ELSEVIER Molecular and Biochemical Parasitology 78 (1996) 265- 268

MOLECULAR

iti%IEMICAL PARASITOLOGY

Short communication

Cloning and sequencing of the gene encoding the principal 1%kDa secreted antigen of activated oncospheres of

Taenia sagina ta 1

Laura Benitez”, Teresa Garate”, Leslie J.S. Harrisonbs*, Paul Kirkham’, Sharon M. Brookes”, R. Michael E. Parkhouse’

“Ministerio de Sarzidad y Consurno, Insiiruto Salud Curios III. CNAIVIS, 18220 Majadahondu. Madrid. Spairl

hUt:icer.\if~~ qf Edirzhwgh. Centrr fbr Tropical Veterinarv Medicirlr, Easter Bush, Roslin. Midlothian, Scotland. EH25 YRG, UK ‘Institute ,for Animal Health, Pirbright Laboratories, Ash Roud. Pirhright, Waking. Surrq~. lfk’

Received 13 November 1995; revised 5 March 1996; accepted 12 March 1996

Kqvt~nds: Trrenirr suginat~l; Oncospheres; 18-kDa secretory antigen

The most rational molecular targets for a pro- tective vaccine against Taenia saginata are compo- nents of the surface and functional proteins, essential for evasion/establishment, such as

secreted enzymes of the invasive oncospheres. All

the accumulated evidence points to the fact that

invasive oncospheres are most vulnerable to anti- body-mediated immune attack and that secretions

of the oncospheres stimulate such immunity [l]. In fact of all the helminth infections, development of a vaccine against cestodes is considered the most feasible because of the strong evidence that larval taeniid infections can be eliminated by hu-

moral immune mechanisms [2]. This assertion is

Ahhreriutwrm: MAb. monoclonal antibody.

* Corresponding author. Tel: 0131 6506279: Fax: 0131

4455099: E-mail: Leshe.Harrison@ed.ac.uk

‘Yore: The nucleotide sequence reported here was deposited

in the GeneBankTM EMBL. databank under accession number

X95983 (TSO-18,‘HP6.4).

strengthened by recent studies in the closely re-

lated cestodes Taenia taeniat@mis and Taeniu ovis [3,4].

An analysis of the metabolically labelled secre-

tions of T. suginata oncospheres revealed a re-

markably restricted number of components with a

major protein of 18 kDa, later shown to be reac-

tive with MAb HP6, while immunofluorescence

studies indicated that the product was located in

the excretory or penetration glands of the onco-

spheres [.5]. Immunoelectronmicroscopic studies with MAb HP6 have now demonstrated 18 kDa/

HP6 determinants on the hooks and the closely

associated penetration gland duct of the onco-

sphere (Fig. 1) suggesting that the 18 kDa compo-

nent may have degradative enzymatic activity and

facilitate oncosphere tissue invasion. The possible

functional role of the 18 kDa secreted protein in oncosphere invasion emphasises the potential util-

ity of the 18 kDa protein as a vaccine.

0166.6851~96/$15.1)0 6: 1996 Elsevier Science B.V. All rights reserved

PII Sl66-6851(96)02610-2

266 L. Benitez et al. / Molecular and Biochemical Parasitology 78 (1996) 265-268

Fig. 1. Localisaton of 18 kDa oncosphere secreted product in penetration glands of T. saginata oncosphere by immunogold staining using MAb HP6. Oncospheres were hatched and activated (4). fixed and processed for immunogold staining by the Lowicryl progressive lowering of temperature method [9] using mouse MAb HP6 and goat anti-mouse Ig conjugated to 15 nm gold particles (Biocell International). In (a) is presented a section of the entire oncosphere to show the general organisation (the bar equals 250 nm). Higher power views of the membrane penetration gland (b - the bar equals 100 nm) and the base of one chitinous hook (c - the bar equals 100 nm) clearly show gold particle staining of the penetration gland (b) and the hook (c) with monoclonal antibody HP6. Other areas of the specimen were not stained with HP6. The isotype-matched negative control mouse monoclonal antibody was similarly negative over the entire section. Gold probes are indicated by small arrow heads. Anatomical structures indicated are: the hook (Ho), dark core vessicles (Ve), penetration gland duct (Du), muscle (Mu) and germinal cells (Gc).

A T. suginata oncosphere cDNA library was activated oncospheres. The resultant amplified li-

prepared in AUni-ZAP-II (Stratagene) from 1.2 brary ( 1.2 x 10” pfu/ml) was screened using MAb

pg mRNA isolated from 3 x lo6 hatched and HP6. A total of 1000 promising signals were

