Cloning of cry2Aa and cry2Ab genes from new isolates of Bacillus thuringiensis andtheir expression in recombinant Bacillus thuringiensis and Escherichia coli strains

Shantanu Kumar1 and V. Udayasuriyan2,*1Centre of Advanced Studies in Agriculture Microbiology, Tamil Nadu Agricultural University, Coimbatore 641 003,Tamil Nadu, India2Centre for Plant Molecular Biology, Tamil Nadu Agricultural University, Coimbatore 641 003, Tamil Nadu, India*Author for correspondence: Tel.: þ91-0422-2431222 ext. 262, Fax: þ91-0422-2431672,E-mail: udayvar@hotmail.com

Received 5 February 2003; accepted 31 July 2003

Keywords: Bacillus thuringiensis, Cry2Aa, Cry2Ab, E. coli, T7 promoter

Summary

Bacillus thuringiensis (Bt) is the major source for transfer of genes to impart insect resistance in transgenic plants.Cry2A proteins of Bt are promising candidates for management of resistance development in insects due to theirdifference from the currently used Cry1A proteins, in structure and insecticidal mechanism. Two insecticidal crystalprotein genes of Bt, viz. cry2Aa and cry2Ab were cloned from new isolates of Bt, 22-4 and 22-11, respectively.Expression of both the genes was studied in an acrystalliferous strain of Bt (4Q7) by fusing the cry2Aa and cry2Abgenes downstream of cry2Aa promoter and orf1 + orf2 sequences. Western blot analysis revealed a low levelexpression of the cloned cry2Aa and cry2Ab genes in the recombinant Bt strains. High-level expression of cry2Aaand cry2Ab genes was achieved in the recombinant E. coli by cloning the cry2A genes under the control of the T7promoter.

Introduction

Bacillus thuringiensis (Bt), is a well-known gram-posi-tive, spore-forming soil bacterium that forms parasporalinsecticidal crystal proteins during the stationary phaseof its growth cycle. Cloning of the first crystal proteingene (cry) of Bt was reported by Schnepf & Whiteley(1981), since then more than 120 cry genes have beencloned, characterized, and their classification based onamino acid sequence similarity of their proteins (Crick-more et al. 1998). Cloning of cry genes provides anopportunity to express the cloned gene in acrystallifer-ous Bt or E. coli to find out the insecticidal activities oftheir proteins. The reintroduction of cloned genes intoBt also provides a system to study factors regulating theexpression of delta endotoxin genes. Using such asystem, it has been discovered that two endotoxin genes,cytA and cry2Aa require an accessory protein to be co-expressed in order that their products may formcrystalline inclusions (Adams et al. 1989; Crickmoreet al. 1990; Crickmore & Ellar 1992). In the naturalisolates of Bt the cry2Aa gene is expressed as third orf inthe operon model whereas the cry2Ab gene is cryptic innature. Dankocsik et al. (1990) achieved expression ofthe cry2Ab gene in an acrystalliferous strain of Bt byusing the promoter derived from Bt cry3A gene.Although the gene was expressed there was no crystalinclusion formation. The orf2 of cry2Aa is necessary to

achieve crystal formation of Cry2Aa and Cry2Abproteins in Bt (Crickmore & Ellar 1992; Crickmoreet al. 1994). Cry2Aa is an unusual subset of the Cryprotein, toxic against two insect orders Lepidoptera andDiptera. The Cry2Aa protein has 633 amino acidresidues with molecular mass of 63 kDa, and formssmall cubical crystals (Yamamoto & Mclanghlin 1981;Donovan et al. 1988). Cry2Ab, an 87% sequencehomologue of Cry2Aa, showed no activity againstdipteran species but was more active than Cry2Aaagainst Helicoverpa zea (Dankocsik et al. 1990).The commercial use of Bt as suspension of spores and

inclusions has been limited in part due to the need tospray at rather frequent intervals in order to sustain aneffective level of biopesticide. Not only is the Bt crystalprotein inclusion readily inactivated, but also thenumber of spores and/or vegetative cells decreasesrather rapidly in the sprayed area. This problem hasbeen circumvented by engineering plants (cotton, cornetc.) to produce the toxin (Schnepf et al. 1998). Trans-genic Bt-cotton expressing Cry1Ac has been registeredfor commercial cultivation in India during the year 2002and it primarily targets Helicoverpa armigera.Continuous exposure to a single kind of Bt toxin can

lead to resistance development in insects. Kranthi et al.(2000) reported 76-fold resistance development in thelaboratory to an Indian population of H. armigeraagainst Cry1Ac after 10 generations of selection.

