characterization and partial sequence of a new furovirus of wheat in china

Characterization and partial sequence of a new furovirusof wheat in China

R. Yea,b, T. Zhenga, J. Chena*, A. Diaoa,c, M. J. Adamsc, S. Yub and J. F. Antoniwc

aVirology Laboratory, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China; bDepartment of Microbiology, FudanUniversity, Shanghai 200433, China; and cCrop and Disease Management Department, IACR-Rothamsted, Harpenden, HertsAL5 2JQ, UK

A soil-borne wheat virus causing severe mosaic and stunting symptoms on wheat in China has been characterized. Ithad been considered to be soil-borne wheat mosaic virus (SBWMV) because of its rod-shaped virions and similaritiesto epidemiology and host range. In this study, the virions purified from infected wheat tissue were approximately20 nm in diameter and of two lengths (140–160 nm and 280–300 nm), with a coat protein of 19 kDa and two RNAcomponents of approximately 7 and 3·5 kb. A rabbit antiserum was produced against the virus and a serologicalrelationship to SBWMV from the USA (Oklahoma) was demonstrated. However, the coat protein was not recognizedby most monoclonal antibodies against Oklahoma SBWMV in either ELISA, ISEM or Western blot analysis,indicating epitope differences. In RT-PCR experiments the viral nucleotide sequences were significantly different fromthose of SBWMV, and this was confirmed by partial sequencing of the cloned PCR fragments generated from RNA1(c. 1100 nt) and RNA2 (c. 1400 nt), which showed homologies of about 79 and 63%, respectively, to correspondingregions of SBWMV. Because of these significant differences in serology and nucleotide sequence it is suggested that it isa new furovirus for which the name Chinese wheat mosaic virus (CWMV) is proposed.

Keywords: Chinese wheat mosaic virus, nucleotide sequence, SBWMV, serology

Introduction

In the past two decades, a soil-borne virus disease of wheathas occurred in successive crops in Shandong province,China, causing grain yield losses commonly of 10–30%and sometimes up to 70% (Chen, 1993). This disease iscaused by wheat yellow mosaic virus (WYMV, genusBymovirus) and/or a rod-shaped virus and is associatedwith the plasmodiophorid fungus Polymyxa graminis,which is the presumed vector of both viruses. Thesymptoms are light chlorotic streaking on the youngestleaves and bright yellow chlorotic streaking on olderleaves (Fig. 1), or even purple chlorotic stripes on somelocal wheat varieties. Infected plants are severely stunted,wilt and later die (Fig. 2). The rod-shaped virus wasdescribed as soil-borne wheat mosaic virus (SBWMV,genus Furovirus) on the basis of a serological relationship(Cai et al., 1983; Xu et al., 1984; Chen, 1993) but nofurther study was carried out. In this paper furthercharacterization of the virus is presented, including thenucleotide sequence of two parts of its genome, whichsuggests that it is a new member of the genus Furovirus.

Materials and methods

Virus purification

Infected wheat plants (cv. Yannong 15) were collectedfrom the farm of Yantai Institute of AgriculturalResearch on 1 April 1997 and stored at ¹ 808C. Thevirus was purified from the infected leaves using themethod of Shirako & Brakke (1984), but including aprecipitation with 6% PEG (MW 6000) containing0·1% Triton X-100 and 3% NaCl between the twodifferential centrifugations. Virus concentrations wereestimated from the A260 assuming a similar extinctioncoefficient to tobacco mosaic virus (A260; 1mg mL¹1¼ 3·1). Diluted preparations were examinedby electron microscopy after negative staining withsodium phosphotungstate. Particle sizes were deter-mined from a total of about 500 particles by examina-tion in a Jeol JEM-1200EX electron microscope at×100 000 using its LMD10 measuring module; allmagnifications were calibrated with a graticule replica.

Antiserum production

A preparation containing 400 mg of virus was emulsifiedwith an equal volume of Freund’s complete adjuvant

Plant Pathology (1999) 48, 379–387

Q 1999 BSPP 379

*To whom correspondence should be addressed.

Accepted 11 January 1999.

380 R. Ye et al.

Q 1999 BSPP Plant Pathology (1999) 48, 379–387

containing 4 mg BCG mL¹1 and multisite-injected intra-muscularly into the hind legs of a rabbit. Boosterinjections with 500 mg of virus preparation weremade subcutaneously on the 24th and 50th days. Fourdays after the final injection, approximately 35 mL ofantiserum was obtained from a bleeding of the rabbit.

