank in common with D. virilis interruptions,

and that the other has incurred short deletions of coding sequence. Further,

the termini of the two species' interruptions have no homology [although

there are internal related regions (Barnett and Rae, 1979)]- The sequence of

the rightmost fifth of a 5 kb insertion is given and is compared with the

shorter type 1 insertions and their flanks (Dawid and Rebbert, 1981).

MATEBIALS AND METHODS

The D. melanogaster rDNA plasmids pDmra51, pDmrd51 and pDmra56 were pre-

pared from clones provided by I.B. Dawid; they are described in Dawid et al.

(1978). The plasmid pKB7 (Beckingham and White, 1979), which contains the 16

kb D. melanogaster rDNA segment of cDmlO3 (Glover and Hogness, 1977), was

obtained from T. Barnett. All of these rDNA segments terminate at Eco RI

sites; Dmra51 is a representative of rDNA repeat units that are free of an

interruption in the 28S rRNA coding region, while the others are members of

the class of repeats which contain a 5 kb type 1 interruption in the 28S gene.

Samples of embryo DNA of the Canton S and Oregon R strains of D. melanogaster

were provided by M. Levine.

Maps of restriction enzyme cleavage sites in the D. melanogaster rDNA

units are shown in Figure 1. The low resolution maps are largely from Dawid

et al. (1978); restriction sites in portions expanded 10-fold were located

according to Smith and Birnstiel (1976) or by direct nucleotide sequencing

(Maxam and Gilbert, 1980). DNA segments to be sequenced or subjected to par-

tial restriction enzyme digestion were 51 end-labelled using y r-ATP and T,

polynucleotide kinase (Maxam and Gilbert, 1980), or 31 end-labelled using an

a T'-dNTP and the KLenow fragment of E. coli DNA polymerase (Smith et al.,

1979)• DNA segments labelled at one end were prepared from doubly end-label-

led segments by cleavage with an appropriate restriction enzyme, preparative

gel electropnoresis in low melting temperature agarose, and phenol extraction.

Alternatively, complementary strands of end-labelled segments were separated

by acrylamide gel electrophoresis prior to sequencing (Maxam and Gilbert,

1980).

RESULTS

The maps in Figure 1 illustrate the two major classes of ribosomal DNA

4998



interveningI8S 28S sequence 28S" spacer

f T

I8S9 [KB7,Dmrd5l

lDmra56

Fig. 1. Maps of cloned segments of D. melanogaster rDNA. KB7, Dmrd51 andDmra56 contain 5 kb type 1 interruptions in the 28S rRNA coding region; Dmra51contains an intact 28S rRNA coding sequence. In these maps, all of the BamHI, Eco RI, Hind III, Sal I and Sma I sites are shown; this is not so for theother enzymes listed except within the ten-fold expanded portions involvingcoding/insertion sequence junctions. Also shown by thin horizontal arrowsare the lengths of DNA that were sequenced. The 28S' and 28S" junctions havebeen sequenced after 51 end-labelling in all three interrupted clones, andafter 31 end-labelling as well in KB7. The block marked with an asterisk nearthe 28S1 junction indicates the position of a 49 base pair deletion in Dmra56.

repeat unit in Drosophila melanogaster. I constructed detailed restriction

site maps and undertook nucleotide sequencing of the coding/insertion sequence

junction regions in pKB7, then conducted similar analyses of pDmrd51, pDmra56,

and of the intact 28S rRNA gene in pDmra51. The results of mapping studies

are shown in the 10-fold expanded segments in Figure 1; also indicated are

the regions that were sequenced to cover the junctions.

We mentioned elsewhere (Rae et al., 1980) that the right end of the in-

sertion in KB7 (Dml03) abutts the 28S" rRNA coding region at precisely the

same place as does the D. virilis rDNA interruption. This is shown in line D

of Figure 2. The coding region at the right flank of the interruption begins

with the sequence TGTCCCTATCTACT, which is the direct repeat of coding se-

4999



D. vir i l is FnuDII HinflA (DvLl-2) CGCGCATGAATGGATTAACGAGATTCCTACTGTCCCTATCTACTCAGTTCGTTTCAGACAGTCGTTGGG... 31

D. melanogaster HhalB (KB7, 0mra56, CGCGCATGAATGGAnAACGACGAACGTGTnTCGTTGCGCTCGTGAACATAGTGCGAAGAACTTTGTT... 3' 28S1 j u n c t i o n