World Journal of Microbiology & Biotechnology 20: 11–17, 2004. 11� 2004 Kluwer Academic Publishers. Printed in the Netherlands.

However, the Cry1Ac-resistant H. armigera was notcross resistant to Cry2Aa (Akhurst et al. 2000). Routinereplacement of cry genes or pyramiding of cry genescould be useful for effective control of insect pests by Bttransgenic plants. Due to the difference in structure andinsecticidal mechanism, cry2A genes are promisingcandidates for management of resistance developmentin insects. But Indian populations of H. armigera werefive- to 30-fold less susceptible to Cry2Aa than Cry1Ac(Chakrabarti et al. 1998; Babu et al. 2002). To the bestof our knowledge the toxicity of Cry2Ab against Indianpopulations of H. armigera has not been reported so far.Variation of a single amino acid can significantlyinfluence the level of toxicity in Cry proteins (Udaya-suriyan et al. 1994; Rajamohan et al. 1996). Since Indiais very rich in biodiversity and genetic resources,different Bt strains available in the country are valuabletools for identification of indigenous novel Bt genes,which could be used for control of insect pests of cropplants. In this context, it is essential to clone and expresscry2A genes from several new isolates of Bt. The presentstudy describes the cloning and expression of cry2Aaand cry2Ab genes from new indigenous isolates of Bt,22-4 and 22-11, respectively.

Materials and methods

Bacterial strains, plasmids and antiserum

The Bt strains 22-4 and 22-11 used in this study wereobtained from the Bt Biotechnology laboratory, Centrefor Plant Molecular Biology, Tamil Nadu AgriculturalUniversity, Coimbatore, India. The Bt strain 4Q7 (acrys-talliferous) and the Bt-E. coli shuttle vector pHT3101were originally obtained from Bacillus Genetic stockCentre, Ohio State University, Columbus, Ohio, USA.The Cry2Aa antiserum was a generous gift from Dr D.H.Dean, Ohio State University, Columbus, Ohio, USA.

Amplification of Bt DNA by PCR

Total DNA from Bt strains 22-4 and 22-11was extractedas described earlier by Kalman et al. (1995) and used asthe template for the polymerase chain reaction (PCR)

amplification. Based on the published sequence ofcry2Aa2 and cry2Ab1 genes (Winder & Whitely 1989)primers were generated and are listed in Table 1. Theprimers 2APF and 2APR correspond to the DNAsequence located 260 nucleotides upstream from thestart codon of cry2Aa orf1 and 90 nucleotides downstream of the stop codon of cry2Aa orf2, respectively.The above-mentioned primers were used to amplifycry2Aa orf1 + orf2 (1.8 kb). The primers 2A3F and2A3R correspond to the N-terminal 20 nucleotides ofcry2Aa orf3 and 218 nucleotide down stream of stopcodon of cry2Aa orf3, respectively. The primers 2A3Fand 2A3R were used to amplify cry2Aa orf3 along withterminator sequence (2.1 kb). The primers 2AbF and2AbR correspond to the N-terminal 26 nucleotides ofcry2Ab and the C-terminal 27 nucleotides of codingregion of cry2Ab respectively. Amplification of cry2Aborf (1.9 kb) was done using 2AbF and 2AbR primers.The primer 2ATF corresponding to the DNA sequencedownstream of the stop codon of cry2Aa orf3 and2ATR is similar to 2A3R except for the restrictionenzyme sites present on their 5¢ ends. The primers 2ATFand 2ATR were used to amplify the terminator sequence(218 bp) from the cry2Aa operon. PCR for the DNAfragment more than 1.0 kb in size was carried out with ahigh fidelity XT-PCR system (Bangalore Genei Pvt.Ltd., India) in 40 ll reaction volume. Each 40 llreaction mixture contained 100 ng of genomic DNA ofBt strain 22-4 or 22-11, 50–100 ng of forward andreverse primers, each dNTP at a final concentration of200–300 lM and 2.5 U of XT-Taq polymerase in 1 �XT-Taq buffer (with 15 lM MgCl2). Amplification wasaccomplished with the thermal cycler (Eppendorf Mas-tercycler Personal, Germany) by using the step-cycleprogram. First, the PCR was carried out for 10 cyclesunder the following conditions: 94 �C for 2 min, 94 �Cfor 40 s, 60 �C for 40 s and 72 �C for 2 min. The PCRwas subsequently subjected to 20 cycles as follows:94 �C for 40 s, 60 �C for 40 s, and 72 �C for2 min + 20 s increment/cycle. The PCR was performedfor DNA fragments of size �200 bp with Taq Polymer-ase for 30 cycles as follows: 94 �C for 1 min, 55 �C for45 s and 72 �C for 45 s. For both the step-cycle andnormal PCR programs, the final extension was per-formed for 7 min at 72 �C.