Plate-trapped antigen (PTA)-ELISA

ELISA tests were carried out in 96-well polystyrenemicrotitre plates, but the outer wells were not used.Plates were coated with antigen (virus preparation or sapfrom leaves at 1 : 100) diluted in 0·05 M sodiumcarbonate buffer, pH 9·6, at 48C overnight. Afterblocking with PBS-T (PBS with 0·1% (v/v) Tween-20)containing 5% nonfat milk powder at room temperature(approx. 208C) for 1 h, the test antiserum (diluted inPBS-T containing 1% nonfat milk powder) was addedand the plates were incubated at 378C for 2 h. After athorough washing, alkaline phosphatase conjugatedgoat antirabbit immunoglobin G (IgG) (Sigma, Sigma-Aldrich, Poole, Dorset) was added (1 : 1000) and theplates were incubated at 378C for 2 h. After a furtherwashing, p-nitrophenyl phosphate substrate wasadded and OD405 values were recorded at intervalsof up to 18 h in a Bio-Rad Model 450 MicroplateReader (Bio-Rad Laboratories Ltd, Hemel Hempstead,Herts).

Immunosorbent electron microscopy (ISEM)

Carbon-coated electron microscope grids were floated,carbon-side-down, on drops of antiserum diluted1 : 1000 with coating buffer (0·05 M sodium carbonatebuffer, pH 9·6) for 30 min at room temperature. Afterthree washings by floating on ISEM buffer (0·06 M

phosphate buffer containing 0·1 M EDTA), the gridswere floated on drops of virus sap overnight at 48C,washed and, for decoration, transferred to antiserumdiluted 100-fold for 1·5 h at room temperature. Afterwashing and staining in sodium phosphotungstate, thegrids were examined in the electron microscope at amagnification of ×30 000.

SDS-PAGE and Western blotting

Purified virus preparation (30 mL containing 0·2 mgvirus) was mixed with the same volume of gel-loadingbuffer (0·06 M Tris-HCl, pH 6.8, containing 20 g L¹1 ofsodium dodecyl sulphate (SDS), 5 mL L¹1 of b-mercap-toethanol, 1 mL L¹1 of glycerol and 0·2 g L¹1 bromo-phenol blue). SDS-polyacrylamide gel electrophoresis(PAGE) and immunoblotting were carried out by themethods described by Laemmli (1970) and Torranceet al. (1988).

Electrophoresis of viral RNAs and Northern blotanalysis

Viral RNAs were extracted from the purified viruspreparation using the method described by Chen et al.(1994), denatured with formaldehyde/formamide byheating to 1008C for 3 min followed by rapid coolingon ice, separated by electrophoresis in formaldehyde/agarose gels and transferred to nitrocellulose. Mem-branes were probed sequentially with RNA1- or RNA2-specific cDNA clones, labelled with [a32P] dATP by themethod of Feinberg & Vogelstein (1984) and exposed toX-ray-sensitive film at ¹ 808C.

RT-PCR

First strand cDNA synthesis was carried out in a 20-mLreaction volume using Superscript Reverse Transcriptase(Life Technologies Ltd, Paisley) according to themanufacturer’s instructions, with 2 mg purified viralRNA as a template and primers SB7 for RNA1 and Ye3for RNA2 (Table 1).

PCR reactions contained 1 mL template cDNA (fromcDNA synthesis reactions above, diluted to 100 mLwith water), 20 pmol of each amplification primer (seeTable 1 and text), 200 mM each dNTP, 1·5 mM MgCl,50 mM KCl and 10 mM Tris-HCl, pH 8·3, in a 50-mLreaction volume. Template DNA was denatured at 948Cfor 3 min and then 2·5 units of Taq DNA polymerase(Life Technologies) was added. All PCR amplificationsconsisted of 30 cycles, each of 1 min at 948C for

New furovirus of wheat 381


Table 1 Primers used for RT-PCR and sequencing reactions

Primer Sequence (50 to 30) Positiona Notes

SB5 GGT GTT CCC GGC TGT GGA AAA TCT RNA1 (þ) 3180–3203SB7 TAT CAA TGA ATC ATC ACC ACC AAA RNA1 (¹) 5153–5130 one mismatch to L07937IA3 TAT TTC TTC TTC ACA TAC GAC AAG RNA2 (þ) 2–25Ye3 TGG GCC GGA TAA CCC T RNA2 (¹) 3593–3578

a Relative to sequences of Shirako & Wilson, 1993 (L07937 and L07938).

Figure 2 Severe infection by the rod-shaped virus and WYMV on wheat plants (cv. Yannong 15) at the farm of Yantai Institute of AgriculturalResearch, Shandong province, China.

Figure 1 Symptoms caused by joint infection by the rod-shaped virus and wheat yellow mosaic bymovirus (WYMV) on wheat plants (cv.Yannong 15). Right, infected plant; left, healthy plant.

382 R. Ye et al.


0

10

20

30

40

50

60

70

80 100 120 140 160 180 200 220 240 260 280 300 320 340 360

Length (nm)

Num

bers

Figure 3 Histogram showing particle-length distribution of the Chinese virus.

Figure 4 Electron micrographs of purified virus particles negatively stained with 2% phosphotungstate, pH 7·0. The meridional spacing and thestain-penetrable lumen are visible.

denaturation, 1 min for annealing (at a temperaturespecific for each primer pair), and 2–3 min at 728C forsynthesis.

