church of the annunciationbob jones jake jacobson christopher krahling allan kukoski chuck mahon...
TRANSCRIPT
![Page 1: Church of the AnnunciationBob Jones Jake Jacobson Christopher Krahling Allan Kukoski Chuck Mahon Barbara Mollard Fred Mollard Juan Ruiz Family Melody Sethman Anthony Tufaro Mike Wachter](https://reader033.vdocuments.us/reader033/viewer/2022042911/5f41ea7356e05175e24b499c/html5/thumbnails/1.jpg)
PARISH
OFFICE HOURS ~
Tuesday & Thursday 10:00 AM to 3:00 PM
or by Appointment
~ 80 Main Street
PO Box 136 Bloomsbury, NJ
08804-0136 ~
Rectory Phone: (908) 479-4905
Religious Education (908) 479-6708
~ Parish Web Site:
annunciationrcc.com ~
Parish Email Annunciation80
@gmail.com
Church of the Annunciation
Mission Statement
PARISH STAFF Rev. Roberto D. Coruña, Pastor Lorraine Soos, Parish Office Donna Perrone Parish Catechetical Leader Tina Spadafora Parish Choir Director Jeff Sinise Chairperson Finance Council Pat Kozlowski Chairperson Parish Pastoral Council
SACRAMENTAL & PRAYER LIFE Sacrament of Eucharistic Mass Monday thru Thursday 9:00AM First Friday 9:00AM Saturday Vigil 4:30PM Sunday 9:00AM Holy Days As announced
SACRAMENTS Reconciliation: Saturday - 4:00 to 4:20 PM or by Appointment Baptism: Second & Fourth Sunday of the Month at 1:00 PM Contact the Rectory in advance to make needed arrangements.
Matrimony: Contact the Rectory several months prior to planning a date.
Sick Calls: Please contact the Rectory to make arrangements for Fr. Bert to make the initial visit to the home, and to schedule Eucharistic Ministers to bring Ho-ly Communion as needed.
RELIGIOUS EDUCATION
2019-2020 PCL : Donna Perrone Phone: 908-479-6708 Email: [email protected]
CCD Office Hours Sun. 8:30-11:30AM Mon. 3:30-8:30PM Classes Grades Pre-K- 8 Sunday 10:10AM – 11:25AM Grade 3 Monday 4:30PM – 5:45PM Grade 5 & 7 Monday 7:00PM – 8:15PM Vacation Bible School July 13-18, 2020
PARISH MINISTRIES
Choir ~ Devotions ~ Holy Name Hospitality & Fund Raising ~ Legion of Mary
Liturgical ~ Religious Education ~ RCIA Social Concerns ~ Women’s Guild
589
LAY TRUSTEES Charles “Chuck” Mahon MaryLou Deak
![Page 2: Church of the AnnunciationBob Jones Jake Jacobson Christopher Krahling Allan Kukoski Chuck Mahon Barbara Mollard Fred Mollard Juan Ruiz Family Melody Sethman Anthony Tufaro Mike Wachter](https://reader033.vdocuments.us/reader033/viewer/2022042911/5f41ea7356e05175e24b499c/html5/thumbnails/2.jpg)
Twenty First Sunday in Ordinary Time August 23, 2020
**Social Concerns**
Shop Rite Gift Cards
Due to the Diocesan order to limit Mass attendance
Mass Offerings
*MASSES re-opened for Public Mass on Saturday, June 13th at 4:30PM Please follow previously advised CDC & Diocese guidelines.* SATURDAY August 22nd The Queenship of the Blessed Virgin Mary 4:30 PM Anna Waldbiesser /Bob & Jane Phillips SUNDAY August 23rd 9:00 AM Robert Davis /The Somers Sisters 11:30 AM David Scott /Barbara Scott 3:00 PM Confirmandi (Private Mass) /Church of the Annunciation MONDAY August 24th St. Bartholomew 9:00 AM Happy Birthday Dan Lyons, Sr. /Bob & Jane Phillips TUESDAY August 25th St. Louis/St. Joseph Calasanz 9:00 AM Eric Koonce / Peggy Koonce WEDNESDAY August 26th 9:00 AM Alphonus & Jennie Somers /The Somers Sisters THURSDAY August 27th St. Monica 9:00 AM May McCalla /Andre Fleury FRIDAY August 28th St. Augustine NO MASS SATURDAY August 29th The Passion of St. John the Baptist 4:30 PM Kathryn Letcher /Mark & Kathy Andia SUNDAY August 30th 9:00 AM Birthday Blessings for Rosaura Rivera /Rich & Lorraine Soos 11:30 AM Marian Grasza /Greg & Ivona Grasza
589-2
Saturday Aug 22 Ez 43:1-7ab; Ps 85:9ab-14; Mt 23:1-12
Sunday Aug 23 Is 22:19-23; Ps 138:1-8; Rom 11:33-36; Mt 16:13-20
Monday Aug 24 Rv 21:9b-14; Ps 145:10-18; Jn 1:45-51
Tuesday Aug 25 Thes 2:1-17; Ps 96:10-13; Mt 22:23-26
Wednesday Aug 26 Thes 3:6-18; Ps 128:1-5; Mt 23:27-32
Thursday Aug 27 Cor 1:1-9; Ps 145:2-7; Mt 24:42-51
Friday Aug 28 Cor 1:17-25; Ps 33:1-11; Mt 25:1-13
Saturday Aug 29 Cor 1:26-31; Ps 33:12-21; Mk 6:17-29
Daily Bible Readings
**The Sanctuary Candle**
**Mass Intentions**
The most beautiful gift one can give to another person is a Spiritual Bouquet of the Holy Sacri ice of the Mass.”