Table 1. Primers used for PCR amplification and construction of the cry2Aa/cry2Ab operon.

Sl. no. Primer name Sequence (5¢ ! 3¢)a

1 2APF CGGTACCAG AAATATGATGTTGATTCTTAGAG

2 2APR GCTCGAGATAAAATTCCTCCTTAAATATCTAGT

3 2A3F GTCTCGAGATGAATAATGTATTGAATAGTG

4 2A3R GTCTGCAGAGCTTTAGGTTAACTTGAATGA

5 2BF GCTCGAGATGAATAGTGTATTGAATAGCGGAAG

6 2BR GCTGCAGCTCAAACCTTAATAAAGTGGTGAAAT

7 2ATF GCTGCAGGGTTTGAGTGAATGTACAATTAGTA

8 2ATR GTCTAGAGCTTTAGGTTAACTTGAAATGATTTC

a Restriction endonuclease cleavage sites for KpnI (GGTACC), XhoI (CTCGAG), PstI (CTGCAG), and XbaI (TCTAGA) are in bold faces.

12 S. Kumar and V. Udayasuriyan

Recombinant DNA procedures

Restriction digestion and ligation reactions were carriedout as per manufacturer’s instruction. Agarose gelelectrophoresis, preparation of E. coli competent cellsand their transformation were as per the standardprocedure (Sambrook et al. 1989). Transformation ofthe cry) strain of Bt (4Q7) was performed as describedpreviously by Lenin et al. (2001).

Preparation and analysis of cloned crystal proteins

Bt transformants were grown in T3 medium (Martin &Travers 1989) containing 20 lg/ml erythromycin at30 �C until cell lysis (�72 h). The spore crystal mixturewas centrifuged and washed twice in 0.5 M NaCl andTE buffer [Tris 10 mM, EDTA 1 mM, pH 8.0 with1 mM phenylmethanesulphonyl fluoride (PMSF)]. Fi-nally, the spore crystal mixture was resuspended in asmall volume of sterile double distilled water with 1 mMPMSF and used for the 8.0% SDS-PAGE (Laemmli1970). Recombinant E. coli cells harbouring thepET2Aa and pET2Ab plasmid were cultivated at37 �C in LB broth containing kanamycin 50 lg/ll andallowed to grow at 37 �C until absorbance 0.6 at600 nm. Isopropyl b-D-thiogalactopyranoside (IPTG)was added to each flask at a final concentration of1 mM. Cells were further grown at 30 �C for another6 h up to an optical density of 1.3 at 600 nm. This wasfollowed by centrifugation and sonication of the cells inTE buffer containing 2 mM PMSF until more than 90%cells were broken. Sonicated cells were centrifuged at7000 · g for 15 min at 4 �C. The pellet was suspended inthe TE buffer containing 0.1% Triton X-100 andwashed twice in the same buffer. Finally, the pelletwas dissolved in small volume of sterile double distilledwater and SDS-PAGE analysis was carried out. AfterSDS-PAGE, proteins were transferred to a PVDFmembrane (Bio Rad, USA) by semi dry blot apparatus(Bio Rad, USA). After transfer, the membrane wasblocked overnight with TBST (Tris 100 mM, pH 7.5,0.9% NaCl and 0.1% Tween 20) containing 3% BSA at4 �C and then incubated with 1:5000 dilution of Cry2Aaprimary antiserum in TBST for 1 h at room tempera-ture. After washing with TBST, the membrane wasincubated with 1:5000 dilution of alkaline-phosphataseconjugated secondary antiserum (Goat antirabbit-ALP)in TBST for 20 min. The proteins were detected with 5-bromo-4-chloro-3indolyl phosphate/nitro blue tetrazo-lium (BCIP/NBT).