Cloning and sequencing of PCR products

DNA fragments generated by PCR amplification wereseparated by electrophoresis in agarose gels and purifiedby electroelution into dialysis tubing. The fragmentswere cloned using a TA cloning kit (pT7 blue vector:R&D Systems Europe Ltd, Abingdon, Oxon) andsequenced using the SequenaseTM Version 2·0 DNAsequencing kit (Amersham Pharmacia Biotech Ltd, LittleChalfont, Bucks) according to the manufacturer’sinstructions. Sequence analysis was carried out usingthe Genetics Computer Group (GCG) program (Dever-eux et al., 1984).

Results and discussion

Properties of the virus

The average yield of the purified virus was 8–10 mg/100 g infected leaf tissue. The titre of the polyclonalantiserum produced was 1 : 50 000 in ELISA tests.

The virus particles were rod-shaped, approximately20 nm in width and ranged in length from 80 to 360 nm,with clear evidence of a bimodal distribution (modallengths of about 130 and 270 nm), the majority ofparticles falling in the smaller size range (Fig. 3). Underhigher magnification, low-pitch helical striations and astain-penetrable lumen were visible (Fig. 4). Theseproperties are similar to those reported for SBWMV(Gumpf, 1971).

In ISEM tests (Table 2), the Chinese virus was trappedbest by its homologous antiserum and by antiserum toan isolate of SBWMV from France. It was also heavilydecorated by these two antisera and by one made againstthe Oklahoma isolate of SBWMV. Reciprocal tests,using antiserum raised to the Chinese virus, also showedsome relationship to French SBWMV. There was nodetectable relationship to oat golden stripe virus(OGSV). Particles were not decorated by antisera towheat yellow mosaic bymovirus (T. Usugi, Chikugo,Japan, Japanese isolate), wheat spindle streak mosaicbymovirus (J. Carroll, Cornell University, Ithaca, NY,USA isolate), barley yellow mosaic bymovirus (M. J.Adams, UK isolate) or barley mild mosaic bymovirus(M. J. Adams, UK isolate) (data not shown). In ELISAtests using plates coated directly with sap of the



Table 2 Trapping and decoration of virus particles in ISEM tests

Virusa Antiserum usedb

OGSV SBWMV-F SBWMV-OK SCR133 Chinese virus Buffer

Trappingc

OGSV 187·8 0·6 5·4 7·2 0·2 0·5SBWMV-F 0·2 27·2 3·7 1·8 5·9 0·0Chinese virus 0·0 24·3d 2·5d 2·7 37·5d 0·0Decorationd

OGSV þþ þ 6 þþ þ þ þ – –SBWMV – F – þ þ þ þþ þ þ þ 6 –Chinese virus – þ þ þd þþ þd 6 þþ þd –

a OGSV, oat golden stripe virus (UK isolate); SBWMV-F, soil-borne wheat mosaic virus (French isolate); both maintained at IACR-Rothamsted.b OGSV, oat golden stripe virus (UK isolate); SBWMV-F, soil-borne wheat mosaic virus (French isolate); SBWMV-OK, soil-borne wheat mosaic virus(Oklahoma isolate, Chen et al., 1997); SCR133 monoclonal antibody to SBWMV-OK (Chen et al., 1997).c Number of particles per field at ×30 000 (mean of 50 fields).d From – (none) to þ þ þ (heavy).d Particles commonly aggregated end-to-end.

Table 3 Absorbence values in ELISA tests:plates coated directly with infected leaf sapor virus preparation and using different anti-bodies at 3 dilutions (mean of 3 replicatewells, less appropriate control values)

Antiserum useda

Dilutionb OGSV SBWMV-F SBWMV-OK Chinese virus SCR133

(a) Plate coated with SBWMV-OK sap1000 2·178 0·780 0·516 0·315 0·4875000 0·793 0·478 0·371 0·095 0·444

25000 0·122 0·390 0·195 0·044 0·262

(b) Plate coated with Chinese virus preparation1000 1·092 2·310 1·007 2·222 0·0315000 0·527 2·831 0·463 2·269 0·046

25000 0·133 2·766 0·206 1·746 0·008

a See Table 2·b Reciprocal of dilution of antiserum·

Oklahoma isolate of SBWMV or with purified Chinesevirus (Table 3), the viruses were shown to be sero-logically related but the homologous antisera gave thestronger reactions. In contrast to the ISEM results, noreaction was obtained with the SCR133 monoclonalantibodies but some relationship to OGSV was indicated.

In SDS-PAGE using size markers of 17·5, 30, 43, 66and 97 kDa, the coat protein of the Chinese virus formeda consistent band that was estimated to be about 19 kDa

(data not shown) and in Western blots there was apositive reaction when probed with the OklahomaSBWMV antiserum, although it was weaker thanthat from its homologous antiserum (Fig. 5). However,of seven monoclonal antibodies made against theOklahoma isolate of SBWMV (Chen et al., 1997), onlySCR133 reacted with the virus in ISEM and Westernblotting (data not shown).