Dmrd51)

C (Dmra51) CGCGCATGAATGGAnAACGAGATTCCTACTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGGA...3' i n t a c t gene

Bam HID (KB7) GGATCCGAAAAAAGCATACATTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGGA... 3' 28S" junction

(Dmra56, Dmrd51) 6GATCCGAAAAGCATACAT=

D. virilisE (DvLl-2) GGTGCTCACGTTAAGCCCACTGACTTTCATGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGGA...3'

Fig. 2. A comparison of sequences at the 28S1 and 28S" coding/insertion se-quence junctions in clones of D. melanogaster and D. virilis rDNA. The D.virilis sequences (lines A and E) are from Rae e_t al. (1980). The singlyunderlined sequences are found in the intact 23S rRNA coding region. The 14nucleotides of this sequence that are duplicated at the ends of the D. virilisrDNA interruption, and are present at the 28S" end of the 5 kb type 1 D. me-lanogaster rDNA insertion, are doubly underlined.

quence at both ends of D. virilis interruptions. The rightmost Bam HI site

in the KB7 insertion is 20 base pairs from the junction; this portion of the

interruption in KB7 differs slightly from the corresponding sequence in two

other D. melanogaster rDNA clones to the extent that in Dmra56 and Dmrd51,

there is a run of four deoxyadenylates rather than six.

The left (28S1) end of the D. virilis rDNA interruption shares the flan-

king TGTCCCTATCTACT coding sequence with the right end (Rae et al., 1980).

In the cloned D. melanogaster rDNA repeats containing 5 kb type 1 interrup-

tions, this 28S1 copy of the tetrakaidecanucleotide is absent. Indeed, an

additional nine base pairs of rRNA coding sequence are missing, as can be

seen from a comparison of lines B and C in Figure 2.

The rRNA coding sequences in D. melanogaster rDNA clones that have been

examined are otherwise identical in the vicinity of interruptions with those

in D. virilis rDNA clones with one exception involving Dmra56. In this clone,

there is another deletion, 50 or 51 base pairs upstream of the extant coding/

insertion sequence junction. This is shown in a comparison of D. melanogaster

and D. virilis sequences in Figure 3. The deletion is of 49 base pairs of

coding sequence, and the right excision point is at, or one nucleotide pair

away from, the insertion site of type 2 interruptions (Dawid and Rebbert,

1981). The ambiguity is due to a T dinucleotide at 100, 101 and a T at 149

of the D. virilis sequence in Figure 3.

The clones of interrupted D. melanogaster rDNA were scanned for other

deletions by analysis of partial digests of end-labelled Hind III and Eco RI

5000



H i n fj 10 20 30 "tO 50 60 70

GANTCCGCT^TCTAATTAAJiACAAAGCATlGTGATGGCC^TAGCGGGTGtTGACACAAT^TGATTTCTGCCCAGTGCT

80 90 150 160 170 FnuDII 1 9 0

ctGAATGTCAAAGTGAAGAAATJJGCCAAATGC^TCGTCATCTAATTAGTGACGCGCATGAAT^GATTAACGA

DvLl-2I00 FnuDII \20I FnuDII \20 \3<> HinflTTCAAGTAAGCGCGGGTCAACGGCGGGAGTAACTATGACTCTCTTAAGG

Hinfl 210 220Hinfl ? ,GATTCCTACTGTCCCTATCTACT

Fig. 3- Differences between 28S1 coding regions in Dmra56 and an interruptedrDNA repeat of D. virilis (DvLl-2). The sequence shown includes and extendsupstream from those given in Fig. 2. Differences over the 222 nucleotides ofDvLl-2 shown are limited to two deletions in Dmra56: one of 49 base pairsthat is 50 or 51 base pairs upstream of the coding/insertion sequence boundaryin this clone, and another of 23 base pairs at the boundary. The 49 base pairdeletion is unique to Dmra56 among the three clones of D. melanogaster rDNAthat were examined. The deleted sequence is drawn as having been excised atone end between nucleotides 148 and 149; this is the site at which type 2interruptions are inserted in D. melanogaster rDNA (Dawid and Rebbert, 198l).Underlining is as in Fig. 2. The sequence is indexed in positive numbersfrom a Hinf I site that is as far upstream as we have a continuous sequencefrom the coding/insertion sequence boundary. The beginning of the Hinf Isite corresponds to nucleotide -222 in Fig. 4 of Rae et al. (1980). The HaeIII site from which coding sequences are numbered in Dawid and Rebbert (1981)is at 36-39.

segments of Dmra56, Dmrd51 and KB7, and corresponding segments of the intact

gene represented by Dmra51. Aside from the deletions mentioned and the inter-

ruption itself, there are no differences in the distribution of Hinf I and

Fnu. DII restriction sites in coding regions among the clones, so that dele-

tions of coding sequence in the interrupted rDNA units examined are evidently

limited to 28S1 coding regions at and near the point of insertion of the 5 kb

interruption.