Results

Construction of cry2Aa and cry2Ab operon in pBluescriptII KS

From the genomic DNA of Bt strain 22-4, the cry2Aaorf1 + orf2 (1.8 kb) was amplified with KpnI and XhoIends and cloned into KpnI and XhoI sites of pBluescript

II KS (3.0 kb) as shown in Figure 1A. The cry2Aa orf3of Bt strain 22-4 along with terminator sequences(2.1 kb) was amplified with XhoI and PstI ends andcloned into XhoI and PstI cloning sites of recombinantpBluescript II KS containing cry2Aa orf1 + orf2(4.8 kb) as shown in Figure 1B. Construction of thecry2Aa operon was confirmed by restriction digestion ofthe recombinant plasmid with KpnI and PstI that releasethe whole cry2Aa operon (3.9 kb), and the recombinantclone was named as pKS2Aa. Similarly the cry2Ab(1.9 kb) gene was amplified from Bt strain 22-11 withXhoI and PstI ends and cloned into the XhoI and PstIsites of recombinant pBluescript II KS containingcry2Aa orf1 + orf2 (4.8 kb) as shown in Figure 1C.The downstream sequence of cry2Aa orf3 (218 bp)containing the terminator sequences of the cry2Aaoperon was amplified by PCR with PstI and XbaI endsand cloned into PstI and XbaI sites of recombinantpBluescript II KS containing cry2Aa orf1+orf2 andcry2Ab orf. Digestion of the recombinant plasmid withSacI and XbaI released a 365 bp DNA fragment(Figure 1D) because the SacI site is present in thecry2Ab orf at 147 bp upstream of stop codon. Con-struction of the cry2Ab operon was confirmed byrestriction digestion of the recombinant clone with KpnIand XbaI that released the whole operon of cry2Ab[cry2Aa orf1 + orf2, cry2Ab and the terminator

Figure 1. Agarose gel electrophorosis of recombinant pBluescript II

KS (pBS) plasmids used for the construction of the cry2Aa/cry2Ab

operon. (A) Lane 1: k DNA/HindIII; Lane 2: recombinant pBS

(cry2Aa orf1 and orf2) digested by KpnI and XhoI. (B) Lane 1: kDNA/

HindIII; Lane 2: recombinant pBS (cry2Aa orf1, 2 and 3) digested by

XhoI and PstI. (C) Lane 1: k DNA/HindIII; Lane 2: recombinant pBS

(cry2Aa orf1, 2 and cry2Ab orf) digested by XhoI and PstI. (D) Lane 1:

k DNA/HindIII; Lane 2: 100 bp ladder; Lane 3: recombinant pBS

(cry2Ab operon + cry2Aa terminator sequence) digested by SacI and

XbaI.

Expression of cry2A genes in recombinant B. thuringiensis and E. coli strains 13

sequences of cry2Aa (3.9 kb)] and the recombinantclone was named as pKS2Ab. Nucleotide sequence dataof pKS2Aa and pKS2Ab obtained from 50 and 30

regions of constructed operons as well as fusion sites,confirmed the amplification and cloning of the expectedregion of DNA (data not shown).

Cloning of the cry2Aa and cry2Ab operon in the E. coli-Bt shuttle vector (pHT3101)

The whole cry2Aa operon (3.9 kb) released frompKS2Aa was ligated to pHT3101 (6.7 kb) at the KpnIand PstI sites and used to transform the E. coli.Recombinant clones were selected, based on the restric-tion digestion with KpnI and PstI that releases the(3.9 kb) cry2Aa operon and 6.7 kb pHT3101 vector(Figure 2). The recombinant pHT3101 containing thecry2Aa whole operon was named as pHT2Aa. Similarlythe pKS2Ab plasmid was digested with KpnI and XbaIto release cry2Ab operon (3.9 kb) and ligated to thepHT3101 vector at KpnI and XbaI sites. A ligatedmixture was used for E. coli transformation. Recombi-nant clones were selected based on restriction digestionwith KpnI and XbaI that releases the 3.9 kb insert and6.7 kb vector as in the case of pHT2Aa. The recombi-nant pHT3101 containing cry2Ab whole operon wasnamed pHT2Ab.

Expression of the cry2Aa and cry2Ab genes in anacrystalliferous Bt strain

The plasmid constructs pHT2Aa (harbouring thecry2Aa operon) and pHT2Ab (harbouring the cry2Aboperon) were used to transform the acrystalliferous Btstrain 4Q7 by electroporation, individually. Trans-formed Bt colonies were selected on LB agar containingerythromycin. To check the crystal protein productionof 4Q7 transformants, spore–crystal mixtures preparedfrom the recombinant 4Q7 Bt strains were subjected to

SDS-PAGE analysis. There were no significant differ-ences in the protein profile of the recombinant 4Q7harbouring pHT2Aa, pHT2Ab and the non-recombi-nant pHT3101 control, whereas the recombinant 4Q7strain harbouring the intact cry2Aa operon (Bt strain47-8, Lenin et al. 2001) showed a prominent band of�65 kDa (Figure 3A). However, Western blot analysiscarried out with Cry2Aa antiserum showed a distinctsignal corresponding to �65 kDa in the case of pHT2Aa(Cry2Aa) whereas a faint signal was noticed in case ofpHT2Ab (Cry2Ab). There was no detectable signal inthe case of the control (non-recombinant Bt strain 4Q7)as shown in (Figure 3B).