RNA was extracted from the purified virions andexamined by electrophoresis under denaturing conditions.This demonstrated the presence of two RNA species ofapproximately 7 and 3·5 kb, of which RNA1 was presentin much lower amounts than RNA2 (Fig. 6A). Northernblot analysis (Fig. 6B) indicated that these RNAs werehybridized by the respective RNA1- or RNA2-specificcDNA probes of US SBWMV (clones p3H5 and pJC2G6,Shirako & Wilson, 1993; Chen, unpublished data).

The Chinese virus is therefore similar to SBWMV inparticle morphology and has a serological relationshipwith it, but the serological methods could easilydistinguish the two viruses.

RT-PCR

A PCR strategy was attempted to amplify DNAfragments at different positions from the first strandcDNA using 12 primer pairs designed according to the

384 R. Ye et al.


Figure 5 SDS-PAGE and immunoblots of the virus: (lane 1) the coatprotein of the virus and (lane 2) healthy wheat sap (dummy viruspurification from healthy wheat leaves) stained with Coomassie blue.The coat protein of the virus was probed by homologous antiserum(lane 3) or Oklahoma SBWMV antiserum (lane 4) (Chen et al., 1997).

Figure 6 Electrophoresis of RNA componentsof the virus (A) and analysis of Northern blot(B). Lane 1, RNA of carnation mottle virus(4.0 kb); lane 2, RNA of the Chinese virus; lane3: RNA of tobacco mosaic virus (6·4 kb), lane4: RNA2 of the Chinese virus probed by cDNAprobe specific to SBWMV RNA2 (Shirako &Wilson, 1993); lane 5, RNA1 of the Chinesevirus probed by cDNA probe specific toSBWMV RNA1 (Shirako & Wilson, 1993).

sequences of SBWMV RNA1 and RNA2 (Shirako &Wilson, 1993). The success of this approach dependedon there being a high degree of homology between theChinese virus and SBWMV. However, most PCRreactions gave no product from the cDNA templates ofthe Chinese virus, whereas they always produced theexpected fragments from homologous cDNA clones.These results suggested that the sequences of the Chinesevirus were different from those of SBWMV.

Successful amplification of a fragment from RNA1 waseventually achieved using primers SB 5 and SB 7 (Table 1),which were designed from conserved sequences in thehelicase and polymerase domains identified by aligning thesequence of SBWMV RNA1 with sequences from otherrod-shaped viruses (tobacco rattle virus, pea early brown-ing virus, peanut clump virus). Fragments of 1·9 and1·3 kb were produced from the Chinese virus RNA1template whereas only the expected 1.9 kb was amplifiedfrom the control SBWMV template. For RNA2, primersIA3 and Ye3 (Table 1) yielded a major 1·4-kb fragment, as



Figure 7 Northern blotting analysis of the PCR products amplifiedfrom the cDNA templates of the virus. Lane 1, clone pSBZ31 (1·3 kb)hybridized to RNA1; lane 2, clone pSB2 A6 hybridized to RNA2.

. . . . . . . . . .1 TACGTGGATTCTGAACAATGCAAATCCCACAAAAGATATGATTCTATCGGTGGGAAAAGAGGCAACTGAGGATTTAAAAGAGAAATTCATGAAAAAACAC 100||| |||||| ||||||| |||||||| | || |||||| | |||| || || ||||| || ||||| ||| | || ||||| |||||||| || |||

3203 TACTTGGATTTTGAACAACGCAAATCCTATGAAGGATATGGTGCTATGCGTTGGTAAAGAAGCCACTGAAGATCTGAAGGAGAAGTTCATGAAGAAGCAC 3302 . . . . . . . . . .

101 AGGTGTGTAGAATCCGACTTGAAGAGGATAAGAACTGTGGATTCATTTCTTATGCACGATTATGACAAGTACAGGGCAGCAACCGTGCACTTTGATGAAG 200| |||| ||| || || ||||| ||||| || ||||| || || || | ||||| || |||||||| | | | || || ||||| || ||||| ||||

3303 AAATGTGCAGAGTCAGATTTGAAAAGGATCAGGACTGTTGACTCTTTCTTGATGCATGACTATGACAAATTCCGTGCTGCTACCGTACATTTTGACGAAG 3402 . . . . . . . . . .

201 CACTTATGGCGCACGCTGGTATGGTGTATTTTTGTGCTGATATACTTGGAGCTAAGAAGGTCATTTGTCAGGGTGATTCTCAACAAATACCTTTTATTAA 300| | ||||| ||||| || || ||||| || |||||||| || ||||| || ||||| || ||||| || || ||||| |||||||||||||| || ||

3403 CGTTGATGGCACACGCAGGAATTGTGTACTTCTGTGCTGACATTCTTGGGGCGAAGAAAGTGATTTGCCAAGGAGATTCACAACAAATACCTTTCATAAA 3502 . . . . . . . . . .