To estimate the extent to which the 49 base pair deletion in the 28S1

coding region of Dmra56 is present in D. melanogaster rDNA, and to look for

similar aberrations at the level of unfractionated rDNA, blots of Hinf I di-

gested embryo DNA were challenged with a 1.8 kb Sma i/Fnu DII segment of

Dmra56 that covers about two-thirds of the 28S1 coding region, ending 19 base

pairs before the left end of the interruption. The results of hybridization

involving Oregon R and Canton S embryo DNA are shown in Figure 4- For compa-

rison, annealing of the Dmra56 Sma i/Fnu DII probe to Hinf I digested cloned

rDNA is also shown. Among the cloned rDNAs, the 0.5 kb segment unique to

Dmra56 (arrowhead adjacent to lane e of Fig. 4) covers the coding/insertion

sequence junction from the Hinf I site that starts the sequence in Figure 3

5001



e f g

4.86 kb3.32

2 16

0.65

0.480.30

Fig. 4. Hybridization of a 1.8 kb Sma i/Fnu DII 28S1 segment of Dmra56 toSouthern (1975) blots of Hinf I digests of total D. melanogaster DNA and clo-ned rDNA repeats. The probe was labelled by nick-translation (Maniatis etal., 1975), and hybridization was as described in Rae et al. (1981). Lanes aand b contained DNA from embryos of Canton S and Oregon R strains, respecti-vely. Lanes e to g of the 1% agarose gel contained pDmra56; pDmrd51 andpDmra51, respectively. Lane £ is a display of end-labelled Bgl II segmentsof Charon 4 lambda DNA, and reported sizes of the segments are listed (De Wetet al., 1980). Lane d is a longer autoradiographic exposure of lane b. Thearrowhead adjacent to lane e_ indicates a 0.5 kb Hinf I segment of Dmra56 thatis unique among the clones because of the 49 base pair deletion of 28S1 codingsequence (Fig. 3). A corresponding segment in total D. melanogaster DNA isindicated by the arrowhead pointing to lane d. Some Hinf I segments of rDNAin the whole genome blots in lanes a and b that hybridize with the probe butare not represented in the clones are indicated by arrowheads between theselanes.

to a Hinf I site that is c_a. 350 base pairs into the interruption (Fig. 1).

A band corresponding to this segment is visible but not well represented in

unfractionated rDNA (arrowhead adjacent to lane d in Fig. 4), and it is evi-

dent that the 49 base pair deletion in the 28S1 region of Dmra56 is not com-

mon in D. melanogaster rDNA. However, there are other bands in the blots of

total DNA that hybridize with the Sma i/Fnu DII probe but that are absent

from Hinf I digests of the clones; many are marked between lanes a and b in

Figure 4- There are some differences between Oregon R and Canton S strains

with regard to this hybridization, and a few are indicated by single arrow-

heads between the lanes.

Although Hinf I digestions were designed to be complete, some of the

bands in Figure 4a and b could have been due to partial digestion of genomic

5002



DNA. Knowing the distributions of Hinf I sites in the clones from Smith and

Birnstiel (1976) analysis, the lengths of possible products of incomplete di-

gestion were determined. None corresponded to visible bands, so the latter

likely reflect some heterogeneity among rDNA repeats that is due to deletions

of, or additions to, the 28S' coding region. Most prominent among these bands

is one at 2.7 kb.

About 15$ of all rDNA repeats in D. melanogaster contain type 2 inser-

tions, and these are positioned close to the site of type 1 interruptions

(Dawid et al., 1978; Wellauer and Dawid, 1978; Dawid and Rebbert, 1981).

Sequence length heterogeneity due to type 2 insertions could therefore be

detected in whole genome blots probed with the Sma i/Fnu DII segment, and

some of the bands indicated between lanes a and b of Figure 4 might be the

consequence of type 2 insertions rather than deletions such as that in Dmra56.