Cloning of the cry2Aa and cry2Ab genes in the pET29avector

The cry2Aa orf3 along with its terminator sequences(2.1 kb) was released from the pKS2Aa plasmid by XhoIand PstI digestion and cloned into XhoI and PstIrestriction sites of pBluescript II KS. RecombinantpBluescript II KS was digested with KpnI and NotI thatrelease the cry2Aa gene (2.1 kb) with KpnI and NotI

Figure 3. SDS-PAGE (A) and Western (B) analysis of recombinant Bt strains. Spore crystal mixture obtained from the 20 ml culture was

suspended in 200 ll of sterile distilled water. Five microlitre of each sample was analyzed. (A) Lane 1: Protein marker; Lane 2: 4Q7 (pHT3101);

Lane 3: 4Q7 (pHT2Ab); Lane4: 4Q7 (pHT2Aa); Lane 5: 4Q7 (pTN2Aa, intact cry2Aa operon of Bt strain 47-8). (B) Lane 1: Protein marker; Lane

2: 4Q7 (pHT2Aa); Lane 3: 4Q7 (pHT2Ab); Lane 4: 4Q7 (pHT3101).

Figure 2. Agarose gel electrophorosis of recombinant pHT3101 plas-

mids. Lane 1: k DNA/HindIII; Lane 2: pHT2Aa digested by KpnI and

PstI.

14 S. Kumar and V. Udayasuriyan

sites at their 5¢ and 3¢ ends, respectively. Later thecry2Aa gene was cloned into KpnI and NotI restrictionsites of pET29a. Cloning of cry2Aa orf (2.1 kb) wasconfirmed by restriction digestion of recombinantpET29a (pET2Aa) that released 2.1 kb cry2Aa and5.4 kb vector (Figure 4A). Similarly, the cry2Ab genereleased from pKS2Ab by XhoI and PstI digestion wascloned into XhoI and PstI restriction sites of pBluescriptII KS. Recombinant pBluescript II KS was digestedwith KpnI and NotI that releases cry2Ab (1.9 kb), whichwas cloned into KpnI and NotI restriction sites ofpET29a. Cloning of 1.9 kb cry2Ab DNA fragment intopET29 (pET2Ab) was confirmed by restriction digestionof recombinant pET29 that released 1.9 kb cry2Ab and5.4 kb vector (Figure 4B).

Expression of the cry2Aa and cry2Ab genes in E. coliBL21 (DE3) strain

The pET2Aa, pET2Ab and the non-recombinantpET29a (vector alone) were transformed separately to

E. coli BL21 (DE3) competent cells. Transformedcolonies that appeared on LB agar containing kanamy-cin were checked by PCR for the presence of cry2Aa andcry2Ab genes by gene specific primers. PCR amplifica-tion confirmed the presence of cry2Aa (2.1 kb) andcry2Ab (1.9 kb) genes in the case of recombinantplasmids whereas there was no amplification in the caseof the control (E. coli harbouring the pET29a vectoralone) as shown in Figure 5. The recombinant E. coliBL21 (DE3) strains harbouring pET2Aa, pET2Ab andthe pET29a vector alone were grown in LB broth andinduced with IPTG. Sonication and partial purificationof crystal proteins were carried out as mentioned in thesection Materials and methods. SDS-PAGE analysis ofprotein purified from recombinant E. coli strains showeda prominent band of �65 kDa in the case of pET2Aaand pET2Ab whereas there was no prominent band incase of pET control (Figure 6A). Western blot analysisusing the Cry2Aa antiserum confirmed the expression ofcry2Aa and cry2Ab genes in E. coli whereas there was nodetectable signal in case of control (Figure 6B).

Figure 4. Agarose gel electrophorosis of recombinant pET plasmids.

(A) Lane 1: k DNA/HindIII; Lane 2: pET2Aa digested by KpnI and

NotI. (B) Lane 1: k DNA/HindIII; Lane 2: pET2Ab digested by KpnI

and NotI.

Figure 5. Agarose gel electrophorosis of PCR amplified cry2Aa

(2.1 kb) and cry2Ab (1.9 kb) gene from recombinant BL 21 (DE3)

cells. Lane 1: BL 21 (pET29a); Lane 2: k DNA/HindIII; Lane 3: BL21

(pET2Ab); Lane 4: Bl21 (pET2Aa).