301 TCGCGTTGAATCTATCACATTGCAGTACTCAAAGCTTGTAATTGACGAGACTGAGCATGTGCGACTAACGTATAGATCTCCTGTTGACGTGGCTCACTAT 400||| ||||| || || || |||||||| | || |||| ||||| ||||| || ||||| |||| || || || || || ||||||||||| || |||

3503 TCGTGTTGAGTCAATTACTTTGCAGTATGCGAAACTTGCGATTGATGAGACGGAATATGTGAGACTTACATACAGGTCGCCAGTTGACGTGGCACATTAT 3602 . . . . . . . . . .

401 CTCACCAAAAAATCGTGGTACAGTGGAGGAAGGGTTACTACAAAGAACCCTGTGATGAGATCTATGAAAACTGTAGGACCGAGAGACGTCAAACCTATGA 500|| ||||| || || ||||||||||| || |||||||| |||||||| |||| ||||||| ||||| ||||| ||| | |||| ||||||||||

3603 CTTACCAAGAAGTCTTGGTACAGTGGCGGTAGGGTTACAACAAAGAATAGTGTGTTGAGATCAATGAAGGTCGTAGGTCCGCGTGACGCAAAACCTATGA 3702 . . . . . . . . . .

501 CGTCAGTTCACTGTGTTCCTTATTTTAAAGACGCGCAGTACTTGACGTTTACGCAATCTGAAAAAACTGATTTGTACAAGGCGCTGAGGAATAAAGGTCC 600|||| || || || |||||||| || ||||| ||||||||||||||||| |||||||| ||| | ||| ||||||| ||| || | ||||| ||

3703 CGTCGGTGCATTGCGTTCCTTACCATAGGGACGCACAGTACTTGACGTTTACACAATCTGAGAAAGCCGATCTGTACAAAGCGTTGCGTGCGAAAGGACC 3802 . . . . . . . . . .

601 AGTCACAGTGAATACCGTGCATGAGACTCAAGGAAAAACCTTTGACGATGTCATTGTGGTAAGGTTAGAAACTACTGAAAATGAGATTTACCCAGGTGGT 700 || ||||| || ||||||||||| ||||||||||| |||||||| || || || || || | | || ||||| ||||| ||||| || |||||

3803 TGTGGAGGTGAACACTGTGCATGAGACACAAGGAAAAACTTTTGACGACGTTATCGTTGTTAGACTGAAGACCACTGAGAATGAAATTTATCCGGGTGGA 3902 . . . . . . . . . .

701 AGGAAAGGTCAACCTTACGAAATTGTGGCAACAACTAGACATCGCCGATCATTGGTTTATTATACTGCTATTGAAGACAGGCTTTTTGAAGATATTAGTG 800||||| || ||||||||||| ||||||||||| || || || | | || |||||||| || ||||||||||| |||||| | || |||||||| || |

3903 AGGAAGGGACAACCTTACGAGATTGTGGCAACCACCAGGCACAGGAGGTCTTTGGTTTACTACACTGCTATTGAGGACAGGTTATTCGAAGATATCAGCG 4002 . . . . . . . . . .

801 ACATGCAGGATGTCATGGAAAGCAAACTCATGAAGAGTTTGTGTCCTGAATTCGACAAATGACGGTTTGGGTCGAAATATGAGTCCATCTTAATATGTGA 900||||||||||||||||||| || ||| | ||||||| | ||| |||| | |||||||||||||||||||| |||||||| || || ||||||||

4003 ACATGCAGGATGTCATGGAGAGTAAATTGATGAAGAACCTCTGTTCTGAGCTTACTAAATGACGGTTTGGGTCGAAGTATGAGTCTATTTTGATATGTGA 4102 . . . . . . . . . .

901 TAGAGAGGTAAGGGTACCCGACGTAGGAACACCTGCAATTTTGCAGGACTTCTACGACAGGGTGTTTCCTGGAAATTCAACGATGGATTCACATTTCGAC 1000|||||||||||||||||| ||||||||||| |||| ||| | ||||| ||||| |||||||| || ||||||||||| || ||||||||||| ||||||

4103 TAGAGAGGTAAGGGTACCTGACGTAGGAACCCCTGTGATTATACAGGATTTCTATGACAGGGTATTACCTGGAAATTCCACAATGGATTCACACTTCGAC 4202 . . . . . . . . . .

1001 GGGTATGAAGTTTCTACTTCTGACATAAGCATCGAATTGGAGAACTGCACAGTACAACCCAACAAAAACGTTAGGGTGTGGCAAGACAAGAGGGGTTTGG 1100||||| |||||||||||||| ||||| ||||| || | || || ||||| || |||||||||||||| |||| ||| ||||||||||||||||||||||

4203 GGGTACGAAGTTTCTACTTCCGACATTAGCATAGAGCTCGAAAATTGCACTGTCCAACCCAACAAAAATGTTAAGGTATGGCAAGACAAGAGGGGTTTGG 4302

.1101 TGCCGGTGATGCGGA 1115

|||| || || | |4303 TGCCTGTTTTGAGAA 4317

(a)

386 R. Ye et al.


. . . . . . . . . .1 CGTTCGCAAGACGCACACCAGGAGTTCCATGCGTAGGTACTTGCGTGACTACAATTATCAGCTTGACATGTGGGAAGCTGCTGCCAGCTGTTCGCCCAGC 1||| || ||||| ||| | | | ||||||| || ||| | || ||||| | ||| ||||| ||||||| | ||| | ||| | |||||

1383 CGTGCGAAAGACTCACTCTCAAACCACAATGCGTAAATATTTGAGGGATTACAACTTTCAACTTGAAGAGTGGGAAACAGCTATTGGTTGTACTCCCAGG 14 . . . . . . . . . .