However, there is a Hinf I site in the coding region within 12 nucleotides of

the left end of type 2 interruptions that have been examined (136-140 in Fig.

3), a Hinf I site in the interruptions that is 0.09 to 0.11 kb from the right

end (Dawid and Rebbert, 1981), and a Hinf I site at 200-204 in genes without

5 kb type 1 interruptions (Fig. 3). Thus, Hinf I segments of genes with type

2 insertions that could be detected with the Dmra56 probe should be limited

to lengths of about 0.15 kb (0.1 kb of interruption plus 0.05 kb of coding

sequence responsible for the hybridization). In cases where a gene has both

a type 2 insertion and a 5 kb type 1 insertion, the hybridizing Hinf I segment

should be £a. 0.5 kb in length (from the mentioned site in the type 2 insert

to a site 0.35 kb into the type 1 interruption). From this, it appears that

most of the minor Hinf I segments of rDNA that are detected with the Sma 1/

Fnu DII probe are not attributable to type 2 insertions.

Figure 2 summarizes data on the coding/insertion sequence junctions in

cloned D. melanogaster rDNA units containing 5 kb type 1 interruptions, and

in interrupted D. virilis rDNA units. There are four points to be made from

this comparison: (i) as mentioned above, with regard to the right (28S") end

of the interruptions, the point of insertion is precisely the same in both

species; (ii) despite this and the conservation of flanking 28S rRNA coding

sequence, the 28S" ends of the insertions in the two species have no sequence

homology; (iii) neither is there homology at the left (28S1) ends of the two

species' interruptions; (iv) although the flanks of the D. virilis rDNA inter-

ruption comprise an entire 28S rRNA coding sequence (including a redundancy

of fourteen base pairs), the 28S1 flank of the interruption in clones of rDNA

repeats containing a 5 kb type 1 insertion lacks twenty-three base pairs of

5003


-1120 -1100 -1060 -1060 -101)0 -1020

GGtACTTGGTGGAGCTCCCCCGjTTGATCTGGCTGCTAAGTTATTAGCGATCAAATACAAGCTAAAACGTGGATTCCCGCTG^AGGAGAACGACTGGCTTTA^GGCGAGGACATTG(

-1000 -980 -960 -91.0 -920 -900

CGTGTctTAGCTGGGAGCAGAGGAAGicTCGCCTAGAGGAGTGTTTiUTCCAGAGTTGGCAGAACAiATGGGACGATGACAGCGAAJcAGACGGGTGACGCATAGGlTTATCCCAT

-880 B a m Hj -860 -BitO -820 -600 -780

ACGTCACTCT+GCCTATCGGGATCCAAGTTtTGGATTCTCGATGAGGACGtcTTTCCTGCTTACAGGGCAiGGGTCGTTCAATGCATTTTtGCACGGGAGAGCCCTCAGC^ATGCCT T )