Figure 6. SDS-PAGE (A) and western blot (B) analysis of recombinant E. coli BL21 (DE3) strains. Cells from 20 ml culture was sonicated,

washed and suspended in 200 ll of sterile distilled water. Four microlitre of the original and fivefold diluted samples were used for SDS-PAGE

and western blot ananlysis, respectively. (A) Lane 1: Protein marker; Lane 2: BL21 (pET2Aa); Lane 3: BL21 (pET2Ab); Lane 4: BL21 (pET29a).

(B) Lane 1: Protein marker; Lane 2: BL21 (pET2Aa); Lanes 3 and 4: BL21 (pET2Ab); Lane 5: BL21 (pET29a).

Expression of cry2A genes in recombinant B. thuringiensis and E. coli strains 15

Discussion

In the present study the cry2Aa promoter along withorf1 and orf2 was used to express both cry2Aa andcry2Ab genes in acrystalliferous Bt strain 4Q7. Thecry2Aa and cry2Ab operons were constructed by fusingcry2Aa orf1+orf2 with cry2Aa orf3 and by joiningcry2Aa orf1+orf2 with cry2Ab orf followed by cry2Aaterminator sequences, respectively. Even though it wasnot possible to distinguish the protein profile of Cry2Aaand Cry2Ab transformants from that of non-recombi-nant pHT3101 in SDS-PAGE, we were able to detect theexpression of cry2Aa and cry2Ab genes in Western blotanalysis. But the level of expression was several-fold lessin the constructed cry2Aa as well as cry2Ab operoncompared to our previous clone where the cry2Aaoperon of Bt strain 47-8 was cloned as a single 3.9 kbDNA fragment (Lenin et al. 2001). However, there wasno difference in the amount of Cry2Aa protein producedby the wild type Bt strains 47-8 and 22-4 (data notshown). Therefore, the possible reason for the low levelexpression of the cry2Aa/cry2Ab gene observed inthe present study may be due to fusion of genes by theinsertion of XhoI restriction enzyme site just prior to thestart codon (ATG) which displaced the Shine Dalgarno(S-D) sequences (GGAGG) 14 bp upstream from theinitiation codon. In the original sequences of cry2Aaand cry2Ab genes, the S-D sequence resides 8 bpupstream from the initiation codon and the spacersequence between the ATG and S-D sequence wasfound to be highly conserved among cry2A genes(Table 2). The spacing between the S-D sequences andinitiation codon is important for the optimum transla-tion; the S-D sequence functions with reduced efficien-cies when it resides far from AUG codon (Kozak 1999).Another reason for the low level expression of Cry2Aproteins may be due to the sequences preceding theAUG start codon. In E. coli, the composition of thetriplet immediately preceding the AUG start codonaffects the efficiency of translation. For translation of b-galactosidase mRNA, the most favourable combina-tions of bases in this triplet are UAU and CUU. IfUUC, UCA or AGG replaced UAU or CUU, the levelof expression was 20-fold less (Hui et al. 1984). In ourconstructed operon of cry2Aa and cry2Ab the triplet

preceding the AUG codon is GAG whereas it is UAU inthe wild type sequence of cry2A genes. Therefore,replacement of favourable UAU by a GAG triplet priorto AUG in constructed cry2A operon (in present study)might be another reason for low level expression ofcry2Aa and cry2Ab genes.However, high-level expression of the cry2Aa and

cry2Ab genes was achieved in E.coli by cloning thecry2Aa orf3 and cry2Ab orf under the control of the T7promoter in the present study. Expression of Cry2Aa andCry2Ab proteins in E. coli was also confirmed by thewestern blot analysis using Cry2Aa antiserum. Cry2Aaantiserum reacted strongly with the Cry2Aa than Cry2Abprotein in the �65 kDa region. There were a few faintsignals observed in both the Cry2Aa and Cry2Ab lanesbelow 65 kDa region which could be degraded proteinsof Cry2Aa and Cry2Ab, respectively (Figure 6B). Therewas no detectable band in the control.Finally it is concluded that the cry2Aa and cry2Ab