101 GAGGCACTGATAGTGGCGGATCAACATATATTCGTATCTGGTGTCATGCGTTTGCTTGATTACGAGGGCGATCTAACATGTGTCGGCGACATCAGAAAAG 2||||| |||| || || ||||| || || | || || || ||| | |||||| | || ||| | |||| | | | || || |

1483 GAGGCGTTGATCGTTGCTGATCAGCACATTCTGGTTCGTGCGGTGCAGCGCATTGTTGATTCAGTCGGTGATGTCGACAGTGTTGATGCGGTAAGGAAGG 15 . . . . . . . . . .

201 TGATGACCAACTACGGAATGAAAAATTTTTCTTTTGAAAAATGGTTAGACAAGCAGACCGTTAGTTGTTCTCTAGTCGTCCTGAATGACAAAGTAAAAAA 3| | | | |||| | | ||||| | || |||||||| |||||||||| || | || || | | || |||| |||

1583 TTTTTAACGGCTACAAGGTCAGGAATTTCAAAATAGAGAAATGGTTGAACAAGCAGACTGTGAATTCCGCTTTGGCAGTTTTGAACGACTCGACTGTTCC 16 . . . . . . . . . .

301 TGATGACGTGCATCTCGATGAAAATATGTTATCTTTGGAGAATGCATCTATCGAGGAGGTTCTTGCATGCGTTATTGAAACGCAAAGGGGTAGTCTCTAC 4||| ||||| | | |||| ||||| ||||| ||| || || | ||||| || | || |||| |||| || | ||| ||

1683 TGAGAACGTGGTTTTAAGTGAAGGCATGTTGTCTTTACAGACAGCCACTTTTGAGGAAGTGTTGCGTTGTAACGTTGAGTCGCAGAGAGAGAGTGCTTAT 17 . . . . . . . . . .

401 TTTAATGACATCATCGCTTTGCAGTTCGCTTTTAAGCTCATTGGTACACCTGAATTTTCAGACTTTGTACTTGCTTACAAAGGCCCTCTGTATCCTTGTT 5|||||||| | ||||||||||| ||||| ||| || | ||||| || || ||||| |||||||| |||||||||||||| ||| ||||||||||

1783 TTTAATGAGCTTATCGCTTTGCAATTCGCGTTTCGACTTGTAGGTACGCCAGAGTTTTCGGACTTTGTGCTTGCTTACAAAGGTCCTGCTTATCCTTGTT 18 . . . . . . . . . .

501 ACGTTGAAGCCATAAAGAGACATGGCGACGAGTTGGCTAAGTGGCGAGTTGATGAGGACAGAAATAGACAGAGTGAAAAAGCTATCGAGTGGTTGCTGTT 6| || ||||| ||||| | ||||| | | || | || ||||| || || | ||| || | ||| || |||||||||||| |

1883 ATGTCGAAGCTATAAACCGTCATGGTACCTGTATTATCCAGCATCATGTCGATGAAGATCAGAAGCGGAAGAACGACAGAGCGATTGAGTGGTTGCTGAT 19 . . . . . . . . . .

601 AGCAGGTCAAGGTGCTTTTGTTGTATCATCAGGTGTGACGGTGGGAGTTCTCATCTATCGGATTCATAAATGGTTGAAGAAGAGGTTGTTGTTGCGTGCT 7 || |||||||| || ||||| || || |||| ||||| ||| ||| | | | | ||| || ||||||||||| | | | || | | ||

1983 GGCCGGTCAAGGCGCCTTTGTCGTTTCTTCAGTCGTGACTACGGGTGTTGTAGTGTTTAAGATACACAAATGGTTGAAACAACGCCTACTGCTTAGAGCA 20 . . . . . . . . . .

701 TTACAGTCTCTACCATCTGT...GGGTGGGAGTTCTGGTGGAGGTGGTGGTGCACTGCCTATGTCAGTGCTCAATCAGTTTGGTCAGGCTCTCACGTTCG 7|| | || ||||| ||||| | |||||| || |||||| | | || || ||| | | |||| | || || ||||

2083 TTGTCAATGTTGCCTTCTGTTGGTGGTGGAGGCAATGGTGGTGGAGGTGGTTCTTTACCACCTCAAGCCCTCGAGCTCTTTGATAGAGCCGGTACATTCG 21 . . . . . . . . . .