-760 -7"iO -720 -700 -680 -660

ACTGCTTGCGCATGtGGTGATCCATATGAGGACTiGATGCATATCTTGTGCGCTlGCCCCCCTATATGCAGATctGCGGGACCTAGATGGACTT^GAGTGCAGCGCCTTGGCGAJiA

-6U0 -620 -600 -580 -560

ACTGGATCTTCGAGGGAAtcCTGATGATCAAGAGAAGAiTCAACGGCTGGCAATGTTT4cGGAAGAAGTGTTCCTGAG?,AGGAGGGGCGTTTAGCTCAJcATCTCTGCCGTGTGGT

-5U0 -520 -500 -480 -t*60 -1*40

TAJcGGGCGAGAATACTACCAciGTCCGCTGTTGCTTGTCGT/lAGAGACGACTAATACAGCGiTAGGACTCCTCTAACCCTGjTTGTCGGAGCAAAAGGGGGiGGCCCACCGAGCC

-420 -1*00 -380 -360 -340 -320

TCTTTT^GGTACCACGGGTTG/lGCAGiT/lTCCAAGACTGCTCATTGiGGTAGGCCCCTGGTGGGAGtATCGTGGTGGCTGTGGTTGjTACCCATATCGCGGGTAGA^CCTTC/lTGC

-300 -280 -260 -2M0 -220 -200

TCGACGTTTGAGTTACGGTGCTAGTTGCGCAAAACTCGGGTGCTGTGACciAGAGATCAGTAGAGATTTT^GGTAGATCTCGCTCCTCAGiAAGGGGGAGTGCTTGCCCG^CAAGC

(

-180 -160 -1U0 -120 -100 -80

AAGTACTCGAATTGiTACCGGGGTGGTCGCTATGfACATAGCTATAGCTTCTAGfcCGGGACGCTTGTCTGGCGTATCCAGACACATGCACCAT/tTGCTCACTTGTGGGTGTATfc

"5° " J 0 Bam HIGGTGCCGTGGTTGTAATCCCTTCAGTGTGGAACACGCCACGTAAAATAAGTTCGGAGGGATCCGAAMAAGCATACATTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGG

A - - = = = = =

28S"T T Y Y T Y T T I T 7 T T T Y T T T YIT I T T T .

I I \k k i I f mk\ 'lOObp



coding sequence [including the fourteen repeated at the flanks of the D. viri-

lis interruption, as well as the flanks of the 0.5 kb type 1 insertion (Dawid

and Rebbert, 1981)].

The right end of the 5 kb type 1 interruption contains the 1 kb type 1

insertion, and the right end of this element contains the 0.5 kb type 1 inter-

ruption (Dawid e_t &L., 1978; Wellauer and Dawid, 1978). This had been deter-

mined from nucleic acid hybridizations and restriction site mapping. In

order to ascertain the extent of these homologies, and to examine the DNA se-

quences at points at which longer type 1 insertions departed from shorter

ones, we sequenced the rightmost 1.1 kb of the interruption in KB7 (and some

included portions of the interruption in Dmra56) for the purpose of comparison

of this sequence with those obtained by Dawid and Rebbert (1981) for the shor-

ter type 1 interruptions. The sequence of the 28S" end of the KB7 interrup-

tion is given in Figure 5, and the few differences between it and sequenced

portions of the Dmra56 interruption are indicated between parentheses under

the KB7 sequence. The left end of the 28S" coding region is underlined, and

the interruption sequence is measured in negative numbers. Also shown is a

restriction map of the region, and an indication of sequencing strategies.

The nucleotide corresponding to the 28S1 end of the 0.5 kb interruption is

Fig. 5. Complete sequence of the rightmost 1.1 kb of the 5 kb type 1 rDNAinterruption represented in pKB7. Lengths within the parentheses underneaththe KB7 sequence were also sequenced in segments from Dmra56, and differencesare indicated. The interruption sequence is measured in negative numbers fromright to left. The numbering corresponds closely with that in Fig. 2 of thepaper by Dawid and Rebbert (1981); it does not do so exactly because the KB?sequence differs from the shorter interruption sequences in Dmrc53 and Dmre52by a few one or two base pair additions and deletions. There are also a fewsubstitutions, and all differences are in the following list:

KB7 Dmrc53/Dmre52 KB7 Dmrc53/Dmre52

T_at_z93O 5_at_-924__ 9(.226-----=ZiZ_t2_rZi2 G(C)5T_at -713_to_-707_A_at_-9O3 5_at_-897__ ?iA.)^_a£_i662_to_::657 G(A)3C_at_-657_to_=§53

_G_at_-777 A_at_-771__ CCTGA_at_-639_to_=635 CTGGA_at_-635_to_z631_

T_at_=757 A_at_-751__ CTCAGC_at_-564_to_-559 CCAAC_at_-560_to_-556_

_C_at_-474 T_at_=471__ A^G)5A_at_-446_to_=440___^GAAGA_at_-443_to_=438

_G_at_-351 A_at_;349__

The Dmrc53/Dmre52 numbers are from Fig. 2 in Dawid and Rebbert (1981).

Shown beneath the KB7 sequence is a restriction map of the region includingit, and the horizontal arrows indicate the extent of sequencing. Restrictionsite symbols not identified in Fig. 1 are: J -Dde I, and J -Rsa I.

5005



number -552. That of the 1 kb interruption may be number -999 (see below).

Figure 6 compares pKB7 sequences with the coding/insertion sequence junc-

tions of pDmre52 (with a 0.5 kb insertion) and pDmrc53 (with a 1 kb insertion).