genes cloned from new isolates of Bt were expressed inthe acrystalliferous Bt strain (4Q7) but the level ofexpression was very much reduced. The possible reasonsfor low level expression of the constructed cry2Aa andcry2Ab operons in the recombinant Bt strain arediscussed. High-level expression of cry2Aa and cry2Abgenes was achieved in E. coli under the control of the T7promoter. The Cry2A proteins are known to be toxicagainst important agricultural insect pests such asCnaphalocrocis medinalis, rice leaf folder (Maqboolet al. 1998) and Helicoverpa armigera, pest for cotton,chickpea, pigeonpea, sunflower, tomato etc. (Babu et al.2002). Hence, the Cry2A proteins obtained from therecombinant E. coli strains could be used for toxicityanalysis against the above mentioned pests of Indiancrop plants. The newly cloned cry2A genes could be avaluable tool for transgenic technology to impart insectresistance in the crop plants and to minimize the use ofhazardous chemical pesticides in agriculture. Partialnucleotide sequence data obtained from the newlycloned cry2A genes showed variation from their respec-tive holotype sequences (data not shown). Despite thehigh level homology of their amino acid sequences, theCry2Aa and Cry2Ab proteins differ in their level oftoxicity and spectrum of insecticidal activity (Dankocsiket al. 1990). Detailed information on the structure andfunction of the newly cloned genes will emerge once wehave the toxicity and deduced amino acid sequence datafor which experiments are in progress.

Acknowledgements

The authors are grateful to Dr K Ramasamy, theDirector of the Centre for Plant Molecular Biology,Tamil Nadu Agricultural University, Coimbatore,India, for the facilities provided and constant encour-agement during the course of study. Our sincere thanksto Dr. D.H. Dean for providing Cry2Aa antiserum. Thisresearch is supported by grants from the Rockefeller

Table 2. Upstream nucleotide sequences of cry2Aa/cry2Ab genes just

prior to start codon.

Origin/Location Sequence (5¢ ! 3¢)a

Wild type

cry2Aa/cry2Ab

DNA sequencesb

AA GGAGG AATTTTAT ATG

DNA Sequences

of constructed

cry2Aa/cry2Ab operon

AA GGAGG AATTTTAT CTCGAG ATG

a Shine Dalgarno (S-D) sequences in bold face; ATG codons are

underlined.b From Winder & Whitely (1889).

16 S. Kumar and V. Udayasuriyan

foundation, New York, USA and Department ofBiotechnology, Government of India, New Delhi, India.S.K. acknowledges the University Grants Commission,Government of India, New Delhi, India, for the JuniorResearch Fellowship awarded.

References

Adams, L.F., Visick, J.E. & Whiteley, H.R. 1989 A 20 kilodalton

protein is required for efficient production of the Bacillus thurin-

giensis subsp. israelensis 27-kilodalton crystal protein in Escheri-

chia coli. Journal of Bacteriology 171, 521–530.

Akhurst, R., Games, B. & Bird, L. 2000 Resistance to Ingard� cotton

by the cotton ball-worm, Helicoverpa armigera. Proceedings of the

10th Australian Cotton Conference, Brisbane.

Babu, B.G., Udayasuriyan, V., Asia Mariam, M., Sivakumar, N.C.,

Bharathi, M. & Balasubramanian, G. 2002 Comparative toxicity

of Cry1Ac and Cry2Aa d-endotoxins of Bacillus thuringiensis

against Helicoverpa armigera (H.). Crop Protection 21, 817–822.

Chakrabarti, S.K., Mandaokar, A., Kumar, A.P. & Sharma, R.P. 1998

Efficacy of lepidopteran specific delta-endotoxin of Bacillus thurin-

giensis against Helicoverpa armigera. Journal of Invertebrate

Pathology 72, 336–337.

Crickmore, N. & Ellar, D.J. 1992 Involvement of a possible chapero-

nin in the efficient expression of a cloned CryIIA d-endotoxin gene

in Bacillus thuringiensis. Molecular Microbiology 6, 1533–1537.

Crickmore, N., Bone, E.J. & Ellar, D.J. 1990 Genetic manipulation of

Bacillus thuringiensis: towards an improved pesticide. Aspects of

Applied Biology 24, 17–24.

Crickmore, N., Wheeler, V.C. & Ellar, D.J. 1994 Use of an operon

fusion to induce expression and crytallisation of a Bacillus

thuringiensis delta endotoxin encoded by a cryptic gene. Molecular

and General Genetics 242, 365–368.

Crickmore, N., Zeigler, D.R., Feitelson, J., Schnepf, E., Van Rie, J.,

Lereclus, J., Baum J., & Dean. D.H. 1998 Revision of the

nomenclature for the Bacillus thuringiensis pesticidal crystal

proteins. Microbiology and Molecular Biology Reviews 62, 807–

813.