L. Benitez et al. / Molerular and Biochemical Parasitology 78 (1996) 265-268 261

GTCGGTTTGGTCTCATCTTGTTGGTGGCCGTTGTCGTTTTGGC~GC~TGGC~TT 60

..F?. .A....K....I.. 20

CCGGCAAACGTAGTATTCGTGCCATACATTCGCTGCTTCGC PANVVFVPYIRCFAISTDRI _.,........ .._

GCGGTGGTTTGGGATCCTAAAGATATGGCTGGCTATGACGTAPAGATGGTCAAAGTGATG AVVWDPKDMAGYDVKMVKVM

120 40

180 60

GTAGAAAAGGCAATAGAACCACGCAAGACCTGGACTTCA?tCAGTCAGCGTGGACAATGGA V E KAIEPRKTWTSTVSVDNG

AAAGTCATTATGAGGGACTTGAAGGCCAACACA?vZATACAGAGTGGACGTAGACGGTTAT KVIMRDLKANTTYRVDVDGY

240 80

300 100

CGAAACGATTTCATGGTGTTTGGCTCGGAGCGTTTCGT-CACCTTCGAAGA~GA RN D FMVFGSERFVKTPSKRR

CCAAAAGCAGGAAGGTCCGTGTAGATGCTTGCATGTCCGTAGTGCCTGCGTCAJ~A P KAGRSEDCRCLHVRSACVK

GCTAACGTTTGCGCAAAGCGGGCAhTGCATCTGTCGTCAATCCTTCGCXiGCAAACAAGT ANVCAKRAMHLSSILRKQTS

360 120

420 140

480 160

hTAATGTGACCTTTCATGTTAACGAATAATTCTTCGATTAATACAGGGTGTTGGTA 540 I M * 162

ATGCT9AAAAAAAAAAAAAAAPJlAA 565

Fig. 2. Nucleotide sequence of the HP6-4 insert (565 bp) and the deduced amino acid sequence. A putative open ended reading frame

of 441 bp was observed, following the ATG start codon at position 48 (bold M). A 19 hydrophobic amino acid sequence is indicated

by a dotted line, the TGA stop codon by an asterisk and the putative polyadencylation signal is underlined. A potential

N-glycosylation concensus sequence is indicated by a box.

obtained after screening 500 000 recombinant clones and ten of these were purified. The longest insert (Fig. 2) is comprised of 565 nucleotides with

a putative open reading frame of 441 bp, followed by a 3’-non-coding region of 76 nucleotides with a

putative polyadenylation signal. Due to the im- possibility of inspecting oncosphere RNA, the mRNA transcript size could not be confirmed by Northern blot. Nonetheless it seems probable that

the ATG indicated does represent the start of the protein sequence as it is contained in a Kozak sequence (GCGATGG i.e. A/GNNATGG/A) for initiation of translation [6] and then followed by a 19 amino acid hydrophobic sequence which finishes in a possible signal peptidase recognition site (alanine, isoleucine and serine) [7].

The amino acid sequence deduced from the nucleotide sequence (Fig. 2) has a molecular mass of 16.6 kDa. The small difference in molecular mass with the native protein may possibly be explained by post-transcriptional modifications. For example, that the sequence has one N-glyco-

sylation site, 2 phosphorylation sites and one

N-myristylation site. The DNA sequence and the

deduced amino acid sequence of the clone HP6-4

were processed using the GCG-computer pro-

gramme set for VAX/VMS computers [8]. No

homologies were found with published sequences.

MAb HP6 was found by Western blot to be

reactive with the expressed polypeptide (data not

shown).

In view of the acknowledged importance of

functional secreted antigens in the stimulation of

protective immunity against T. saginatrr it is con-

sidered that further studies into the possible use of

this 18 kDa molecule as a vaccine should be

investigated. Of further interest is its possible role

as an indicator of the degree of resistance of cattle

to T. saginata infection. Finally, the close taxa-

nomic relationship between T. saginuta and Tue- nia solium also means that this molecule may be

immediately applicable to similar studies in T. solium cysticercosis.

268 L. Benitez et al. I Molecular und Biochemical Parasitology 78 (1996) 265-268

Acknowledgements [31

The research presented in this paper was sup- ported by a grant from the European Union, by the FISS (0321/94) and by the ODA/NRRD Ani-

mal Health Programme. We would like to thank Dr J.A. Onyango-Abuje of NVRC, KARl Kenya

for supplying the T. suginuta eggs and Mr S.H. Wright of CTVM for his skillful technical assis-

tance.

[41

[51

[61

References

[‘I

[21

Harrison, L.J.S. and Parkhouse, R.M.E. (1994) Antigens

of parasitic helminths in protection and pathology. In:

Helminthology (Chowdhury. N.. rd.), pp. 258-271.

Narosa Publishing House and Springer Verlag Ltd.

Harrison. L.J.S. and Parkhouse. R.M.E. (1985) Antigens

of taeniid cestodes in protection. diagnosis and escape.

Curr. Top. Microbial. Immunol. 120. l59- 172.

[71

PI

[91

Rickard, M.D., Harrison. G.B.L., Heath, D.D. and

Lightowlers, M.A. (1995) Trre~riu oris vaccine ~ Quo

V&it. Parasitology I IO, S5S9.

Cougle, W.G., Lightowlers, M.W., Bogh, H.O.. Rickard,

M.D. and Johnson, K.S. (1991) Molecular cloning of

Taeniu taeniaeforrnais oncosphere antigen genes. Mol.

Biochem. Parasitol. 45, l37- 146.

Harrison, L.J.S. and Parkhouse, R.M.E. (1986) Passive

protection against Tuenia saginutu infection in cattle by a

mouse monoclonal antibody reactive with the surface of

the invasive oncospheres. Parasite Immunol. 8. 319-332.

Kozak. M. (1983) Comparison of initiation of protein

synthesis in prokaryotes, eukaryotes and organelles. Mi-

crobiol. Rev. 47,1-45.

Periman. D. and Halvorsan, H.O. (1983) A putative signal

peptidase recognition site and sequences in eukaryotic and

prokaryotic signal peptides. J. Mol. Biol. 167, 391-409.

Devereux, J.R.. Haeberli, P.L. and Smithies, 0. (1984) A

comprehensive set of sequence analysis programmes for the

VAX. Nucleic Acids Res. 12, 3877395.

Hyatt, A.D. (1991) In: Electron Microscopy in Biology: A

Practical Approach (Harris, R.. ed.). pp. 56681. I.R.L..

Oxford.