Chromatin Structure and Replication
Chromosome Structure and Replication From chapters 5 & 6 Chapter 5 While we will not cover DNA structure in class formally, but you should review materials in the chapter on the fundamental structures of DNA. We will discuss in class chromatin structure covered on pages pp In Chapter 6, you will not be responsible for the details of homologous recombination. DNA Helicase Questions in this chapter you should be able to answer: Chapter 5- #s 1, 3, 4, 5A& B, 7, 11-14, 16 Chapter 6- #s 1 - 8, Chromatin Structure and Replication Chromatin Structure and Replication
From Chapter 5 Eukaryotic DNA exists as chromatin Chromatin = DNA + histones Nucleosome core Histone octet H1 Nucleosome Chromatin Structure and Replication Chromatin Structure and Replication
Nucleosomes allow for DNA condensation and remodeling Histone modifications Hetero- & Euchromatin DNA supercoiling Inheritable Supercoiling Chromatin Structure and Replication Chromatin Structure and Replication
From Chapter 6 Why is DNA replication said to be semiconservatve? Read How We know about Meselson and Stahl experiment 06_04_replic.rounds.jpg Chromatin Structure and Replication Chromatin Structure and Replication
In what direction does DNA replication occur? Where does energy for addition of nucleotide come from? What happens if a base mismatch occurs? 06_02_DNA template.jpg DNA Orietation Chromatin Structure and Replication Chromatin Structure and Replication
Why does DNA replication only occur in the 5 to 3 direction? (Picture not in 4th edition) 06_15_proofreading.jpg Chromatin Structure and Replication Chromatin Structure and Replication
Where does DNA replication begin on a chromosome? 06_09_Replic.forks.jpg Answer Question 6-1A How long until forks 4 and 5 meet? Distance between bases is 0.34 nm Replication rate is 100 bases / sec How many nM / mM? 2) How many nM between 4 - 5? 3) How many bases between 4 5? 4) How long to replicate this region? Chromatin Structure and Replication Chromatin Structure and Replication
How is DNA synthesized on 3 end behind advancing replication fork? Okasaki fragments 06_12_asymmetrical.jpg Chromatin Structure and Replication Chromatin Structure and Replication
Why does DNA synthesis begin with an RNA primer? How are Okasaki fragments synthesized and connected? 06_16_lagging strand.jpg Chromatin Structure and Replication Chromatin Structure and Replication
How do other proteins contribute to DNA replication? Helicase Topoisomerase ssDNA binding proteins Sliding clamp DNA Polymerases Ligase 06_17_group proteins.jpg Replication Fork DNA Replication Chromatin Structure and Replication Telomeres pose a special DNA replication problem
~ 7-10,000 bases Telomere repeat sequence TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC s X= Sacrificial DNA Tick and Sick-6 11 Chromatin Structure and Replication
What is the telomere replication problem? Terminal 3 end cannot be replicated by DNA polymerase 06_18_telomeres.jpg Chromatin Structure and Replication Chromatin Structure and Replication
How does telomerase solve the problem?? RNA template Telomerase and cancer treatment 06_18_telomeres.jpg Telomere Replication Chromatin Structure and Replication Telomere shortening protects us against cancer
Cancer cells become immortal by activating telomerase Stem cells are thus prone to cancer Tick and Sick-6 14 Is telomere lengthening the answer to eternal youth?
ABC News report Tick and Sick-6 Pack 3 Powerful Proteins
Some viruses cause to cell proliferation and cancer ~12-18% of human cancers Viruses prefer dividing cells Human papilloma viruses (HPV) Epstein-Barr Hepatitis B & C Kaposis sarcoma herpesvirus HPV 16 & 18 Pack 3 Powerful Proteins E5 suppresses MHC production -- promotes immune evasion E6 inactivatesp53 TSG -- genome instability activates telomerase -- confers immortality E7 triggers cell proliferation promotes angiogenesis Tick and Sick-6 Chromatin Structure and Replication
How is damaged DNA repaired? Surveillance & repair proteins 1) Mismatch repair during S-phase -- how does the cell know which base to replace? 2) Excision repair (mismatch) -- post S-phase -- 3 steps -- 50% chance of error 06_26_three steps.jpg Chromatin Structure and Replication Chromatin Structure and Replication
How is damaged DNA repaired? 3) End-joining of DS breaks -- Nonhomologous end joining -- short deletion 4) Homologous recombination -- usually S-phase -- sequence on homolog is used 06_26_three steps.jpg Chromatin Structure and Replication Gene & Genome Evolution
Mutations accumulate over time Numerous single-nucleotide polymorphisms (SNP) distinguish individual genomes Consequence of point mutations 107+ documented in humans Can influence: Our individual physical traits Disease susceptibility Risk factors for disorders e.g., Macular Degeneration SNP in Complement factor H His Tyr 5 7x>risk Gene & Genome Evolution