Dankocsik, C., Donovan, W.P. & Jany, C.S. 1990 Activation of a

cryptic crystal protein gene of Bacillus thuringiensis subspecies

Kurstaki by gene fusion and determination of crystal protein

insecticidal specificity. Molecular Microbiology 4, 2087–2094.

Donovan, W.P., Dankosik, C.C., Gilbert, M.P., Gawron Burke, M.C.,

Groat, R.G. & Carlton B.C. 1988 Amino acid sequence and

entomocidal activity of the P2 crystal protein. Journal of Biological

Chemistry 263, 561–567.

Hui, A., Hayflick, J., Dinkelspiel, K. & De Boer, H.A. 1984

Mutagenesis of the three base preceding the start codon of the b-galactosidase mRNA and its effect on translation in Escherichia

coli. EMBO Journal 3, 623–629.

Kalman, S., Keehne, K.L., Cooper, N., Reynoso, M.S. & Yamamoto,

T. 1995 Enhance production of insecticidal protein in Bacillus

thuringiensis strain carrying an additional crystal protein gene in

their chromosome. Applied and Environmental Microbiology 61,

3063–3068.

Kozak, M. 1999 Initiation of translation in prokaryotes and eukar-

yotes. Gene 234, 187–208.

Kranthi, K.R., Kranthi, S., Ali, S. & Banerjee, S.K. 2000 Resistance of

Cry1Ac d-endotoxin of Bacillus thuringiensis in a laboratory

selected strain of Helicoverpa armigera (Hubner). Current Science

78, 1001–1004.

Laemmli, U.K. 1970 Cleavage of structural proteins during the

assembly of the head of Bacteriophage T4. Nature 227, 680–685.

Lenin, K., Asia Mariam, M. & Udayasuriyan, V. 2001 Expression of

cry2Aa gene in an acrystalliferous bacillus thuringiensis strain and

toxicity of Cry2Aa against Helicoverpa armigera. World Journal of

Microbiology and Biotechnology 17, 273–278.

Martin, P.A.W. & Travers, R.S. 1989 Worldwide abundance and

distribution of Bacillus thuringiensis isolates. Applied and Environ-

mental Microbiology 55, 2437–2442.

Maqbool, S.B., Husnain, T., Riazuddin, S., Masson, L. & Christou, P.

1998 Effective control of yellow stem borer and rice leaf folder in

transgenic rice indica varieties Basmati 370 and M7 using the novel

d endotoxin cry2A Bacillus thuringiensis gene. Molecular Breeding

4, 501–507.

Rajamohan, F., Hussain, S.R.A., Cotrill, J.A., Gould, F. & Dean,

H.D. 1996 Mutation in domain II, loop 3 of Bacillus thuringiensis

cry1Aa and cry1Ab delta endotoxin suggested loop 3 is involved

in initial binding of lepidopteran midgets. Journal of Biological

Chemistry 271, 25220–25225.

Sambrook, J., Fritsch, E.F. & Maniatis, T. 1989 Molecular Cloning: A

Laboratory Manual, 2nd edn. New York: Cold Spring Harbour

Laboratory. ISBN 0-87969-309-6.

Schnepf, H.E. & Whiteley, H.R. 1981 Cloning and expression of the

Bacillus thuringiensis crystal protein gene in Escherichia coli.

Proceedings of National Academy of Sciences of the USA 78,

2989–2897.

Schnepf, E., Crickmore, N., Van Rie, J., Lerecurs, D., Baum, J.,

Feitelson, J., Zeigler, J.D.R. & Dean, D.H. 1998 Bacillus

thuringiensis and its pesticidal crystal proteins. Microbiology and

Molecular Biology Reviews 62, 775–806.

Udayasuriyan, V., Nakamura, A., Mori, A., Masaki, H. & Uozumi, T.

1994 Cloning of a new crylA (a), gene from Bacillus thuringiensis

strain FU-2-7 and analysis of chimeric cry1A (a) proteins of

toxicity. Bioscience, Biotechnology and Biochemistry 58, 830–835.

Winder, W.R. & Whiteley, H.R. 1989 Two highly related crystal

proteins of Bacillus thuringiensis serovar kurstaki posses different

host range specificities. Journal of Bacteriology 171, 965–974.

Yamamoto, T. & Mclanghlin, R.E. 1981 Isolation of a protein from

the parasporal crystal of Bacillus thuringiensis var. kurstaki toxic to

the mosquito larva, Aedes taeniorhynchus. Biochemical and

Biophysical Research Communications 103, 414–421.

Expression of cry2A genes in recombinant B. thuringiensis and E. coli strains 17