798 ATGAGCGTTTGGCGGCGTTGCAACACCATCTTGATCTTGGAGAGGATAACTTGGATTATTGCTCTTCTACTGACCTTAAACAAGAAGTTGCTAACGTTCT 8| || ||| | || || | || | ||||||| | | || ||| |||| | || | || | ||| ||| | | ||| |

2183 AAGAACGTCTTGCTGCTCTACAGAATGGTCTTGATTTGAGCCCTGAAAACATGGAAGTGTTTACTCCCGAAGAGTTGAAAACTGAAATACGACATGTTGT 22 . . . . . . . . . .

898 TGCTACTAGGGCTGACGATGCCTTTCATGTTGCTGACGTGCCGTACGTTGTCGATGTTGTTAGGTCTGTTGGGTCTGTGTCCACCAATCTTGGTGGATCT 9| || ||||| | | | ||| ||||| |||| |||||| || | ||||| | |||| | ||| |||| ||

2283 TCAGGCTTATGCTGATAGTTCTTATCACGTTGCGGACGAACCGTACCTTCGTGGTGTTGGTGTCACTGTGGTCACTG..........GCTTGCCAGA..G 23 . . . . . . . . . .

998 GTTGTTGGAGGTGTAAGTGCTAGGGTCTCTGACGGTGCCAGTTCTTCTCTAGTGTTGA..........GTAATGCGCGTAGTACTAAGT.CTAGGCGTCG 10| |||||||| | | | | | || ||| | || |||||| || || ||||| || | || | ||

2371 GCTGTTGGAGAGATCACTACCACGGGTAGTGAAG...........TCAGTAGTGTGGATACGTCCATTTCTTTGGGCGTACCTGGGCGTGCACGGAGGCG 24 . . . . . . . . . .

1087 TTCAGTGTCCAAGAAAGATAGGGTCTTTCCT......GGTGGTTACAGTGTGTATAGTGATATGTTACCTAGTAAAATAGGTGGGAAAAGTGGTGTGAGT 11 | || || || || | | | |||| |||| | ||||| ||| || |||||| || |||| ||||||||||| ||

2460 CGCGGTTTCGAAAAATACACGCATGTATCCTTCGACAAGTGGGCAATCATATAATAGTTATAAGTCACCTAG...GGTAAGTGGTAAAAGTGGTGTTGGT 25 . . . . . . . . . .

1181 AGTTTGAAAATGAAAATTGCTAGTAAGCCTTTGGCGATCTAGCATGTTGTTTTT............GTATTCACACTCAATCTTACCATTAACGTAAT.. 12||| |||| |||||||| |||||||||||| ||||| ||| | |||||||||| | |||||| | | || || | |

2557 AGTATGAAGATGAAAATCGCTAGTAAGCCTATGGCGTCCTAACGTGTTGTTTTTAATACTACTTCACCAATCACACACTACTTTCTGGGCTACTTGTTTA 26 . . . . . . . . . .

1267 ....CGTTATGACTAC...TGGTACTCATTCTTGTGAGAAGTGTGCTAACGGTTTCTCTAATGTCATCTGCGTTAGTAAGTATCGTACTAGCGTGTATAA 13 | ||||| |||| |||| || |||||| || || | | | || | | | || |||||||||||||||| ||||||||| ||

2657 TCTCCATTATGTCTACTGTTGGTTTCCACACTTGTGCGAGTTGCGTTGATGGACCTAAGTCTATTAAATGTGTTAGTAAGTATCGTATTAGCGTGTACAA 27 . . . . .

1360 ATCTCTAGGTTTGGTTCCTGTTAAGTGTCGTCTGCCTGCAGATTGTGGTGTTAAT 14

|||| ||| | | | ||||||||||||||| |||||||||||||| ||||||2757 GACTCTTGGTCTTGATGTTGTTAAGTGTCGTCTTCCTGCAGATTGTGGCGTTAAT 28

(b)

Figure 8 Partial nucleotide sequences of the Chinese virus (top line) aligned with those from SBWMV by the GCG program BESTFIT: (a)pSBZ31 from RNA1 with part of L09737 and (b) pSB2 A6 from RNA2 with part of L09738.

Table 4 Nucleotide and amino acid comparisons between clone psbz31 from RNA1 of the Chinese virus and corresponding regions of otherrod-shaped viruses

Percentage identicalAccession

Virus Genus no. Position Nucleotides Amino acids

Peanut clump virus RNA1 Pecluvirus X78602 2721–3805 61·8 51·0Indian peanut clump virus RNA1 Pecluvirus X99149 2676–3761 62·9 50·7Beet soil-borne virus RNA1 Pomovirus Z97873 3143–4166 62·8 59·4Beet virus Q RNA1 Pomovirus AJ223596 3248–4289 61·4 57·7Tobacco rattle virus RNA1 Tobravirus D00155 2941–3927 59·3 48·1

well as several minor fragments of 3·0, 2·0 and 0·5 kb, allof which were smaller than expected.

