chromatin structure and replication
DESCRIPTION
Chromatin Structure and Replication From Chapter 5 Eukaryotic DNA exists as chromatin Chromatin = DNA + histones Nucleosome core Histone octet H1 Nucleosome Chromatin Structure and ReplicationTRANSCRIPT
Chromatin Structure and Replication
Chromosome Structure and Replication From chapters 5 & 6
Chapter 5 While we will not cover DNA structure in class formally,
but you should review materials in the chapter on the fundamental
structures of DNA. We will discuss in class chromatin structure
covered on pages pp In Chapter 6, you will not be responsible for
the details of homologous recombination. DNA Helicase Questions in
this chapter you should be able to answer: Chapter 5- #s 1, 3, 4,
5A& B, 7, 11-14, 16 Chapter 6- #s 1 - 8, Chromatin Structure
and Replication Chromatin Structure and Replication
From Chapter 5 Eukaryotic DNA exists as chromatin Chromatin = DNA +
histones Nucleosome core Histone octet H1 Nucleosome Chromatin
Structure and Replication Chromatin Structure and Replication
Nucleosomes allow for DNA condensation and remodeling Histone
modifications Hetero- & Euchromatin DNA supercoiling
Inheritable Supercoiling Chromatin Structure and Replication
Chromatin Structure and Replication
From Chapter 6 Why is DNA replication said to be semiconservatve?
Read How We know about Meselson and Stahl experiment
06_04_replic.rounds.jpg Chromatin Structure and Replication
Chromatin Structure and Replication
In what direction does DNA replication occur? Where does energy for
addition of nucleotide come from? What happens if a base mismatch
occurs? 06_02_DNA template.jpg DNA Orietation Chromatin Structure
and Replication Chromatin Structure and Replication
Why does DNA replication only occur in the 5 to 3 direction?
(Picture not in 4th edition) 06_15_proofreading.jpg Chromatin
Structure and Replication Chromatin Structure and Replication
Where does DNA replication begin on a chromosome?
06_09_Replic.forks.jpg Answer Question 6-1A How long until forks 4
and 5 meet? Distance between bases is 0.34 nm Replication rate is
100 bases / sec How many nM / mM? 2) How many nM between 4 - 5? 3)
How many bases between 4 5? 4) How long to replicate this region?
Chromatin Structure and Replication Chromatin Structure and
Replication
How is DNA synthesized on 3 end behind advancing replication fork?
Okasaki fragments 06_12_asymmetrical.jpg Chromatin Structure and
Replication Chromatin Structure and Replication
Why does DNA synthesis begin with an RNA primer? How are Okasaki
fragments synthesized and connected? 06_16_lagging strand.jpg
Chromatin Structure and Replication Chromatin Structure and
Replication
How do other proteins contribute to DNA replication? Helicase
Topoisomerase ssDNA binding proteins Sliding clamp DNA Polymerases
Ligase 06_17_group proteins.jpg Replication Fork DNA Replication
Chromatin Structure and Replication Telomeres pose a special DNA
replication problem
~ 7-10,000 bases Telomere repeat sequence
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCC s X= Sacrificial
DNA Tick and Sick-6 11 Chromatin Structure and Replication
What is the telomere replication problem? Terminal 3 end cannot be
replicated by DNA polymerase 06_18_telomeres.jpg Chromatin
Structure and Replication Chromatin Structure and Replication
How does telomerase solve the problem?? RNA template Telomerase and
cancer treatment 06_18_telomeres.jpg Telomere Replication Chromatin
Structure and Replication Telomere shortening protects us against
cancer
Cancer cells become immortal by activating telomerase Stem cells
are thus prone to cancer Tick and Sick-6 14 Is telomere lengthening
the answer to eternal youth?
ABC News report Tick and Sick-6 Pack 3 Powerful Proteins
Some viruses cause to cell proliferation and cancer ~12-18% of
human cancers Viruses prefer dividing cells Human papilloma viruses
(HPV) Epstein-Barr Hepatitis B & C Kaposis sarcoma herpesvirus
HPV 16 & 18 Pack 3 Powerful Proteins E5 suppresses MHC
production -- promotes immune evasion E6 inactivatesp53 TSG --
genome instability activates telomerase -- confers immortality E7
triggers cell proliferation promotes angiogenesis Tick and Sick-6
Chromatin Structure and Replication
How is damaged DNA repaired? Surveillance & repair proteins 1)
Mismatch repair during S-phase -- how does the cell know which base
to replace? 2) Excision repair (mismatch) -- post S-phase -- 3
steps -- 50% chance of error 06_26_three steps.jpg Chromatin
Structure and Replication Chromatin Structure and Replication
How is damaged DNA repaired? 3) End-joining of DS breaks --
Nonhomologous end joining -- short deletion 4) Homologous
recombination -- usually S-phase -- sequence on homolog is used
06_26_three steps.jpg Chromatin Structure and Replication Gene
& Genome Evolution
Mutations accumulate over time Numerous single-nucleotide
polymorphisms (SNP) distinguish individual genomes Consequence of
point mutations 107+ documented in humans Can influence: Our
individual physical traits Disease susceptibility Risk factors for
disorders e.g., Macular Degeneration SNP in Complement factor H His
Tyr 5 7x>risk Gene & Genome Evolution