The KB7 sequences are from Figure 5, and the Dmre52 and Dmrc53 sequences are

from Dawid and Rebbert (1931). As is the case with D. virilis rDNA interrup-

tions (Rae et al., 1980), the 28S1 end of the 0.5 kb interruption is flanked

by the TGTCCCTATCTACT coding sequence that also flanks the 28S" end of the

interruption (Dawid and Rebbert, 1981). This sequence is not intact at the

putative 28S1 flank of the 1 kb interruption; rather, the 28S1 coding sequence

reads through eleven of the fourteen before homology with the intact gene is

lost, and the sequence contains a nucleotide substitution (TGTCCCTGTCT). The

difficulty in identifying the precise coding/insertion junction in Dmrc53

comes from the fact that the leftward extension of the 5 kb interruption from

the putative 28S1 end of the 1 kb interruption includes five nucleotides of

FnuDIIDtnra51 CGCGCATGAATGGATTAACGAGATTCCTACTGTCCCTATCTACTATCTAGCGAAACCACAGCCAAGGGA (intact gene)

Dmre52 CGCGCATGAATGGATTAACGAGATTCCTACTGTCCCTATCTACTGCCGTGTGGTTAGCGGGCGAGAATA (28S' end of a 0.5 kb insert)

KB7 AGCTCAGCATCTCTGCCGTGTGGTTAGCGGGCGAGAATA (-566 to -528 of a 5 kb insert)

Dmrc53 CScECATGAATGGATTAACGAGATTCCTACTGTCCCTGTCTTAGCTGGGAGCAGAGGAAGACTCGCCTA (28S' end of a 1 kb Insert)

KB7 ATTGCGTGTCTTAGCTGGGAGCAGAGGAAGACTCGCCTA (-1010 to -972 of a 5 kb insert)

Dmre52 T6TCCCTATCTACTGCCGTGTGGTTAG

KB7 GCTCAGCATCT-CTGCCGTGTGGTTAG

Fig. 6. Comparison of the 23S1 coding/insertion sequence junctions of 1 kband 0.5 kb type 1 rDNA interruptions (from Dawid and Rebbert, 1981) with se-quences in the 5 kb type 1 interruption (Fig. 5), and with the correspondingregion of an intact 28S rRNA gene (Fig. 2). In A, portions of the KB7 inter-ruption are aligned with the left ends of the interruptions in Dmre52 andDmrc53- As in previous figures, sequences found in the intact 28S rRNA geneare underlined, and the portion repeated at the flanks of interruptions isdoubly underlined (the single nucleotide difference between Dmrc53 and theothers within this sequence is indicated by a gap in the double underline).Homology with this sequence in the KB7 interruption is also underlined. InB, the portion of the KB7 interruption that is homologous with the 28S1 endof the Dmre52 interruption is adjusted by the introduction of a single nucleo-tide gap to suggest a relatedness between this and the coding region terminusin Dmre52.

5006



the eleven attributable to the 28S1 coding sequence flank (TGTCT). This is

illustrated in Figure 6A, which also shows intact gene sequences from Figure 2.

The comparison of Dmre52 and KB7 sequences in the middle of Figure 6 can

be arranged to also give some homology involving the 28S1 coding sequence

flank of the 0.5 kb insertion. The alignment, which supposes a single nucleo-

tide deletion in the KB7 interruption sequence, is shown in Figure 6B.

DISCUSSION

More than half of the ca. 150 repeating units of Drosophila melanogaster

ribosomal DNA have an interruption in the 28S coding region, and such repeats

are essentially not transcribed. To learn if the coding/insertion sequence

junctions contain information bearing on the role and/or origin of rDNA inser-

tion sequences, I sequenced the left and right junctions in clones containing

the 5 kb form of type 1 insertion. This is the major form of interruption in

D. melanogaster rDNA (Wellauer and Dawid, 1977; Wellauer et al., 1978). I

also sequenced the region of an intact 28S gene that corresponds to the inser-

tion site.

We had already sequenced the coding/insertion sequence junctions in D.

virilis rDNA (Rae et al., 1980). We found that interruptions are flanked by

direct repeats of fourteen base pairs of coding sequence, which sequence is

present once at the "target site" in an intact gene. Such a structure sug-

gested a relatedness between these rDNA interruptions and transposable ele-

ments. Consistent with this notion is the fact that sequences homologous with

at least portions of the interruptions in D. virilis, and of the type 1 inter-

ruptions in D. melanogaster, are present outside of rDNA (Dawid and Botchan,

1977; Dawid et al., 1980; Barnett and Rae, 1979). However, there is only li-

mited evidence of mobility (Dawid et al., 1980), and the rDNA interruptions

proper are not terminated by inverted or direct repeats as are transposons

(Calos and Miller, 1980) and the copia type of transposable element in D.

melanogaster (Levis et al., 1930).