Cloning and sequencing

The mixed DNA fragments amplified from the RNA1and RNA2 templates of the Chinese virus were used forcloning with the TA vector cloning kit, and fragments of1·3 kb (pSBZ31) and 1·4 kb (pSB2 A6) were finallycloned. Northern blot analysis, using pSBZ31 andpSB2 A6 as probes to hybridize RNAs extracted fromthe purified preparation of the virus, indicated that theywere generated from RNA1 and RNA2, respectively(Fig. 7). The nucleotide sequences of these cloneswere then determined and compared with those fromSBWMV (Fig. 8). This showed that the pSBZ31clone corresponded to SBWMV RNA1 at positions3203–4317 (mostly in the helicase region of the repli-case gene) and had sequence identities to it of 79%(nucleotides) and 92% (amino acids). This region ishighly conserved and a difference of this size suggeststhat the two viruses should be regarded as different.There are no other furovirus sequences available forcomparison in this region, but homologies of 59–63%(nucleotides) and 48–59% (amino acids) were foundfor some other rod-shaped viruses (Table 4). ClonepSB2 A6 corresponded to SBWMV RNA2 at positions1383–2811, with 63% nucleotides identical between thetwo sequences. This largely consists of the C-terminalpart of the coat protein readthrough domain, likely to bemore variable than the helicase region. The amino acidsin this region were only 55% identical. Such a smallhomology again suggests that the Chinese virus shouldbe regarded as different from SBWMV. No substantialhomologies could be detected with similar regions ofother rod-shaped fungally transmitted viruses that havebeen sequenced: peanut clump virus RNA2 (L07269),beet soil-borne virus RNA2 (U64512), beet virus QRNA2 (AJ223597) and potato mop top virus RNA3(D16193).

Conclusions

The soil-borne rod-shaped virus on wheat has beenknown of in China for decades. Although it was notwell studied, it has been thought to be SBWMV becauseof similarities in transmission, host range, particlemorphology and serology. However, a more detailedstudy of its serology and, in particular, an analysis ofnucleotide sequence data suggests that it should beconsidered a new virus within the genus Furovirus. Thename Chinese wheat mosaic virus (CWMV) is proposed.The sequences have been deposited in the EMBLdatabase with accession numbers of AJ012005(RNA1) and AJ012006 (RNA2).

Acknowledgements

This work was funded by an EU collaborative project(INCO IC18-CT960049), Chinese High-tech Project(863), Chinese National and Zhejiang ProvincialFoundation for Natural Sciences and Chinese Founda-tion for Agricultural Sciences and Education. Rong Ye isa staff member and graduate student of Fudan Universityworking at ZAAS for the degree of PhD. Aipo Diao is astudent registered for the degree of PhD at the Universityof Hertfordshire, Hatfield, UK. IACR receives grant-aided support from the Biotechnology and BiologicalSciences Research Council of the United Kingdom.

References

Cai WQ, Peng XX, Mang KQ, 1983. Identification of soil-borne wheat mosaic virus caused wheat mosaic in Shan-dong province, China. Acta Phytopathologica Sinica 13, 7–12.

Chen JP, 1993. Occurrence of fungally transmitted wheatmosaic viruses in China. Annals of Applied Biology 123,55–61.

Chen JP, Macfarlane SA, Wilson TMA, 1994. Detection andsequence analysis of a spontaneous deletion mutant of soil-borne wheat mosaic virus RNA2 associated with increasedsymptom severity. Virology 202, 921–9.

Chen JP, Torrance L, Cowan GH, MacFarlane SA, Stubbs G,Wilson TMA, 1997. Monoclonal antibodies detect a singleamino acid difference between the coat proteins of soil-borne wheat mosaic virus isolates: implications for virusstructure. Phytopathology 87, 295–301.

Devereux J, Haebegli P, Smithies O, 1984. A comprehensiveset of sequence analysis programs for the VAX. NucleicAcids Research 12, 387–95.

Feinberg AP, Vogelstein B, 1984. A technique for radio-labelling DNA restriction endonuclease fragment to highspecific activity. Annals of Biochemistry 137, 266–7.

Gumpf DJ, 1971. Purification and properties of soil-bornewheat mosaic virus. Virology 43, 588–96.

Laemmli UK, 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature 227,680–5.

Shirako Y, Brakke MK, 1984. Two purified RNAs of soil-borne wheat mosaic virus are needed for infection. Journalof General Virology 65, 855–8.

Shirako Y, Wilson TMA, 1993. Complete nucleotide sequenceand organization of the bipartite RNA genome of soil-borne wheat mosaic virus. Virology 195, 16–32.

Torrance L, Pead MT, Buxton G, 1988. Production andsome characteristics of monoclonal antibodies against beetnecrotic yellow vein virus. Annals of Applied Biology 133,519–30.

Xu SH, Ci WQ, Peng XX, Mang KQ, 1984. Electron micro-scopy of a soil-borne wheat mosaic virus. Acta Phyto-pathologica Sinica 14, 87–9.



characterization and partial sequence of a new furovirus of wheat in china

Documents