2021
~~~~~~ **Message from Father Bert**
~~~~ **Annunciation News**
CONGRATULATIONS!!
![Page 3: Church of the AnnunciationBob Jones Jake Jacobson Christopher Krahling Allan Kukoski Chuck Mahon Barbara Mollard Fred Mollard Juan Ruiz Family Melody Sethman Anthony Tufaro Mike Wachter](https://reader033.vdocuments.us/reader033/viewer/2022042911/5f41ea7356e05175e24b499c/html5/thumbnails/3.jpg)
589-3
To ac vate the prayer chain, please contact one of the following: Chuck & Joyce Mahon 908-735-4816 Text 908-432-3930 Joe & Mary Zinkann 908-730-8658 Text 908-500-0426 Jeanie Franzo 908-479-4284 Text 908-268-1886 ***Names on the prayer chain will remain ac ve for 3 months. If your need for prayers con nues, please contact us to be added again.
~~~~~ Do You Know
Answer: Pray for Us Weekly Collections
July 19 July 26 Aug 2 Second—Parish Improvement Aug 9 Aug 15—Assumption Aug 16
$ 3,798 $ 2,320 $ 3,273 $ 1,503 $ 2,442 $ 482 $ 1,177
Scripture Reflections
“Or who has given the Lord anything that he may be re-paid?” (Romans 11:35)
St. Paul reminds us of a central fact of stewardship. We can-not give the Lord anything - God already owns it all. God made everything. All we can do is return a por on of God’s many gi s back to Him. Sincere gra tude for our gi s opens our hearts to joyful generosity! Through your generous sharing, you just may be the answer to someone’s prayer.
~~~~~ Keep in Touch!!
If you are not ready to return to Public Mass be sure to join our Zoom Mass each Sunday at 9am.
www.facebook.com/Annuncia onChurchHolyNameSociety
~~~~ News from the Diocese
2020 Bishop’s Annual Appeal Stepping Forward in Faith: Grace in Action—
120%
RESTORE—REKINDLE - RENEW
Virtual Worldwide Marriage Encounter
aweekendforyourmarriage.org
Virtual Bible Study for Young Married & Engaged Couples
Monday, August 24th from 6:30pm to 7:30pm
[email protected] Peter’s Pence Collection—
Jean Cronch Clare Hudson Bob Jones Chuck Mahon Sigfried Netzer Katia Saad Barbara Studley Inge Wallner Father Bert Coruna
Deceased: Sylvester Basler Joe Schuster Philip Studer
Annunciation Calendar
![Page 4: Church of the AnnunciationBob Jones Jake Jacobson Christopher Krahling Allan Kukoski Chuck Mahon Barbara Mollard Fred Mollard Juan Ruiz Family Melody Sethman Anthony Tufaro Mike Wachter](https://reader033.vdocuments.us/reader033/viewer/2022042911/5f41ea7356e05175e24b499c/html5/thumbnails/4.jpg)
589 Annunciation ~ Bloomsbury, NJ (back) Rt. X John Patrick Publishing Company (800) 333-3166 • www.jppc.net
Truck Caps • LinersBed Mats • Truck & Camping Accessories • Utility Trailer
Open & EnclosedSales & Rentals
1074 Rt. 173 E.1074 Rt. 173 E.908-735-5995908-735-5995 Parishioners
QUALITY, QUALITY, VARIETY VARIETY & SERVICE& SERVICEShop Rite of Flemington
( Rt. 31 & Commerce St.)Shop Rite of Clinton
( 50 Wal-Mart Plaza)Shop Rite of Greenwich
( 1207 Rt. 22, Phillipsburg)
KATHLEEN MCGOWAN ARGIROFFKATHLEEN MCGOWAN ARGIROFFBROKER, REALTORBROKER, REALTOR
Cellular: (252) 202-8147Cellular: (252) 202-8147
NACHMAN Realty
NEED A REALTOR? Whether you are a Buyer or Seller in today’s market it is
more important than ever to have the “Right” Realtor. I have a network of local realtors ready to work for you.
I’m easily reached at any time. Look forward to hearing from you!
KATHLEEN MCGOWAN ARGIROFF (A Philadelphia native) KATHLEEN MCGOWAN ARGIROFF (A Philadelphia native) WWW.THINKOBX.COM - [email protected] WWW.THINKOBX.COM - [email protected] 1-800-282-6401 Ext.117 1-800-282-6401 Ext.117
Parishioner
Christopher J. ButlerChristopher J. ButlerThe Realtor For All Fellow Annunciation Families
908.285.0534908.285.0534 [email protected]
SUPREME
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we
can help Save you money with your monthly payments on your
commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days! Four season customer
service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
See what colorcan do for you!
John Patrick Publishing
800-333-3166
to advertise in color, please call us at
BUILD YOUR COMMUNITY!
SHOP LOCAL
Patronize the Adve isers who make this bulletin possible!
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering
their vehicle to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson
#WHATSMYNAME
Mallory’s Army FoundationUnited Together In The Fight Against Bullying...
Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com
(973) 440-8657 [email protected]
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
This Space is Available!800-333-3166 ext. 161
www.jppc.net
Log onto Log onto www.jppc.netwww.jppc.netconveniently from conveniently from your home or offi ce.your home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted
FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!
Wedding Wedding Invitations & Invitations & Holiday CardsHoliday Cards
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati
echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community
Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.
This describes the power of..., ppppppppppppppp , , gpppppppppppppppppppppppppppppp
Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!Call 1.800.333.3166!