We mentioned earlier that the insertion site of 5 kb type 1 D. melanogas-

ter rDNA interruptions is the same as that of D. virilis rDNA interruptions

(Rae et al., 1980). In all three clones we have examined, the 28S" coding

region begins with the TGTCCCTATCTACT that is present once in an intact gene

and flanks the D. virilis interruption. The 28S" termini of Dmra!J6 and Dmrd51

are identical for the 19 base Dairs from the rightmost Bam HI site in the

interruption to the beginning of the coding region; KB7 differs from these in

that it has a run of six A's rather than four near the Bam HI site. The dif-

5007



ference may be the consequence of cloning or plasmid propagation, or it may

reflect microheterogeneity among 5 kb type 1 insertions. It is interesting

that despite the fact that the right ends of the rDNA interruptions in D. vi-

rilis and D. melanogaster are identically located, there is no sequence homo-

logy between the two species' insertions at this terminus.

The left coding/insertion sequence junction in Dmra56, Dmrd51 and KB7 is

rather different from that in D. virilis rDNA. The three D. melanogaster

clones are identical in this region, and lack coding sequence that is present

in interrupted D. virilis rDNA repeats and in the clone of intact D. melano-

gaster rDNA. Specifically, the 14 base pairs of coding sequence that is du-

plicated at the ends of D. virilis interruptions are missing, along with 9

other base pairs. This is not a general property of type 1 interruptions in

D. melanogaster, as the genes with 0.5 kb insertions have an intact coding

sequence and the direct repeat (Dawid and Rebbert, 1981). The clone Dmra56

has a second deletion, of 49 base pairs, in the 28S1 region near the coding/

insertion sequence junction. This deletion, which, interestingly, is at or

immediately adjacent to the insertion site of type 2 rDNA interruptions, is

infrequent in genomic rDNA, but Southern hybridizations suggest the presence

of other aberrations in other rDNA repeats. A further feature of the 23S"

junction is that, as is the case with the 28S" junction, the terminal sequence

of the interruption proper shares no homology with the corresponding terminus

of the D. virilis rDNA interruption.

There are, however, regions of homology between type 1 rDNA interruptions

in D. melanogaster and counterparts in D. virilis rDNA (Barnett and Rae, 1979).

These have yet to be mapped in detail, but one involves a portion of the ca.

2.5 kb Sma I segment of the 5 kb type 1 D. melanogaster interruption, and an-

other is within the ca. 0.9 kb Bam HI segment (see Fig. 1). Homology of the

former with its correlate in the D. virilis interruption is great, while the

latter has considerably less homology with the D. virilis insertion. Never-

theless, the 0.9 kb Bam HI segment hybridizes with rDNA interruptions of di-

pteran genera distantly related to Drosophila, so that the region of this seg-

ment responsible for interspecific hybridization has been conserved to degrees

during divergence of the Diptera (Barnett and Rae, 1979). Given this and the

identity of insertion site between species, it appears that type 1 interrup-

tions were established early in the evolution of higher diptera. It may be

that an ancestral dipteran acquired an rDNA insertion, perhaps as a transpos-

able element, and that this element became fixed in a proportion of rDNA units.

Since the termini of the interruptions are not inverted or direct repeats, it

5008



may be that if interruptions arose as a transposon, it became defective through

the loss of one or both of its ends.

From a comparison of the sequences given in Dawid and Rebbert (1981) and

those in Figure 5 of this paper, it is clear that there is extensive nucleo-

tide sequence homology between the 0.5 kb type 1 insertion and the right half

of the 1 kb insertion, and between the 1 kb insertion and the right fifth of

the 5 kb insertion. The homology amounts to 98$. As to the origin of length

diversity, it seems likely that shorter sequences were derived from longer

ones through deletion of material. The D. virilis interruption has homologies

both with a region of the 5 kb insertion that is not represented in the shorter

ones, and with a region that is shared with at least the 1 kb insertion (Bar-

nett and Rae, 1979). Also, the points of departure among the three lengths

of type 1 interruption as they are represented in the 5 kb KB7 interruption

include features of the short coding sequence that flanks each interruption

at one or both ends (underlined KB7 sequences in Fig. 6). It may be that 1 kb

and 0.5 kb type 1 insertions were derived from 5 kb insertions by unequal

crossing over that involved these homologies. A correlary of this is that

type 1 rDNA interruptions of 4 kb and 4-5 kb should be as abundant as recipro-

cal 1 kb and 0.5 kb forms, but this is evidently not so. However, the alter-

native t>f short rDNA interruptions giving rise to longer ones requires a com-

plicated scheme of sequential insertion of various elements at a single site

in subsets of ancestral Drosophila rDNA repeats.

After this manuscript was completed, an article by Roiha et aL. (1981)

appeared in which sequences of the 28S1 and 28S" coding/insertion sequence

junctions in Dml03 are presented. Their data are essentially the same as

those given in Figure 2 of this paper.

ACKNOWLEDGMENTS

I appreciate the assistance of Janice Oles, Donald James and Anne Scott,and thank Joseph Gall and Vicki Murtif for their comments on the manuscript.I am particularly grateful to Igor Dawid and Martha Rebbert for providing rDNAclones and unpublished information. This work was supported by a grant fromthe NIH.

REFERENCES

1. Barnett, T. and Rae, P.M.M. (1979). Cell 16, 763-775-2. Beckingham, K. and White, R. (1980). J. Molec. Biol. 137, 349-373-3. Calos, M.P. and Miller, J.H. (1980). Cell 20, 579-595.4. Dawid, I.B. and Botchan, P. (1977). Proc. Nat. Acad. Sci. USA 74, 4233-

4237.5. Dawid, I.B. and Rebbert, M.L. (1981). Submitted to Nucl. Acids Res.

5009



6. Dawid, I.B., Wellauer, P.K. and Long, E.O. (1978). J. Molec. Biol. 126,749-768.

7. Dawid, I.B., Lauth, M. and Wellauer, P.K. (1980). Miami Winter Symp. 17,217-234.

8. De Wet, J.R., Daniels, D.L., Schroeder, J.L., Williams, B.G., Denniston-Thompson, C , Moore, D.D. and Blattner, F.R. (1980). J. Virol. 33, 401-410.

9. Glover, D.M. and Hogness, D.S. (1977). Cell 10, 167-176.10. Jolly, D.J. and Thomas, C.A., Jr. (1980). Nucl. Acids Res. 8, 67-84.11. Levis, R., Dunsmuir, P. and Rubin, G.M. (1980). Cell 21, 581-588.12. Long, E.O. and Dawid, I.B. (1979). Cell 18, 1185-1196.13. Long, E.O., Rebbert, M.L. and Dawid, I.B. (1980). Cold Spring Harbor

Symp. Quant. Biol., in press.14. Maniatis, T., Jeffrey, A. and Kleid, D.C.

USA 72, 1184-1188.15. Maxam, A.M. and Gilbert, W. (1980). Meth.16. Pellegrini, M., Manning, J. and Davidson,17. Rae, P.M.M., Kohorn, B.D. and Wade, R.P. (1980). Nucl. AcidsRes. 8,

3491-3504.18. Rae, P.M.M., Barnett, T. and Murtif, V.L. (1981). Chromosoma 82, 637-655.19. Roiha, H. and Glover, D.M. (1980). J. Molec. Biol. 140, 341-355.20. Roiha, H., Miller, J.R., Woods, L.C. and Glover, D.M. (1981). Nature 290,

749-753-21. Smith, H.O. and Birnstiel, M.L. (1976). Nucl. Acids Res. 3, 2387-2398.22. Smith, M., Leung, D.W., Gillam, S., Astell, C.R., Montgomery, D.L., and

Hall, B.D. (1979)- Cell 16, 753-761.23. Southern, E.M. (1975). J. Molec. Biol. 98, 503-517. /24. Wellauer, P.K. and Dawid, I.B. (1977). Cell 10, 193-212.25. Wellauer, P.K. and Dawid, I.B. (1978). J. Molec. Biol. 126, 769-782.26. Wellauer, P.K., Dawid, I.B. and Tartof, K.D. (1978). Cell 14, 269-278.27. White, R.L. and Hogness, D.S. (1977). Cell 10, 177-192.

(1975). Proc. Nat. Acad. Sci.

Enzymol. 65, 499-530.N. (1977). Cell 10, 213-224.

5010


coding region deletions associated with the major form of rdna

Documents